RU2840503C9 - Method for producing human t-cell receptor specific to epitope 112-120 (kvaelvhfl) of mage-a3 receptor - Google Patents

Abstract

FIELD: biotechnology; immunology.

SUBSTANCE: what is presented is a method for producing a human T-cell receptor specific to KVAELVHFL epitope (112-120) produced of MAGE-A3 protein. Peripheral blood mononuclear cells of relatively healthy HLA-A02+ donors are recovered and divided into adherent and non-adhesive fractions. An adherent fraction is cultivated with recombinant human GM-CSF and IL-4. A dendritic cell culture is obtained, incubated with addition of a priming factor – KVAELVHFL epitope. Method includes adding TNF-α to complete the maturation of dendritic cells, which are then co-cultured with autologous CD8+ T cells, anti-CD3 and anti-CD28 antibodies, IL-2, IL-7 and IL-15. Antigen-specific CD8+ T-cells are recovered, TCR clones are selected on the basis of their affinity, phenotype and specificity. A TCR gene sequence is identified by full-length TCR sequencing, including CDR3. A HIV-1 lentiviral vector carrying the TCR gene is constructed to produce one dominant TCR with alpha and beta chain from the same cell.

EFFECT: invention provides more accurate information on the structure and affinity of human TCR, having high affinity and specificity to the target peptide in a short period of time, which reduces the risk of developing side reactions.

1 cl, 4 dwg

Description

The invention relates to the field of biotechnology, specifically to immunology, and is aimed at obtaining a lentiviral construct encoding a T-cell receptor (TCR) that recognizes the antigen epitope of the MAGE-A3 protein and is capable of inducing antigen-specific destruction of a target cell expressing MAGE-A3.

In the structure of mortality of the population of Russia, malignant neoplasms occupy the second place (15.4%) after diseases of the circulatory system. The leading localizations of malignant tumors in both sexes are skin (12.3%, with melanoma - 14.0%), mammary gland (11.4%), trachea, bronchi, lung (10.5%), stomach (7.0%). At the same time, the leading oncological pathology in the female population is breast cancer (20.9%), the mortality rate from which ranks first (17.0%) [Ed. by A.D. Kaprin, V.V. Starinsky, G.V. Petrova Malignant neoplasms in Russia in 2013 (incidence and mortality) Moscow: FGBU "P.A. Herzen Moscow Oncology Research Institute" of the Ministry of Health of the Russian Federation. - 2015. ill. 250 p. ISBN 978-5-85502-205-6].

The most commonly used cancer treatments today are surgery, radiation therapy, and chemotherapy. These methods effectively reduce tumor burden in a short period of time, but they do not eliminate all tumor cells disseminated within the patient's body. A minimal tumor burden that persists after the removal of the main portion of the tumor is a cause of tumor recurrence and the development of metastases, which in turn leads to increased mortality and disability in cancer patients.

Thus, traditional approaches to cancer treatment are showing shortcomings in eliminating minimal tumor burden, and the need for new technologies aimed at improving the processes of recognizing and destroying individual tumor cells remaining in the patient’s body after radiation therapy, chemotherapy, or surgical removal of the bulk of the tumor is becoming clear.

Fundamental and clinical studies in recent years confirm that using the potential of the immune system can be very promising for eliminating tumor cells [Palucka K., Ueno H., Banchereau J. Recent developments in cancer vaccines. // JImmunol. - 2011. - Vol. 186. - №3. - P. 1325-31; Qian X., Wang X., Jin H. Cell transfer therapy for cancer: past, present, and future. // JImmunolRes. - 2014. doi: 10.1155/2014/525913]. Immunotherapeutic approaches make it possible to activate the cellular component of immunity, targeting a specific immune response against tumor cells carrying tumor antigens on their surface, without damaging healthy cells. In view of the above, it is advisable to develop approaches that allow for the effective generation of a specific antitumor immune response in the patient’s body.

To date, several different immunotherapeutic approaches have been developed aimed at melanoma, ovarian cancer, and non-small cell lung cancer (NSCLC) expressing MAGE-A3 (Zhang B, Ren Z, Zhao J, Zhu Y, Huang B, Xiao C, Zhang Y, Deng J, Mao L, Tang L, Lan D, Gao L, Zhang H, Chen G, Luo OJ. Global analysis of HLA-A2 restricted MAGE-A3 tumor antigen epitopes and corresponding TCRs in non-small cell lung cancer. Theranostics. 2023 Aug 6;13(13):4449-4468. doi: 10.7150/thno.84710). Immunotherapy against the MAGE-A3 antigen is aimed at activating effector cells. For this purpose, a number of studies have used MAGE-A3 vaccination in combination with immunostimulants (AS02B or AS15) (NCT00086866, NCT00849875). On the other hand, increasing the efficiency of antigen presentation to effector cells. DNA constructs were created that included the MAGE-A family of antigens, which were transfected into dendritic cells (a means of natural delivery and presentation of antigens to effector cells) (Lin, L.; Wei, J.; Chen, Y.; Huang, A.; Li, K.K.-W.; Zhang, W. Induction of Antigen-Specific Immune Responses by Dendritic Cells Transduced with a Recombinant Lentiviral Vector Encoding MAGE-A3 Gene. J. Cancer Res. Clin. Oncol. 2014, 140, 281-289.). This approach has been shown to induce a strong immune response that is reflected in reduced tumor growth (Duperret, E.K.; Liu, S.; Paik, M.; Trautz, A.; Stoltz, R.; Liu, X.; Ze, K.; Perales-Puchalt, A.; Reed, C.; Yan, J.; et al. A Designer Cross-Reactive DNA Immunotherapeutic Vaccine That Targets Multiple MAGE-A Family Members Simultaneously for Cancer Therapy. Clin. Cancer Res. 2018, 24, 6015-6027.).

Another immunotherapeutic approach is the development of adoptive T cell therapy targeting MAGE-A3, specifically the generation of high-affinity T cell receptors (TCRs) that specifically bind the MAGE-A3 epitope KVAELVHFL(112-120) on the target cell. Also, the use of methods and pharmaceutical compositions containing modified T cells for adoptive therapy (Kageyama, S.; Ikeda, H.; Miyahara, Y.; Imai, N.; Ishihara, M.; Saito, K.; Sugino, S.; Ueda, S.; Ishikawa, T.; Kokura, S.; et al. Adoptive Transfer of MAGE-A4 T-Cell Receptor Gene-Transduced Lymphocytes in Patients with Recurrent Esophageal Cancer. Clin. cancer Res. 2015, 21, 2268-2277; Shah, N.N.; Maatman, T.; Hari, P.; Johnson, B. Multi Targeted CAR-T Cell Therapies for B-Cell Malignancies. Front. Oncol. 2019, 9, 146.; NCT01273181

Cytotoxic T lymphocytes play a key role in the development of a specific antitumor immune response. The presence of antitumor cytotoxic T lymphocytes (CTLs), both in terms of their quantity and normal functioning, is a prerequisite for the destruction of tumor cells by the immune system [Aerts J., Hegmans J. Tumor-specific cytotoxic T cells are crucial for the efficacy of immunomodulatory antibodies in patients with lung cancer. // Cancer Res. - 2013. - Vol. 73. - P. 2381-2388]. Immunotherapeutic approaches aimed at combating specific tumor-associated antigens also use activated antigen-specific cytotoxic T lymphocytes as the main antitumor agent.

The closest to the claimed method is the method of obtaining a human T-cell receptor specific to the KVAELVHFL (112-120) epitope obtained from the MAGE-A3 protein, including the isolation of mononuclear cells (MNCs) of peripheral blood HLA-A02+ donors, then MNCs are cultured in the presence of recombinant human granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukin-4 (IL-4) for 4 days; on the 5th day, the KVAELVHFL (112-120) epitope is added as a priming factor to the dendritic cell culture, followed by their incubation at a temperature of 37 ° C; on the 6th day, a maturation factor is added to complete the maturation of dendritic cells; then the obtained dendritic cells are collected, washed with nutrient medium, their number is counted, their viability is assessed and they are co-cultured with autologous CD8+ T lymphocytes in a certain ratio, and after 7 days of co-culture, antigen-specific CD8+ T cells are isolated, then the TCR gene sequence is identified by sequencing the full length of TCR, including CDR3, isolated from the T cell clones, while the TCRα and TCRβ chains are connected by a peptide linker 2A (TCRb-P2A-TCRa), and the complete TCR construct is cloned into the backbone of the viral plasmid to obtain

viral vector carrying the TCR gene. To obtain a human T-cell receptor specific for the KVAELVHFL (112-120) epitope, an analogue of antigen-presenting cells (T2 cell line) and a set of MAGE-A3 epitopes (Mp1, Mp2, Mp3, Mp4, Mp5, Mp6, Mp7, Mp8, Mp9, and Mp10) were used, followed by selection of those that showed the highest immunogenicity in tests. The antitumor activity of the obtained TCR-T cells specific for the KVAELVHFL (112-120) epitope was assessed by the expression of activation markers (CD69 and CD137) and cytotoxic activity against the tumor cell line (PC9 and A375) expressing the MAGE-A3 receptor. (Zhang B, Ren Z, Zhao J, Zhu Y, Huang B, Xiao C, Zhang Y, Deng J, Mao L, Tang L, Lan D, Gao L, Zhang H, Chen G, Luo OJ. Global analysis of HLA-A2 restricted MAGE-A3 tumor antigen epitopes and corresponding TCRs in non-small cell lung cancer. Theranostics. 2023 Aug 6;13(13):4449-4468. doi: 10.7150/thno.84710).

The disadvantage of the prototype is the use of an analogue of antigen-presenting cells (T2 cell line) and a set of MAGE-A3 epitopes (Mp1, Mp2, Mp3, Mp4, Mp5, Mp6, Mp7, Mp8, Mp9 and Mp10) and the subsequent selection of those that showed the highest immunogenicity in tests. The T2 cell line cannot fully reflect the functionality of natural antigen-presenting cells (dendritic cells) and because of this, the results obtained vary among different donors/patients depending on the severity of the disease and the stage of antitumor therapy; assessment of the affinity of the obtained TCRs using a tool that uses only the CDR3β sequence, epitope sequence and HLA allele information, which is not enough to assess affinity; The antitumor activity of TCR-T cells is assessed by the expression of activation markers (CD69 and CD137) and cytotoxic activity against tumor cell lines (PC9 and A375). These limitations prevent us from obtaining accurate information about the structure and affinity of the human T-cell receptor for the MAGE-A3 epitope.

The objective of the invention is to obtain, in a short period of time, precise information about the human T-cell receptor specific to the MAGE-A3 KVAELVHFL (112-120) epitope.

The problem is solved in that in the method for obtaining a human T-cell receptor specific to the KVAELVHFL (112-120) epitope, obtained from the MAGE-A3 protein, including the isolation of mononuclear cells (MNCs) of peripheral blood HLA-A02+ donors, then MNCs are cultured in the presence of recombinant human granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukin-4 (IL-4) for 4 days; on the 5th day, the KVAELVHFL (112-120) epitope is added to the dendritic cell culture as a priming factor, with subsequent incubation at a temperature of 37 °C; on the 6th day, a maturation factor is added to complete the maturation of dendritic cells; then the obtained dendritic cells are collected, washed with a nutrient medium, their number is counted, their viability is assessed and they are co-cultured with autologous CD8+ T lymphocytes in a certain ratio, and after 7 days of co-cultivation, antigen-specific CD8+ T cells are isolated, then the TCR gene sequence is identified and by sequencing the full length of the TCR, including CDR3, isolated from the T cell clones, while the TCRα and TCRβ chains are connected by a peptide linker 2A (TCRb-P2A-TCRa), and the complete TCR construct is cloned into the backbone of a viral plasmid to obtain a viral vector carrying the TCR gene, while the donors are conditionally healthy individuals, from whose blood monocytes were isolated on a Ficoll gradient, on the 5th day the KVAELVHFL (112-120) epitope is added as a priming factor, in dose of 100 μg/ml and subsequent incubation for 24 hours, on the 6th day, TNF-a is added as a maturation factor at a concentration of 25 ng/ml for 24 hours, and co-cultivation of dendritic cells is carried out with CD8+ T lymphocytes in the presence of 0.5 μg/ml antibodies to CD3 (anti-CD3), 1 μg/ml antibodies to CD28 (anti CD28) and IL-2, IL-7, IL-15 (10 ng/ml each) in a ratio of 1:10, after 7 days of co-cultivation, antigen-specific CD8+ T cells are isolated using Flex-T reagents, then the TCR gene sequence is identified using Single-cell RNA sequencing (scRNA-seq) and the BD Rhapsody kit TCR/BCR amplification kit, selection of TCR clones specific to the epitope (112-120) of the MAGE-A3 protein, based on their affinity, phenotype and specificity, using the ERGO-II and NetMHCpan-4.1 neural networks and the TCRscape program, and in addition to connecting the TCRα and TCRβ chains with a peptide linker 2A (TCRb-P2A-TCRa), the 5' and 3' untranslated region of beta-globulin at the 5' and 3' ends of the insert is used, a lentivirus based on HIV-1 (pLenti_hPGK) is used as a viral plasmid, one dominant TCR with alpha and beta chains originating from the same cell is obtained.

We believe this invention is novel. A key feature of this method is its rapid, more accurate acquisition of information on the structure and affinity of the human T-cell receptor specific to the MAGE-A3 KVAELVHFL (112-120) epitope. This receptor has a high affinity for the target peptide and minimal affinity for non-target peptides, resulting in a lower risk of adverse reactions.

This is achieved, in particular, by using a precise method of cell transcriptome analysis (single-cell RNA sequencing), which allows for obtaining complete information on the full length of a specific T-cell receptor (α-chain and β-chain) on each cell and uses a significantly smaller number of target cells for this, allowing for obtaining the necessary information using biological material from donors. This method eliminates the need for additional procedures (vaccination of donors with cells loaded with the target antigen and prolonged culturing of the studied cells to obtain the required number) and reduces the time required for T-cell receptor isolation. The use of ERGO-II and NetMHCpan-4.1 neural networks and the TCRscape program (https://github.com/Perik-Zavodskii/TCRscape) allows for the selection of TCR clones to the MAGE-A3 antigen, which have a high affinity for the target peptide and minimal affinity for non-target peptides. The use of Flex-T and two fluorochromes simultaneously to isolate positive clones is a more specific method for detecting antigen-specific cells.

The method is carried out as follows.

1. Obtaining antigen-specific T cells.

Mononuclear cells (MNCs) were isolated from the peripheral blood of healthy donors with the HLA-A02 genotype. MNCs were separated into adherent and non-adherent fractions by adhesion to plastic for 30 minutes at 37°C in a _CO2 incubator. Mature dendritic cells (DCs) were isolated from the adherent fraction using GM-CSF (100 ng/ml) and IL-4 (50 ng/ml). Antigen loading was achieved using the KVAELVHFL (112-120) peptide, derived from the MAGE-A3 protein, at a dose of 100 μg/ml on day 5 of culture, followed by DC maturation using TNF-alpha (25 ng/ml) on day 6 of culture. Non-adherent MNC fraction cells were cultured for 6 days. On day 7, DC and CD8+ cell cultures from the non-adherent fraction were combined (1:10 ratio) with the addition of 0.5 μg/ml antibodies to CD3 (anti-CD3), 1 μg/ml antibodies to CD28 (anti-CD28) and IL-2, IL-7, IL-15 (10 ng/ml each) to maintain the viability and proliferation of CD8+ cytotoxic T lymphocytes.

After 7–8 days of co-cultivation, antigen-specific T cells were isolated from the co-culture of DCs and CD8+ cells using Flex-T reagents and corresponding peptides, with simultaneous staining of positive specific cells with two fluorochromes and anti-CD8+ antibodies for identification by flow sorting.

Following the full protocol cycle for obtaining antigen-specific T cells, two samples specific for the KVAELVHFL (112-120) epitope of the MAGE-A3 antigen were obtained. Cell viability was assessed using 7AAD and calcein stains. The 7AAD-negative/calcein-positive cell content in the sample was at least 80%. The cells were labeled with SampleTag antibodies for multiplexing biological samples for use on the BD Rhapsody single-cell multiome platform.

Twenty-seven thousand T cells labeled with multiplexing antibodies were loaded onto a BD Rhapsody Express, where metal beads with molecular barcodes were added to capture poly-A-suppressing molecules (mRNA, including TCR alpha and beta chains, and SampleTag), cells were lysed, and poly-A-suppressing molecules from lysed cells were hybridized to the metal beads. The poly-A-suppressing molecules were then reverse transcribed to generate cDNA. Template Switch Oligo (TSO) was added to the cDNA, and another round of reverse transcription was performed, allowing reads to be generated from the 5' end of the cDNA. The cDNA was amplified in two rounds of semi-nested PCR. The TCR library was then subjected to random primer annealing and elongation. To obtain the final immune transcriptome libraries (379 genes associated with the immune response), TCR, and SampleTag, the products of the second semi-nested PCR of the SampleTag and immune transcriptome libraries, and the products of random annealing and elongation of the TCR library were amplified in nested PCR with primers containing adapters for Illumina sequencers. The resulting libraries were pooled at 27,000 loaded cells and 10,000 reads per cell for the immune transcriptome library, 15,000 reads per cell for the TCR library, and 1,200 reads per cell for the SampleTag library. They were sequenced on a NovaSeq 6000 instrument on the S2 cell with 150 paired-end reads.

The resulting FASTQ files were processed using the BD pipeline version 1.11.1L, which performs quality control of reads, their alignment to the reference transcriptome, including T-cell receptors, builds libraries of cell indices, eliminates PCR effects using UMI RSEC (unique molecular identifier recursive substitution error correction) and UMI DBEC (unique molecular identifier distribution-based error correction), builds cell libraries, eliminates technical noise using second derivative analysis and produces final gene expression matrices and Adaptive Immune Receptor Repertoire (AIRR) - matrices of sequences of the alpha and beta chains of the T-cell receptor.

We obtained 7,700 single cells. Bioinformatic analysis of the sequencing data was performed using the TCRscape software tool (https://github.com/Perik-Zavodskii/TCRscape). TCRscape is a tool for identifying dominant (by single-cell count) T-cell receptor clonotypes by CDR3 loop or by complete amino acid sequences and assessing the phenotype of antigen-specific TCR T cells. TCRscape uses single-cell gene expression matrices and the adaptive immune receptor repertoire (AIRR) matrix generated by the BD Rhapsody single-cell RNA sequencing raw data processing tool. Log2 (Counts Per Million) normalization is performed on the gene expression matrix, and T-cell receptor (TCR) clonotypes are detected and enumerated using the AIRR matrix. Selected genes from the normalized gene expression matrix associated with TCR specificity and affinity are combined with the clonotype matrix along with the results of the ERGO-II neural network binding assay. The combined matrix is then subjected to principal component analysis (PCA) to assess data dimensionality, dimensionality reduction using Uniform Manifold Approximation and Projection (UMAP) is performed to account for the data dimensionality, and clusters are then identified using the HDBSCAN method. Over 3,000 clonotypes were detected for the MAGE-A3 epitope, including 191 with two or more cells per clonotype.

The ERGO-II neural network was used to predict the binding specificity of the resulting TCRs. After loading the neural network repository, the tool was launched from the terminal, selecting the input file and database (McPAS) used to train the model. McPAS-TCR is a manually curated database based on published literature, containing information on approximately 40,000 T-cell receptor sequences, the antigens they bind to, T-cell type (CD4 ⁺ /CD8 ⁺ ), and MHC type (MHC-I/MHC-II). McPAS-TCR includes information on T lymphocytes expanding in various human or mouse pathological conditions (including viral infections, cancer, and autoimmune reactions). The input CSV file for running ERGO-II contains information on the TCR CDR3α and CDR3β sequences, the peptide sequence, the MHC type (MHC-I/MHC-II class), the V and J genes, and the T cell type (CD4 ⁺ /CD8 ⁺ ). The output file contains a predicted probability value for T cell receptor binding to the peptide/MHC complex (normalized affinity score), which ranges from 0 to 1, where 0 is the minimum affinity and 1 is the maximum affinity. Using ERGO-II, we can predict the affinity of the resulting TCRs for the peptide, facilitating the selection of candidates from the TCR pool depending on the desired application.

Many CAR-T and TCR-T cells are known to have off-target effects because they can interact with related proteins. To mitigate this effect, a computer analysis of the interactions of the resulting TCRs with peptides of related proteins was performed. Using the ERGO-II neural network, the probability of TCR binding to a peptide/MHC complex (peptides from the MAGE subfamily of proteins and the Titin protein) was predicted in silico.

Non-targeted peptides were selected as a result of literature analysis and analyzed using the NetMHCpan-4.1 neural network with the following parameters: peptide length - 8-11 amino acids, allele - HLA-A*02:01, weighted criterion of predicted binding reliability (rank) - less than 2%.

Based on the clonotype dominance analysis and phenotypic analysis of antigen-specific T cells using TCRscape, clonotype affinity to the target peptide and minimal affinity to non-target peptides using ERGO-II and NetMHCpan-4.1 neural networks, the dominant clone with the highest cell number was selected. Figure 1 shows the TCRscape clonotype analysis of MAGE-A3-specific CD8 T cells, namely, UMAP visualization of MAGE-A3-specific CD8 T cell clonotypes using TCRscape; 1), 2), 3) and 4) represent the expression of marker genes in each cluster; 5) represent the number of cells for each clonotype; 6) represent the dominant clonotype.

Next, a lentiviral vector based on HIV-1 (pLenti_hPGK_gfp) with an insert instead of the EGFP gene was constructed. The diagram of the pLenti_hPGK plasmid is shown in Fig. 2. The insert sequence is presented on a CD-RW disc. The disc recording session is closed for subsequent recording of information onto it. The construction was used to obtain a viral vector carrying the TCR gene, which is specific to the epitope of the tumor-associated antigen MAGE-A3. The transfer plasmid of the lentiviral vector includes the TCRa and TCRb sequences in a single reading frame, separated by a signal for the ejection of the polypeptide with the P2A polysem and the 5' and 3' untranslated region of beta-globulin at the 5' and 3' ends of the insert. The diagram of the insert construction for the plasmid is shown in Fig. 3.

The following protocol was used to synthesize and clone a specific gene encoding a TCR specific to the epitope of the tumor-associated antigen MAGE-A3:

1. Gene synthesis by PCR (polymerase chain reaction).

The gene encoding the TCR was synthesized by PCR amplification. First, primers were synthesized to obtain the full nucleotide sequence of the inserted plasmid. The sequence listing is attached.

PCR was performed using the ThermoFisherScientific kit (#F549), which includes Phusion Hot Start II DNA polymerase, 5x HF and GC buffers, 50 mM MgCl2, and DMSO. PCR was performed on a Bio Rad Thermal cycler C-1000. Flanking primers For (GGATCCACATTTGCTTCTGA) and Rev (TGTACATTTATTGCAATGAAAAT) were used at a concentration of 10 μM. The remaining primers were used at a concentration of 2 μM. The reaction mixture for the first PCR was prepared as follows (final volume 50 ml): 10 μl 5X GC buffer, 10 μl equimolar primer solution, 0.5 μl dNTP mixture (25 mM each), 1 μl Phusion HS II polymerase, 28.5 μl mQ. Mode: initial denaturation (1 cycle): 98°C - 2 min; amplification (15 cycles): 98°C - 10 sec, 60°C - 15 sec, 72°C - 2.5 min; finishing synthesis (1 cycle): 72°C - 5 min; storage at + 4°C.

After completion of the first PCR, the second PCR was performed to obtain amplicons of the target length (2029 bp). The reaction mixture for the second PCR was prepared as follows (final volume 50 ml): 10 μl 5X GC buffer, 2 μl working solution of flanking primers (10 μM each), 6 μl reaction mixture obtained after stage 1 PCR, 0.5 μl dNTP mixture (25 mM each), 1 μl Phusion HS II polymerase, 30.5 μl mQ. Mode: initial denaturation (1 cycle): 98°C - 2 min; amplification (25 cycles): 98°C - 15 sec, 50°C - 15 sec, 72°C - 2.5 sec; finishing synthesis (1 cycle): 72°C - 5 min; storage at + 4°C.

After the second PCR, horizontal gel electrophoresis was performed in a 1% agarose gel at 6 V/cm for at least 30 minutes. PCR fragments of 2029 bp in length were visible in the gel. The fragment was excised from the gel and purified using the commercial LumiPure agarose gel DNA extraction kit.

2. Cloning into the intermediate vector pUC57:

The pUC57 vector, linearized at the EcoRV site, was used as the cloning vector. Ligation reactions were performed using Thermo Scientific™ T4 DNA ligase (5 units/µl) (#EL0011). The vector:purified PCR product ratio was 1:3. Incubation was carried out for 16-18 hours at 4°C.

The ligation mixture was transformed into E. coli XL1-blue cells for chemical transformation Eurogene CC001 according to the manufacturer's protocol. Then, these transformed cells were plated on LB agar Petri dishes containing X-gal, IPTG, and ampicillin at a dose of 100 μg/ml. The plates were incubated for 16-18 h at +37°C. Verification of white clones was performed by PCR screening using specific primers for the insert (M13 for (5-GTAAAACGACGGCCAGT-3), M13_rev (5-AGCGGATAACAATTTCACACAGGA-3).). The reaction mixture for PCR Basic, 2x Lumiprobe # 5024 were used for screening. The expected size of the PCR product was 2175 bp. Clones that yielded positive PCR results were cultured in liquid LB medium (5 ml, ampicillin 100 μg/ml). Plasmid isolation was performed the following day (16 hours later) using the LumiPure Plasmid DNA Isolation Kit (Spin Miniprep), Lumiprobe #1583. Suitable clones were then selected by sequencing.

3. Recloning the desired gene into the final lentiviral vector pLenti_hPGK_gfp:

The insert was prepared for recloning by cutting out the pUC57_M plasmid with a sequential restriction reaction, first at the BstAUI site (SibEnzyme) (1 h at 37°C in ThermoScientific Fast Digest buffer, #B72), then at the BamHI site (SibEnzyme) (also in ThermoScientific Fast Digest buffer, #B72). The reaction mixture was then subjected to horizontal gel electrophoresis in a 1% agarose gel at a voltage of 5-6 V/cm for at least 45 min, and sections with the desired fragment size (2023 bp) were excised from the gel. The fragment was purified using the LumiPuree agarose gel DNA extraction kit, Lumiprobe, #5793.

The pLenti_hPGK_gfp vector was prepared for recloning by removing the gfp-encoding gene from the vector and simultaneously digesting it at the BstAUI (SibEnzyme) and BamHI (SibEnzyme) sites using ThermoScientific Fast Digest, #B72, for 1 h at 37°C. The reaction mixture was then subjected to horizontal gel electrophoresis in a 1% agarose gel at 5-6 V/cm for at least 45 min, and sections containing the desired 7594 bp fragment, corresponding to the vector without the insert, were excised from the gel. The fragment was purified using the LumiPuree agarose gel DNA extraction kit, Lumiprobe, #5793.

4. Cloning the gene into the pLenti_hPGK_gfp vector using BstAUI, BamHI sites:

The ligation reaction was carried out using T4 DNA Ligase (5 U/μL) Thermo Scientific™ (#EL0011). The vector:fragment ratio was 1:5. Incubation was carried out for 16-18 hours at +4°C.

The ligation mixture was transformed into E. coli XL1-blue cells for chemical transformation Eurogene CC001 according to the manufacturer's protocol. Then, these transformed cells were plated on Petri dishes with LB agar containing ampicillin at a dose of 100 μg/ml. The dishes were incubated overnight at +37°C. Clones were verified by PCR screening using specific primers hPGK-F (5- GTGTTCCGCATTCTGCAAG-3), WPRE-R (5- CATAGCGTAAAAGGAGCAACA-3), PCR reaction mixture Basic, 2x Lumiprobe # 5024 were used for screening. The expected size of the PCR product was 2147 bp. Clones that yielded positive PCR results were cultured in liquid LB medium (5 ml, ampicillin 100 μg/ml, overnight culture). Plasmid isolation was performed the following day (after 16 hours) using the LumiPure Plasmid DNA Isolation Kit (Spin Miniprep), Lumiprobe #1583. Suitable clones were then selected by sequencing.

The transfer plasmid, the VSV-G-encoding plasmid, and third-generation lentivirus packaging plasmids (Gag-pol and Rev) were produced in E. coli (NEB Stable strain). The resulting plasmids were verified using restriction enzymes and gel electrophoresis. These plasmids were delivered to HEK-293T (Human embryonic kidney 293T) packaging cells using Lipofectamine 2000.

The produced lentiviruses were concentrated using the commercial TransLv™ Lentivirus Precipitation Solution kit (5×) and titrated using quantitative PCR (with diluted standards) for proviral DNA (TransLv™ Lentivirus qPCR Titration Kit) in HEK-293T cells. The required multiplicity of infection (MOI) was selected for the target cells to transduce the largest number of cells with the highest vitality and the fewest exhaustion markers. Target T cells were then transduced with the resulting lentiviral particles according to the optimal MOI, after which CD8 cells were sorted. To assess the cytotoxic activity of transduced TCR-T cells, they were cocultured with tumor cell lines (ratio 1:5) differing in MAGE-A3 expression (SK-MEL-5 - MAGE-A3-positive, HCT 116 - MAGE-A3-positive, and MDA-MB-231 - MAGE-A3-negative). Untransduced T cells served as a control.

Figure 4 shows the percentage of tumor cell death of the MAGE-A3-positive line (SK-MEL-5 and HCT 116) and the MAGE-A3-negative line (MDA-MB-231) when they were co-cultured with CD8+ T cells transduced with a lentiviral vector carrying the gene encoding the T cell receptor specific to the MAGE-A3 epitope, and with non-transduced CD8+ T cells (control), n=6. Arrows indicate statistically significant differences between the experimental and control groups (p≤0.05).

Thus, the proposed method for producing a human T-cell receptor specific for the KVAELVHFL (112-120) epitope of the MAGE-A3 protein allows for the creation in a short time, without additional lengthy procedures (obtaining dendritic cell vaccines, vaccinating donors), and having an accurate description of the structure of the T-cell receptor specific for the KVAELVHFL (112-120) MAGE-A3 epitope. In vitro studies of CD8+ cells transduced with a lentiviral vector carrying the gene encoding the developed T-cell receptor specific for the KVAELVHFL (112-120) MAGE-A3 epitope using a direct cytotoxic test against tumor cells expressing the MAGE-A3 antigen demonstrated a high cytotoxicity rate against tumor cells expressing the MAGE-A3 antigen, in contrast to the corresponding (antigen-negative) control.

--->

<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE ST26SequenceListing

PUBLIC "-//WIPO//DTD Sequence Listing 1.3//EN"

"ST26SequenceListing_V1_3.dtd"><ST26SequenceListing

originalFreeTextLanguageCode="ru" nonEnglishFreeTextLanguageCode="ru"

dtdVersion="V1_3" fileName="/Users/Saleh/Desktop/Seq for MAGE-A3

patent.xml" softwareName="WIPO Sequence" softwareVersion="2.3.0"

productionDate="2024-05-14">

<ApplicantFileReference>07052024</ApplicantFileReference>

<ApplicantName languageCode="ru">Federal State

budgetary scientific institution "Research Institute"

fundamental and clinical immunology"

(NIIFKI)</ApplicantName> <ApplicantNameLatin>Federal State Budgetary

Scientific Institution Research Institute of Fundamental and Clinical

Immunology</ApplicantNameLatin> <InventionTitle

languageCode="en">Method for obtaining human T-cell

receptor specific for epitope 112-120 (KVAELVHFL) receptor

MAGE-A3</InventionTitle>

<SequenceTotalQuantity>1</SequenceTotalQuantity> <SequenceData

sequenceIDNumber="1"> <INSDSeq>

<INSDSeq_length>2050</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table>

<INSDFeature> <INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..2050</INSDFeature_location>

<INSDFeature_quals> <INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier> <INSDQualifier id="q4">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>Homo sapiens</INSDQualifier_value>

</INSDQualifier> </INSDFeature_quals> </INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>ggatccacatttgcttctgacacaactgtgttcactagcaacctcaaacaga

caccccaccatggatacatggctcgtttgctgggcaattttctctctgctgaaggccgggctgaccgaac

cagaagtcacgcagactcctagtcaccaggttacccagatgggacaggaggtaatcctccgatgtgtacc

aatcagcaatcacctgtacttttactggtatcgccaaatcctcggccaaaaggtggaattcctggtgtcc

ttctataacaatgaaatctccgagaagtctgagattttcgacgaccagttttctgtagagagacctgacg

gctccaacttcacactcaaaattcgctccaccaaactggagaggacagtgcaatgtatttttgtgcttcatc

tgaggccgtgggcgggacctataatgagcagttcttcggcccaggaacaagactgaccgtgctggaggac

ctcaaaaacgtttttcccccagaggtggcggtttttgagcctagcgaggccgaaatctctcatacccaga

aagcgaccctggtctgtcttgccactggcttctttcctgaccacgttgaattgtcctggtgggttaatgg

gaaagaggtacacagtggagtttccaccgatccccagccactgaaggagcagcctgcgctcaatgactca

cgctactgtttgtcttcccgattgcgcgtgtcagctaccttctggcagaaccccaggaaccactttcgat

gtcaggtccagttctatggactctctgaaaatgacgagtggactcaggaccgcgctaagccagtcacaca

gatagtctctgcagaagcctggggaagagcagactgcgggttcaccagtgtgtcatatcagcagggcgtg

ctgtctgccactatcctgtacgagattttgctgggcaaggctaccctgtatgcggtgttggtgtctgctc

ttgtgctcatggccatggtcaagcgcaaggacttctcaggctcaggcgcaactaactttagcctgttgaa

gcaagcaggagatgtggaggaaaaccctggacctatgtcactgtcatccttgcttaaagttgtcaccgca

tctctttggctcgggccaggcatcgctcagaagataacccaaacccaacctggaatgtttgtgcaggaga

aagaagcagtgactctcgactgtacctacgacacctcagacccatcttacgggctgttttggtataaaca

gccgtcatctggcgagatgatttttcttatttaccagggaagctacgatcagcaaaacgccacggaaggc

aggtactccctgaatttccaaaaagcaaggaagagtgccaacttggtgattagcgcatctcagttgggtg

acagcgctatgtacttttgtgctatgcgagagggtaagtcaggggccggttcataccagctgacgtttgg

caaaggcactaagctctctgtgattcccaatatccagaaccccgaccctgcagtctatcaactgcgggat

tcaaaaagcagcgataaaagcgtttgcctctttactgacttcgacagccaaactaacgtgagccagagca

aagacagcgatgtatatatcaccgataagacagtgctcgacatgcggagcatggatttcaaaagcaattc

tgctgttgcctggagcaataagtccgactttgcgtgtgctaatgcctttaacaacagcattatccctgaa

gacactttcttcccctctccagaaagcagttgtgacgtgaagttggttgaaaagagcttcgagaccgaca

ccaatttgaactttcagaatctcagcgtgatcggattccggattctgctcctgaaagtggctgggttcaa

tttgctcatgaccctgagactctggagtagctaagctcgctttcttgctgtccaatttctattaaaggtt

cctttgttccctaagtccaactaaactgggggatattatgaagggccttgagcatctggattctgcc

taataaaaaacatttattttcattgcaataaatgtaca</INSDSeq_sequence> </INSDSeq>

</SequenceData></ST26SequenceListing>

<---

Claims (1)

A method for producing a human T-cell receptor specific to the KVAELVHFL (112-120) epitope derived from the MAGE-A3 protein, comprising isolating peripheral blood mononuclear cells (MNCs) from HLA-A02+ donors, subsequently separating them into adherent and non-adherent fractions by adhesion on plastic for 30 min at +37°C in a _CO2 incubator, then culturing the adherent MNC fraction in the presence of recombinant human granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukin-4 (IL-4) for 4 days; on the 5th day, adding the KVAELVHFL (112-120) epitope to the dendritic cell culture as a priming factor, followed by incubation at 37°C; On the 6th day, a maturation factor is added to complete the maturation of dendritic cells; then the obtained dendritic cells are collected, washed with a nutrient medium, their number is counted, their viability is assessed and they are co-cultured with autologous CD8+ T lymphocytes in a certain ratio, and after 7 days of co-cultivation, antigen-specific CD8+ T cells are isolated, then the TCR gene sequence is identified by sequencing the full length of the TCR, including CDR3, isolated from the T cell clones, while the TCRα and TCRβ chains are connected by a peptide linker 2A (TCRb-P2A-TCRa), and the complete TCR construct is cloned into the backbone of a viral plasmid to obtain a viral vector carrying the TCR gene, characterized in that the donors are conditionally healthy individuals, from whose blood monocytes were isolated on a Ficoll gradient, on the 5th day the epitope KVAELVHFL (112-120) is added as a priming factor at a dose of 100 μg/ml and followed by incubation for 24 hours, on the 6th day, TNF-α is added as a maturation factor at a concentration of 25 ng/ml for 24 hours, and co-cultivation of dendritic cells is carried out with CD8+ T lymphocytes in the presence of 0.5 μg/ml antibodies to CD3 (anti-CD3), 1 μg/ml antibodies to CD28 (anti-CD28) and IL-2, IL-7, IL-15 (10 ng/ml each) in a ratio of 1:10, after 7 days of co-cultivation, antigen-specific CD8+ T cells are isolated using Flex-T reagents, then the TCR gene sequence is identified using Single-cell RNA sequencing (scRNA-seq) and the BD Rapsody kit TCR/BCR amplification kit, selection of TCR clones of the MAGE-A3 protein specific to the KVAELVHFL (112-120) epitope based on their affinity, phenotype and specificity using the ERGO-II and NetMHCpan-4.1 neural networks and the TCRscape program, in addition to connecting the TCRα and TCRβ chains with a peptide linker 2A (TCRb-P2A-TCRa), the 5' and 3' untranslated region of beta-globulin at the 5' and 3' ends of the insert is used, a lentivirus based on HIV-1 (pLenti_hPGK) is used as a viral plasmid, one dominant TCR with alpha and beta chains originating from the same cell is obtained.