RU2809007C2 - Tyrosine inhibitors with immunosuppressive activity in human neonatal keratinocyte progenous cells - Google Patents

Abstract

FIELD: medicine; therapy and immunology.

SUBSTANCE: group of inventions is intended to reduce inflammation in a subject. A method of reducing inflammation in a subject by immunosuppressing a cell comprises administering to a subject in need thereof a composition containing an effective amount of one or more peptides, wherein the said one or more peptides comprise the following SEQ ID NO: 9, the following SEQ ID NO: 10, the following SEQ ID NO: 11 or SEQ ID NO: 12. In another embodiment, a method of reducing inflammation in a subject by immunosuppressing a cell is provided, comprising administering to a subject in need thereof a composition containing an effective amount of oxyresveratrol.

EFFECT: use of a group of inventions makes it possible to increase the effectiveness of reducing inflammation in a subject.

20 cl, 8 dwg, 12 tbl

Description

Cross reference to related application

[1] This patent application claims priority to US Patent Application 62/794582, filed January 19, 2019, the contents of which are incorporated by reference along with other references cited in this application.

List of sequences

[2] This application incorporates by reference the sequence listing entitled "20200120_ELIXP005_ST25.TXT" (3 kilobytes) created on January 20, 2020 and filed electronically with this application.

State of the art

[3] The present invention relates to the field of new biological agents.

Brief description of the invention

[4] Embodiments relate to tyrosine inhibitors that exhibit immunosuppressive activity in human neonatal keratinocyte progenitor cells. Specific embodiments relate to the immunosuppressive effects of decapeptide and/or oxyresveratrol measured in two different ways: blockade of stimulated cell growth and inhibition of cytotoxic killing.

[5] Some embodiments include a method of treating a subject that enables immunosuppression of a cell, the method comprising administering to a subject in need thereof a composition containing an effective amount of one or more peptides, hydroxyresveratrol, or both, wherein said one or more peptides comprise SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ. ID NO: 12. Said cell may be a mammalian cell. Said cell may be a skin cell. Administration may include oral administration. This patent describes various embodiments.

[6] In one embodiment, there is provided a method of treating a subject by immunosuppressing a cell, the method comprising administering to a subject in need thereof a composition comprising an effective amount of one or more peptides, wherein said one or more peptides comprise SEQ ID NO: 9. SEQ ID NO: 10, SEQ ID NO: 11 or SEQ. ID NO: 12.

[7] In various embodiments, said peptide consists of SEQ ID NO: 9. The cell is a mammalian cell. Said mammalian cell is a skin cell. Said mammalian skin cell is a progenitor cell. Said progenitor cell is an epidermal keratinocyte precursor, melanoblast, fibroblast, histioblast or dendroblast. Administration is carried out orally. The cell is terminally differentiated. The cell is a keratinocyte, melanocyte, fibrocyte, histiocyte or dendrocyte. The peptide is present at a concentration of approximately 1 millimole or less. The composition additionally contains oxyresveratrol.

[8] In one embodiment, there is provided a method of treating a subject by immunosuppressing a cell, the method comprising administering to a subject in need thereof a composition containing an effective amount of oxyresveratrol.

[9] In various embodiments, oxyresveratrol is present at a concentration of from about 0.1 millimol to about 1.0 millimol. The composition further contains an effective amount of one or more peptides, wherein said one or more peptides comprise SEQ ID NO: 9. The cell is a mammalian cell. Said mammalian cell is a skin cell. Said mammalian skin cell is a progenitor cell. Said progenitor cell is an epidermal keratinocyte progenitor cell, melanoblast, fibroblast, histioblast or dendroblast. Administration is carried out orally. The cell is a terminally differentiated keratinocyte, melanocyte, fibrocyte, histiocyte or dendrocyte.

[10] Other objects, features and advantages of the present invention will become apparent from a reading of the following detailed description and the accompanying drawings, in which the same legend represents the same features throughout the figures.

Brief description of drawings

[11] In FIG. Figure 1A shows the dose-dependent up-regulation of SIRT1(a) transcription. Data are expressed as fold increase relative to the internal control gene 18S and represent means ± standard error of the mean (SEM) for 3 independent experiments.

[12] In FIG. Figure 1B shows the dose-dependent up-regulation of SIRT3 transcription, (b). Data are expressed as fold increases relative to the internal control gene 18S and represent means ± SEM of 3 independent experiments.

[13] In FIG. Figure 1C shows the dose-dependent up-regulation of SIRT6 transcription (c). Data are expressed as fold increases relative to the internal control gene 18S and represent means ± SEM of 3 independent experiments.

[14] In FIG. Figure 1D shows the dose-dependent up-regulation of SIRT7 transcription (d). Data are expressed as fold increases relative to the internal control gene 18S and represent means ± SEM of 3 independent experiments.

[15] In FIG. Figure 2A shows the cytotoxic effects of decapeptide-12 and oxyresveratrol on epidermal keratinocytes. Data are expressed as percentage relative to control and represent means ± SEM of 3 separate experiments. *P<0.05.

[16] In FIG. 2B shows the effect of decapeptide-12 and oxyresveratrol on the proliferation of epidermal keratinocytes. Data are expressed as percentage relative to control and represent means ± SEM of 3 separate experiments. *P<0.05.

[17] In FIG. 3 shows the chemical structure of decapeptide P4 with SEQ ID NO: 9.

[18] In FIG. Figure 4 shows the chemical structure of oxyresveratrol.

[19] FIG. 5 is a graph of the immunosuppressive effects of P4 decapeptide of SEQ ID NO: 9.

[20] FIG. 6 is a graph of the immunosuppressive effects of oxyresveratrol.

[21] FIG. 7 is a graph of the immunosuppressive effects of P4 decapeptide of SEQ ID NO: 9.

[22] FIG. 8 is a graph of the immunosuppressive effects of oxyresveratrol.

Detailed Description of the Invention

[23] The skin exhibits the effects of chronological aging and photoaging, constantly reminding us of the aging process and forcing us to seek remedies to slow or reverse its effects. Skin aging is traditionally divided into external and internal. Recent evidence indicates that both types share important molecular features, including altered signal transduction pathways that promote matrix metalloproteinase expression, decreased procollagen synthesis, and connective tissue damage.

[24] In human skin, aging is associated with an increase in the number of senescent cells and a decrease in the ability of cells to proliferate and differentiate. Considerable evidence supports the theory that aging is primarily a consequence of free radical damage by various endogenous reactive oxygen species (ROS). Velarde et al. reported in vivo confirmation of a causal relationship between mitochondrial oxidative damage, cellular senescence, and aging phenotypes in the skin. In addition, ultraviolet (UV) radiation stimulates the synthesis of ROS, which is involved in mutagenesis and photoaging. Consistent with these findings, the data suggest altered expression of sirtuin activity in UV-irradiated versus sun-protected skin and that these differences may be responsible for certain aspects of skin aging.

[25] Cellular senescence describes the process by which cells stop dividing and undergo characteristic phenotypic changes, including profound changes in chromatin and secretome, as well as tumor suppressor activation. Numerous reported data have helped to establish the concept of sirtuins as effective antiaging proteins, detailing their pleiotropic role in slowing cellular senescence and premature aging. Sirtuins are key effectors in pathways such as DNA damage repair, telomere shortening, cellular response to oxidative stress, and alleviation of ROS-induced pathologies.

[26] In mammals, there are seven sirtuin genes (SIRT1-7), localized in different cell compartments and capable of different actions. Biochemically, sirtuins are a class of proteins that have primarily NAD ⁺ -dependent lysine deacetylase activity. Sirtuins are widely recognized as critical regulators of multiple metabolic pathways, sensors of energy and redox status in cells, and modulators of oxidative stress.

[27] These findings have sparked interest in the development of small molecule activators or drugs to help slow the progression of aging and a wide range of age-related disorders. Of the seven mammalian sirtuins, SIRT1 has been the most studied in relation to aging and lifespan. For example, the anti-aging effects of resveratrol are mainly due to the activation of SIRT1. Indeed, Ido et al. reported that resveratrol, through increasing the activity of AMP-activated protein kinase and sirtuins, attenuated cellular senescence and proliferative dysfunction.

[28] Previously, the present inventors reported that decapeptide-12 was highly effective against hypopigmentation in human skin. Further clinical studies showed an overall improvement in the appearance of facial skin in patients with dyschromia who were treated twice daily with a topical cream containing 0.01 percent decapeptide-12 for 8 weeks. These data led the present inventors to hypothesize that decapeptide-12 may modulate sirtuin activity and improve the overall appearance of the skin. To clarify this possibility, we assessed the effect of decapeptide-12 on sirtuin transcription in human epidermal progenitor cells.

[29] These findings detail the pleiotropic role of sirtuins in suppressing premature aging, slowing cellular aging, increasing lifespan, and alleviating a wide range of aging-related disorders. Herein, the inventors report their results on an effective sirtuin activator, decapeptide-12, and compare its effectiveness to the well-documented oxyresveratrol. Treatment of human epidermal keratinocyte progenitor cells with 100 micromolar decapeptide-12 increased SIRT1 transcription by 141 ± 11 percent compared to control cells, while levels of SIRT3, SIRT6 and SIRT7 increased by 121 ± 13 percent, 147 ± 8 percent, and 95 ± 14 percent respectively. Decapeptide-12 upregulated sirtuin transcription to levels similar to oxyresveratrol, but with reduced cytotoxicity.

[30] Materials and methods

[31] Reagents

[32] Decapeptide-12 (YRSRKYSSWY), SEQ ID NO: 9, was synthesized by Bio Basic, Inc. (Ontario, Canada) using solid phase FMOC chemistry. Oxyresveratrol was purchased from Sigma-Aldrich (St. Louis, MO).

[33] Cell culture

[34] Neonatal human epidermal progenitor cells (Thermo Fisher Scientific, New York) were seeded in 6-well plates at a density of 2 x 10 ⁵ cells per well. Each well was injected with 2 milliliters of Epilife medium containing 60 micromolar calcium chloride (Thermo Fisher Scientific, New York). The plates were incubated in a humidified chamber at 37 degrees Celsius and 5 percent CO ₂ . Twenty-four hours later, cells were treated with various concentrations of oxyresveratrol or decapeptide-12 dissolved in PBS containing 5% DMSO. Control wells were injected with vehicle only (5% DMSO and PBS). The final concentration of DMSO in each well was 0.05 percent.

[35] Total RNA extraction, quantitative analysis and cDNA synthesis

[36] After a 72-hour incubation period, cells were trypsinized and total RNA was extracted using the RNeasy kit (Qiagen, Valencia, CA) according to the manufacturer's protocol.

[37] RNA concentration was determined using nanodrop (Thermo fisher Scientific, New York). Two μg of total RNA was used for cDNA synthesis using oligo dT primers and TaqMan reverse transcription reagents (Thermo fisher Scientific, New York). The reaction was performed in a DNA Engine Peltier Thermal Cycler (Bio-Rad, Hercules, CA). The annealing temperature was 25 degrees Celsius for 10 minutes, followed by first-strand synthesis at 48 degrees Celsius for 1 hour and heat inactivation at 95 degrees Celsius for 5 minutes.

[38] Semi-quantitative analysis

[39] Primers SIRT1-7 (Table A) were prepared using Primer3. Semiquantitative PCR reactions were performed in a DNA Engine Peltier Thermo Cycler (Bio-Rad, Hercules, CA). PCR was performed under the following conditions: denaturation at 94 degrees Celsius for 2 minutes and primer extension at 54 degrees Celsius for 30 seconds in 34 cycles for SIRT 1-7 and the housekeeping gene 18S.

[40] Table A: Primer sequences for SIRT1-7 and 18S

Gene Primer sequence (5'-3') SIRT1 SEQ ID NO: 1 Straight (R) GCCAATCATAAGATGTTGCTGAAC
Reverse (O) TAGAGCCTCACATGCAAGCTCTA SIRT2 SEQ ID NO: 2 P AACCTCCCTCATCTCTAACT
ABOUT GTCTCCAATAAGCAATGTCT SIRT3 SEQ ID NO: 3 P GTGGTTACAAGATCCAGAC
ABOUT AGATAGAAAGTGCTGGAATG SIRT4 SEQ ID NO: 4 P AGAGCTGTGAGAGAATGAAG
ABOUT TTTCTGACCTGTAGTCTGGT SIRT5 SEQ ID NO: 5 P TCTTCCATACACTTTACTACCTT
ABOUT TTTATATGATAGTGTCTTGTTGC SIRT6 SEQ ID NO: 6 P CAGCTTAAACAGGAGTGAAC
ABOUT TTATTGCATTGAGGACTTTT SIRT7 SEQ ID NO: 7 P GACATTTTTAGCCATTTGTC
ABOUT CATCCAGTACAGAGAGGATT 18S
SEQ ID NO: 8 P CGGAGGTTCGAAGACGATCAGATA
ABOUT TTGGTTTCCCGGAAGCTGCC

[41] Samples were analyzed and separated on a 1.5 percent agarose gel containing 0.5 micrograms per milliliter of ethidium bromide and visualized using a FluorChem HD2 Imaging System (Protein simple, San Jose, CA). Densitometric analysis was performed using AlphaEase FC software (Protein simple, San Jose, CA). Intensity ratios were calculated as the intensity value for each gene divided by the intensity value of the 18S internal control gene.

[42] Viability/proliferation and cytotoxicity assays

[43] Proliferation rates were determined using the TACS® MTT Cell Proliferation Kit (R&D systems, Minneapolis, MN). Cells were seeded at 2.5 x 10 ⁴ per well in 96-well plates in a humidified atmosphere of 5% CO ₂ at 37 degrees Celsius. Twenty-four hours later, decapeptide-12 or oxyresveratrol was added to the corresponding wells at various concentrations (0, 3, 10, 30, 100, 300, and 1000 micromolar), and the cultures were then incubated for 72 hours. The remainder of the procedure was performed according to the manufacturer's protocol.

[44] Cellular toxicity was measured using a trypan blue dye exclusion assay. Cells were cultured in 6-well plates at a density of 4×10 ⁵ cells per well. Each well was injected with a different concentration of decapeptide-12 or oxyresveratrol (0, 3, 10, 30, 100, 300, and 1000 micromolar). The plates were incubated at 37 degrees Celsius in a humidified chamber with 5 percent CO ₂ . After 72 hours, an aliquot was removed and cells were counted using a hemocytometer. Cytotoxicity was measured according to the following formula: [1 - (# cells in control - # live cells in test sample) / # cells in control] × 100 percent.

[45] Statistical analysis

[46] Means and their standard errors from 3 independent analyzes were calculated using Microsoft Excel, and statistical significance was determined using pairwise analysis of variance. P -values were considered statistically significant at P < 0.05.

[47] Results

[48] Effect of decapeptide on proliferation rates and cytotoxicity:

[49] We first evaluated the cytotoxic effects of decapeptide-12 and oxyresveratrol on human epidermal progenitor cells. In FIG. Figure 2A shows that treatment with 100 micromolar decapeptide-12 or oxyresveratrol caused 3 ± 1 percent or 6 ± 1 percent cell death, respectively. At a concentration of 1 millimol, decapeptide-12 or oxyresveratrol caused 7 ± 2 percent or 16 ± 2 percent cell death, respectively.

[50] The present inventors also evaluated the effects of decapeptide-12 and oxyresveratrol on the viability and proliferation of human epidermal progenitor cells. In FIG. 2B shows that treatment with 300 micromolar decapeptide-12 or oxyresveratrol resulted in a 2 ± 1 percent or 5 ± 1 percent decrease in cell proliferation, respectively. However, unlike 1 mM decapeptide-12, which reduced proliferation by 3 ± 2 percent, 3-day incubation with oxyresveratrol resulted in a 12 ± 2 percent reduction in proliferation.

[51] Decapeptide-12 up-regulated SIRT1-7 transcription:

[52] We then assessed the effects of oxyresveratrol and decapeptide-12 on sirtuin expression in human epidermal progenitor cells. In FIG. 1A-1D and Table B show SIRT1-7 transcription modulated by decapeptide-12 and oxyresveratrol in a dose-dependent manner. With 30 micromolar oxyresveratrol, SIRT1 transcription levels increased by 125 ± 9 percent compared to control cells, while SIRT3, SIRT6, and SIRT7 levels increased by 133 ± 5 percent, 73 ± 8 percent, and 95 ± 7 percent, respectively.

[53] Table B and Table C. Expression profile of SIRT 1-7 genes in response to treatment with decapeptide-12 (Table B) and oxyresveratrol (Table C). Results are averages of three independent analyses.

[54] Table B

Deca [µM] SIRT1 SIRT2 SIRT3 SIRT4 SIRT5 SIRT6 SIRT7 3 3±1% 1±1% 4±1% 3±1% 3±1% 3±1% 5±1% 10 12.2±3.1% 4.1±3% 9.2±2.8% 8.1±4% 5.2±3% 21.3±8.1% 15±4.2% thirty 34±6.7% 11.2±3.7% 32.2±6.1% 12.1±7% 21±6.7% 52±5.1% 34.4±9.2% 50 79.2±12% 21.5±4.9% 65±12.1% 41.2±13.1% 33.1±6.1% 95.4±13.4% 61.3±10.2% 100 141.2±11% 35.4±5.5% 121±13.2% 71.4±14.1% 46±7.3% 147±8.4% 95.4±14.2% 300 188±12% 61.1±6.8% 165.2±12.4% 115±11.7% 67±9.3% 189±9.5% 148±9.6% 500 205±13.3% 76±6.1% 177±9.2% 145±12.7% 87.4±15.1% 194±14% 171.4±8.4% 1000 213±13.4% 76±7.1% 171±9% 151±13.4% 92.1±16.8% 167±12.2% 181.1±8.4%

[55] Table C

Oxy [μΜ] SIRT1 SIRT2 SIRT3 SIRT4 SIRT5 SIRT6 SIRT7 3 8.7±1% 7.9±2% 10±3% 8.1±1% 7.1±1% 6.1±1% 6.3±1% 10 45±7.7% 14.9±1.9% 52.7±5.1% 12.4±2.1% 12.3±3% 34±5.5% 65±2.9% thirty 124.5±8.6% 43.1±2.4% 133±4.8% 49±6.7% 45.1±4.3% 73±8.1% 95±6.7% 50 166±14.5% 56.3±7.7% 156±9.2% 52.1±6.6% 46±4% 81.3±8.1% 114±8.1% 100 187±16.6% 41.2±8.1% 148±7.3% 64.1±7.4% 36.1±6.7% 82.4±8.4% 132±7.6% 300 187±15.4% 39±9.3% 152.2±9% 67±8.7% 33.4±7.1% 87.4±9.3% 168±4.8% 500 176±10% 33.1±12.4% 151±8.1% 61.2±8.8% 35.1±8.1% 81.2±12.4% 177±6.6% 1000 175±9% 31.2±12.3% 151±7.4% 71.3±9.2% 37±6.8% 75±15.1% 165±5.1%

[56] Data show that 100 micromolar decapeptide-12 increased SIRT1 transcription by 141 ± 11 percent compared to untreated cells, while SIRT3, SIRT6, and SIRT7 increased by 121 ± 13 percent, 147 ± 8 percent, and 95 ± 14 percent. respectively (Fig. 1A-1D).

[57] Discussion

[58] The pleiotropic role of sirtuins in slowing cellular aging and blocking the development of premature aging has confirmed that they are effective anti-aging proteins. The therapeutic applications of resveratrol as a SIRT1 activator and potential anti-aging agent have been extensively studied and documented. Resveratrol protects human endothelium from H2O2-induced oxidative stress and aging through activation of SIRT1. Likewise, oxyresveratrol is also an effective antioxidant and free radical scavenger. However, unlike resveratrol, it exhibits less cytotoxicity and higher solubility in water. Accordingly, the present inventors selected it for use as a positive control against which the efficacy of decapeptide-12 and its ability to modulate sirtuin transcription in human epidermal keratinocytes were compared.

[59] Although there was up-regulation of all 7 sirtuins following decapeptide-12 treatment, further discussion will focus on those sirtuins that are directly involved in skin aging.

[60] At concentrations of 100 micromoles or 1 millimoles, decapeptide-12 increased SIRT1 transcription by a significant 141 or 213 percent, respectively. SIRT1 is primarily a nuclear deacetylase. It controls various cellular processes such as proliferation, differentiation, apoptosis, metabolism, stress response, genome stability and cell survival. As reported by Cao et al. SIRT1 provides protection against UVB- and H2O2-induced cell death through modulation of p53 and c-Jun N-terminal kinases in cultured skin keratinocytes, suggesting that SIRT1 activators may serve as novel anti-skin aging agents. Other researchers have reported that SIRT1 may suppress NF-κB signaling and thus slow down the aging process and increase lifespan. Activation of SIRT1 inhibits NF-κB signaling directly by deacetylating the p65 subunit of the NF-κB complex and enhances oxidative metabolism and inflammation resolution. Accordingly, SIRT1 can be considered a key antiaging protein that mediates widespread effects in preventing premature aging and accelerated aging by regulating several molecular pathways.

[61] SIRT3 transcription increased by 121 percent after treatment with 100 micromolar decapeptide. SIRT3 is primarily associated with the regulation of a number of mitochondrial processes such as β-oxidation, ATP generation, and ROS management. SIRT3 is also involved in maintaining the regenerative capacity of hematopoietic stem cells. SIRT3 is downregulated with age, and up-regulation of SIRT3 in aged hematopoietic stem cells improves their regenerative capacity. This finding identifies a significant role for SIRT3 in maintaining stemness and, more importantly, helps pave the way for future stem cell-based interventions for metabolic disorders that lead to premature aging.

[62] SIRT6 can be considered as an important antiaging protein that plays multifaceted roles in DNA damage repair, metabolic regulation, inflammation, and tumor suppression. SIRT6 came to light when a knockout mouse model developed severe premature aging phenotypes with mortality within a month. Moreover, SIRT6 is the only mammalian sirtuin that showed a clear increase in lifespan when overexpressed throughout the whole body of mice. In addition, as reported by Kawahara et al. SIRT6 reduces overactive NF-κB signaling by deacetylating histone H3 at K9 at the promoters of NF-κB target genes, enhancing the role of SIRT6 as a critical anti-inflammatory protein.

[63] Baohua et al. demonstrated that SIRT6 plays a key role in the skin aging process by modulating collagen metabolism and NF-κB signaling. They reported that blocking SIRT6 significantly reduced hydroxyproline content by inhibiting type 1 collagen transcription, stimulating matrix metalloproteinase 1 secretion and enhancing NF-κB signaling. Overall, SIRT6 acts as a key modulator of anti-aging processes by regulating multiple pathways to slow cellular aging and accelerate aging. Therefore, decapeptide-12, which increased SIRT6 transcription by 147 percent at 100 μM, may be extremely promising as a therapeutic anti-aging candidate to address the often overlapping phenotypes of premature skin aging and skin photodamage.

[64] Thus, decapeptide-12 was shown in this report to significantly increase the transcription levels of SIRT1, SIRT3 and SIRT6, all 3 of which play a significant role in counteracting skin aging and other age-related pathologies. Clinical study designs using various topical formulations containing decapeptide-12 are currently under development to confirm the in vitro results and test the in vivo efficacy of this potent sirtuin activator.

[65] EXAMPLE

[66] In this example, certain modifications were made to decapeptide P4, as detailed in the following Table D.

[67] Table D

Peptide Short designation Subsequence Modification Native-P4
SEQ ID NO: 9 P4 YRSRKYSSWY Absent Palm-P4-amide
SEQ ID NO: 10 P4A Palmitoyl-YRSRKYSSWY-amide •N-terminus: palmitoyl.
•C-terminus: amide. Palm-D-ISO-amide
SEQ ID NO: 11 P4B Palmitoyl-YRSRK[*Y]SSWY-amide •N-terminus: palmitoyl. •Internal part: tyrosine at position 6 in the D isoform.
•C-terminus: amide. Acet-P4-amide
SEQ ID NO: 12 P4C Acetyl-YRSRKYSSWY-amide •N-terminus: acetyl.
•C-terminus: amide.

[68] These modifications of P4 decapeptide may serve to increase stability against proteases and to enhance transdermal or transcellular penetration, or both.

[69] The peptides of the present invention may contain any naturally occurring amino acid or non-naturally occurring amino acid residues. These naturally occurring and non-naturally occurring amino acids may have the D or L configuration, or may include both dextrorotatory forms. The terms "D" and "L" are used in this application as they are known to be used in the art. The peptides of the present invention include single amino acids and short sections (eg, 1-20) of amino acids. In addition, the modified peptides of the present invention may also include a monomer or dimer.

[70] Standard one-letter and three-letter amino acid designations are used in this application and are shown in Table E below.

[71] Table E

A (Ala) Alanine C (Cys) Cysteine D (Asp) Aspartic acid E (Glu) Glutamic acid F (Phe) Phenylalamine G (Gly) Glycine H (His) Histidine I (Ile) Isoleucine K(Lys)lysine L (Leu) Leucine M (Met) Methionine N (Asn) Asparagine P (Pro) Proline Q (Gln) Glutamine R (Arg) Arginine S (Ser) Serine T (Thr) Threonine V (Val) Valin W(Trp) Tryptophan Y (Tyr) Tyrosine

[72] As described above, said residues may be a naturally occurring L-amino acid or a modification thereof, i.e. chemical modification, optical isomer or connection with a modifying group. It is contemplated that specific peptide modifications can be made that retain the ability of the peptides of the present invention to specifically modulate the expression of the sirtuin gene(s).

[73] The effect of decapeptides P4, P4A, P4B and P4C on the transcription levels of sirtuins 1-7 was assessed. Table F shows the transcription levels for all four decapeptides with their corresponding genes at the concentrations tested: 10, 30, 50, 100, and 300 (all in micromoles).

[74] Table F

Concentration Gene P4 P4A P4B P4C 10 µM SIRT1 12±3% 18±2% 10±4% 7±3% SIRT2 4±3% 14±1% 5±1% 5.00 SIRT3 9±3% 25±4% 22±3% 8±3% SIRT4 8±3% 16±1% 9±1% 3±1% SIRT5 5±3% 13±2% 2.00 4±1% SIRT6 21±8% 24±5% 21±5% 12±3% SIRT7 15±4% 29±6% 20±6% 14±5% Concentration Gene P4 P4A P4B P4C 30 µM SIRT1 34±7% 19±1% 10±3% 5.00 SIRT2 11±4% 15±1% 8±3% 2±1% SIRT3 32±6% 26±3% 23±2% 6±2% SIRT4 12±7% 16±1% 10±1% 3±1% SIRT5 21±7% 12±2% 1.00 2±1% SIRT6 52±5% 25±5% 22±4% 9±4% SIRT7 34±9% 33±5% 23±5% 7±2% Concentration Gene P4 P4A P4B P4C 50 µM SIRT1 79±12% 42±5% 48±3% 1.00 SIRT2 22±5% 6±3% 17±6% 1.00 SIRT3 65±12% 60±4% 28±5% 45±9% SIRT4 41±13% 9±4% 17±1% 11±6% SIRT5 33±6% 10±3% 1.00 3±1% SIRT6 95±13% 33±7% 10±4% 31±5% SIRT7 61±10% 52±4% 54±7% 46±5% Concentration Gene P4 P4A P4B P4C 100 µM SIRT1 141±11% 144±5% 135±12% 137±8% SIRT2 35±5% 48±1% 52±4% 42±1% SIRT3 121±13% 152±2% 78±10% 82±8% SIRT4 71±14% 98±12% 86±6% 32±9% SIRT5 46±7% 47±7% 35±3% 35±2% SIRT6 147±8% 135±10% 107±2% 124±7% SIRT7 95±14% 87±6% 61±7% 80±11% Concentration Gene P4 P4A P4B P4C 300 µM SIRT1 188±12% 184±2% 155±3% 190±9% SIRT2 61±7% 30±5% 40±4% 31±9% SIRT3 165±12% 147±2% 142±5% 159±6% SIRT4 115±12% 65±1% 49±4 67±9% SIRT5 67±9% 29±4% 29±5% 28±9% SIRT6 189±10% 85±5% 81±4% 87±3% SIRT7 148±10% 113±2% 103±8% 130±9%

[75] At low concentrations, native P4 decapeptide showed increased transcription levels compared to modified decapeptides. However, each of the three modified decapeptides (P4A, P4B, and P4C) increased the transcription levels of sirtuin genes compared to the control. At a concentration of 100 microM, the effect on transcription levels was comparable for all four decapeptides.

[76] Proliferation rates of three human cell lines (epidermal progenitor cells, melanoblasts and fibroblasts) were determined using the TACS® MTT Cell Proliferation Kit. Cells were seeded at 2.5 x 104 per well in 96-well plates in a humidified atmosphere of 5% CO2 at 37 degrees Celsius. After twenty-four hours, decapeptides were added to the corresponding wells at various concentrations and incubated for 72 hours. The remainder of the procedure was performed according to the manufacturer's protocol.

[77] Table G the rate of proliferation of epidermal progenitors after 72 hours is presented.

[78] Table G

Concentration (µM) P4 P4A P4B P4C 3 100% 99±1% 99±1% 99±1% 10 99±1% 99±1% 99±1% 99±1% thirty 98±1% 98±1% 98±1% 98±1% 50 97±1% 97±1% 98±1% 98±1% 100 97±1% 97±2% 97±1% 97±1% 300 96±1% 96±2% 97±1% 97±1% 500 96±2% 96±2% 95±2% 96±2% 1000 94±2% 94±2% 94±2% 96±2%

[79] Table H shows the proliferation rate of melanoblasts after 72 hours.

[80] Table H

Concentration (µM) P4 P4A P4B P4C 3 100% 100% 100% 100% 10 100% 100% 100% 100% thirty 99±1% 99±1% 99±1% 99±1% 50 98±1% 98±1% 98±1% 98±1% 100 97±1% 97±2% 97±2% 97±2% 300 97±1% 97±2% 96±2% 96±3% 500 95±2% 96±2% 95±2% 95±2% 1000 95±2% 95±2% 94±2% 95±2%

[81] Table I shows the proliferation rate of fibroblasts after 72 hours.

[82] Table I

Concentration (µM) P4 P4A P4B P4C 3 100% 100% 100% 100% 10 99±1% 99±1% 99±1% 99±1% thirty 99±1% 98±1% 99±1% 99±1% 50 98±1% 98±1% 99±1% 99±1% 100 97±1% 97±2% 98±2% 98±2% 300 97±1% 97±2% 97±2% 97±2% 500 97±2% 96±2% 96±2% 96±2% 1000 96±2% 95±2% 96±2% 96±2%

[83] After 72 hours of incubation of epidermal progenitor cells, melanoblasts and fibroblasts with 100 micromoles of decapeptide P4A, the result was a 3% reduction in the proliferation rate of all three cell lines.

[84] At 1,000 microM, the proliferation rate of epidermal progenitor cells was reduced by 6 percent, while that of melanoblasts and fibroblasts was reduced by 5 percent and 4 percent, respectively.

[85] The effect of each of these decapeptides on cell viability was also tested. Specifically, cells were co-incubated with various concentrations of decapeptide and then scored for viability compared to control (untreated cells) using trypan blue. Cytotoxicity was measured according to the following formula:

[1 - (# cells in control - # living cells in test sample) / # cells in control] × 100 percent.

[86] Table J shows the viability of epidermal progenitor cells after 7 days.

[87] Table J

Concentration (µM) P4 P4A P4B P4C 3 100% 100% 100% 100% 10 99±1% 99±1% 99±1% 99±1% thirty 98.4±1% 98.2±1% 98.2±1% 98±1% 50 97.8±1% 97.5±1% 98±1% 97.4±1% 100 97.1±1% 96.9±2% 97±1% 96.6±2% 300 95.6±2% 95.6±2% 96.5±2% 95.7±3% 500 94.2±2% 94.3±2% 95.5±2% 94.8±3% 1000 93.8±2% 93.6±3% 94.5±2% 94±3%

[88] Table K shows the viability of melanoblasts after 7 days.

[89] Table K

Concentration (µM) P4 P4A P4B P4C 3 100% 100% 100% 100% 10 99±1% 99±1% 98.5±1% 99±1% thirty 98.3±1% 98.5±1% 97.8±3% 98.4±1% 50 98±1% 98±1% 97.2±2% 97.9±1% 100 97.3±1% 97±2% 96.3±2% 97±2% 300 95.2±2% 96.2±2% 95.6±2% 96±3% 500 94.6±2% 95.6±2% 94.6±2% 95.5±3% 1000 94±2% 94.8±2% 93.8±2% 94.8±3%

[90] Table L shows fibroblast viability after 7 days.

[91] Table L

Concentration (µM) P4 P4A P4B P4C 3 100% 100% 100% 100% 10 98.6±1% 98.9±1% 98.8±1% 98.9±1% thirty 98.2±1% 98.4±1% 98.3±1% 98.3±1% 50 97.8±1% 98±1% 97.6±1% 97.8±1% 100 97.2±1% 97.4±2% 97.3±2% 97.4±2% 300 95.6±2% 96.6±2% 96.5±2% 96.5±2% 500 94.5±2% 95.5±2% 95.3±3% 95.7±2% 1000 93.8±1% 94.3±2% 94.2±3% 94.9±3%

[92] At 100 microM, cell viability was maintained at over 97 percent for all three cell lines. At 1,000 micromolar, cell viability dropped by 6 percent compared to control.

[93] In conclusion, recent reports have detailed the pleiotropic role of sirtuins in suppressing premature aging, delaying cellular aging, extending lifespan, and alleviating a wide range of aging-related disorders. Herein, the inventors report their results on an effective sirtuin activator, decapeptide-12, and compare its effectiveness to the well-documented oxyresveratrol. Treatment of human epidermal progenitor cells with 100 micromolar decapeptide-12 increased SIRT1 transcription by 141 ± 11 percent compared to control cells, while levels of SIRT3, SIRT6 and SIRT7 increased by 121 ± 13 percent, 147 ± 8 percent, and 95.4 ± 14 percent respectively. Decapeptide-12 upregulated sirtuin transcription to levels similar to oxyresveratrol, but with reduced cytotoxicity. Thus, decapeptide-12 may hold promise as a safer therapeutic agent to counteract skin aging and other age-related pathologies.

[94] Although the above description mentions a typical decapeptide concentration of 100 micromolar or greater, indicating where the effect was evident, the results also demonstrate that lower concentrations had a beneficial effect. Thus, in some embodiments, a decapeptide concentration of 1 micromolar or greater can be used, and in certain embodiments, a peptide concentration range of 100 micromolar or greater can be used. Examples of peptide concentration ranges according to various embodiments are: 1 microM or more, 5 microM or more, 10 microM or more, 30 microM or more, 50 microM or more, 100 microM or more, 300 microM or more, 500 microM or more and 1000 micromoles or more.

[95] In addition, it should be noted that a particular decapeptide can be used in combination with other component(s) to achieve the desired effect. For example, a particular decapeptide can be used in combination with other peptides, such as decapeptides P4A, 4B and/or 4C, and/or other components, such as oxyresveratrol. In such embodiments, the synergistic effect achieved by the inclusion of other components may ultimately result in a reduction in the concentration of any individual component (eg, decapeptide, other component) necessary to achieve the desired result.

[96] While the above specifically includes decapeptides and oxyresveratrol as possible additional components, the embodiments are not limited thereto. Examples of other possible additives may include, but are not limited to, α-lipoic acid, biotin, caffeine, ceramides, coenzyme Q10, glycolic acid, green tea, human stem cells, human stem cell extracts, hyaluronic acid, hydroquinone, oil Jojoba, Kojic Acid, Lactic Acid, Malic Acid, Niacinamide, Oligopeptides, Peptides, Plant Stem Cells, Plant Stem Cell Extracts, Resveratrol, Retinol, Vitamin C, Vitamin E and Vitamin K.

[97] It should be noted that embodiments can be used to treat various types of skin cells. Examples of terminally differentiated skin cells may include, but are not limited to, keratinocytes, fibrocytes, melanocytes, and immune cells such as Langerhans cells (eg, histiocytes or dendrocytes), which also age over time.

[98] Embodiments may also be used to treat skin progenitor cells to reduce skin aging and promote skin renewal throughout life. Examples of such progenitor cells may include, but are not limited to, epidermal keratinocyte progenitors, fibroblasts, melanoblasts, histioblasts, or dendroblasts, which are the precursors of Langerhans cells that reside in the epidermis.

[99] Finally, although the treatment of human skin cells is described above, specific embodiments are not limited to such approaches. In alternative embodiments, treatment of skin cells from other organisms may be used, including, but not limited to, mammals such as cows (for example, in the production of tanned leather), pigs, and other animals (for example, dogs, cats, and other animals that can be evaluated based on skin appearance for competition purposes).

[100] Item 1A. A peptide consisting of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ. ID NO: 12.

[101] Paragraph 2A. The peptide of claim 1A, wherein said peptide consists of SEQ ID NO: 9 modified with a modifying group, said modifying group being either a palmitoyl group or an acetyl group at the amino terminus, or an amidation of the carboxy terminus, or both.

[102] Paragraph 3A. The peptide according to any one of claims 1A to 2A, consisting of SEQ ID NO: 11 containing the amino acid tyrosine at position 6 as a D isoform, and all other amino acids are L isoforms.

[103] Paragraph 4A. A composition comprising a first peptide consisting of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ. ID NO: 12.

[104] Paragraph 5A. The composition of claim 4A, wherein said peptide consists of SEQ ID NO: 9 modified with a modifying group, said modifying group being either a palmitoyl group or an acetyl group at the amino terminus, or an amidation of the carboxy terminus, or both.

[105] Paragraph 6A. The composition according to any one of claims 4A to 5A, consisting of SEQ ID NO: 11 containing the amino acid tyrosine at position 6 as a D isoform, and all other amino acids are L isoforms.

[106] Paragraph 7A. The composition according to any one of claims 4A to 6A, characterized in that said peptide is present in a concentration of 1 μm or more.

[107] Paragraph 8A. A method of treating a subject by modulating the expression of a sirtuin gene in a skin cell to reduce symptoms of skin aging, the method comprising administering to a subject in need thereof a composition containing an effective amount of one or more peptides, wherein said one or more peptides consist of SEQ ID NO: 9 , SEQ ID NO: 10, SEQ ID NO: 11 or SEQ. ID NO: 12.

[108] Paragraph 9A. The method of claim 8A, wherein said peptide consists of SEQ ID NO: 9 modified with a modifying group, said modifying group being either a palmitoyl group or an acetyl group at the amino terminus, or an amidation of the carboxy terminus, or both.

[109] Paragraph 10A. The method according to any one of claims 8A-9A, wherein said peptide consists of SEQ ID NO: 11 containing the amino acid tyrosine at position 6 as a D isoform, and all other amino acids are L isoforms.

[110] Item 11A. The method according to any one of claims 8A to 10A, characterized in that said skin cell is a progenitor cell.

[111] Item 12A. The method of claim 11A, wherein said progenitor cell is an epidermal keratinocyte progenitor cell, a melanoblast, a fibroblast, a histioblast or a dendroblast.

[112] Item 13A. The method according to any one of claims 8A to 10A, characterized in that said skin cell is terminally differentiated.

[113] Item 14A. The method according to claim 13A, characterized in that said skin cell is a keratinocyte, melanocyte, fibrocyte, histiocyte or dendrocyte.

[114] Paragraph 15A. The method according to any one of paragraphs 8A-14A, characterized in that the specified peptide is present in a concentration of 1 μm or more.

[115] Paragraph 16A. The method according to any one of paragraphs 8A-15A, characterized in that the sirtuin gene contains SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7.

[116] Paragraph 17A. The method according to any one of paragraphs 8A-16A, characterized in that said composition additionally contains oxyresveratrol.

[117] Paragraph 18A. The method according to any one of claims 8A to 17A, wherein said skin cell is a mammalian cell.

[118] Paragraph 19A. The method of claim 18A, wherein said skin cell is a human skin cell.

[119] Clause 20. A method of modulating sirtuin gene expression in a skin cell, the method comprising administering to a subject in need thereof a composition containing an effective amount of one or more peptides, wherein said one or more peptides consist of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ. ID NO: 12.

[120] Immunosuppressive effects of peptide formulations and/or oxyresveratrol have also been noted. In FIG. 3 shows the chemical structure of decapeptide P4 with SEQ ID NO: 9. FIG. Figure 4 shows the chemical structure of oxyresveratrol.

[121] In particular, decapeptide-12 (P4) with SEQ ID NO: 9 and oxyresveratrol showed anti-inflammatory effects measured in two different ways:

[122] 1) blockade of stimulated peripheral blood mononuclear cells (PBMCs) and

[123] 2) inhibition of natural killer (NK) cell-mediated cytotoxic killing.

[124] These results are detailed in the example below.

[125] EXAMPLE

[126] PBMC proliferation and NK cytotoxic killing assays

[127] Cryopreserved human PBMCs were purchased from Astarte Biologies (Redmond, WA, USA), activated with phytohemagglutinin (PHA), and assessed for proliferation. Interleukin (IL)-2-activated cytotoxic killing of human NK cells of K562 cells was assessed using the CytoTox96 Non-Radioactive Cytotoxicity Assay Kit (Promega). A protease inhibitor was added to the media to prevent degradation of decapeptide-12.

[128] Three independent trials were performed for each experiment. Microsoft Excel (Seattle, WA) was used to calculate means and standard errors, and statistical significance was determined using unpaired analysis of variance or two-tailed Student's T test. P-values <0.05 were considered statistically significant.

[129] The effects of decapeptide-12 and oxyresveratrol on PBMC proliferation rates after exposure to PHA for 72 hours were examined.

[130] In the graph of FIG. Figure 5 shows the immunosuppressive effect of decapeptide-12 (P4) on the proliferation of PHA-stimulated PBMCs. Data are expressed as percentages (%) relative to control and represent means ± SEM of 3 separate experiments. *P<0.05. E:T denotes the ratio of effector cells to target cells.

[131] In FIG. Figure 5 shows that decapeptide-12 statistically significantly (p<0.02) reduced proliferation by 28.0±3.8 percent at a concentration of 0.05 millimoles and by 54.3±1.1 at a concentration of 0.1 millimoles. At concentrations of 0.3 or 1 millimol, no further significant reduction was achieved (p>0.05).

[132] In the graph of FIG. Figure 6 shows the immunosuppressive effect of oxyresveratrol on the proliferation of PHA-stimulated PBMCs. Data are expressed as percentages (%) relative to control and represent means ± SEM of three separate experiments. *P<0.05. E:T denotes the ratio of effector cells to target cells.

[133] In FIG. Figure 6 shows that oxyresveratrol also reduced proliferation by 35.3 ± 1.8 percent (p < 0.02) at a concentration of 0.1 millimol and by 14.7 ± 3.4 percent at a concentration of 3 millimol (p < 0.02). ).

[134] The effect of decapeptide-12 on IL-2-primed NK-mediated cytotoxic killing of K562 cells was also assessed.

[135] In the graph of FIG. Figure 7 shows the immunosuppressive effect of decapeptide-12 (P4) on NK92-mediated cytotoxic killing of K562 cells. Data are expressed as percentages (%) relative to control and represent means ± SEM of 3 separate experiments. *P<0.05. E:T denotes the ratio of effector cells to target cells.

[136] In FIG. Figure 7 shows that decapeptide-12 reduced NK killing by 81.4 ± 1.3 percent and 59.3 ± 3.6 percent at a concentration of 0.1 and 0.3 millimoles, respectively (p>0.05) at the effector ratio cells and target cells (E:T) at a ratio of 10:1. At a 30:1 ratio, decapeptide-12 reduced NK killing by 64.8±5.3 percent and 44.8±3.2 percent at 0.1 and 0.3 millimol concentrations, respectively (p<0.04).

[137] In the graph of FIG. Figure 8 shows the immunosuppressive effect of oxyresveratrol on NK92-mediated cytotoxic killing of K562 cells. Data are expressed as percentages (%) relative to control and represent means ± SEM of three separate experiments. *P<0.05. E:T denotes the ratio of effector cells to target cells.

[138] In FIG. Figure 8 shows that oxyresveratrol reduced NK killing by 88.7 ± 1.8 percent and 86.1 ± 0.9 percent at 0.1 and 0.3 millimol concentrations, respectively (p < 0.03) at E:T ratio , making up 10:1. At a 30:1 ratio, hydroxyresveratrol blocked NK killing by 72.8±1.9 percent and 64.0±3.4 percent at 0.1 and 0.3 millimol concentrations, respectively (p<0.03).

[139] In summary, studies have shown that decapeptide-12 and oxyresveratrol have anti-inflammatory effects measured in two ways: 1) blockade of proliferation of PHA-stimulated PBMCs and 2) inhibition of NK-mediated cytotoxic killing.

[140] When a proliferation blockade was tested, the effect of decapeptide-12 was found to be dose-dependent. The effect of oxyresveratrol was evident in a limited range of inhibitory concentrations.

[141] In fact, the general trend has shown that oxyresveratrol may have a biphasic effect. This is because the 0.3 and 1 millimol concentrations showed progressively less inhibition than the 0.1 millimol concentration.

[142] Decapeptide-12 showed plateau or maximum inhibition at concentrations of 0.1 millimol or greater over the concentration range tested. This may be explained by dose-dependent differences in the activation of downstream signaling pathways or feedback loops. Indeed, careful examination of the dose-response curves of sirtuin expression profiles reveals biphasic effects in which higher concentrations become inhibitory.

[143] In contrast, the cessation of NK killing appeared to be dose-dependent for both decapeptide-12 and oxyresveratrol. Oxyresveratrol showed greater inhibition at all concentrations tested.

[144] The inhibitory effect was greater at an E:T ratio of 10:1 than at 30:1 for both decapeptide-12 and oxyresveratrol. This may be due to NKG2D blockade and perforin-mediated cytotoxicity.

[145] It should be noted that resveratrol (an analogue of oxyresveratrol) inhibits PHA-induced proliferation at a concentration of 0.1 millimol. This suppressive effect may be due to inhibition of NF-kappa B, which is also regulated by sirtuins and is associated with immune and inflammatory responses, as well as the regulation of cell proliferation and apoptosis, among other effects.

[146] Overall, the observed immunosuppressive effects suggest that unique and specific regulatory pathways are involved in different branches of the immune system. Future studies may clarify these pleiotropic effects.

[147] For example, assessing the effects of these two agents on proinflammatory mediators such as TNFα, IL-1β, IFNγ, and IL-6 may be informative. In addition, it may be informative to determine the translational and other transcriptional effects of activated PBMCs compared to quiescent PBMCs.

[148] Although the above description mentions a typical concentration of decapeptide in the range of about 0-1.0 millimoles, indicating where the effect was evident, other concentrations may demonstrate a beneficial effect. Thus, in some embodiments, a decapeptide concentration of 1.0 millimoles or greater may be used. Examples of peptide concentration ranges according to various embodiments are 0.025 mM, 0.05 mM, 0.1 mM, 0.2 mM, 0.3 mM, 0.4 mM, 0.5 mM, 0.6 mM, 0.7 millimoles, 0.8 millimoles, 0.9 millimoles and 1.0 millimoles or more.

[149] Although the description above mentions a typical concentration of oxyresveratrol in the range of approximately 0.1-1.0 millimoles, indicating where an effect was evident, other concentrations may demonstrate a beneficial effect. Thus, in some embodiments, a concentration of oxyresveratrol of 1.0 millimoles or greater may be used. Examples of oxyresveratrol concentration ranges according to various embodiments are 0.1 millimol, 0.2 millimol, 0.3 millimol, 0.4 millimol, 0.5 millimol, 0.6 millimol, 0.7 millimol, 0.8 millimol, 0 .9 millimoles and 1.0 millimoles or more.

[150] It should also be noted that a particular component (eg, decapeptide, oxyresveratrol) can be used in combination with other component(s) to achieve the desired effect. For example, a particular decapeptide can be used in combination with other peptides, such as decapeptides P4A, 4B and/or 4C, and/or other components, such as oxyresveratrol. In such embodiments, the synergistic effect achieved by the inclusion of other components may ultimately result in a reduction in the concentration of any individual component (eg, decapeptide, oxyresveratrol, other component) necessary to achieve the desired result.

[151] While the above specifically includes decapeptides and hydroxyresveratrol as possible additional components, embodiments are not limited thereto. Examples of other possible additives may include, but are not limited to, α-lipoic acid, biotin, caffeine, ceramides, coenzyme Q10, glycolic acid, green tea, human stem cells, human stem cell extracts, hyaluronic acid, hydroquinone, oil Jojoba, Kojic Acid, Lactic Acid, Malic Acid, Niacinamide, Oligopeptides, Peptides, Plant Stem Cells, Plant Stem Cell Extracts, Resveratrol, Retinol, Vitamin C, Vitamin E and Vitamin K.

[152] It should be noted that various embodiments can be used to immunosuppress different types of skin cells. Examples of terminally differentiated skin cells may include, but are not limited to, keratinocytes, fibrocytes, melanocytes, and immune cells such as Langerhans cells (eg, histiocytes or dendrocytes), which also age over time.

[153] Certain embodiments may also be used to treat skin progenitor cells to immunosuppress and reduce skin aging and promote skin renewal throughout life. Examples of such progenitor cells may include, but are not limited to, epidermal keratinocyte progenitor cells, fibroblasts, melanoblasts, histioblasts, or dendroblasts, which are the precursors of Langerhans cells that reside in the epidermis.

[154] Although the foregoing description focuses on treating human skin cells, specific embodiments are not limited to such approaches. In alternative embodiments, treatment of skin cells from other organisms may be used, including, but not limited to, mammals such as cows (for example, in the production of tanned leather from leather), pigs, and other animals (for example, dogs, cats, and other animals that may be judged based on skin appearance for competition purposes).

[155] Moreover, although the foregoing description focuses on treating skin cells, embodiments are not limited to this or any other cell type. In some embodiments, various types of mammalian and even non-mammalian cells can be treated.

[156] And, in some embodiments, the treatment may be administered orally to a mammalian subject. Alternatively, treatment may involve other forms of delivery, such as direct application or targeted topical application (eg, injection).

[157] Point 1B. A method of treating a subject by immunosuppressing a cell, the method comprising administering to a subject in need thereof a composition comprising an effective amount of one or more peptides, said one or more peptides comprising SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO : 11 or SEQ. ID NO: 12.

[158] Paragraph 2B. The method of claim 1B, wherein said peptide consists of SEQ ID NO: 9.

[159] Paragraph 3B. The method of claim 1B, wherein said peptide consists of SEQ ID NO: 9 modified with a modifying group, said modifying group being either a palmitoyl group or an acetyl group at the amino terminus, or an amidation of the carboxy terminus, or both.

[160] Paragraph 4B. The method of claim 1B, wherein said peptide consists of SEQ ID NO: 11 containing the amino acid tyrosine at position 6 as a D isoform, and all other amino acids are L isoforms.

[161] Paragraph 5B . The method of claim 1B, wherein said cell is a mammalian cell.

[162] Paragraph 6B. The method of claim 5B, wherein said mammalian cell is a skin cell.

[163] Paragraph 7B. The method of claim 6B, wherein said mammalian skin cell is a progenitor cell.

[164] Paragraph 8B. The method of claim 7B, wherein said progenitor cell is an epidermal keratinocyte progenitor cell, a melanoblast, a fibroblast, a histioblast, or a dendroblast.

[165] Paragraph 9B. The method according to any one of paragraphs 1B, 5B, 6B, 7B and 8B, characterized in that the administration is carried out orally.

[166] Item 10B. The method according to paragraph 1B, characterized in that the specified cell is terminally differentiated.

[167] Item 11B. The method of claim 10B, wherein said cell is a keratinocyte, melanocyte, fibrocyte, histiocyte or dendrocyte.

[168] Item 12B. The method of claim 1B, wherein said peptide is present at a concentration of about 1 millimole or less.

[169] Item 13B. The method according to paragraph 1B, characterized in that said composition additionally contains oxyresveratrol.

[170] Paragraph 14B. A method of treating a subject by immunosuppressing a cell, the method comprising administering to a subject in need thereof a composition containing an effective amount of oxyresveratrol.

[171] Paragraph 15B. The method of claim 14B, wherein the hydroxyresveratrol is present in a concentration in the range of about 0.1-1.0 millimoles.

[172] Paragraph 16B. The method of claim 14B, wherein said composition further comprises an effective amount of one or more peptides, wherein said one or more peptides comprise SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ. ID NO: 12.

[173] Paragraph 17B. The method of claim 16B, wherein said peptide consists of SEQ ID NO: 9.

[174] Paragraph 18B. The method of claim 16B, wherein said peptide is present at a concentration of about 1 millimole or less.

[175] Paragraph 19B. The method of claim 14B, wherein said cell is a mammalian cell.

[176] Paragraph 20B. The method of claim 19B, wherein said mammalian cell is a skin cell.

[177] Paragraph 21B. The method of claim 20B, wherein said mammalian skin cell is a progenitor cell.

[178] Paragraph 22B. The method of claim 21B, wherein said progenitor cell is an epidermal keratinocyte progenitor cell, a melanoblast, a fibroblast, a histioblast, or a dendroblast.

[179] Paragraph 23B. The method according to any one of paragraphs 14B, 19B, 20B, 21B and 22B, characterized in that the administration is oral.

[180] Paragraph 24B. The method according to paragraph 14B, characterized in that the specified cell is terminally differentiated.

[181] Paragraph 25B. The method of claim 24B, wherein said cell is a keratinocyte, melanocyte, fibrocyte, histiocyte or dendrocyte.

[182] The description of the present invention is presented for purposes of illustration and description. It is not intended to be exhaustive or limiting the present invention to the exact form described, and many modifications and variations are possible in light of the teachings set forth above. These embodiments have been selected and described to better explain the principles of the present invention and its practical application. The present description will enable one skilled in the art to best utilize and practice the present invention in various embodiments and with various modifications as suited to a particular application. The scope of the present invention is defined by the following claims.

--->

LIST OF SEQUENCES

<110> Escape Therapeutics, Inc.

<120> Tyrosine inhibitors with immunosuppressive activity in

human neonatal keratinocyte progenitor cells

<130>ELIXP005PC

<150>US 62/794,582

<151> 2019-01-19

<160> 12

<170> PatentIn, version 3.5

<210> 1

<211> 24

<212> DNA

<213> Homo sapiens

<400> 1

gccaatcata agatgttgct gaac 24

<210> 2

<211> 20

<212> DNA

<213> Homo sapiens

<400> 2

aacctccctc atctctaact 20

<210> 3

<211> 20

<212> DNA

<213> Homo sapiens

<400> 3

gttggttaca agatccagac 20

<210> 4

<211> 20

<212> DNA

<213> Homo sapiens

<400> 4

agagctgtga gagaatgaag 20

<210> 5

<211> 23

<212> DNA

<213> Homo sapiens

<400> 5

tcttccatac actttactac ctt 23

<210> 6

<211> 20

<212> DNA

<213> Homo sapiens

<400> 6

cagcttaaac aggagtgaac 20

<210> 7

<211> 20

<212> DNA

<213> Homo sapiens

<400> 7

gaccattttta gccatttgtc 20

<210> 8

<211> 24

<212> DNA

<213> Homo sapiens

<400> 8

cggaggttcg aagacgatca gata 24

<210> 9

<211> 10

<212> Protein

<213> Homo sapiens

<400> 9

Tyr Arg Ser Arg Lys Tyr Ser Ser Trp Tyr

1 5 10

<210> 10

<211> 10

<212> Protein

<213> Homo sapiens

<220>

<221> MOD_RES

<222> (1)..(1)

<223> N-terminal palmitoyl

<220>

<221> AMIDIATION

<222> (10)..(10)

<400> 10

Tyr Arg Ser Arg Lys Tyr Ser Ser Trp Tyr

1 5 10

<210> 11

<211> 10

<212> Protein

<213> Homo sapiens

<220>

<221> MOD_RES

<222> (1)..(1)

<223> N-terminal palmitoyl

<220>

<221> SITE

<222> (6)..(6)

<223> D-isoform

<220>

<221> MOD_RES

<222> (10)..(10)

<223> AMIDIATION

<400> 11

Tyr Arg Ser Arg Lys Tyr Ser Ser Trp Tyr

1 5 10

<210> 12

<211> 10

<212> Protein

<213> Homo sapiens

<220>

<221> MOD_RES

<222> (1)..(1)

<223> ACETYLATION

<220>

<221> MOD_RES

<222> (10)..(10)

<223> AMIDIATION

<400> 12

Tyr Arg Ser Arg Lys Tyr Ser Ser Trp Tyr

1 5 10

<---

Claims (20)

1. A method of reducing inflammation in a subject by immunosuppressing a cell, the method comprising administering to a subject in need thereof a composition containing an effective amount of one or more peptides, wherein said one or more peptides comprise SEQ ID NO: 9, SEQ ID NO: 10 , SEQ ID NO: 11 or SEQ ID NO: 12. 2. The method according to claim 1, characterized in that said peptide consists of SEQ ID NO: 9. 3. The method according to claim 1, characterized in that said cell is a mammalian cell. 4. The method according to claim 3, characterized in that said mammalian cell is a skin cell. 5. The method according to claim 4, characterized in that said mammalian skin cell is a progenitor cell. 6. The method of claim 5, wherein said progenitor cell is an epidermal keratinocyte progenitor cell, a melanoblast, a fibroblast, a histioblast or a dendroblast. 7. Method according to any one of paragraphs. 1-6, characterized in that the administration is carried out orally. 8. The method according to claim 1, characterized in that said cell is terminally differentiated. 9. The method according to claim 8, characterized in that said cell is a keratinocyte, melanocyte, fibrocyte, histiocyte or dendrocyte. 10. The method of claim 1, wherein said peptide is present in a concentration of approximately 1 millimole or less. 11. The method according to claim 1, characterized in that said composition additionally contains hydroxyresveratrol. 12. A method of reducing inflammation in a subject by immunosuppressing a cell, the method comprising administering to a subject in need thereof a composition containing an effective amount of oxyresveratrol. 13. The method of claim 12, wherein the oxyresveratrol is present in a concentration of from about 0.1 millimol to about 1.0 millimol. 14. The method of claim 12, wherein said composition further comprises an effective amount of one or more peptides, wherein said one or more peptides comprise SEQ ID NO: 9. 15. The method according to claim 12, characterized in that said cell is a mammalian cell. 16. The method of claim 15, wherein said mammalian cell is a skin cell. 17. The method of claim 16, wherein said mammalian skin cell is a progenitor cell. 18. The method of claim 17, wherein said progenitor cell is an epidermal keratinocyte progenitor cell, melanoblast, fibroblast, histioblast or dendroblast. 19. Method according to any one of paragraphs. 12 or 15-18, characterized in that the administration is carried out orally. 20. The method according to claim 15, characterized in that said cell is a terminally differentiated keratinocyte, melanocyte, fibrocyte, histiocyte or dendrocyte.