RU2840503C1 - Method for producing human t-cell receptor specific to epitope 112-120 (kvaelvhfl) of mage-a3 receptor - Google Patents

Abstract

FIELD: biotechnology; immunology.

SUBSTANCE: what is presented is a method for producing a human T-cell receptor specific to KVAELVHFL epitope (112-120) produced of MAGE-A3 protein. Peripheral blood mononuclear cells of relatively healthy HLA-A02+ donors are recovered and divided into adherent and non-adhesive fractions. An adherent fraction is cultivated with recombinant human GM-CSF and IL-4. A dendritic cell culture is obtained, incubated with addition of a priming factor – KVAELVHFL epitope. Method includes adding TNF-α to complete the maturation of dendritic cells, which are then co-cultured with autologous CD8+ T cells, anti-CD3 and anti-CD28 antibodies, IL-2, IL-7 and IL-15. Antigen-specific CD8+ T-cells are recovered, TCR clones are selected on the basis of their affinity, phenotype and specificity. A TCR gene sequence is identified by full-length TCR sequencing, including CDR3. A HIV-1 lentiviral vector carrying the TCR gene is constructed to produce one dominant TCR with alpha and beta chain from the same cell.

EFFECT: invention provides more accurate information on the structure and affinity of human TCR, having high affinity and specificity to the target peptide in a short period of time, which reduces the risk of developing side reactions.

1 cl, 4 dwg

Description

The invention relates to the field of biotechnology, specifically to immunology, and is aimed at obtaining a lentiviral construct encoding a T-cell receptor (TCR) that recognizes an antigen epitope of the MAGE-A3 protein and is capable of inducing antigen-specific destruction of a target cell expressing MAGE-A3.

In the structure of mortality of the population of Russia, malignant neoplasms occupy the second place (15.4%) after diseases of the circulatory system. The leading localizations of malignant tumors in both sexes are skin (12.3%, with melanoma - 14.0%), mammary gland (11.4%), trachea, bronchi, lung (10.5%), stomach (7.0%). At the same time, the leading oncological pathology in the female population is breast cancer (20.9%), the mortality rate from which ranks first (17.0%) [Ed. by A.D. Kaprin, V.V. Starinsky, G.V. Petrova Malignant neoplasms in Russia in 2013 (morbidity and mortality) Moscow: FGBU "P.A. Herzen Moscow Oncology Research Institute" of the Ministry of Health of the Russian Federation. - 2015. ill. 250 p. ISBN 978-5-85502-205-6].

The generally accepted methods of cancer treatment today are surgery, radiation therapy and chemotherapy. The use of these methods allows for an effective reduction of the tumor load in a short period of time, but does not provide the opportunity to eliminate all tumor cells disseminated in the patient's body. The minimal tumor load that remains after the removal of the main part of the neoplasm is the cause of tumor relapses and the development of metastases, which in turn leads to an increase in the mortality rate and disability of patients with oncological diseases.

Thus, traditional approaches to cancer treatment reveal shortcomings in the issue of eliminating minimal tumor load, and the need for new technologies aimed at improving the processes of recognition and destruction of individual tumor cells remaining in the patient's body after radiation therapy, chemotherapy or surgical removal of the bulk of the tumor becomes obvious.

Fundamental and clinical studies of recent years confirm that the use of the immune system's potential can be very promising for the elimination of tumor cells [Palucka K., Ueno H., Banchereau J. Recent developments in cancer vaccines. // JImmunol. - 2011. - Vol. 186. - №3. - P. 1325-31; Qian X., Wang X., Jin H. Cell transfer therapy for cancer: past, present, and future. // JImmunolRes. - 2014. doi: 10.1155/2014/525913]. Immunotherapeutic approaches make it possible to activate the cellular component of immunity, targeting a specific immune response against tumor cells carrying tumor antigens on their surface, without damaging healthy cells. In view of the above, it is advisable to develop approaches that allow for the effective generation of a specific antitumor immune response in the patient’s body.

To date, several different immunotherapeutic approaches have been developed aimed at melanoma, ovarian cancer, and non-small cell lung cancer (NSCLC) expressing MAGE-A3 (Zhang B, Ren Z, Zhao J, Zhu Y, Huang B, Xiao C, Zhang Y, Deng J, Mao L, Tang L, Lan D, Gao L, Zhang H, Chen G, Luo OJ. Global analysis of HLA-A2 restricted MAGE-A3 tumor antigen epitopes and corresponding TCRs in non-small cell lung cancer. Theranostics. 2023 Aug 6;13(13):4449-4468. doi: 10.7150/thno.84710). Immunotherapy against the MAGE-A3 antigen is aimed at activating effector cells. For this purpose, a number of studies used MAGE-A3 vaccination in combination with immunostimulants (AS02B or AS15) (NCT00086866, NCT00849875). On the other hand, increasing the efficiency of antigen presentation to effector cells. DNA constructs were created that included the MAGE-A family of antigens, which were transfected into dendritic cells (a means of natural delivery and presentation of antigens to effector cells) (Lin, L.; Wei, J.; Chen, Y.; Huang, A.; Li, K.K.-W.; Zhang, W. Induction of Antigen-Specific Immune Responses by Dendritic Cells Transduced with a Recombinant Lentiviral Vector Encoding MAGE-A3 Gene. J. Cancer Res. Clin. Oncol. 2014, 140, 281-289.). This approach has been shown to induce a strong immune response that is reflected in reduced tumor growth (Duperret, E.K.; Liu, S.; Paik, M.; Trautz, A.; Stoltz, R.; Liu, X.; Ze, K.; Perales-Puchalt, A.; Reed, C.; Yan, J.; et al. A Designer Cross-Reactive DNA Immunotherapeutic Vaccine That Targets Multiple MAGE-A Family Members Simultaneously for Cancer Therapy. Clin. Cancer Res. 2018, 24, 6015-6027.).

Another immunotherapeutic approach involves the development of adoptive T cell therapies targeting MAGE-A3, specifically the generation of high-affinity T cell receptors (TCRs) that specifically bind the MAGE-A3 KVAELVHFL(112-120) epitope on the target cell. Also, the use of methods and pharmaceutical compositions containing modified T cells for adoptive therapy (Kageyama, S.; Ikeda, H.; Miyahara, Y.; Imai, N.; Ishihara, M.; Saito, K.; Sugino, S.; Ueda, S.; Ishikawa, T.; Kokura, S.; et al. Adoptive Transfer of MAGE-A4 T-Cell Receptor Gene-Transduced Lymphocytes in Patients with Recurrent Esophageal Cancer. Clin. cancer Res. 2015, 21, 2268-2277; Shah, N.N.; Maatman, T.; Hari, P.; Johnson, B. Multi Targeted CAR-T Cell Therapies for B-Cell Malignancies. Front. Oncol. 2019, 9, 146.; NCT01273181

Cytotoxic T lymphocytes play a major role in the development of a specific antitumor immune response. The presence of antitumor cytotoxic T lymphocytes (CTL), both in terms of their quantity and normal functioning, is a prerequisite for the destruction of tumor cells by the immune system [Aerts J., Hegmans J. Tumor-specific cytotoxic T cells are crucial for efficacy of immunomodulatory antibodies in patients with lung cancer. // Cancer Res. - 2013. - Vol. 73. - P. 2381-2388]. Immunotherapeutic approaches aimed at combating specific tumor-associated antigens also use activated antigen-specific cytotoxic T lymphocytes as the main antitumor agent.

The closest to the claimed method is a method for obtaining a human T-cell receptor specific to the KVAELVHFL (112-120) epitope obtained from the MAGE-A3 protein, including the isolation of mononuclear cells (MNCs) from peripheral blood of HLA-A02+ donors, then MNCs are cultured in the presence of recombinant human granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukin-4 (IL-4) for 4 days; on the 5th day, the KVAELVHFL (112-120) epitope is added as a priming factor to the culture of dendritic cells, followed by their incubation at a temperature of 37°C; on the 6th day, a maturation factor is added to complete the maturation of dendritic cells; then the obtained dendritic cells are collected, washed with a nutrient medium, their number is counted, their viability is assessed and co-cultured with autologous CD8+ T lymphocytes in a certain ratio, and after 7 days of co-culture, antigen-specific CD8+ T cells are isolated, then the TCR gene sequence is identified by sequencing the full length of TCR, including CDR3, isolated from T cell clones, while the TCRα and TCRβ chains are connected by a peptide linker 2A (TCRb-P2A-TCRa), and the complete TCR construct is cloned into the backbone of the viral plasmid to obtain

viral vector carrying the TCR gene. To obtain a human T-cell receptor specific to the KVAELVHFL (112-120) epitope, an analogue of antigen-presenting cells (T2 cell line) and a set of MAGE-A3 epitopes (Mp1, Mp2, Mp3, Mp4, Mp5, Mp6, Mp7, Mp8, Mp9 and Mp10) were used, followed by selection of those that showed the highest immunogenicity in the tests. The antitumor activity of the obtained TCR-T cells specific to the KVAELVHFL (112-120) epitope was assessed by the expression of activation markers (CD69 and CD137) and cytotoxic activity against the tumor cell line (PC9 and A375) expressing the MAGE-A3 receptor. (Zhang B, Ren Z, Zhao J, Zhu Y, Huang B, Xiao C, Zhang Y, Deng J, Mao L, Tang L, Lan D, Gao L, Zhang H, Chen G, Luo OJ. Global analysis of HLA-A2 restricted MAGE-A3 tumor antigen epitopes and corresponding TCRs in non-small cell lung cancer. Theranostics. 2023 Aug 6;13(13):4449-4468. doi: 10.7150/thno.84710).

The disadvantage of the prototype is the use of an analogue of antigen-presenting cells (T2 cell line) and a set of MAGE-A3 epitopes (Mp1, Mp2, Mp3, Mp4, Mp5, Mp6, Mp7, Mp8, Mp9 and Mp10) and the subsequent selection of those that showed the highest immunogenicity in tests. The T2 cell line cannot fully reflect the functionality of natural antigen-presenting cells (dendritic cells) and because of this, the results obtained vary among different donors/patients depending on the severity of the disease and the stage of antitumor therapy; assessment of the affinity of the obtained TCRs using a tool that uses only the CDR3β sequence, epitope sequence and HLA allele information, which is not enough to assess affinity; The antitumor activity of TCR-T cells is assessed by the expression of activation markers (CD69 and CD137) and cytotoxic activity against the tumor cell line (PC9 and A375). These shortcomings do not allow obtaining true information on the structure and affinity of the human T-cell receptor to the MAGE-A3 epitope.

The objective of the invention is to obtain, in a short period of time, precise information about the human T-cell receptor specific to the MAGE-A3 epitope KVAELVHFL (112-120).

The problem is solved in that in the method for obtaining a human T-cell receptor specific to the KVAELVHFL (112-120) epitope obtained from the MAGE-A3 protein, which includes isolating mononuclear cells (MNCs) from peripheral blood of HLA-A02+ donors, then MNCs are cultured in the presence of recombinant human granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukin-4 (IL-4) for 4 days; on the 5th day, the KVAELVHFL (112-120) epitope is added to the dendritic cell culture as a priming factor, with subsequent incubation at a temperature of 37°C; on the 6th day, a maturation factor is added to complete the maturation of dendritic cells; then the obtained dendritic cells are collected, washed with a nutrient medium, their number is counted, their viability is assessed and they are co-cultured with autologous CD8+ T lymphocytes in a certain ratio, and after 7 days of co-cultivation, antigen-specific CD8+ T cells are isolated, then the TCR gene sequence is identified and the full-length TCR, including CDR3, isolated from the T cell clones is sequenced, while the TCRα and TCRβ chains are connected by a peptide linker 2A (TCRb-P2A-TCRa), and the complete TCR construct is cloned into the backbone of a viral plasmid to obtain a viral vector carrying the TCR gene, while the donors are conditionally healthy individuals, from whose blood monocytes were isolated on a Ficoll gradient, on the 5th day the KVAELVHFL (112-120) epitope is added as a priming factor, in dose of 100 μg/ml and subsequent incubation for 24 hours, on the 6th day, TNF-a is added as a maturation factor at a concentration of 25 ng/ml for 24 hours, and co-cultivation of dendritic cells is carried out with CD8+ T lymphocytes in the presence of 0.5 μg/ml antibodies to CD3 (anti-CD3), 1 μg/ml antibodies to CD28 (anti CD28) and IL-2, IL-7, IL-15 (10 ng/ml each) in a ratio of 1:10, after 7 days of co-cultivation, antigen-specific CD8+ T cells are isolated using Flex-T reagents, then the TCR gene sequence is identified using single-cell RNA sequencing (scRNA-seq) and the BD Rhapsody kit TCR/BCR amplification kit, selection of TCR clones specific to the epitope (112-120) of the MAGE-A3 protein, based on their affinity, phenotype and specificity, using ERGO-II and NetMHCpan-4.1 neural networks and the TCRscape program, wherein in addition to connecting the TCRα and TCRβ chains with a peptide linker 2A (TCRb-P2A-TCRa), the 5' and 3' untranslated region of beta-globulin at the 5' and 3' ends of the insert is used, a lentivirus based on HIV-1 (pLenti_hPGK) is used as a viral plasmid, one dominant TCR with alpha and beta chains originating from the same cell is obtained.

The invention, in our opinion, is new. The essential feature of this method is the ability to obtain, in a short period of time, more accurate information on the structure and affinity of the human T-cell receptor specific to the epitope MAGE-A3 KVAELVHFL (112-120), which has a high affinity for the target peptide and minimal affinity for non-target peptides, which determines a lower risk of developing adverse reactions.

This is achieved, in particular, by using an accurate method of cell transcriptome analysis (single-cell RNA sequencing), which allows obtaining complete information on the full length of a specific T-cell receptor (α-chain and β-chain) on each cell and using a significantly smaller number of target cells for this, which makes it possible to obtain the necessary information using the biological material of donors. This method eliminates the need for additional procedures (vaccination of donors with cells loaded with the target antigen and long-term cultivation of the studied cells to obtain the required number) and reduces the time for obtaining the T-cell receptor. The use of ERGO-II, NetMHCpan-4.1 neural networks and the TCRscape program (https://github.com/Perik-Zavodskii/TCRscape) allows selecting TCR clones to the MAGE-A3 antigen, which has a high affinity for the target peptide and minimal affinity for non-target peptides. The use of Flex-T and two fluorochromes simultaneously to isolate positive clones is a more specific method for detecting antigen-specific cells.

The method is carried out as follows.

1. Obtaining antigen-specific T cells.

Mononuclear cells (MNCs) were obtained from the peripheral blood of conditionally healthy donors with the HLA-A02 genotype. MNCs were separated into adherent and non-adherent fractions by adhesion on plastic for 30 minutes at +37° in a CO ₂ incubator. Mature dendritic cells (DCs) were obtained from the adherent fraction using GM-CSF (100 ng/ml) and IL-4 (50 ng/ml). For antigen loading, the KVAELVHFL (112-120) peptide obtained from the MAGE-A3 protein was used at a dose of 100 μg/ml on the 5th day of cultivation, with subsequent maturation of DCs using TNF-alpha (25 ng/ml) on the 6th day of cultivation. Cells of the non-adherent MNC fraction were cultured for 6 days. On day 7, DC and CD8+ cell cultures from the non-adherent fraction were combined (1:10 ratio) with the addition of 0.5 μg/ml antibodies to CD3 (anti-CD3), 1 μg/ml antibodies to CD28 (anti-CD28), and IL-2, IL-7, IL-15 (10 ng/ml each) to maintain the viability and proliferation of CD8+ cytotoxic T lymphocytes.

After 7-8 days of co-cultivation, antigen-specific T cells were isolated from the co-culture of DC and CD8+ cells using Flex-T reagents and corresponding peptides with simultaneous staining of positive specific cells with two fluorochromes and anti-CD8+ antibodies for identification by flow sorting.

After a full cycle of the Ag-specific T cell production protocol, 2 samples specific for the KVAELVHFL (112-120) epitope, MAGE-A3 antigen, were obtained. The viability of the obtained cells was assessed using 7AAD and calcein dyes. The content of 7AAD-negative/calcein-positive cells in the sample was at least 80%. The obtained cells were labeled with SampleTag antibodies for multiplexing biological samples for use on the BD Rhapsody single-cell multiome platform.

Twenty-seven thousand multiplexed T cells were loaded onto a BD Rhapsody Express, where the polyA-capture molecules (mRNA including TCR alpha and beta chains and SampleTag) were added to molecularly barcoded metal beads, the cells were lysed, and the polyA-capture molecules from the lysed cells were hybridized to the metal beads. The polyA-capture molecules were then reverse transcribed to generate cDNA. Template Switch Oligo (TSO) was added to the cDNA and another round of reverse transcription was performed, allowing reads to be generated from the 5’ end of the cDNA. The cDNA was amplified in two rounds of semi-nested PCR. The TCR library was then subjected to random primer annealing and elongation. To obtain the final immune transcriptome (379 immune response-related genes), TCR, and SampleTag libraries, the products of the second semi-nested PCR of the SampleTag and immune transcriptome libraries and the random annealing and elongation products of the TCR library were amplified in nested PCR with primers containing adapters for Illumina sequencers. The resulting libraries were pooled at 27,000 loaded cells and 10,000 reads per cell for the immune transcriptome library, 15,000 reads per cell for the TCR library, 1,200 reads per cell for the SampleTag library and sequenced on a NovaSeq 6000 instrument on the S2 cell with 150 paired reads.

The resulting FASTQ files were processed using the BD pipeline version 1.11.1L, which performs quality control of reads, their alignment to the reference transcriptome, including T-cell receptors, builds libraries of cell indices, eliminates PCR effects using UMI RSEC (unique molecular identifier recursive substitution error correction) and UMI DBEC (unique molecular identifier distribution-based error correction), builds cell libraries, eliminates technical noise using second derivative analysis and produces final gene expression matrices and Adaptive Immune Receptor Repertoire (AIRR) - matrices of sequences of alpha and beta chains of the T-cell receptor.

We obtained 7700 single cells. Bioinformatics analysis of the sequencing data was performed using the TCRscape software tool (https://github.com/Perik-Zavodskii/TCRscape). TCRscape is a tool for determining dominant (by single cell count) CDR3-loop or full amino acid sequence T cell receptor clonotypes and assessing the phenotype of antigen-specific TCR T cells. TCRscape uses single-cell gene expression matrices and the adaptive immune receptor repertoire (AIRR) matrix generated by the BD Rhapsody single-cell RNA sequencing raw data processing tool. Log2(Counts Per Million) normalization is performed on the gene expression matrix of interest, and T cell receptor (TCR) clonotypes are detected and counted using the AIRR matrix. Selected genes of the normalized gene expression matrix associated with TCR specificity and affinity are combined with the clonotype matrix along with the results of the ERGO-II neural network binding score, then the combined matrix is subjected to principal component analysis (PCA) to estimate the dimensionality of the data, Uniform Manifold Approximation and Projection (UMAP) dimensionality reduction is performed to account for the dimensionality of the data, and then clusters are found using the HDBSCAN method. More than 3000 clonotypes were detected for the MAGE-A3 epitope, among them 191 with 2 or more cells per clonotype.

The ERGO-II neural network was used to predict the binding specificity of the obtained TCRs. After loading the neural network repository, the tool was launched from the terminal with the input file and database (McPAS) selected, on the basis of which the model was trained. McPAS-TCR is a manually curated database based on published literature, containing information on approximately forty thousand T-cell receptor sequences, the antigens they bind to, the T-cell type (CD4 ⁺ /CD8 ⁺ ) and the MHC type (MHC-I/MHC-II class). McPAS-TCR includes information on T-lymphocytes expanding in various pathological conditions of humans or mice (including viral infections, cancer and autoimmune reactions). The input CSV file for running ERGO-II contains information about the TCR CDR3α and CDR3β sequence, peptide sequence, MHC type (MHC-I/MHC-II class), V and J genes, and T cell type (CD4 ⁺ /CD8 ⁺ ). The output file contains a predicted probability value of T cell receptor binding to the peptide/MHC complex (normalized affinity score), which ranges from 0 to 1, where 0 is the minimum affinity and 1 is the maximum affinity. Using ERGO-II, we can predict the affinity of the resulting TCRs for the peptide, which facilitates the selection between candidates from the TCR pool depending on the desired application.

It is known that many CAR-T and TCR-T cells have a non-target effect, since they can interact with related proteins. To reduce this effect, a computer analysis of the interaction of the obtained TCRs with peptides of related proteins was performed. Thus, using the ERGO-II neural network in silico, the probability of TCR binding to the peptide/MHC complex (peptides from proteins of the MAGE subfamily, Titin protein) was predicted.

Non-targeted peptides were selected as a result of literature analysis and analyzed using the NetMHCpan-4.1 neural network with the following parameters: peptide length - 8-11 amino acids, allele - HLA-A*02:01, weighted criterion of predicted binding reliability (rank) - less than 2%.

Based on the clonotype dominance analysis and phenotypic analysis of antigen-specific T cells using TCRscape, affinity of clonotypes to the target peptide and minimal affinity to non-target peptides using ERGO-II and NetMHCpan-4.1 neural networks, the dominant clone with the highest cell number was selected. Figure 1 shows the TCRscape clonotype analysis of MAGE-A3-specific CD8 T cells, namely, UMAP visualization of MAGE-A3-specific CD8 T cell clonotypes using TCRscape; 1), 2), 3) and 4) represent the expression of marker genes in each cluster; 5) represent the cell number for each clonotype; 6) represent the dominant clonotype.

Next, a lentiviral vector based on HIV-1 (pLenti_hPGK_gfp) with an insert instead of the EGFP gene was constructed; the scheme of the pLenti_hPGK plasmid is shown in Fig. 2. The sequence of the insert is presented on a CD-RW disk. The disk recording session is closed for subsequent recording of information onto it. The construction was used to obtain a viral vector carrying the TCR gene, which is specific to the epitope of tumor-associated antigens MAGE-A3. The transfer plasmid of the lentiviral vector includes the TCRa and TCRb sequences in a single reading frame, separated by a signal for ejection of the polypeptide with the P2A polysome and the 5' and 3' untranslated region of beta-globulin at the 5' and 3' ends of the insert. The scheme of constructing the insert for the plasmid is shown in Fig. 3.

The following protocol was used to synthesize and clone a specific gene encoding a TCR specific to an epitope of the tumor-associated antigen MAGE-A3:

1. Gene synthesis using PCR (polymerase chain reaction).

The gene encoding the TCR was synthesized by PCR amplification. First, primers were synthesized to obtain the complete nucleotide sequence of the insert in the plasmid. The sequence listing is attached.

PCR was performed using the ThermoFisherScientific kit (#F549), which includes Phusion Hot Start II DNA polymerase, 5x HF and GC buffer system, 50 mM MgCl2 solution, DMSO, and was carried out on a Bio Rad Thermal cycler C-1000. Flanking primers For (GGATCCACATTTGCTTCTGA) and Rev (TGTACATTTATTGCAATGAAAAT) were used at a concentration of 10 μM. The remaining primers were used at a concentration of 2 μM. The reaction mixture for the first PCR was prepared as follows (final volume 50 ml): 10 μl 5X GC buffer, 10 μl equimolar primer solution, 0.5 μl dNTP mixture (25 mM each), 1 μl Phusion HS II polymerase, 28.5 μl mQ. Mode: initial denaturation (1 cycle): 98°C - 2 min; amplification (15 cycles): 98°C - 10 sec, 60°C - 15 sec, 72°C - 2.5 min; finishing synthesis (1 cycle): 72°C - 5 min; storage at + 4°C.

After completion of the first PCR, the second PCR was performed to obtain amplicons of the target length (2029 bp). The reaction mixture for the second PCR was prepared as follows (final volume 50 ml): 10 μl 5X GC buffer, 2 μl working solution of flanking primers (10 μM each), 6 μl reaction mixture obtained after stage 1 PCR, 0.5 μl dNTP mixture (25 mM each), 1 μl Phusion HS II polymerase, 30.5 μl mQ. Mode: initial denaturation (1 cycle): 98°C - 2 min; amplification (25 cycles): 98°C - 15 sec, 50°C - 15 sec, 72°C - 2.5 sec; finishing synthesis (1 cycle): 72°C - 5 min; storage at + 4°C.

After the second PCR, horizontal gel electrophoresis was performed in 1% agarose gel at 6 V/cm for at least 30 minutes. PCR fragments of 2029 bp in length were visible in the gel. The fragment was excised from the gel and purified using the commercial LumiPure agarose gel DNA extraction kit.

2. Cloning into the intermediate vector pUC57:

The pUC57 vector linearized at the EcoRV site was used as a cloning vector. Ligation reactions were performed using Thermo Scientific™ T4 DNA ligase (5 units/µl) (#EL0011). The vector:purified PCR product ratio was 1:3. Incubation was carried out for 16-18 h at +4°C.

The ligation mixture was transformed into E. coli XL1-blue cells for chemical transformation Eurogene CC001 according to the manufacturer's protocol. Then, these transformed cells were plated on Petri dishes with LB agar containing X-gal, IPTG and ampicillin at a dose of 100 μg/ml. The dishes were incubated for 16-18 h at +37°C. Verification of white clones was performed by PCR screening using specific primers for the insert (M13 for (5-GTAAAACGACGGCCAGT-3), M13_rev (5-AGCGGATAACAATTTCACACAGGA-3).). For screening, the reaction mixture for PCR Basic, 2x Lumiprobe # 5024 was used. The expected size of the PCR product was 2175 bp. Clones that gave positive PCR results were cultured in liquid LB medium (5 ml, ampicillin 100 μg/ml). Plasmid isolation was performed the following day (after 16 hours) using the LumiPure Plasmid DNA Isolation Kit (Spin Miniprep), Lumiprobe #1583. Suitable clones were then selected by sequencing.

3. Recloning the desired gene into the final lentiviral vector pLenti_hPGK_gfp:

The insert was prepared for recloning by cutting out the pUC57_M plasmid with a sequential restriction reaction, first at the BstAUI site (SibEnzyme) (1 h at 37°C in ThermoScientific Fast Digest buffer, #B72), then at the BamHI site (SibEnzyme) (also in ThermoScientific Fast Digest buffer, #B72). The reaction mixture was then subjected to horizontal gel electrophoresis in 1% agarose gel at 5-6 V/cm for at least 45 min, and sections with the desired fragment size (2023 bp) were cut from the gel. The fragment was purified using the LumiPuree DNA Agarose Gel Extraction Kit, Lumiprobe, #5793.

The pLenti_hPGK_gfp vector was prepared for recloning by removing the gfp encoding gene from the vector with simultaneous restriction digestion at the BstAUI (SibEnzyme) and BamHI (SibEnzyme) sites using ThermoScientific Fast Digest, #B72, for 1 h at 37°C. The reaction mixture was then subjected to horizontal gel electrophoresis in 1% agarose gel at 5-6 V/cm for at least 45 min, and sections with the desired 7594 bp fragment corresponding to the vector without insert were cut from the gel. The fragment was purified using the LumiPuree Agarose Gel DNA Extraction Kit, Lumiprobe, #5793.

4. Cloning of the gene into the pLenti_hPGK_gfp vector using BstAUI, BamHI sites:

The ligation reaction was carried out using T4 DNA Ligase (5 U/μL) Thermo Scientific™ (#EL0011). Vector:fragment ratio was 1:5. Incubation for 16-18 h at +4°C.

The ligation mixture was transformed into E. coli XL1-blue cells for chemical transformation Eurogene CC001 according to the manufacturer's protocol. Then, these transformed cells were plated on Petri dishes with LB agar containing ampicillin at a dose of 100 μg / ml. The dishes were incubated overnight at + 37 ° C. Clones were verified by PCR screening using specific primers hPGK-F (5- GTGTTCCGCATTCTGCAAG-3), WPRE-R (5- CATAGCGTAAAAGGAGCAACA-3), the reaction mixture for PCR Basic, 2x Lumiprobe # 5024 was used for screening. The expected size of the PCR product was 2147 bp. Clones that gave positive PCR results were cultured in liquid LB medium (5 ml, ampicillin 100 μg/ml, overnight culture). Plasmid isolation was performed the following day (after 16 hours) using the LumiPure Plasmid DNA Isolation Kit (Spin Miniprep), Lumiprobe #1583. Suitable clones were then selected by sequencing.

Transfer plasmid, VSV-G encoding plasmid and third generation lentivirus packaging plasmids (Gag-pol and Rev) were produced in E. coli (NEB Stable strain) and the resulting plasmids were checked by restriction enzymes and gel electrophoresis. The above plasmids were delivered by lipofectamine 2000 into HEK-293T (Human embryonic kidney 293T) packaging cells.

The produced lentiviruses were concentrated using the commercial TransLv™ Lentivirus Precipitation Solution (5×) and titrated using quantitative (with diluted standards) PCR for proviral DNA (TransLvTM Lentivirus qPCR Titration Kit) in HEK-293T cells. The target cells were treated with the required Multiplicity Of Infection (MOI) to transduce the largest number of cells with the highest vitality and the fewest exhaustion markers. Target T cells were then transduced with the obtained lentiviral particles according to the optimal MOI, after which CD8 cells were sorted. To assess the cytotoxic activity of transduced TCR-T cells, they were cocultured with tumor cell lines (ratio 1:5) differing in MAGE-A3 expression (SK-MEL-5 - MAGE-A3-positive, HCT 116 - MAGE-A3-positive and MDA-MB-231 - MAGE-A3-negative). Non-transduced T cells served as a control.

Figure 4 shows the percentage of tumor cell death of the MAGE-A3-positive line (SK-MEL-5 and HCT 116) and MAGE-A3-negative line (MDA-MB-231) when they were co-cultured with CD8+ T cells transduced with a lentiviral vector carrying the gene encoding the T cell receptor specific to the MAGE-A3 epitope, and with non-transduced CD8+ T cells (control), n=6. Arrows indicate statistically significant differences between the experimental and control groups (p≤0.05).

Thus, the proposed method for obtaining a human T-cell receptor specific for the KVAELVHFL (112-120) epitope of the MAGE-A3 protein allows for the creation in a short time, without additional lengthy procedures (obtaining dendritic cell vaccines, vaccinating donors), and having an accurate description of the structure of the T-cell receptor specific for the KVAELVHFL (112-120) MAGE-A3 epitope. The conducted in vitro studies of CD8+ cells transduced with a lentiviral vector carrying the gene encoding the developed T-cell receptor specific for the KVAELVHFL (112-120) MAGE-A3 epitope using a direct cytotoxic test against tumor cells expressing the MAGE-A3 antigen demonstrated a high cytotoxicity rate against tumor cells expressing the MAGE-A3 antigen, in contrast to the corresponding (antigen-negative) control.

Claims (1)

A method for producing a human T-cell receptor specific to the KVAELVHFL (112-120) epitope derived from the MAGE-A3 protein, comprising isolating peripheral blood mononuclear cells (MNCs) from HLA-A02+ donors, then separating them into adherent and non-adherent fractions by adhesion on plastic for 30 min at +37°C in a _CO2 incubator, then culturing the adherent MNC fraction in the presence of recombinant human granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukin-4 (IL-4) for 4 days; on the 5th day, the KVAELVHFL (112-120) epitope is added to the dendritic cell culture as a priming factor, followed by incubation at 37°C; On the 6th day, a maturation factor is added to complete the maturation of dendritic cells; then the obtained dendritic cells are collected, washed with a nutrient medium, their number is counted, their viability is assessed and they are co-cultured with autologous CD8+ T lymphocytes in a certain ratio, and after 7 days of co-cultivation, antigen-specific CD8+ T cells are isolated, then the TCR gene sequence is identified by sequencing the full length of the TCR, including CDR3, isolated from the T cell clones, while the TCRα and TCRβ chains are connected by a peptide linker 2A (TCRb-P2A-TCRa), and the complete TCR construct is cloned into the backbone of a viral plasmid to obtain a viral vector carrying the TCR gene, characterized in that the donors are conditionally healthy individuals, from whose blood monocytes were isolated on a Ficoll gradient, on the 5th day the KVAELVHFL (112-120) epitope is added as a priming factor at a dose of 100 μg/ml and followed by incubation for 24 h, on the 6th day, TNF-α is added as a maturation factor at a concentration of 25 ng/ml for 24 h, and co-cultivation of dendritic cells is carried out with CD8+ T lymphocytes in the presence of 0.5 μg/ml antibodies to CD3 (anti-CD3), 1 μg/ml antibodies to CD28 (anti-CD28) and IL-2, IL-7, IL-15 (10 ng/ml each) in a ratio of 1:10, after 7 days of co-cultivation, antigen-specific CD8+ T cells are isolated using Flex-T reagents, then the TCR gene sequence is identified using single-cell RNA sequencing (scRNA-seq) and the BD Rapsody kit TCR/BCR amplification kit, selection of TCR clones of the MAGE-A3 protein KVAELVHFL (112-120) epitope-specific TCR based on their affinity, phenotype and specificity using ERGO-II and NetMHCpan-4.1 neural networks and the TCRscape program, wherein in addition to connecting the TCRα and TCRβ chains with a peptide linker 2A (TCRb-P2A-TCRa), the 5' and 3' untranslated region of beta-globulin at the 5' and 3' ends of the insert is used, and an HIV-1-based lentivirus (pLenti_hPGK) is used as a viral plasmid, one dominant TCR with alpha and beta chains originating from the same cell is obtained.