RU2806030C2 - Compounds suitable for therapy against hiv - Google Patents

Abstract

FIELD: organic chemistry; pharmaceuticals.

SUBSTANCE: group of inventions is aimed at providing a compound with activity against HIV. The following is disclosed: a compound having the structure set forth below, or a pharmaceutically acceptable salt thereof. Besides, pharmaceutical compositions based on the specified compound or a pharmaceutically acceptable salt thereof are disclosed.

EFFECT: group of inventions provides effective suppression of HIV infection.

8 cl, 1 dwg, 4 tbl, 63 ex

Description

CROSS REFERENCE TO RELATED APPLICATIONS

This application claims benefit from U.S. Provisional Patent Application Serial No. 62/773,563, filed November 30, 2018, the contents of which are incorporated herein by reference in their entirety.

FIELD OF TECHNOLOGY TO WHICH THE INVENTION RELATES

The present invention relates to compounds, pharmaceutical compositions and methods of their use in connection with individuals infected with HIV, HBV or cancer.

LIST OF SEQUENCES

This application contains sequences listed in an electronic sequence listing entitled PR66692_Seq_List, 2 KB in size, generated using Patent-In 3.5 on November 12, 2010, the contents and sequences of which are incorporated herein by reference.

BACKGROUND OF THE ART

Infection with human immunodeficiency virus type 1 (HIV-1) leads to the disease acquired immunodeficiency syndrome (AIDS). The number of HIV cases continues to rise, and currently the number of individuals suffering from HIV infection in the world is estimated at thirty-five million, see for example http://www.sciencedirect.com/science/article/pii/S235230181630087X? via%3Dihub

Currently, long-term suppression of viral replication with antiretroviral drugs is the only treatment option for HIV-1 infection. Indeed, the US Food and Drug Administration (FDA) has approved twenty-five drugs across six different classes of inhibitors that have been shown to significantly improve patient survival and quality of life. However, there is still a need for additional therapeutic agents due to a number of problems, including unwanted drug-drug interactions; interactions between drugs and food; non-compliance with therapy; drug resistance due to mutations in the target enzyme and inflammation associated with immunological damage caused by HIV infection, but not limited to these.

Currently, during Lent, all HIV-positive patients receive regimens that include combinations of antiretroviral drugs called highly active antiretroviral therapy ("HAART" or "HAART"). However, HAART treatment options can be complex due to the need to administer a combination of different drugs to the patient, often daily, in order to avoid the rapid emergence of drug-resistant variants of HIV-1. Despite the positive impact of HAART on patient survival, drug resistance can still occur, and survival and quality of life are not normalized compared to uninfected people [Lohse Ann Intern Med 2007 146; 87-95]. Indeed, the incidence of some non-AIDS-related morbidity and mortality, such as cardiovascular disease, frailty, and neurocognitive impairment, is increased in HIV-infected subjects receiving HAART for viral suppression [Deeks Annu Rev Med 2011; 62:141-155]. This increased incidence of non-AIDS-related morbidity/mortality occurs in the context of increased systemic inflammation associated with immunological damage caused by HIV infection and residual HIV infection[Nip1 J Infect Dis 2014][Byakagwa J Infect Dis 2014][Tenorio J Infect Dis 2014].

Current antiretroviral therapy (APT) can effectively suppress HIV replication and improve the health outcomes of HIV-infected individuals, but it is not thought to be able to completely eliminate reservoirs of the HIV virus in an individual. HIV genomes can remain latent mainly in the immune cells of the infected individual and can be reactivated at any time, so that after APT is interrupted, viral replication usually resumes within a few weeks. In a small number of people, the size of this viral reservoir was significantly reduced, and after stopping APT, the resumption of viral replication was slowed [Henrich TJ J Infect Dis 2013][Henrich TJ Ann Intern Med 2014]. In one case, the viral reservoir was eliminated during treatment for leukemia, and no replication of the virus was observed over several years of observation [Hutter G N Engl J Med 2009]. These examples indicate that reduction or elimination of the viral reservoir is possible and may lead to virological remission or cure. Accordingly, methods are being developed to eliminate the viral reservoir using direct molecular means, including cutting the viral genome with CRISPR/Cas9 systems, or inducing reactivation of the latent reservoir during APT, which would eliminate latent cells. Reversal of latency is thought to be necessary to make latently infected cells available for clearance.

SMACm (second mitochondrial activator of caspases) mimetics are a class of compounds that have recently entered clinical trials as potential cancer treatments. These drugs deplete and/or inhibit cellular inhibitor of apoptosis proteins (cIAPs), which act as anti-apoptotic proteins, thereby promoting cancer cell death. Antagonism and/or depletion of cIAP also leads to activation of the non-canonical NF-κB signaling pathway, which can induce HIV expression and may promote clearance of HIV-infected cells. Additionally, SMAC mimetics can selectively stimulate the death of cells infected with HIV [Campbell Cell Host Microbe 2018] or HBV (hepatitis B virus) [Ebert Proc Nat Acad Sci 2013] by antagonizing anti-apoptotic proteins.

Recently, information has emerged about targeting the non-canonical NF-κB (ncNF-κB) pathway to reverse latency in cell line models. The ncNF-κB pathway is typically activated by ligation of a subset of members of the TNF (tumor necrosis factor) receptor family. In the steady state, a multimolecular complex with ubiquitin ligase activity, consisting of TNF receptor-associated factor 2 (TRAF2), TRAF3 and cellular inhibitor of apoptosis proteins 1 (cIAP1), associates with the cytoplasmic part of the unligated receptor and constitutively ubiquitinylates and degrades NF-κB-inducing kinase (NIK). Following receptor ligation, cIAP1 ubiquitinylates TRAF3 and autoubiquitinylates, leading to proteasomal degradation of TRAF3 and cIAP1 and, accordingly, relieving inhibition of NIK accumulation. NEK. It is constitutively active and, after accumulation, phosphorylates the inhibitor of κB kinase α (IKKα) homodimer.

The activated IKKα/IKKα homodimer then phosphorylates the inactive p100 form of NFκB2, leading to ubiquitinylation by the Skp1-Cull-F-box ubiquitin ligase (SCFβTrCP) and proteasomal degradation of p100, which releases the active p52 subunit. p52 associates with RelB, and this heterodimer translocates to the nucleus, where it directs transcription from the κB promoter elements. In addition to receptor ligation, ncNF-κB can be activated by signaling intermediates of the apoptotic cascade. Cleavage of the second mitochondrial activator of caspases (SMAC) from the mitochondrial membrane exposes the N-terminal Ala-Val-Pro-Ile motif, which specifically binds to the intermediate baculovirus repeat (BLR) domains of LAP proteins. This binding of BLR to cIAP1/2 activates the ubiquitin ligase activity of the TRAF2:TRAF3:cIAP complex, causing autoubiquitinylation and degradation of cIAP1/2, accumulation of NIK, and activation of the ncNF-κB pathway. SMAC binding to the BLR domains of XIAP and ML-IAP antagonizes the caspase inhibitory activity of these molecules, often overexpressed in tumor cells, resulting in increased apoptosis. Thus, the Ala-Val-Pro-Ile SMAC motif has received considerable attention in oncology, leading to the discovery of a class of peptide mimetics with SMAC-like activity called SMAC mimetics (SMACm). SMACm potently activates the ncNF-κB pathway and does not induce apoptosis in non-tumor cells and, accordingly, is of interest for reversing HIV latency. See, for example, Richard Dunham et.al., The SMAC Mimetic AZD5582 is a Potent HIV Latency Reversing Agent, bioRxiv, May. 2, 2018; doi: http://dx.doi.org/10.1101/312447.

US Patent No. 7,960,372 relates to divalent diazobicyclic SMAC mimetics that inhibit LAP activity.

BRIEF DESCRIPTION OF THE INVENTION

In one aspect of the present invention there is provided a compound of the structure corresponding to Formula (I):

or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:

R, R', R'' and R''' are independently selected from H and CH ₃ ;

X ₁ and X ₂ are independently selected from the group consisting of O and S; And

L is a linker selected from the group consisting of:

Where:

Ar ₁ , Ar ₂ , Ar ₃ , Ar ₄ , Ar ₅ , Ar ₆ , Ar ₇ , Ar ₈ , Ar ₉ , Ar ₁₀ , Ar ₁₁ , Ar 12, Ar ₁₃ , Ar ₁₄ , Ar ₁₅ , Ar _{16 ,} Ar ₁₇ , Ar ₁₈ , Ar ₁₉ , Ar ₂₁ , Ar ₂₂ , Ar ₂₃ , Ar ₂₄ , Ar ₂₅ and Ar ₂₆ are each independently selected from (C ₆ -C ₁₄ )aryl;

Alk, Alk ₂ and Alk ₃ are each independently selected from:

R ₁ represents a C ₃ -C ₆ cycloalkyl or a C ₁ -C ₆ heterocycle;

R ₂ is selected from the group consisting of -(CH ₂ ) _a -, -(CH ₂ ) _b -O-(CH ₂ ) _c -, -(CH ₂ ) _d -(C ₆ -C ₁₄ )aryl-(CH ₂ ) _e - and -(CH ₂ ) _f -(C ₁ -C ₆ )heteroaryl-(CH ₂ ) _g -;

R ₃ is selected from the group consisting of -(CH ₂ ) _h -; -(CH ₂ ) _i -O-(CH ₂ ) _j , -(CH ₂ ) _k -(C ₆ -C ₁₄ )aryl-(CH ₂ ) ₁ - and -(CH ₂ ) _m -(C ₁ -C ₆ )heteroaryl-(CH ₂ ) _m'' -;

R ₄ represents C ₃ -C ₆ cycloalkyl, (C ₆ -C ₁₄ )aryl or (CH ₂ ) _n' -(C ₆ -C ₁₄ )aryl -(CH ₂ ) _n'' , (CH ₂ ) _n''' -Alk-(CH ₂ ) _n'''' , where n', n'', n''' and n'''' are independently selected from 1 to 8

R ₅ represents C ₃ -C ₆ cycloalkyl;

R ₆ is selected from the group consisting of (CH ₂ ) _z ,

And

a, b, c, d, e, f, g, h, i, j, k, l, m, m', m'', n, p, q, r, s, t, u, v, x , y and z are each independently selected from 1 to 12.

In another aspect, the present invention relates to a compound of Formula (Ia):

or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:

R, R', R'' and R''' are independently selected from H and CH ₃ ;

X ₁ and X ₂ are independently selected from the group consisting of O and S; And

L is a linker selected from the group consisting of:

Where:

Ar ₁ , Ar ₂ , Ar ₃ , Ar ₄ , Ar ₅ , Ar ₆ , Ar ₇ , Ar ₈ , Ar ₉ , Ar ₁₀ , Ar ₁₁ , Ar 12, Ar ₁₃ , Ar ₁₄ , Ar ₁₅ , Ar _{16 ,} Ar ₁₇ , Ar ₁₈ , Ar ₁₉ , Ar ₂₁ , Ar ₂₂ , Ar ₂₃ , Ar ₂₄ , Ar ₂₅ and Ar ₂₆ are each independently selected from (C ₆ -C ₁₄ )aryl;

Alk, Alk ₂ and Alk ₃ are each independently selected from:

R ₁ represents a C ₃ -C ₆ cycloalkyl or a C ₁ -C ₆ heterocycle;

R ₂ is selected from the group consisting of -(CH ₂ ) _a -, -(CH ₂ ) _b -O-(CH ₂ ) _c -, -(CH ₂ ) _d -(C ₆ -C ₁₄ )aryl-(CH ₂ ) _e - and -(CH ₂ ) _f -(C ₁ -C ₆ )heteroaryl-(CH ₂ ) _g -;

R ₃ is selected from the group consisting of -(CH ₂ ) _h -; -(CH ₂ ) _i -O-(CH ₂ ) _j -, -(CH ₂ ) _k -(C ₆ -C ₁₄ )aryl-(CH ₂ ) _l - and -(CH ₂ ) _m' -(C ₁ -C ₆ )heteroaryl-(CH ₂ ) _m'' -;

R ₄ represents C ₃ -C ₆ cycloalkyl, (C ₆ -C ₁₄ )aryl or (CH ₂ ) _n' -(C ₆ -C ₁₄ )aryl-(CH ₂ ) _n'' , (CH ₂ ) _n''' -Alk-(CH ₂ ) _n'''' , where n', n'', n''' and n'''' are independently selected from 1 to 8

R ₅ represents C ₃ -C ₆ cycloalkyl;

R ₆ is selected from the group consisting of (CH ₂ ) _z ,

And

a, b, c, d, e, f, r, h, i, j, k, 1, m, m', m'', n, p, q, r, s, t, u, v, x , y and z are each independently selected from 1 to 12.

In another aspect, the present invention relates to a compound of Formula (Ib):

or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:

R, R', R'' and R'' are independently selected from H and CH ₃ ;

X ₁ and X ₂ are independently selected from the group consisting of O and S; And

L is a linker selected from the group consisting of:

Where:

Ar ₁ , Ar ₂ , Ar ₃ , Ar ₄ , Ar ₅ , Ar ₆ , Ar ₇ , Ar ₈ , Ar ₉ , Ar ₁₀ , Ar ₁₁ , Ar 12, Ar ₁₃ , Ar ₁₄ , Ar ₁₅ , Ar _{16 ,} Ar ₁₇ , Ar ₁₈ , Ar ₁₉ , Ar ₂₁ , Ar ₂₂ , Ar ₂₃ , Ar ₂₄ , Ar ₂₅ and Ar ₂₆ are each independently selected from (C ₆ -C ₁₄ )aryl;

Alk, Alk ₂ and A1k ₃ are each independently selected from:

R ₁ represents a C ₃ -C ₆ cycloalkyl or a C ₁ -C ₆ heterocycle;

R ₂ is selected from the group consisting of -(CH ₂ ) _a -, -(CH ₂ ) _b -O-(CH ₂ ) _c -, -(CH ₂ ) _d -(C ₆ -C ₁₄ )aryl-(CH ₂ ) _c - and -(CH ₂ ) _f -(C ₁ -C ₆ )heteroaryl-(CH ₂ ) _g -;

R ₃ is selected from the group consisting of -(CH ₂ ) _h -; -(CH ₂ ) _i -O-(CH ₂ ) _j -, -(CH ₂ ) _k -(C ₆ -C ₁₄ )aryl-(CH ₂ ) _l - and -(CH ₂ ) _m' -(C ₁ -C ₆ )heteroaryl-(CH ₂ ) _m'' -;

R ₄ represents C ₃ -C ₆ cycloalkyl, (C ₆ -C ₁₄ )aryl or (CH ₂ ) _n' -(C ₆ -C ₁₄ )aryl -(CH ₂ ) _n'' , (CH ₂ ) _n''' -Alk-(CH ₂ ) _n'''' , where n', n'', n''' and n'''' are independently selected from 1 to 8

R ₅ represents C ₃ -C ₆ cycloalkyl;

R ₆ is selected from the group consisting of (CH ₂ ) _z ,

And

a, b, c, d, e, f, g, h, i, j, k, l, m, m', m'', n, p, q, r, s, t, u, v, x , y and z are each independently selected from 1 to 12.

In another aspect, the present invention relates to the compound represented by Formula (II):

Where

R, R', R'' and R''' are independently selected from H and CH ₃ ;

X ₁ and X ₂ are independently selected from the group consisting of O and S; And

L' is a linker of the formula:

Where:

Ar ₂₇ and Ar ₂₈ are each independently selected from C ₆ -C ₁₄ aryl,

R ₇ is selected from the group consisting of

C ₆ aryl and -(CH ₂ ) _4-15 -; And

a' and b' are independently selected from 0 to 6.

In another aspect, the present invention relates to the compound represented by Formula (III):

Where

R, R', R'' and R''' are independently selected from H and CH ₃ ;

X ₁ and X ₂ are independently selected from the group consisting of O and S; And

L'' represents a linker of the formula:

where Ar ₂₉ and Ar ₃₀ are independently selected from C ₆ -C ₁₀ aryl, and R ₈ is selected from the group consisting of:

-(CH ₂ ) _6-15 -, - and -(CH ₂ ) _d' -(C ₆ -C ₁₀ )aryl-(CH ₂ ) _e' -; where d' and e' are chosen independently and range from 1 to 6.

In another aspect of the present invention, there is provided a pharmaceutical composition containing a compound corresponding to Formula (I), (Ia), (Ib), (II), (III), or thereof. In another aspect of the present invention, there is provided a method of treating or curing HIV infection in a subject comprising administering to said subject a compound of Formula (I), (Ia), (Ib), (II), (III) or a pharmaceutically acceptable salt thereof.

In another aspect of the present invention, there is provided a method of depleting HIV-infected HIV cells, comprising administering to a subject a compound of Formula (I), (Ia), (Ib), (II), (III) or a pharmaceutically acceptable salt thereof.

Another aspect of the present invention provides depletion of HIV-infected HIV cells, comprising administering to a subject a compound of Formula (I), (Ia), (Ib), (II), (III) or a pharmaceutically acceptable salt thereof and one or more additional agents having activity against HIV. In some aspects, these agents having anti-HIV activity are selected from the group consisting of antiretroviral agents, latency reversal agents, and clearance therapy agents.

These and other aspects are within the scope of the invention described herein.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is a graph comparing the pharmacokinetic (PK) data of several Formula I compounds with the PK data of SMACm AZD5582.

DETAILED DESCRIPTION

The object of the present invention will be described in more detail below. However, one skilled in the art to which the subject matter of the present invention relates will be able to imagine many modifications and other embodiments of the subject matter of the present invention set forth herein based on the ideas presented in the preceding descriptions. Accordingly, it is to be understood that the subject matter of the present invention is not limited to the specific embodiments disclosed, and that modifications and other embodiments are intended to be included within the scope of the appended claims. In other words, the subject matter described herein covers all alternatives, modifications and equivalents. To the extent that one or more of the included literature, patents and similar materials differ from or conflict with this application, including, but not limited to, certain terms, usage of terms, methods described, etc., this application controls. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one skilled in the art. All publications, patent applications, patents and other sources mentioned herein are incorporated by reference in their entirety.

Apoptosis, a type of programmed cell death, plays an important role in maintaining homeostasis and regulating cell number in higher organisms. Abnormal apoptosis has been implicated in a number of diseases, including autoimmune disorders, degenerative diseases of the central nervous system, cancer, and viral infections such as HIV. The inhibitor of apoptosis protein (IAP) family plays a key role in suppressing proaposignaling in mammalian cells. SMACm, which mimics a critical tetrapeptide sequence from the second mitochondrial caspase activator, has been shown to disrupt the binding of LAP to its functional partner and restore the apoptotic response to proapoptotic stimuli in cells. Since the early 2000s, much effort has been focused on the development and production of SMAC mimetics as IAP antagonists, particularly to promote tumor cell death and, more recently, to reverse HIV latency. Such studies have examined activation of the non-canonical NF-κB (ncNF-κB) pathway as a potential mechanism by which SMAC selectively mimics the exhaustion of latent HIV cells. An example of an early SMAC mimetic is monomeric SBI-0637142, obtained by researchers at the Sanford-Burnham Institute for Medical Research. In HIV depletion studies, SBI-0637142 was found to be potent in cell line assays but was not active in p100-p52 conversion or induction of HIV caRNA in primary cells. Much work has also been done to develop divalent mimetics that are covalently linked to momomeric SMAC mimetics. AstraZeneca's AZD5582 and Medivir's birinapant TL32711 are examples of dimeric SMAC mimetics. In HIV latency modification studies, birinapant TL32711 had no activity against Jurkat, p100-p52 conversion, or HIV caRNA induction. In contrast, AZD5582 demonstrated an increase in cell-associated HIV RNA expression in resting CD4+ T cells in Jurkat assays, p100-p52 conversion studies, and HIV and caRNA induction (Sampey et al. BioRxiv 312447). However, AZD5582 may also exhibit tolerability issues.

Disclosed herein are dimeric SMACm that are considered to be sufficiently potent and effective enough to activate ncNF-kB, reverse HIV latency in primary unmodified human cells as monotherapy agents, and may have less off-target toxicity compared to other dimeric SMACm such as AZD5582, making them suitable for consideration for further development. In particular, the dimeric SMACm of the invention is capable of inducing HIV RNA expression in unstimulated, resting primary CD4+ T cells from HIV-infected donors, in which viremia is completely suppressed by standard therapy. Other SMACm, namely monomeric molecules or dimeric molecules with non-optimized linkers, are not thought to have this effect in these cells, the primary latent reservoir of persistent infection. Moreover, the dimeric SMACm of the invention is capable of clinically measurable latency changes in two animal models (SIV-infected, antiretroviral-suppressed rhesus monkeys and APT-suppressed HIV-infected humanized mice), as evidenced by intermittent plasma viremia that temporarily occurs despite successful ongoing antiviral therapy.

It should be understood that the terminology used herein is intended solely for the purpose of describing specific embodiments and is not intended to limit the scope of the present invention. In this specification and in the following claims, a number of terms will be referred to which are defined to have the following meanings.

As used herein, unless otherwise noted, “alkyl” refers to a monovalent saturated aliphatic carbyl group containing 1 to 14 carbon atoms and, in some embodiments, 1 to 8 carbon atoms or 1 to 6 carbon atoms. "(Cx-Cy)alkyl" refers to alkyl groups containing x to y carbon atoms. The term "alkyl" includes, by way of example, linear or branched hydrocarbyl groups such as methyl (CH ₃ ), ethyl (CH ₃ CH ₂ ), n-propyl (CH ₃ CH ₂ CH ₂ ), isopropyl ((CH ₃ ) ₂ CH), n-butyl (CH ₃ CH ₂ CH ₂ CH ₂ ), isobutyl ((CH ₃ ) ₂ CHCH ₂ ), sec-butyl ((CH ₃ )(CH ₃ CH ₂ )CH), tert-butyl ( (CH ₃ ) ₃ C), n-pentyl (CH ₃ CH ₂ CH ₂ CH ₂ CH ₂ ) and neopentyl ((CH ₃ ) ₃ CCH ₂ ). It should be noted that references to, for example, (C ₁ -C ₁₂ ) alkyl also cover ranges within this group, for example, (C ₁ -C ₆ ) alkyl.

"Alkylene" or "alkylene" refers to divalent saturated aliphatic hydrocarbyl groups containing from 1 to 10 carbon atoms and, in some embodiments, from 1 to 6 carbon atoms. "(CuCv)alkylene" refers to alkylene groups containing from u to v carbon atoms. Alkenylene groups include branched and straight chain hydrocarbyl groups. For example, "(C ₁ -C ₆ )alkylene" is meant to include methylene, ethylene, propylene, 2-methylpropylene, dimethylethylene, pentylene, etc. Accordingly, the following structure can be given as an example of the term "propylene": . Likewise, the term "dimethylbutylene" can be illustrated by any of the following three or more structures: , p or . The term "(C ₁ -C ₆ )alkylene" is further intended to include branched hydrocarbyl groups such as cyclopropylmethylene, which may be illustrated by the following structure: .

"Alkynyl" or "alkyne" refers to a linear monovalent hydrocarbon radical or a branched monovalent hydrocarbon radical containing at least one triple bond. The term "alkynyl" is also intended to include hydrocarbyl groups containing one triple bond and one double bond. For example, (C ₂ -C ₆ ) alkynyl is meant to include ethynyl, propynyl and the like.

"Aryl" refers to an aromatic group of 6 to 14 carbon atoms with no heteroatoms in the ring, containing a single ring (eg, phenyl) or multiple fused (conjugated) rings (eg, naphthyl or anthryl). In the case of a multi-ring system, including conjugated, bridged and spiro ring systems, containing aromatic and non-aromatic rings that do not contain heteroatoms in the ring, the term "Aryl" or "Ar" is used when the point of attachment is on an aromatic carbon atom (e.g. , 5,6,7,8 tetrahydronaphthalene-2-yl is an aryl group because its point of attachment is at position 2 of the aromatic phenyl ring). In one embodiment, a preferred bicyclic aryl system may be represented by the formula:

where the size of the ring fused with the _C6 aryl group ranges from 4 to 8.

For purposes of clarity, other attachment points are included within the term "Aryl" or "Ar", for example, attachment points on a non-aromatic carbon atom.

“Cycloalkyl” refers to a saturated or partially saturated cyclic group of 3 to 14 carbon atoms and no heteroatoms, and having a single ring or multiple rings, including conjugated, bridged and spiro ring systems. In the case of a multi-ring system containing aromatic and non-aromatic rings and no heteroatoms on the ring, the term "cycloalkyl" is used when the point of attachment is on a non-aromatic carbon atom (for example, 5,6,7,8,-tetrahydronaphthalene-5-yl) . The term "cycloalkyl" includes cycloalkenyl groups such as cyclohexenyl.

Examples of cycloalkyl groups include, for example, adamantyl, cyclopropyl, cyclobutyl, cyclohexyl, cyclopentyl, cyclooctyl, cyclopentenyl and cyclohexenyl. Examples of cycloalkyl groups that include bicycloalkyl multi-ring systems include bicyclohexyl, bicyclopentyl, bicyclooctyl and the like. Two such multi-ring bicycloalkyl systems are exemplified below; Their names are also given: bicyclohexyl and bicyclohexyl.

"(C _u -C _v )cycloalkyl" refers to a cycloalkyl group containing from u to v carbon atoms.

"Spiro-cycloalkyl" refers to a 3- to 10-membered cyclic substituent formed by replacing two hydrogen atoms on a common carbon atom in a cyclic ring structure or in an alkylene group containing from 2 to 9 carbon atoms, as exemplified by the following structure in which the group shown here attached to the bonds indicated by wavy lines is replaced by a spiro-cycloalkyl group:

"Conjugated cycloalkyl" refers to a 3-10 membered substituent formed by replacing two hydrogen atoms at different carbon atoms in the cycloalkyl ring structure; An example is the following structure, in which the cycloalkyl group shown here contains bonds, indicated by wavy lines, that are attached to carbon atoms that are replaced by a fused cycloalkyl group:

"AUC" refers to the area under the plasma drug concentration (not the logarithm of the concentration) plotted against time after drug administration.

"EC ₅₀ " refers to the drug concentration that produces half the maximum response. It is sometimes also converted to the pEC ₅₀ scale (-log IC ₅₀ ), whereby higher values indicate exponentially greater efficiency.

"IC ₅₀ " refers to the half-maximal inhibitory concentration of the drug. It is sometimes also converted to a pIC ₅₀ scale (-log IC ₅₀ ), whereby higher values indicate exponentially greater efficiency.

"Heteroaryl" refers to an aromatic group of, for example, and unless otherwise indicated, 1 to 14 carbon atoms (preferably 1 to 12 carbon atoms, and more preferably 2 to 12 carbon atoms) and 1 to 6 heteroatoms (more preferably 1 to 3 heteroatoms) selected from oxygen, nitrogen and sulfur, which includes single ring (eg imidazolyl) and multiple ring systems (eg benzimidazol-2-yl and benzimidazol-6-yl). In the case of a multi-ring system, including conjugated, bridged and spiro ring systems, the term "heteroaryl" is used if at least one hyteroatom is present in the ring and the point of attachment is on the aromatic ring atom (e.g., 1,2,3, 4-tetrahydroquinolin-6-yl t 5,6,7,8-tetrahydroquinolin-3-yl). In some embodiments, the nitrogen and/or sulfur atom(s) of the ring of the heteroaryl group are optionally oxidized to form N-oxide (N→O), sulfinyl, or sulfonyl moieties. The prefix indicating the number of carbon atoms (for example, C _x -C _y ) refers to the total number of carbon atoms in the heteroaryl part, without regard to the number of heteroatoms. This group also includes all ranges between x and y, for example, C ₁ -C ₁₄ includes C ₂ -C ₁₄ , C ₂ -C ₉ , etc. More specifically, the term “heteroiraril” includes, without restrictions on the listed: pyridil, furanel, thyenil, thiazolil, isotiazolil, triazolil, imidazolil, imidasoline, Izoxazolil, pyrrolil, pyrazolil, pyridazinyl, pyrimidinyl, pourisil, naphthylpylpydil, testeridal Gidrobenzofuranil, invented , benzothiazolyl, benzisothiazolyl, benzotriazolyl, indolyl, isoindolyl, indolizinyl, dihydroindolyl, indazolyl, indolinyl, benzoxazolyl, quinolyl, isoquinolyl, quinolysyl, quinazolyl, quinoxalyl, tetrahydroquinolinyl, isoquinolyl, quinazolinonyl, benzimidazolyl, benziso xazolyl, benzothienyl, benzopyridazinyl, pteridinyl, carbazolyl, carbolinyl , phenanthridinyl, acridinyl, phenanthrolinyl, phenazinyl, phenoxazinyl, phenothiazinyl, phthalimidyl and tetrazole. In one embodiment, for example, a (C ₃ -C ₉ ) heteroaryl spiro-ring fused ring system is provided, more preferably a (C ₄ -C ₆ ) heteroaryl.

"Heterocyclic" or "heterocycle" or "heterocycloalkyl" or "heterocyclyl" refers to a saturated or partially saturated group containing, for example, and unless otherwise specified, from 1 to 14 carbon atoms (preferably from 1 to 12 carbon atoms carbon and more preferably from 2 to 12 carbon atoms) and from 1 to 6 heteroatoms (more preferably from 1 to 3 heteroatoms) selected from nitrogen, sulfur, phosphorus or oxygen, and includes single ring or multiple ring systems, including fused , bridged and spiro-ring systems. For multi-ring systems containing aromatic and/or non-aromatic rings, the terms "heterocyclic", "heterocycle", "heterocycloalkyl" or "heterocyclyl" are used when at least a heteroatom is present on the ring and the point of attachment is on the atom non-aromatic ring (for example, 1,2,3,4-tetrahydroquinolinyl-3-yl, 5,6,7,8-tetrahydroquinolinyl-6-yl and decahydroquinolin-6-yl). In one embodiment, the phosphorus and/or sulfur nitrogen atom(s) of the heterocyclic group are optionally oxidized to form an N-oxide, phosphamine oxide, sulfinyl, sulfonyl moiety. More specifically, heterocyclyl includes, but is not limited to: tetrahydropyranyl, piperidinyl, piperazinyl, 3-pyrrolidinyl, 2-pyrrolidon-1-yl, morpholinyl and pyrrolidinyl. The prefix indicating the number of carbon atoms (for example, C _x -C _y ) refers to the total number of carbon atoms in the heteroaryl part, without regard to the number of heteroatoms. This group also includes all ranges between x and y, for example, C ₁ -C ₁₄ includes C ₂ -C ₁₄ , C ₂ -C ₉ , etc.

In one embodiment, for example, a (C ₃ -C ₉ ) heterocyclic fused spiro ring system is present, more preferably a (C ₄ -C ₆ ) heterocycle.

Examples of heterocyclic and heteroaryl include, but are not limited to: azetidine, pyrrole, imidazole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, pyridone, indolysine, isoindole, indole, dihydroindole, indazole, purine, quinolysine, isoquinoline, quinolinyl, phthalazine, naphthylpyridine, quinoxaline, quinazoline, cinnoline, pteridine, carbazole, carboline, phenanthridine, acridine, phenanthroline, isothiazole, phenazine, isoxazole, phenoxazine, phenothiazine, imidazolidine, imidazoline, piperidine, piperazine, indoline, phthalimide, 1,2,3,4 tetrahydroisoquinoline, 4 ,5,6,7 tetrahydrobenzo[b]thiophene, thiazole, thiazolidine, thiophene, benzo[b]thiophene, morpholine, thiomorpholine (also called thiamorpholine), piperidine, pyrrolidine and tetrahydrofuranyl.

In addition to the above embodiments set forth herein, "fused heterocyclic" or "fused heterocycle" refers to a 3-9 membered (preferably 4-6 membered) cyclic substituent formed by replacing two hydrogen atoms at different carbon atoms in cycloalkyl ring, as illustrated by the following structure, in which the cycloalkyl group shown here contains bonds, shown by wavy lines, that are connected to carbon atoms that are replaced by a fused heterocyclic group:

One embodiment of the spiro ring system (eg, without limitation, formed from R ² and R ³ ) in formula (I), (Ia), (Ib), (II) or (III) includes, without limitation:

,

where A may be selected from, for example, C(O), O, N, B, B(OH), SI or P, P(OR).

"Compound", "compounds", "chemical compound" and "chemical compounds" as used herein refers to a compound covered by the general formulas disclosed herein, any subgenera of that general formula, and any forms of the compound within the general formula and subcategories of the general formula formulas, including racemates, stereoisomers and tautomers of such compound or compounds.

The term "heteroatom" means nitrogen, oxygen or sulfur and includes any oxidized forms of nitrogen, such as N(O) {N ⁺ -O ^- }, and sulfur, such as S(O) and S(O) ₂ , and quaternized forms of any basic nitrogen.

"Linker" ("L") refers to a substance (eg, a molecule) that links two parts of a molecule.

"Polymorphism" refers to the situation where two or more clearly distinct phenotypes exist in a single population of species, giving rise to the existence of more than one form or morph. To be considered as such, morphs must occupy one habitat at one time and belong to a panmictic population (with free interbreeding).

“Protein binding” refers to the binding of a drug to proteins in blood plasma, tissue membranes, red blood cells and other blood components.

“Protein shift” refers to the determination of binding shift by comparing EC ₅₀ values determined in the absence and presence of human serum.

The term "racemates" refers to a mixture of enantiomers. In one embodiment of the invention, the compounds of Formula I, Ia, Ib, II and III, or pharmaceutically acceptable salts thereof, are enantiomerically enriched in a single enantiomer in which all of said chiral carbon atoms are in the same configuration. Generally, reference to an enantiomerically enriched compound or salt means that said enantiomer constitutes more than 50% by weight of the total weight of all enantiomers of said compound or salt.

"Solvate" or "solvates" of a compound refer to compounds as defined above that are associated with a stoichiometric or non-stoichiometric amount of solvent. Compound solvates includes solvates of all forms of the compound. In some embodiments, the solvents are volatile, non-toxic, and/or acceptable for human administration in trace amounts. Suitable solvates include water.

"Stereoisomer" or "stereoisomers" refer to compounds that differ in the chirality of one or more stereocenters. Stereoisomers include enantiomers and diastereomers, including the compounds of Formula (I), (Ia), (Ib), (II) and (III) linkers (L) of Formulas (I) to (xiii) described herein, as well as the linkers described in formulas (II) and (III).

"Tautomer" refers to interchangeable forms of a compound that differ in the position of the proton, such as keto-enol and imine/enmine tautomers, or tautomeric forms of gataroaryl groups in which one of the ring atoms is attached to both the NH ring moiety and the =N moiety rings such as pyrazoles, imidazoles, benzimidazoles, triazoles and tetrazoles.

The term "atropisomer" refers to the stereoisomer generated by the axis of asymmetry. This may occur due to hindered rotation around a single bond in cases where the rotation barrier is high enough to permit differentiation of isomeric variants up to and including complete isolation of a stable, non-interconvertible, diastereomeric or enantiomeric variant. It is clear to a specialist that when an asymmetric R ^x is introduced into the nucleus, the formation of atropisomers becomes possible. In addition, when a chiral center is introduced into a molecule comprising an atropisomer, the two chiral elements together can form diastereomeric and enantiomeric stereochemical variants. Depending on the substitution around the C ^x axis, interconversions of atropisomers may or may not be possible, and may depend on temperature. In some cases, atropisomers may undergo rapid interconversions at room temperature and not separate under normal conditions. Other situations may allow separation and separation, but interconversion may occur over a period of seconds to hours or even days or months, such that the optical purity decreases measurably with time. For other molecules, interconversion at ambient and/or elevated temperatures may be inhibited to the point of impossibility, allowing separation and isolation and yielding stable variant molecules. In known cases, helical nomenclature is used to name atropisomers. For such designations, only the two ligands with the highest priority, in front of the axis and behind it, are taken into account. If the priority direction of rotation from the front ligand 1 to the back ligand corresponds to a clockwise movement, this configuration is called P, and if it is a counterclockwise movement, then M.

"Pharmaceutically acceptable salt" refers to pharmaceutically acceptable salts formed by various organic and inorganic counterions well known in the art, including, by way of example only, sodium, potassium, calcium, magnesium, ammonium and tetraalkylammonium, and in cases where the molecule contains basic functional group, salts of organic or inorganic acids such as hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate and oxalate. Suitable salts include those described in P. Heinrich Stahl, Camille G. Wermuth (Eds.), Handbook of Pharmaceutical Salts Properties, Selection, and Use; 2002.

"Patient" or "subject" refers to mammals and includes humans and non-human mammals.

“Treatment” or “the process of treating” a disease in a patient refers to 1) preventing a disease in a patient who is susceptible to or who is not yet exhibiting symptoms of the disease; 2) suppressing the disease or blocking its development; or 3) alleviation or reversal of disease.

As stated above, “treating” a disorder involves preventing the disorder. One skilled in the art will understand that "prevention" is not an absolute term. In medicine, "prevention" refers to the prophylactic administration of a drug to significantly reduce the likelihood or severity of a disorder or its biological manifestation, or to delay the onset of such a disorder or its biological manifestation.

As used herein, the terms “intermittently” or “intermittently” mean stopping and starting at regular or irregular intervals. As used herein, the term "viral infection" describes a disease state in which a virus invades healthy cells, uses the cell's reproductive apparatus to multiply or replicate, and ultimately lyses the cell, resulting in cell death, release of viral particles, and infection of other cells. newly formed daughter viruses. A possible result of a viral infection may also be latent infection with some viruses.

As used herein, the term “treating viral infections” means inhibiting the replication of a particular virus, inhibiting the transmission of a virus, and alleviating or ameliorating the symptoms of a disease caused by a viral infection. A treatment is considered “therapeutic” if there is a reduction in viral load, mortality and/or morbidity. “Preventing viral infections” means preventing the virus from establishing itself in the host. Treatment is considered "prophylactic" if the subject is exposed to the virus but does not become infected with the virus as a result of the treatment.

As used herein, the term “latency” means a concept that describes 1) a state of quiescence of viral activity in a population of cells in which virus production, virus packaging, and host cell lysis do not occur or occur at a very low frequency, or 2) down-regulation or absence of expression gene in an infected cell.

As used herein, “reversal of latent HIV infection” refers to a treatment that up-regulates the expression of integrated HIV genomes in latently infected cells, for example, as an agent that activates the non-canonical NF-κB pathway, which renders the cells susceptible to virus-induced cell death or immunological clearance As used herein, “exhaustion of latent HIV infection” refers to the clearance of latently HIV-infected cells that may follow reversal of HIV latency by reagents such as those that activate the non-canonical NF-kB pathway.

In some embodiments, the latent HIV-infected cells are resting CD4 ⁺ T cells.

In cases where dashed lines occur adjacent to single bonds indicated by solid lines, the dashed line represents an optional double bond at that position. Likewise, where dotted circles occur in ring structures indicated by solid lines or solid circles, the dotted circles represent one to three optional double bonds, arranged according to their correct valency, taking into account whether there are any in the ring. or optional substitutions around the ring, as known to one skilled in the art. For example, the dotted line in the structure below could indicate either a double bond at a given position or a single bond at a given position:

Where specific compounds or general formulas containing aromatic rings, such as aryl or heteroaryl rings, are depicted, one skilled in the art will appreciate that the particular aromatic position of any double bonds is a combination of equivalent positions, even if they are depicted in different positions for different compounds. or for different formulas. For example, in the two pyridine rings shown below (A and B), the double bonds are shown in different positions, yet they are known to represent the same structure and the same compound:

The present invention includes the compounds as well as their pharmaceutically acceptable salts. Accordingly, the word “or” in the context of “a compound or a pharmaceutically acceptable salt thereof” should be understood to refer to one of the following: 1) the compound alone or the compound and its pharmaceutically acceptable salt(s), or 2) the compound and its pharmaceutically acceptable salt(s) salt (in combination).

Unless otherwise indicated, the names of substituents that are not explicitly defined herein are formed by giving the name of the terminal portion of the functional group followed by the adjacent functional group in the direction of the point of attachment. For example, the substituent "arylalkyloxycarbonyl" refers to the group (aryl)(alkyl)OC(O). Terms such as "-C(R ^x ) ₂ " imply that two R ^x groups may be the same, or they may be different if R ^x is defined as having more than one possible form. Additionally, some substituents are depicted as -R ^x R ^y , where "-" denotes a bond adjacent to the parent molecule and R ^y represents the terminal portion of the functional group. Likewise, it is understood that the above definitions do not include unacceptable substitution options (eg, methyl substituted with 5 fluorine-containing groups). Such unacceptable substitution options are well known to those skilled in the art.

The present invention provides compounds of Formulas (I), (Ia), (Ib), (II) and (III), and various forms of these compounds (eg, pharmaceutically acceptable salts) are described herein. It should be understood that any reference to compounds of Formulas (I), (Ia), (Ib), (II) and (III) herein is intended to also expressly include, without limitation, the compounds presented in Table 1.

In one aspect of the present invention there is provided a compound of the structure corresponding to Formula (I):

or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:

R, R', R'' and R''' are independently selected from H and CH ₃ ;

X ₁ and X ₂ are independently selected from the group consisting of O and S; And

L is a linker selected from the group consisting of:

Where:

Ar ₁ , Ar ₂ , Ar ₃ , Ar ₄ , Ar ₅ , Ar ₆ , Ar ₇ , Ar ₈ , Ar ₉ , Ar ₁₀ , Ar ₁₁ , Ar 12, Ar ₁₃ , Ar ₁₄ , Ar ₁₅ , Ar _{16 ,} Ar ₁₇ , Ar ₁₈ , Ar ₁₉ , Ar ₂₁ , Ar ₂₂ , Ar ₂₃ , Ar ₂₄ , Ar ₂₅ and Ar ₂₆ are each independently selected from (C ₆ -C ₁₄ )aryl;

Alk, Alk ₂ and Alk ₃ are each independently selected from:

R ₁ represents a C ₃ -C ₆ cycloalkyl or a C ₁ -C ₆ heterocycle;

R ₂ is selected from the group consisting of -(CH ₂ ) _a -, -(CH ₂ ) _b -O-(CH ₂ ) _c -, -(CH ₂ ) _d -(C ₆ -C ₁₄ )aryl-(CH ₂ ) _e - and -(CH ₂ ) _f -(C ₁ -C ₆ )heteroaryl-(CH ₂ ) _g -; more preferably is C ₂ heteroaryl

R ₃ is selected from the group consisting of -(CH ₂ ) _h -; -(CH ₂ ) _i -O-(CH ₂ ) _j -, -(CH ₂ ) _k -(C ₆ -C ₁₄ )aryl-(CH ₂ ) _l - and -(CH ₂ ) _m' -(C ₁ -C ₆ )heteroaryl-(CH ₂ ) _m'' -;

R ₄ represents C ₃ -C ₆ cycloalkyl, (C ₆ -C ₁₄ )aryl or (CH ₂ ) _n' -(C ₆ -C ₁₄ )aryl-(CH ₂ ) _n'' , (CH ₂ ) _n''' -Alk-(CH ₂ ) _n'''' , where n', n'', n''' and n'''' are independently selected from 1 to 8

R ₅ represents C ₃ -C ₆ cycloalkyl;

R ₆ is selected from the group consisting of (CH ₂ ) _z ,

And

a, b, c, d, e, f, g, h, i, j, k, l, m, m', m'', n, p, q, r, s, t, u, v, x , y and z are each independently selected from 1 to 12.

In another aspect, the present invention relates to a compound of Formula (Ia):

or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:

R, R', R'' and R''' are independently selected from H and CH ₃ ;

X ₁ and X ₂ are independently selected from the group consisting of O and S; And

L is a linker selected from the group consisting of:

Where:

Ar ₁ , Ar ₂ , Ar ₃ , Ar ₄ , Ar ₅ , Ar ₆ , Ar ₇ , Ar ₈ , Ar ₉ , Ar ₁₀ , Ar ₁₁ , Ar 12, Ar ₁₃ , Ar ₁₄ , Ar ₁₅ , Ar _{16 ,} Ar ₁₇ , Ar ₁₈ , Ar ₁₉ , Ar ₂₁ , Ar ₂₂ , Ar ₂₃ , Ar ₂₄ , Ar ₂₅ and Ar ₂₆ are each independently selected from (C ₆ -C ₁₄ )aryl;

Alk, Alk ₂ and Alk ₃ are each independently selected from:

R ₁ represents a C ₃ -C ₆ cycloalkyl or a C ₁ -C ₆ heterocycle;

R ₂ is selected from the group consisting of -(CH ₂ ) _a -, -(CH ₂ ) _b -O-(CH ₂ ) _c -, -(CH ₂ ) _d -(C ₆ -C ₁₄ )aryl-(CH ₂ ) _c - and -(CH ₂ ) _f -(C ₁ -C ₆ )heteroaryl-(CH ₂ ) _g -;

R ₃ is selected from the group consisting of -(CH ₂ ) _h -; -(CH ₂ ) _i -O-(CH ₂ ) _j -, -(CH ₂ ) _k -(C ₆ -C ₁₄ )aryl-(CH ₂ ) _l - and -(CH ₂ ) _m' -(C ₁ -C ₆ )heteroaryl-(CH ₂ ) _m'' -;

R ₄ represents C ₃ -C ₆ cycloalkyl, (C ₆ -C ₁₄ )aryl or (CH ₂ ) _n' -(C ₆ -C ₁₄ )aryl -(CH ₂ ) _n'', (CH ₂ ) _n''' -Alk-(CH ₂ ) _n'''' , where n', n'', n''' and n'''' are independently selected from 1 to 8

R ₅ represents C ₃ -C ₆ cycloalkyl;

R ₆ is selected from the group consisting of (CH ₂ ) _z ,

And

a, b, c, d, e, f, g, h, i, j, k, l, m, m', m'', n, p, q, r, s, t, u, v, x , y and z are each independently selected from 1 to 12.

In another aspect, the present invention relates to a compound of Formula (Ib):

or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:

R, R', R'' and R''' are independently selected from H and CH ₃ ;

X ₁ and X ₂ are independently selected from the group consisting of O and S; And

L is a linker selected from the group consisting of:

Where:

Ar ₁ , Ar ₂ , Ar ₃ , Ar ₄ , Ar ₅ , Ar ₆ , Ar ₇ , Ar ₈ , Ar ₉ , Ar ₁₀ , Ar ₁₁ , Ar 12, Ar ₁₃ , Ar ₁₄ , Ar ₁₅ , Ar _{16 ,} Ar ₁₇ , Ar ₁₈ , Ar ₁₉ , Ar ₂₁ , Ar ₂₂ , Ar ₂₃ , Ar ₂₄ , Ar ₂₅ and Ar ₂₆ are each independently selected from (C ₆ -C ₁₄ )aryl;

Alk, Alk ₂ and Alk ₃ are each independently selected from:

R ₁ represents a C ₃ -C ₆ cycloalkyl or a C ₁ -C ₆ heterocycle;

R ₂ is selected from the group consisting of -(CH ₂ ) _a -, -(CH ₂ )bO-(CH ₂ ) _c -, -(CH ₂ ) _d -(C ₆ -C ₁₄ )aryl-(CH ₂ ) _e - and -(CH ₂ ) _f -(C ₁ -C ₆ )heteroaryl-(CH ₂ ) _g -;

R ₃ is selected from the group consisting of -(CH ₂ ) _h -; -(CH ₂ ) _i -O-(CH ₂ ) _j -, -(CH ₂ ) _k -(C ₆ -C ₁₄ )aryl-(CH ₂ ) _l - and -(CH ₂ ) _m' -(C ₁ -C ₆ )heteroaryl-(CH ₂ ) _m'' -;

R ₄ represents C ₃ -C ₆ cycloalkyl, (C ₆ -C ₁₄ )aryl or (CH ₂ ) _n' -(C ₆ -C ₁₄ )aryl -(CH ₂ ) _n'' , (CH ₂ ) _n''' -Alk-(CH ₂ ) _n'''' , where n', n'', n''' and n'''' are independently selected from 1 to 8

R ₅ represents C ₃ -C ₆ cycloalkyl;

R ₆ is selected from the group consisting of (CH ₂ ) _z ,

And

a, b, c, d, e, f, g, h, i, j, k, l, m, m', m'', n, p, q, r, s, t, u, v, x , y and z are each independently selected from 1 to 12.

In various embodiments, and in addition to the above, each of the variables a, b, c, d, e, f, g, h, i, j, k, l, m, m', m'', n, p , q, r, s, t, u, v, x, y and z for Formulas (I), (Ia), (Ib), (II) and (III) can be selected from 1 to 8

In various embodiments, at least one of R'' and R''' is CH ₃ . Preferably, both R'' and R' are each CH ₃ .

Most preferably, R, R', R'' and R''' are each CH ₃ .

In various embodiments, X ₁ and X ₂ are both O.

In various embodiments, X ₁ and X ₂ are both S.

In various embodiments, X ₁ is O and X ₂ is S.

In various embodiments, Xi is S and X ₂ is O.

In various embodiments, Alk, Alk ₂ and Alk ₃ are each preferably:

In various embodiments, each of Ar ₁ , Ar ₂ , Ar ₃ , Ar ₄ , Ar ₅ , Ar ₆ , Ar ₇ , Ar ₈ , Ar 9, Ar ₁₀ , Ar ₁₁ , Ar ₂₁ , Ar ₂₂ , Ar ₂₃ , _{Ar 24} , Ar ₂₅ and Ar ₂₆ may be C ₆ aryl.

In various embodiments, Ar ₁₂ , Ar ₁₃ , Ar ₁₄ , Ar _{15 ,} Ar ₁₆ , Ar ₁₇ , Ar ₁₈ and Ar ₁₉ may each be C ₉ aryl. In preferred embodiments, C ₉ aryl is represented by the formula

where the nitrogen in NH is joined by an amide bond to the bicyclic compound system(s), and R denotes attachment to a linker.

In various embodiments, Ar ₁₆ , Ar ₁₇ , Ar ₁₈ and Ar ₁₉ are each _{C 10} aryl. In preferred embodiments, C ₁₀ aryl is represented by the formula

where the nitrogen in NH is connected by an amide bond to the bicyclic system(s) of the compound and R denotes attachment to a linker.

In various embodiments, the linker has formula (i):

Ar ₁ and Ar ₂ may each be independently selected from C ₆ -C ₉ aryl

Preferably, in formula (i), Ar ₁ represents C ₆ aryl. Alk represents:

Ar ₂ is C ₆ aryl, m is 1, n is 1, p is 1, and q is 1. In one embodiment, X ₁ is S, and X ₂ is S. In one embodiment X ₁ represents S, and X ₂ represents O.

In various embodiments, the linker is formula (ii):

Each of Ar ₃ , Ar ₂ and Ar ₅ may be independently selected from C ₆ -C ₉ aryl. Preferably, in formula (ii), Ar ₃ is C ₆ aryl, Ar ₄ is C ₆ aryl, r is 1, Ar ₄ is C ₆ aryl, s is 1, and Ar ₅ is C ₆ aryl. In one embodiment, X ₁ is O and X ₂ is O. In one embodiment, X ₁ is S and X ₂ is S.

In various embodiments, the linker has formula (iii):

where Ar ₆ and Ar ₇ are each independently C ₆ -C ₉ aryl, most preferably each is C ₆ aryl;

where R ₁ preferably represents a C ₁ -C ₆ heterocycle (for example, a C ₄ heterocycle), most preferably:

In various embodiments, the linker has formula (iv):

Preferably in formula (iv), Ar ₈ is C _6-9 aryl, more preferably C ₆ aryl, and Alk ₂ is:

and Ar ₉ is C ₆ aryl; C _6-9 aryl, more preferably C ₆ aryl. In various embodiments, the linker has formula (v):

Preferably in formula (v), Ar ₁₀ is C _6-9 aryl, more preferably C ₆ aryl, Ar ₁₁ is preferably C _6-9 aryl, more preferably C ₆ aryl, and R ₂ is selected from -(CH ₂ ) -C _6-9 aryl-(CH ₂ )-, (more preferably -(CH ₂ )-C ₆ aryl-(CH ₂ )-), -(CH ₂ ) _1-8 - (more preferably -(CH ₂ ) ₄ -, -(CH ₂ ) ₃ -, or -(CH ₂ ) ₆ -) and -(CH ₂ ) _2-6 -O-(CH ₂ ) _2-6 - (more preferably -(CH ₂ ) _{2 -4} -O-(CH ₂ ) _2-4 ). In one embodiment, R ₂ is -(CH ₂ ) ₂ -O-(CH ₂ ) ₂ -. If R ₂ represents heteroaryl, it is preferably C ₂ heteroaryl.

In various embodiments, the linker has formula (vi):

Preferably in formula (vi), Ar ₁₂ is C _6-9 aryl, t is 1-4 (more preferably t is 1), Alk ₃ is:

and is 1-4 (more preferably, and is 1), and Ar ₁₃ is C _6-9 aryl. Most preferably Ar ₁₂ and Ar ₁₃

each is _C9 aryl, and most preferably, _C9 aryl is represented by the following formula:

where the nitrogen in NH is joined by an amide bond to the bicyclic compound system(s), and R denotes attachment to a linker.

In various embodiments, the linker has formula (vii):

Preferably, in formula (vii), Ar ₁₄ is C _6-9 aryl (more preferably C ₉ aryl), R ₃ selected from the group consisting of (CH ₂ ) ₁ - ₁₂ (for example, (CH ₂ ) ₄ - ₆ ); -(CH ₂ ) ₁ - ₆ -O-(CH ₂ ) ₁ - ₆ - (for example, -(CH ₂ ) ₂ - ₄ -O-(CH ₂ ) ₂ - ₄ -), and Ar ₁₅ is C ₉ aryl. More preferably, in formula (vii), Ar ₁₄ is C ₉ aryl, R ₃ is selected from the group consisting of -(CH ₂ ) _4-12 -, -(CH ₂ ) _2-4 -O-(CH ₂ ) _{2 -4} -,

In preferred embodiments of Ar ₁₄ and Ar ₁₅ , each C ₉ is the following aryl:

where the nitrogen in NH is connected by an amide bond to the bicyclic system(s) of the compound and R denotes attachment to a linker.

In various embodiments, the linker has formula (viii):

Preferably, Ar ₁₆ is C _6-10 aryl, more preferably C ₉ aryl or C ₁₀ aryl, R ₄ is selected from the group consisting of C ₃ -C ₆ cycloalkyl or (C ₆ -C ₁₄ )aryl and Ar ₁₇ is is _C6-10 aryl, more preferably _C9 aryl or _C10 aryl. More preferably, R ₄ is C ₆ cycloalkyl, C ₆ aryl, -CH ₂ -C ₆ aryl-CH ₂ or

In various embodiments, the linker has formula (ix):

Preferably, Ar ₁₈ is C _6-10 aryl, more preferably C ₉ aryl or C ₁₀ aryl, and Ar ₁₉ is C _6-10 aryl, more preferably C ₉ aryl or C ₁₀ aryl.

In various embodiments, the linker has the formula (x):

Preferably, A ₂₁ and A ₂₂ are independently selected from C _6-9 aryl, and v is in the range from 1 to 6. More preferably, in one embodiment, Ar ₂₁ is C ₆ aryl, v is 1, and Ar ₂₂ is C ₆ aryl. More preferably, in one embodiment, Ar ₂₁ is C ₆ aryl, v is 2, and Ar ₂₂ is C ₆ aryl.

In various embodiments, the linker has formula (xi):

Preferably, Ar ₂₃ is C _6-9 aryl, more preferably C ₆ aryl, R ₅ is C ₃ -C ₆ cycloalkyl, and Ar24 is preferably C _6-9 aryl, more preferably C ₆ aryl. Most preferably, R ₅ is C ₆ cycloalkyl.

Another aspect of the present invention provides a compound of Formula (II):

Where

R, R', R'' and R''' are independently selected from H and CH ₃ ;

X ₁ and X ₂ are independently selected from the group consisting of O and S; And

L' is a linker of the formula:

Where:

Ar ₂₇ and Ar ₂₈ are each independently selected from C ₆ -C ₁₄ aryl,

R ₇ is selected from the group consisting of

, C ₆ aryl and -(CH ₂ ) _4-15 - (more preferably -(CH ₂ ) _6-10 -); And

a' and b' are independently selected from 0 to 6.

In various embodiments, R, R', R'', and R''' are each CH ₃ .

In various embodiments, X ₁ and X ₂ are each O;

In various embodiments, Ar ₂₇ and Ar ₂₈ are each selected from C ₆ -C ₁₀ aryl, and more preferably, each is C ₉ aryl. In various embodiments, C ₉ aryl may be represented by the formula

where the nitrogen in NH is joined by an amide bond to the bicyclic compound system(s), and R denotes attachment to a linker. Most preferably, C ₉ aryl has the formula:

In one embodiment, R, R', R'' and R''' are each CH ₃ , X ₁ and X ₂ are each O;

a' is 1, b' is 1, R ₇ is:

Ar ₂₇ and Ar ₂₈ each have the formula:

In one embodiment of the present invention, a compound of Formula (II) is provided, with the proviso that if R, R', R'' and R''' are each CH ₃ , X ₁ and X ₂ are each O, Ar ₂₇ and Ar ₂₈ each has the formula:

and a' is 1 and b' is 1, R ₇ is not:

In various embodiments, a compound of formula (II) is provided wherein a' is 0, b' is 0, and R ₇ is -(CH ₂ ) _6-15 -, (more preferably -(CH ₂ ) _6-10 -), R, R', R'' and R''' are each CH ₃ , X ₁ and X ₂ are each O, and Ar ₂₇ and Ar ₂₈ are each C ₉ aryl. Preferably, C ₉ aryl is represented by the formula

where the nitrogen in NH is joined by an amide bond to the bicyclic compound system(s), and R denotes attachment to a linker. Most preferably, C ₉ aryl has the formula:

In one embodiment of the present invention there is provided a compound of Formula (II) wherein a' is 0, b' is 0, R ₇ is -(CH ₂ ) ₆ -, R, R', R'' and R''' each is CH ₃ , X ₁ and X ₂ are each O, and Ar ₂₇ and Ar ₂₈ are each C ₉ aryl represented by the formula:

where the nitrogen in NH is joined by an amide bond to the bicyclic compound system(s), and R denotes attachment to a linker.

In one aspect of the present invention, a compound of Formula (II) is provided, with the proviso that if R, R', R'' and R''' are each CH ₃ , X ₁ and X ₂ are each O, Ar ₂₇ and Ar ₂₈ each has the formula:

and a' is 0, b' is 0, R ₇ is not -(CH ₂ ) ₆ -:

In another aspect of the present invention there is provided a compound of the structure corresponding to formula (III):

Where

R, R', R'' and R''' are independently selected from H and CH ₃ ;

X ₁ and X ₂ are independently selected from the group consisting of O and S; And

L'' represents a linker of the formula:

where Ar ₂₉ and Ar ₃₀ are independently selected from C ₆ -C ₁₀ aryl, and R ₈ is selected from the group consisting of:

, -(CH ₂ ) _6-15 -, - and -(CH ₂ ) _d' -(C ₆ -C ₁₀ )aryl-(CH ₂ ) _e' -; where d' and e' are chosen independently and range from 1 to 6.

In one embodiment of the compounds of Formula (III), R, R', R'' and R''' are each CH ₃ ; X ₁ and X ₂ each represent O, Ar ₂₉ and Ar ₃₀ each represent C ₆ aryl, and R ₈ represents:

In one embodiment of the compounds of Formula (III), R, R', R'' and R''' are each CH ₃ ; X ₁ and X ₂ each represent O, Ar ₂₉ and Ar ₃₀ each represent C ₆ aryl, and R ₈ represents -(CH ₂ ) ^, -(C ₆ )aryl-(CH ₂ ) ^, -.

In one embodiment of the compounds of Formula (III), R, R', R'' and R''' are each CH ₃ ; X ₁ and X ₂ are each O, Ar ₂₉ and Ar ₃₀ are each C ₆ aryl, and R ₈ is -(CH ₂ ) ₆ -.

In formulas (II) and (III) described above, any of the aryl may be optionally substituted with any of the following substituents, without limitation: (C ₁ -C ₆ )alkyl, (C ₁ -C ₆ )alkoxy, halo, oxo, haloalkyl, bihaloalkyl, trihaloalkyl, haloalkoxy, bihaloalkoxy, trihaloalkoxy, hydroxyl, amino and amide. Additionally, any of the aryl groups in formulas (I), (Ia) and (Ib) may also be substituted with those described above.

Examples of compounds covered by the present invention include, but are not limited to, those listed in Table 1 below:

In one aspect, the present invention relates to a compound selected from the group consisting of:

;

and their pharmaceutically acceptable salts.

In one aspect of the present invention there is provided a compound selected from the group consisting of:

and their pharmaceutically acceptable salts.

Pharmaceutically acceptable salts are also included within the scope of the present invention for all compounds 1-63 described herein. Most preferably, each of compounds 1-63 may be present as a hydrochloride (ie, an HCl salt), such as, more specifically, a dihydrochloride (2 HCl). Also included within the scope of the present invention are all compounds 1-63 presented as individual molecules, including their pharmaceutically acceptable salts, as well as any of these compounds in free base form.

Specific examples of linkers (L) that can be used in accordance with the present invention include linkers selected from the group consisting of:

According to one embodiment of the present invention, there is provided a pharmaceutical composition comprising a compound of Formula (I), (Ia), (Ib), (II) or (III) or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient. In another embodiment, the compound is in amorphous form. In another embodiment, the pharmaceutical composition is presented in the form of a tablet. In another embodiment, the compound is presented in the form of a spray-dried dispersion. In another embodiment, the composition is in the form of nanoparticles, for example, particles ranging in size from 1 to 100 nanometers.

In accordance with one embodiment of the present invention, there is provided a method of treating HIV infection in a subject, comprising administering to said subject a compound of Formula (I), (Ia), (Ib), (II) or (III) or a pharmaceutically acceptable salt thereof. In accordance with one embodiment of the present invention, there is provided a method of treating HIV infection in a subject, comprising administering to said subject a pharmaceutical as described herein. Further, the compounds of the present invention, as well as the linkers (L), may exist in specific geometric or stereoisomeric forms. The invention provides for all such compounds, including cis- and trans-isomers, (-)- and (+)-enantiomers, (R)- and (S)-enantiomers, diastereomers, (D)-isomers, (L)-isomers, racemic mixtures thereof and other mixtures thereof, such as enantiomerically or diastereomerically enriched mixtures, which are also included within the scope of the present invention. Additional asymmetric carbon atoms may be present on substituents such as alkyl groups. All such isomers, as well as mixtures thereof, are intended to be included in the present invention. The optically active (R)- and (S)-isomers, and the d and l isomers, can be prepared using chiral synthons and chiral reagents or separated using conventional techniques. If, for example, it is desired to obtain a particular enantiomer of a compound of the present invention, it can be prepared by asymmetric synthesis or by derivatization with a chiral auxiliary group, wherein the resulting mixture of diastereomers is separated and the auxiliary group is cleaved away to yield the pure desired enantiomers. Alternatively, in cases where the molecule contains a basic functional group, such as an amino group, or an acidic functional group, such as a carboxyl group, diastereomeric salts can be formed with a suitable optically active acid or base, followed by fractional separation of the diastereomers thus formed. crystallization or using chromatographic means known in the art, and subsequent isolation of pure enantiomers. Additionally, separation of enantiomers and diastereomers is often accomplished using chromatography using chiral stationary phases, optionally in combination with chemical derivatization (eg, formation of carbamates from amines).

In another embodiment, the present invention provides a compound of Formula I, Ia, Ib, II or III, or a pharmaceutically acceptable salt thereof, for use in medical therapy.

In another embodiment, the present invention provides a compound of Formula I, Ia, Ib, II or III, or a pharmaceutically acceptable salt thereof, for use in the treatment of HIV infection.

In another embodiment of the invention, a compound of Formula I, Ia, Ib, II or III is provided, wherein said compound or a salt of the compound is used in the manufacture of a medicament for use in the treatment of HIV infection in humans.

In one aspect of the present invention, there is provided a method of treating HIV infection in a subject comprising administering to said subject a compound of Formulas I, Ia, Ib, II or III, as well as any compound from Table 1, as well as pharmaceutically acceptable salts thereof. "Eliminating" or "cure" a disease in a patient is used to refer to the eradication, stopping or ending of a person's virus or immunodeficiency symptoms, or the progression of viral symptoms over a period. As an example, in one embodiment, “elimination” or “cure” refers to a therapeutic administration (administration) or combination of administrations that, alone or in combination with one or more other compounds, induces and maintains sustained control of the virus (plasma viremia levels, undetectable, for example, a polymerase chain reaction (PCR) test, a bDNA (branched-chain DNA) rDNA test, or a NASBA (nucleic acid sequence-based amplification) test for human immunodeficiency virus after a minimum of two years without any therapeutic intervention. These PCR, rDNA and NASBA analyzes are carried out using techniques known and familiar to one skilled in the art. By way of example, eradication, cessation, arrest or termination of a virus or symptoms of a human immunodeficiency, or progression of symptoms or virus, can be maintained for at least two years.

In one aspect of the present invention, there is provided a method of treating HIV infection in a subject, comprising administering to said subject a pharmaceutical composition containing a compound of Formulas I, Ia, Ib, II and III, as well as a pharmaceutical salt thereof.

In one aspect of the present invention, there is provided the use of a compound of Formulas I, Ia, Ib, II and III, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for use in treating HIV infection.

In one aspect of the present invention there is provided a compound of Formulas I, Ia, Ib, II and III, or a pharmaceutically acceptable salt thereof, for use in treating HIV infection.

Combinations of compounds of Formulas I, Ia, Ib, II and III and one or more agents useful in HIV therapy may also be used in methods of treating HIV infection.

In one embodiment, the pharmaceutical preparation containing a compound of Formula I, Ia, Ib, II or III or a salt thereof is a preparation adapted for parenteral administration. In another embodiment, the drug is a long-acting drug for parenteral administration. In another embodiment, the drug is a nanoparticle drug. The compounds of the present invention and their salts, solvates or other pharmaceutically acceptable derivatives can be used alone or in combination with other therapeutic agents. Accordingly, in other embodiments, methods of treating and/or preventing HIV infection in a subject may, in addition to administering a compound of Formula I, Ia, Ib, II, or III, further include administering one or more additional pharmaceutical agents having anti-HIV activity.

In such embodiments, one or more additional agents having activity against HIV is selected from the group consisting of antiretroviral agents, latency reversal agents, and clearance therapy agents.

In other embodiments, one or more additional agents having activity against HIV is selected from the group consisting of nucleotide reverse transcriptase inhibitors, non-nucleotide reverse transcriptase inhibitors, protease inhibitors, cell entry inhibitors, attachment and fusion inhibitors, integrase inhibitors, maturation inhibitors, inhibitors CXCR4 and/or CCR5, histone deacetylase inhibitors, histone crotonyl transferase inhibitors, protein kinase C agonists, proteasome inhibitors, TLR7 agonists, bromodomain inhibitors and neutralizing antibodies and combinations thereof.

In some embodiments, one or more additional agents having anti-HIV activity is selected from the group consisting of zidovudine, didanosine, lamivudine, zalcitabine, abacavir, stavudine, adefovir, adefovir dipivoxil, fosivudine, todoxil, emtricitabine, alovudine, amdoxovir, elvucitabine, nevirapine , delaverdine, efavirenz, loviride, immunocal, oltipraz, capravirine, lersivirine, GSK2248761, TMS-278, TMS-125, etravirine, saquinavir, ritonavir, indinavir, nelfinavir, amprenavir, fosamprenavir, brecanavir, duranavir, atazan vira, tipranavir, palinavir, lasinavir , enfuvirtide, T-20, T-1249, PRO-542, PROMO, TNX-355, BMS-806, BMS-663068 and BMS-626529, 5-Helix (5-helix), raltegravir, elvitegravir, dolutegravir, cabotegravir, bictegravir, vicriviroc (Sch-C), Sch-D, TAK779, maraviroc, TAK449, didanosine, tenofovir, lopinavir, duranavir, vorinostat, panobinostat, romidepine, valproic acid, mocetinostat, sodium corotonate, bryostatin, ingenol B, disulforam, GS- 9620, JQ1, iBET151, bortezomib, epigallocatechin gallate, salinosporamide A, carfilzomib, broad neutralizing antibodies (bNAbs), eCD4-Ig, CD4-Ig and dual affinity redirecting antibodies (DART).

Accordingly, the compounds of the present invention of Formula (I), (Ia), (Ib), (II) or (III) and any other pharmaceutically active agent(s) can be administered together or separately, and in the case of separate administration, the administration can be simultaneously or sequentially, in any order. The amounts of compounds of Formula (I), (Ia), (Ib), (II) or (III) of the present invention and other pharmaceutically active agent(s) and the relative timing of administration may be selected to provide the desired combined therapeutic effect. Administration in combination of a compound of the present invention of Formula (I), (Ia), (Ib), (II) or (III) and salts, solvates or other pharmaceutically acceptable derivatives of the said compound in other therapeutic agents can be combined by administering together in : (1) a single pharmaceutical composition containing both compounds; or (2) separate pharmaceutical compositions, each of which contains one compound. Alternatively, the combination may be administered separately in a sequential manner in which one treatment agent is administered first and the other second, or vice versa. Such sequential administration may be close or distant in time. The amounts of the compound(s) of Formula I, Ia, Ib, II or III or their salts and other pharmaceutically active agent(s) and the relative time of administration will be selected to achieve the desired combined therapeutic effect.

Additionally, the compounds of the present invention of Formula (I), (Ia), (Ib), (II) or (III) can be used in combination with one or more other agents that may be useful in the treatment of HIV. These agents may include antiretroviral agents, latency reversal agents, and clearance therapy agents. The following are some examples of antiretroviral agents:

nucleotide reverse transcriptase inhibitors such as zidovudine, didanosine, lamivudine, zalcitabine, abacavir, stavudine, adefovir, adefovir dipivoxil, fosivudine, todoxil, emtricitabine, alovudine, amdoxovir, elvucitabine and similar agents; non-nucleotide reverse transcriptase inhibitors (including agents with antioxidant activity, such as immunocal, oltipraz, etc.), such as nevirapine, delaverdine, efavirenz, loviride, immunocal, oltipraz, capravirine, lersivirine, GSK2248761, TMS-278, TMS- 125, etravirine and similar agents;

Protease inhibitors. such as saquinavir, ritonavir, indinavir, nelfinavir, amprenavir, fosamprenavir, brecanavir, duranavir, atazanavir, tipranavir, palinavir, lasinavir and similar agents;

Entry, attachment and fusion inhibitors such as enfuvirtide (T-20), T-1249, PRO-542, PRO-140, TNX-355, BMS-806, BMS-663068 and BMS-626529, 5-Helix and similar agents ;

Integrase inhibitors such as raltegravir, elvitegravir, dolutegravir, cabotegravir, bictegravir and similar agents;

Maturation inhibitors such as PA-344 and PA-457 and similar agents; and CXCR4 and/or CCR5 inhibitors. such as vicriviroc (Sch-C), Sch-D, TAK779, maraviroc (UK 427.857), TAK449, as well as those disclosed in WO 02/74769, PCT/US03/39644, PCT/US03/39975, PCT/US03/39619, PCT/US03/39618, PCT/US03/39740, and PCT/US03/39732 and similar agents. Additional examples in which the compounds of the present invention may be used in combination with one or more agents suitable for the prevention or treatment of HIV are provided in Table 2.

The present invention can be used in combination with other agents that induce HIV expression, such as latency reversal agents. Some agents that reverse latency include, but are not limited to: histone deacetylase inhibitors (eg, vorinostat, panobinostat, romidepine), histone crotonyl transferase (sodium corotonate) inhibitors, protein kinase C agonists (eg, bryostatin, ingenol B), disulfiram, TLR7 agonists (eg , GS-9620), bromodomain inhibitors (eg JQ1, iBET151). Many of these agents are described in detail below.

The present invention can be used in combination with other agents that induce HIV expression, such as clearance therapy agents. Some examples of agents for clearance therapy or immunological combinations for clearance include, but are not limited to: neutralizing antibodies and broad neutralizing antibodies (bNAbs), eCD4-Ig, CD4-Ig and dual affinity redirection proteins (DART).

The scope of combinations of the compounds of the present invention with anti-HIV agents is not limited to those specified above, but includes in principle any combination with any pharmaceutical compositions suitable for the treatment and/or prevention of HIV. As noted, in such combinations, the compounds of the present invention and other anti-HIV agents can be administered separately or together. In addition, one agent may be administered prior to, simultaneously with, or sequentially with the administration of the other agent(s). The present invention can be used in combination with one or more agents that can be used as pharmacological enhancing agents, as well as with or without additional compounds for the treatment or prevention of HIV. Examples of such pharmacokinetic enhancing agents (or pharmacokinetic boosters) include, but are not limited to: ritonavir, GS-9350 (cobicistat), and SPI-452.

Ritonavir is 10-hydroxy-2-methyl-5-(1-methylethyl)-1-1[2-(1-methylethyl)-4-thiazolyl]-3,6-dioxo-8,11-bis(phenylmethyl) -2,4,7,12-tetraazatridecane-13-oic acid, 5-thiazolyl methyl ester, [5S-(5S*,8R*,10R*,11R*)] and is available from Abbott Laboratories Abbott park, Illinois, called Norvir (norvir). Ritonavir is an HIV protease inhibitor prescribed with other antiretroviral agents to treat HIV infection. Ritonavir also inhibits P450-mediated drug metabolism as well as the P-glycoprotein (Pgp) transport system of the cell, thereby providing increased concentrations of the active compound in the body.

GS-9350 (cobicistat) is a compound developed by Gilead Sciences of Foster City, California, as a pharmacologic enhancer.

SPI-452 is a compound developed by Sequoia Pharmaceuticals of Gaithersburg, Maryland, as a pharmacological enhancer.

In one embodiment of the present invention, a compound of Formula I, la, lb, or is used in combination with ritonavir. In one embodiment, the combination is an oral fixed-dose combination. In another embodiment, the compound of formula I, Ia, Ib, II or III is in a long-acting injection form for parenteral administration, and ritonavir is in the form of a composition for oral administration. In one embodiment, a kit is provided containing a compound of Formula I, Ia, Ib, II or III, formulated in a long-acting injectable form for parenteral administration, and ritonavir, formulated in the form of a composition for oral administration. In another embodiment, the compound of formula I, Ia, Ib, II or III is in a long-acting injection form for parenteral administration, and ritonavir is in the form of a composition for oral administration. In one embodiment, a kit is provided containing a compound of Formula I, Ia, Ib, II or III, formulated in a long-acting injectable form for parenteral administration, and ritonavir, formulated in the form of an injectable composition.

In another embodiment of the present invention, a compound of Formula I, Ia, Ib, II or III is used in combination with GS-9350. In one embodiment, the combination is an oral fixed-dose combination. In another embodiment, a compound of Formula I, Ia, Ib, II or III is formulated in a sustained-release injectable form for parenteral administration, and GS-9350 is formulated in a composition for oral administration. In one embodiment, a kit is provided containing a compound of Formula I, Ia, Ib, II or III, formulated in a sustained-release injectable form for parenteral administration, and GS-9350, formulated as a composition for oral administration. In another embodiment, a compound of Formula I, Ia, Ib, II or III is formulated in a sustained release injectable form for parenteral administration, and GS-9350 is formulated in a composition for oral administration. In one embodiment, a kit is provided containing a compound of Formula I, Ia, Ib, II or III, formulated in a long-acting injectable form for parenteral administration, and GS-9350, formulated in an injectable composition.

In one embodiment of the present invention, a compound of Formula I, Ia, Ib, II or III is used in combination with SPI-452. In one embodiment, the combination is an oral fixed-dose combination. In another embodiment, the compound of Formula I, Ia, Ib, II or III is in a sustained-release injectable form for parenteral administration, and SPI-452 is in the form of a composition for oral administration. In one embodiment, a kit is provided containing compounds of Formula I, Ia, Ib, II or III, formulated in a long-acting injectable form for parenteral administration, and SPI-452, formulated in a composition for oral administration. In another embodiment, a compound of Formula I, Ia, Ib, II or III is in a sustained release injectable form for parenteral administration, and SPI-452 is in the form of a composition for oral administration. In one embodiment, a kit is provided containing compounds of Formula I, Ia, Ib, II or III, formulated in a long-acting injectable form for parenteral administration, and SPI-452, formulated in the form of an injectable composition.

In one embodiment of the present invention, a compound of Formula I, Ia, Ib, II or III is used in combination with compounds described in previously filed application PCT/CN2011/0013021, which is incorporated herein by reference. The above therapeutic agents, when used in combination with the chemical compounds described herein, may be used, for example, in the amounts specified in the Physicians' Desk Reference (PDR) or as otherwise determined by one skilled in the art. .

In another embodiment, the invention provides a method of treating a viral infection in a mammal that is at least partially mediated by a virus of the retrovirus family, the method comprising administering to a mammal that has been diagnosed with said viral infection, or is at risk of developing said viral infection, a compound of Formula I, Ia, Ib, II or III.

In another embodiment, the invention provides a method of treating a viral infection in a mammal that is at least partially mediated by a virus of the retroviral family, the method comprising administering to a mammal that has been diagnosed with said viral infection, or that is at risk of developing said viral infection, a compound of Formula I, Ia, Ib, II or III, wherein said virus is the HIV virus. In some embodiments, the HIV virus is an HIV-1 virus.

In another embodiment, the invention provides a method of treating a viral infection in a mammal that is at least partially mediated by a virus of the retrovirus family, the method comprising administering to a mammal that has been diagnosed with said viral infection, or is at risk of developing said viral infection, a compound of Formula I, Ia, Ib, II or III, further comprising administering a therapeutically effective amount of one or more agents having activity against the HIV virus.

In another embodiment, the invention provides a method of treating a viral infection in a mammal that is at least partially mediated by a virus of the retroviral family, the method comprising administering to a mammal that has been diagnosed with said viral infection, or that is at risk of developing said viral infection, a compound of Formula I, Ia, Ib, II or III, further comprising administering a therapeutically effective amount of one or more agents having activity against the HIV virus, wherein said agent having activity against the HIV virus is selected from nucleotide reverse transcriptase inhibitors, non-nucleotide reverse transcriptase inhibitors, inhibitors protease, entry, attachment and fusion inhibitors, integrase inhibitors, maturation inhibitors, CXCR4 inhibitors and CCR5 inhibitors.

In another aspect of the present invention, there is provided a Method for depleting latent HIV-infected cells comprising administering to a subject a compound of Formula (I), (Ia), (Ib), (II) or (III) or a pharmaceutically acceptable salt thereof.

In various embodiments of this method, each of Alk, Alk ₂ and Alk ₃ is represented by the formula:

In various embodiments of this method, each of Ar ₁ , Ar ₂ , Ar ₃ , Ar ₄ , Ar ₅ , Ar ₆ , Ar ₇ , Ar 8, Ar ₉ , Ar ₁₀ , Ar ₁₁ , Ar ₂₁ , Ar ₂₂ , _{Ar 23 ,} Ar ₂₄ , Ar ₂₅ and Ar ₂₆ are C ₆ aryl. In various embodiments of the invention described above, Ar ₁₂ , Ar ₁₃ , Ar ₁₄ and Ar ₁₅ , Ar ₁₆ , Ar ₁₇ , Ar ₁₈ and Ar ₁₉ are each C ₉ aryl.

In various embodiments of the invention described above, Ar ₁₆ , Ar ₁₇ , Ar ₁₈ and Ar ₁₉ are each C ₁₀ aryl.

In various embodiments of the invention described above, the linker (L) is selected from the group consisting of:

In various embodiments of the invention described above, the compound is selected from the group consisting of the following compounds:

In various embodiments of this method, X ₁ X ₂ each represents O, preferably for Formulas (Ia) and (Ib).

In various embodiments of the above method in the linker (L), each of Ar ₁ , Ar ₂ , Ar ₃ , Ar ₄ , Ar ₅ , Ar ₆ , Ar ₇ , Ar ₈ , Ar ₉ , Ar ₁₀ , Ar ₁₁ , Ar ₂₀ , Ar ₂₁ , Ar ₂₂ , Ar ₂₃ and Ar ₂₄ are C ₆ aryl.

In various embodiments of this method, the linker (L) is selected from the group consisting of (i) and (v).

In various embodiments of the above method, each of m, n, p, and q is 1, and each (CH ₂ ) _0-3 group in formula (v) is (CH ₂ ).

In various embodiments of the specified method, as well as connections, the linker (L) is selected from the group consisting of:

In various embodiments of this method, the linker (L) is selected from the group consisting of (vi) and (vii), and each of Ar ₁₂ , Ar ₁₃ , Ar ₁₄ and Ar ₁₅ is C ₉ aryl.

In various embodiments of this method, each of Ar ₁₂ and Ar ₁₄ is

and each of Ar ₁₃ and Ar ₁₅ is where the wavy lines represent attachment points.

In various embodiments of this method, the linker (L) is selected from the group consisting of:

In one embodiment, the present invention provides a compound (compound 13) of the formula:

or a pharmaceutically acceptable salt thereof. The present invention also includes a pharmaceutical composition containing it, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient, including, for example, those provided herein. The present invention also includes a method of treating HIV infection in a subject comprising administering to the subject the compound or a pharmaceutically acceptable salt thereof, as well as combinations. The present invention also includes this compound, or a pharmaceutically acceptable salt thereof, for use in the treatment of HIV infection. The present invention also includes the use of this compound in the manufacture of a medicament for the treatment of HIV infection. The present invention also includes a method of depleting latent HIV-infected cells comprising administering to a subject the compound or a pharmaceutically acceptable salt thereof, as well as combinations thereof.

In one embodiment, the present invention provides a compound (compound 20) of the formula:

or a pharmaceutically acceptable salt thereof. The present invention also includes a pharmaceutical composition containing this compound, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient, including, for example, those provided herein. The present invention also includes a method of treating HIV infection in a subject comprising administering to the subject the compound or a pharmaceutically acceptable salt thereof, as well as combinations. The present invention also includes this compound, or a pharmaceutically acceptable salt thereof, for use in the treatment of HIV infection. The present invention also includes the use of this compound in the manufacture of a medicament for the treatment of HIV infection. The present invention also includes a method of depleting latent HIV-infected cells comprising administering to a subject the compound or a pharmaceutically acceptable salt thereof, as well as combinations thereof.

In various embodiments, the method of depleting latent HIV infection further comprises administering to the subject one or more additional agents having anti-HIV activity disclosed above herein. As an example, in various embodiments, one or more additional agents are selected from the group consisting of nucleotide reverse transcriptase inhibitors, non-nucleotide reverse transcriptase inhibitors, protease inhibitors, cell entry inhibitors, attachment and fusion inhibitors, integrase inhibitors, maturation inhibitors, CXCR4 inhibitors and/or CCR5, histone deacetylase inhibitors, histone crotonyl transferase inhibitors, protein kinase C agonists, proteasome inhibitors, TLR7 agonists, bromodomain inhibitors and antibodies for clearance therapy and combinations thereof. In various embodiments, one or more additional agents having activity against HIV is selected from the group consisting of zidovudine, didanosine, lamivudine, zalcitabine, abacavir, stavudine, adefovir, adefovir dipivoxil, fosivudine, todoxil, emtricitabine, alovudine, amdoxovir, elvucitabine, nevirapine, delaverdine, efavirenz, loviride, immunocal, oltipraz, capravirine, lersivirine, GSK2248761, TMS-278, TMS-125, etravirine, saquinavir, ritonavir, indinavir, nelfinavir, amprenavir, fosamprenavir, brecanavir, duranavir, atazanavir, tipranavir, palinavir, lasinavir, enfuvirtide, T-20, T-1249, PRO-542, PRO-140, TNX-355, BMS-806, BMS-663068 and BMS-626529, 5-Helix, raltegravir, elvitegravir, dolutegravir, cabotegravir, bictegravir, vicriviroc (Sch-C), Sch-D, TAK779, maraviroc, TAK449, didanosine, tenofovir, lopinavir, duranavir, vorinostat, panobinostat, romidepine, valproic acid, mocetinostat, sodium corotonate, bryostatin, ingenol B, disulforam, GS-9620, JQ1, iBET151, bortezomide, epigallocatechin gallate, salinosporamide A, carfilzomib and neutralizing antibodies, eCD4-Ig, CD4-Ig, bNAb, DARTS and IgA.

The compounds of Formula I, Ia, Ib, II and III and their pharmaceutically acceptable salts may be useful for the treatment of cancer, precancerous syndromes. Where appropriate, the present invention relates to a method of treating cancers selected from the group consisting of brain cancer (gliomas), glioblastomas, astrocytomas, glioblastoma multiforme, Bannayan-Zonan syndrome, Cowden disease, Lhermitte-Duclos disease, Wilms tumor, Ewing sarcoma, rhabdomyosarcoma, ependymoma, medulloblastoma, head and neck cancer, kidney, liver, melanoma, ovarian cancer, pancreatic cancer, adenocarcinoma, ductal adenocarcinoma, glandular squamous cell carcinoma, acinar cell carcinoma, glucagonoma, insulinoma, prostate, sarcoma, osteosarcoma, giant cell bone tumor, thyroid cancer, lymphoblastic T-cell leukemia, chronic myelogenous leukemia, chronic leukocytic leukemia, hairy cell leukemia, acute lymphoblastic leukemia, acute myelogenous leukemia, chronic neutrophilic leukemia, acute lymphoblastic T-cell leukemia, plasmacyte oma, immunoblastic large cell leukemia, mantle cell leukemia, multiple myeloma, megakaryoblastic leukemia, multiple myeloma, acute megakaryocytic leukemia, promyelocytic leukemia, erythroleukemia, malignant lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, lymphoblastic T-cell lymphoma, Burkitt's lymphoma, follicular lymphoma s, neuroblastoma, bladder cancer, urothelial cancer, vulvar cancer, cervical cancer, endometrial cancer, renal cancer, mesothelioma, esophageal cancer, salivary gland cancer, renal cell cancer, stomach cancer, nasopharyngeal cancer, cheek cancer, oral cancer, GIST (gastrointestinal stromal tumor) and testicular cancer.

Where appropriate, the present invention provides a method for treating precancerous syndromes in a mammal, including a human, wherein the precancerous syndrome is selected from: cervical intraepithelial neoplasia, monoclonal gammopathy of unknown origin (MGUS), myelodysplastic syndrome, aplastic anemia, cervical lesions, cutaneous nevi (pre -melanoma), prostatic intraepithelial neoplasia (PRN), ductal carcinoma in situ (DCIS), colon polyps and severe hepatitis or cirrhosis.

The compounds of Formulas (I), (Ia), (Ib), (II), (III) and their pharmaceutical salts can be administered in conjunction with at least one other agent known to be useful for the treatment or precancerous syndromes.

The term "co-administration" as used herein means either the simultaneous administration or any method of separate sequential administration of a c-MYC inhibitory compound as described herein and an additional active agent or agents known to be beneficial for cancer treatments, including chemotherapy and radiation therapy. The term “additional active agent or agents” as used herein includes any compound or therapeutic agent that is known or exhibits beneficial properties when administered to a patient in need of treatment for cancer. Preferably, if the administration is not simultaneous, the compounds are administered close to each other in time. Moreover, it does not matter whether the compounds are administered in the same dosage form, for example, one compound may be administered by injection and the other compound may be administered orally.

Examples of additional active ingredient or ingredients (antineoplastic agent) for use in combination or co-administration with the compounds of the present invention are given below. This list is not limiting. Antineoplastic agents are provided for use with the compounds of the present invention.

Generally, any antineoplastic agent that has activity against a susceptible tumor being treated can be co-administered to treat cancer in the present invention. Examples of such agents can be found in Cancer Principles and Practice of Oncology V.T. Devita and S. Hellman (editors), 6th ed. (February 15, 2001), Lippincott Williams & Wilkins Publishers. One of ordinary skill in the art will be able to discern which combinations of agents will be useful based on the specific characteristics of the drugs and the cancer in question. Typical antineoplastic agents useful in the present invention include, but are not limited to, microtubule-targeting agents such as diterpenoids and vinca alkaloids; platinum coordination complexes; such as nitrogen mustard, oxazophosphorines, alkylsulfonates, nitrosoureas and triazenes; antibiotics such as anthracyclines, actinomycins and bleomycins; topoisomerase II inhibitors such as epipodophyllotoxins; antimetabolites such as purine and pyrimidine analogues and antifolate compounds; topoisomerase I inhibitors such as camptothecins; hormones and hormone analogues; inhibitors of signaling cascades; non-receptor tyrosine kinase inhibitors of angiogenesis; immunotherapeutic agents; proapoptotic agents; cell signaling inhibitors; proteasome inhibitors; and cancer metabolism inhibitors.

Examples of additional active ingredient or ingredients (antineoplastic agent) for use in combination or co-administered with the compounds of the present invention are chemotherapeutic agents.

Microtubule-targeting or antimitotic agents are phase-specific agents that exhibit activity against the microtubules of tumor cells during the M phase or mitotic phase of the cell cycle. Examples of microtubule-targeting agents include, but are not limited to: diterpenoids and vinca alkaloids.

Diterpenoids, which are obtained from natural sources, are phase-specific anticancer agents that act in the G ₂ /M phases of the cell cycle. Diterpenoids are thought to stabilize microtubule β-tubulin subunits by binding to this protein. Protein disassembly then appears to be inhibited, leading to a block in mitosis and subsequent cell death. Examples of diterpenoids include, but are not limited to, paclitaxel and its analogue docetaxel.

Paclitaxel, 13-ester 5β,20-epoxy-1,2α,4,7β,10β,13α-hexa-hydroxytax-11-en-9-one-4,10-diacetate-2-benzoate with (2R,3S )-N-benzoyl-3-phenylisoserine, is a natural diterpenoid product isolated from the American yew tree Taxus brevifolia and is commercially available as TAXOL® injection solution (Taxol). It is a member of the taxane family of terpenes. It was first isolated in 1971 by Wani et al., J. Am. Chem. Soc, 93: 2325. (1971), who characterized its structure using chemical and X-ray crystallographic methods. One of the mechanisms of its activity relates to the ability of paclitaxel to bind tubulin, thereby inhibiting the growth of cancer cells. Schiff et al., Proc. Natl, Acad. Sci. USA, 77: 1561-1565 (1980); Schiff et al., Nature, 277: 665-667 (1979); Kumar, J. Biol. Chem., 256: 10435-10441 (1981). A review of the synthesis and anticancer activity of some paclitaxel derivatives can be found in: D.G.I. Kingston et al., Studies in Organic Chemistry vol. 26, entitled "New trends in Natural Products Chemistry 1986", Attaur-Rahman, P.W. Le Quesne, Eds, (Elsevier, Amsterdam, 1986) pp. 219-235.

Paclitaxel has been approved for clinical use in the treatment of refractory ovarian cancer in the United States (Markman et al., Yale Journal of Biology and Medicine. 64-583, 1991; McGuire et al., Ann. Intern. Med., 111: 273, 1989 ) and for the treatment of breast cancer (Holmes et al., J. Nat. Cancer Inst., 83: 1797, 1991). It is a potential candidate for the treatment of skin neoplasms (Einzig et al., Proc. Am. Soc. Clin. Oncol. 20:46) and head and neck carcinomas (Forastire et al., Sem. Oncol. 20:56, 1990) . This compound also shows potential for the treatment of polycystic kidney disease (Woo et al., Nature, 368: 750, 1994), lung cancer and malaria. Treatment of patients with paclitaxel results in bone marrow suppression (multiple cell lines, Ignoff, R.J. et al., Cancer Chemotherapy Pocket Quide, 1998) associated with duration of dosing above the threshold concentration (50 nM) (Kearns, S.M. et al. , Seminars in Oncology, 3 (6) pp. 16-23, 1995).

Docetaxel, (2R,3S)-N-carboxy-3-phenylisoserine N-tert-butyl ester 13-ester with 5β-20-epoxy-1,2α,4,7β,10β,13α-hexahydroxytax-11-ene-trihydrate 9-one-4-acetate-2-benzoate, is commercially available as TAXOTER® injection solution. Docetaxel is indicated for the treatment of breast cancer. Docetaxel is a semi-synthetic derivative of paclitaxel, see other references, obtained using a natural precursor, 10-deacetylbaccatin III, extracted from berry or European yew needles. The dose-limiting toxicity of docetaxel is neutropenia.

Vinca alkaloids are phase-specific antineoplastic agents obtained from the periwinkle plant. Vinca alkaloids act in the M phase (mitosis) of the cell cycle due to specific binding to tubulin. As a result, the bound tubulin molecule is not able to polymerize into microtubules. It is believed that mitosis is arrested in metaphase with subsequent cell death. Examples of vinca alkaloids include, but are not limited to, vinblastine, vincristine, and vinorelbine.

Vinblastine, vincaleucoblastine sulfate, is commercially available under the brand name VELBAN® as an injection. Although it has indications as a possible second-line therapy for a variety of solid tumors, it is primarily indicated in the treatment of testicular cancer and various lymphomas, including Hodgkin's disease, and lymphocytic and histiocytic lymphomas. Myelosuppression is a dose-limiting side effect of vinblastine.

Vincristine, vincaleucoblastine, 22-oxosulfate, is commercially available under the brand name ONCOVIN® in the form of an injection solution. Vincristine is indicated for the treatment of acute leukemia and has also been found to be useful in treatment regimens for the treatment of malignant Hodgkin's lymphomas and non-Hodgkin's lymphomas. Alopecia and neurological effects are the most common side effects of vincristine, with myelosuppression and gastrointestinal inflammation occurring to a lesser extent.

Vinorelbine, 3',4'-didehydro-4'-deoxy-C'-norvincaleucoblastine [R-(R*,R*)-2,3-dihydroxybutanedioate (1:2)(salt)], commercially available in solution form for injection vinorelbine tartrate (NAVELBINE® (navelbine)), is a semi-synthetic vinca alkaloid. Vinorelbine is indicated as a monotherapy agent or in combination with other chemotherapeutic agents such as cisplatin in the treatment of various solid tumors, particularly non-small cell lung cancer, advanced breast cancer and hormone-refractory prostate cancers. Myelosuppression is the most common dose-limiting side effect of vinorelbine.

Platinum coordination complexes are non-phase-specific anticancer agents that interact with DNA. Platinum complexes penetrate tumor cells, hydrate and form intra- and interstrand cross-links in DNA, producing biological effects detrimental to the tumor. Primary platinum coordination complexes include, but are not limited to: cisplatin and carboplatin.

Cisplatin, a cis-diaminedichloroplatinum, is commercially available under the brand name PLATINOL® as an injection. Cisplatin is primarily indicated for the treatment of metastatic testicular and ovarian cancer and advanced bladder cancer. The main dose-limiting side effects of cisplatin are nephrotoxicity, which can be modulated by hydration and diuresis, and ototoxicity.

Carboplatin, a diamine [1,1-cyclobutane-dicarboxylate(2-)-O,O'], is commercially available under the brand name PARAPLATIN® in the form of an injection solution. Carboplatin is primarily indicated in the first and second line treatment of advanced ovarian carcinoma. Bone marrow suppression is a dose-limiting toxicity of carboplatin.

Alkylating agents are non-phase specific anticancer agents and strong electrophiles. Typically, alkylating agents form covalent bonds by alkylating DNA through nucleophilic moieties of the DNA molecule, such as phosphate, amino, sulfhydryl, hydroxyl, carboxyl and imidazole groups. Such alkylation disrupts the functioning of the nucleic acid, leading to cell death. Examples of alkylating agents include, but are not limited to: nitrogen mustards such as cyclophosphamide, melphalan and chlorambucil; alkylsulfonates such as busulfan; nitrosoureas such as carmustine; and triazenes such as dacarbazine.

Cyclophosphamide, 2-bis[2-chloroethyl)amino]tetrahydro-2H-1,3,2-oxazaphosphorine 2-oxide monohydrate, is commercially available in injection or tablet form as CYTOXAN®. Cyclophosphamide is indicated as a monotherapy agent or in combination with other chemotherapeutic agents in the treatment of malignant lymphomas, multiple myeloma and leukemias. Alopecia, nausea, vomiting and leukopenia are the most common dose-limiting side effects of cyclophosphamide.

Melphalan, 4-[bis(2-chloroethyl)amino]-L-phenylalanine, is commercially available in injection or tablet form as ALKERAN®. Melphalan is indicated for the palliative treatment of multiple myeloma and unresectable epithelial ovarian carcinoma. Bone marrow suppression is the most common dose-limiting side effect of melphalan.

Chlorambucil, 4-[bis(2-chloroethyl)amino]benzenebutanoic acid, is commercially available in tablet form as LEUKERAN®. Chlorambucil is indicated for the palliative treatment of chronic lymphatic leukemia and malignant lymphomas such as lymphosarcoma, gigantofollicular lymphoma and Hodgkin's disease. Bone marrow suppression is the most common dose-limiting side effect of chlorambucil.

Busulfan, a 1,4-butanediol dimethane sulfonate, is commercially available as MYLERAN® tablets. Busulfan is indicated for the palliative treatment of chronic myelogenous leukemia. Bone marrow suppression is the most common dose-limiting side effect of busulfan.

Carmustine, 1,3-[bis(2-chloroethyl)-1-nitrosourea, is commercially available in single-dose lyophilized vials under the brand name BiCNU®. Carmustine is indicated for palliative treatment as a monotherapy agent in combination with other agents for the treatment of brain tumors, multiple myeloma, Hodgkin's disease and non-Hodgkin's lymphomas. Delayed myelosuppression is the most common dose-limiting side effect of carmustine.

Dacarbazine, 5-(3,3-dimethyl-1-triazeno)-imidazole-4-carboxamide, is commercially available in single-dose vials of the material under the brand name DTIC-Dome®. Dacarbazine is indicated for the treatment of metastatic malignant melanoma and in combination with other agents for the second-line treatment of Hodgkin's disease. Nausea, vomiting, and anorexia are the most common dose-limiting side effects of dacarbazine.

Antibiotic antineoplastic agents are non-phase specific agents that bind or intercalate with DNA. Typically, this action leads to the formation of stable complexes with DNA or strand breakage, which disrupts the normal functioning of nucleic acids, leading to cell death. Examples of antibiotic antineoplastic agents include, but are not limited to: dactinomycin, anthrocyclines such as daunorubicin and doxorubicin; and bleomycins.

Dactinomycin, also known as actinomycin D, is commercially available in injectable form as COSMEGEN®. Dactinomycin is indicated for the treatment of Wilms tumor and rhabdomyosarcoma. Nausea, vomiting, and anorexia are the most common dose-limiting side effects of dactinomycin.

Daunorubicin, (8S-cis-)-8-acetyl-10-[(3-amino-2,3,6-trideoxy-α-L-lixohexopyranosyl)oxy]-7,8,9,10-tetrahydro-6, 8,11-trihydroxy-1-methoxy-5,12 naphthacenedione hydrochloride is commercially available as injectable liposomes under the brand name DAUNOXOME® or injectable form under the brand name CERUBIDINE®.

Daunorubicin is indicated to induce remission in the treatment of acute nonlymphocytic leukemia and advanced HIV-associated Kaposi's sarcoma. Myelosuppression is the most common dose-limiting side effect of daunorubicin.

Doxorubicin, (8S,10S)-10-[(3-amino-2,3,6-trideoxy-α-L-lyxo-hexopyranosyl)oxy]-8-glycoloyl, 7,8,9,10-tetrahydro-6 8,11-trihydroxy-1-methoxy-5,12 naphthacenedione hydrochloride is commercially available in injection form under the brand name RUBEX® or ADRIAMYCIN RDF®. Doxorubicin is primarily indicated for the treatment of acute lymphoblastic leukemia and acute myeloid leukemia, but it is also a useful component for the treatment of certain solid tumors and lymphomas. Myelosuppression is the most common dose-limiting side effect of doxorubicin.

Bleomycin, a mixture of cytotoxic glycopeptide antibiotics isolated from a strain of Streptomyces verticillus, is commercially available under the brand name BLENOXANE®. Bleomecin is indicated as a palliative agent, as a monotherapy agent, in combination with other agents, for the treatment of squamous cell carcinoma, lymphomas and testicular carcinomas. Pulmonary toxicity and skin toxicity are the most common dose-limiting side effects of bleomycin.

Topoisomerase II inhibitors include, but are not limited to: epipodophyllotoxins.

Epipodophyllotoxins are phase-specific antineoplastic agents obtained from the mandrake plant. Epipodophyllotoxins typically affect cells in the S and G ₂ phases of the cell cycle by forming a ternary complex with topoisomerase II and DNA, causing DNA strand breaks. Strand breaks accumulate, leading to cell death. Examples of epipodophyllotoxins include, but are not limited to: etoposide and teniposide.

Etoposide, 4'-demethyl-epipodophyllotoxin 9[4,6-0-(R)-ethylidene-β-D-glucopyranoside], is commercially available in injection or capsule form under the brand name VePESID®, and is commonly known as VP-16 . Etoposide is indicated as a monotherapy agent in combination with other chemotherapeutic agents for the treatment of testicular cancer and non-small cell lung cancer. Myelosuppression is the most common side effect of etoposide. Cases of leukopenia tend to be more severe than thrombocytopenia.

Teniposide, 4'-demethyl-epipodophyllotoxin 9[4,6-0-(R)-tenylidene-β-D-glucopyranoside], is commercially available in injection form under the brand name VUMON® and is commonly known as VM- 26. Teniposide is indicated as a monotherapy agent in combination with other chemotherapeutic agents for the treatment of acute leukemia in children. Myelosuppression is the most common dose-limiting side effect of teniposide. Teniposide can cause both leukopenia and thrombocytopenia.

Antineoplastic agents of the antimetabolite class are phase-specific antineoplastic agents that can act in the S phase (DNA synthesis) of the cell cycle by inhibiting DNA synthesis or by inhibiting the synthesis of purine or pyrimidine bases, thereby limiting DNA synthesis. As a result, the S phase does not occur and cell death follows. Examples of antineoplastic agents of the antimetabolite class include, but are not limited to: fluorouracil, methotrexate, cytarabine, mecaptopurine, thioguanine and hemicitabine.

5-Fluorouracil, 5-fluoro-2,4-(1H,3H)pyrimidinedione, is commercially available as fluorouracil. The introduction of 5-fluorouracil leads to inhibition of thymidylate synthesis and is also incorporated into both RNA and DNA. The result is usually cell death. 5-fluorouracil is indicated as a monotherapy agent in combination with other chemotherapeutic agents for the treatment of carcinomas of the breast, colon, rectum, stomach and pancreas. Myelosuppression and mucositis are dose-limiting side effects of 5-fluorouracil. Other fluorine-containing pyrimidine analogues include 5-fluorodeoxyuridine (floxyridine) and 5-fluorodeoxyuridine monophosphate.

Cytarabine, 4-amino-1-β-D-arabinofuranosyl-2(1H)-pyrimidinone, is commercially available under the brand name CYTOSAR-U® and is commonly known as Ara-C. Cytarabine is thought to exhibit cellular phase specificity in S phase by inhibiting DNA chain elongation by terminal insertion of cytarabine into the growing DNA strand. Cytarabine is indicated as a monotherapy agent in combination with other chemotherapeutic agents for the treatment of acute leukemia. Other cytidine analogs include 5-azacytidine and 2',2'-difluorodeoxycytidine (gemcitabine). Cytarabine causes leukopenia, thrombocytopenia and mucositis.

Mercaptopurine, 1,7-dihydro-6H-purine-6-thione monohydrate, is commercially available under the brand name PURINETHOL®. Mercaptopurine exhibits cell cycle phase specificity in S phase by inhibiting DNA synthesis through an as yet unspecified mechanism. Mercaptopurine is indicated as a monotherapy agent in combination with other chemotherapeutic agents for the treatment of acute leukemia. Myelosuppression and gastrointestinal mucositis are expected side effects of mercaptopurine at high doses. Azathioprine is a useful analogue of mercaptopurine.

Thioguanine, 2-amino-1,7-dihydro-6H-purine-6-thione, is commercially available under the brand name TABLOID®. Thioguanine exhibits cell cycle phase specificity in S phase by inhibiting DNA synthesis through an as yet unspecified mechanism. Thioguanine is indicated as a monotherapy agent in combination with other chemotherapeutic agents for the treatment of acute leukemia. Myelosuppression, including thrombocytopenia and anemia, is the most common dose-limiting side effect of thioguanine administration. However, gastrointestinal side effects do occur and may be dose limiting. Other purine analogs include pentostatin, erythrohydroxynonyladenine, fludarabine phosphate, and cladribine.

Gemchitabine, 2'-deoxy-2',2'-difluorocytidine topohydrochloride (β-isomer), is commercially available under the brand name GEMZAR® (gezmar). Gemcitabine exhibits cell cycle phase specificity in S phase and by blocking cell passage through the G1/S boundary. Gemcitabine is indicated in combination with cisplatin for the treatment of locally advanced non-small cell lung cancer and as monotherapy for the treatment of locally advanced pancreatic cancer. Myelosuppression, including leukopenia and anemia, is the most common dose-limiting side effect of gemcitabine administration.

Methotrexate, N-[4[[(2,4-diamino-6-pteridinyl)methyl]methylamino]benzoyl]-L-glutamic acid, is commercially available as methotrexate sodium. Methotrexate exhibits cell cycle phase specificity in S phase by inhibiting DNA synthesis, repair and/or replication through inhibition of dihydrofolate reductase, which is required for the synthesis of purine nucleotides and tipidylate. Methotrexate is indicated as a monotherapy agent in combination with other chemotherapeutic agents for the treatment of choriocarcinoma, meningeal leukemia, non-Hodgkin's lymphoma and carcinomas of the breast, head, neck, ovary and bladder. Myelosuppression (leukopenia, thrompocytopenia and anemia) and mucositis are expected side effects of methotrexate administration.

Camptothecins, including camptothecin and camptothecin derivatives, are available or under development as topoisomerase I inhibitors. The cytotoxic activity of camptothecin is believed to be related to its topoisomerase I inhibitory activity. Examples of camptothecins include, but are not limited to, irinotecan, topotecan and various the optical forms of 7-(4-methylpiperazinomethylene)-10,11-ethylenedioxy-20-camptothecin are described below.

Irinotecan HCl, (4S)-4,11-diethyl-4-hydroxy-9-[(4-piperidinopiperidino)carbonyloxy]-1H-pyrano[3',4',6,7]indolizino[1,2-b] Quinolinyl-3,14(4H,12H)-dione hydrochloride is commercially available as CAMPTOSAR® injection solution.

Irinotecan is a camptothecin derivative that, like its active metabolite SN-38, binds to the topoisomerase I-DNA complex. Cytotoxicity is thought to result from unrepairable double-strand breaks caused by the interaction of the topoisomerase I:DNA:irintecan or SN-38 ternary complex with replication enzymes. Irinotecan is indicated for the treatment of metastatic colon or rectal cancer. Dose-limiting side effects of irinotecan HCl include myelosuppression, including neutropenia, and gastrointestinal effects, including diarrhea.

Topotecan HCl, (S)-10-[(dimethylamino)methyl]-4-ethyl-4,9-dihydroxy-1H-pyrano[3',4',6,7]indolizino[1,2-b]quinolinyl- 3,14-(4H,12H)-dione monohydrochloride, commercially available as HYCAMTrN(R) injection solution. Topotecan is a camptothecin derivative that binds to the topoisomerase I-DNA complex and prevents the religation of single-strand breaks caused by topoisomerase I in response to twisting deformation of the DNA molecule. Topotecan is indicated for the second-line treatment of metastatic ovarian cancer and small cell lung cancer. A dose-limiting side effect of topotecan HCl is myelosuppression, primarily neutropenia.

Topotecan HCl, (S)-10-[(dimethylamino)methyl]-4-ethyl-4,9-dihydroxy-1H-pyrano[3',4',6,7]indolizino[1,2-b]quinolinyl- 3,14-(4H,12H)-dione monohydrochloride, commercially available as HYCAMTEM® injection solution. Topotecan is a camptothecin derivative that binds to the topoisomerase I-DNA complex and prevents the religation of single-strand breaks caused by topoisomerase I in response to torsional stress in the DNA molecule. Topotecan is indicated for second-line treatment of metastatic ovarian cancer and small cell lung cancer. A dose-limiting side effect of topotecan HCl is myelosuppression, primarily neutropenia.

Hormones and hormone analogs are compounds that can be used to treat cancers in which there is a relationship between the hormone(s) and the growth and/or lack of growth of the cancer. Examples of hormones and hormone analogs that can be used in the treatment of cancer include, but are not limited to: adrenocorticosteroids, such as prednisone and prednisolone, which can be used to treat malignant lymphoma and acute leukemia in children; aminoglutethimide and other aromatase inhibitors such as anastrozole, letrazole, vorazole and exemestane, which can be used to treat adrenocortical carcinoma and hormone-dependent estrogen receptor breast carcinoma; progestrins, such as megestrol acetate, which can be used to treat hormone-dependent breast and endometrial cancer; estrogens, androgens and antiandrogens such as flutamide, nilutamide, bicalutamide, cyproterone acetate and 5α-reductases such as finasteride and dutasteride, which can be used to treat prostate carcinoma and benign prostatic hypertrophy; antiestrogens such as tamoxifen, toremifene, raloxifene, droloxifene, iodoxifene, and selective estrogen receptor modulators (SERMS) such as those described in US Pat. Nos. 5,681,835, 5,877,219, and 6,207,716, which can be used to treat hormone-dependent breast carcinoma and other susceptible types of cancer; and gonadotropin releasing hormone (GnRH) and its analogs that stimulate the release of luteinizing hormone (LH) and/or follicle stimulating hormone (FSH) for the treatment of prostate carcinoma, for example, LHRH (luteinizing hormone releasing hormone) agonists and antagonists such as like goserelin acetate and luprolide.

Inhibitors of signal transduction cascades are those inhibitors that block or inhibit a chemical process that causes intracellular changes. As used herein, this change is cell proliferation or differentiation. Signal transduction inhibitors that can be used in the present invention include inhibitors of receptor tyrosine kinases, non-receptor tyrosine kinases, SH2/SH3 domain blockers, serine/threonine kinases, phosphotidylinositol-3 kinase, myo-inositol signaling and Ras oncogenes.

Some protein tyrosine kinases catalyze the phosphorylation of specific tyrosyl residues in various proteins involved in the regulation of cell growth. Such protein tyrosine kinases can be broadly classified as receptor or non-receptor kinases. Receptor tyrosine kinases are transmembrane proteins that have an extracellular ligand-binding domain, a transmembrane domain, and a tyrosine kinase domain. Receptor tyrosine kinases are involved in the regulation of cell growth and are commonly called growth factor receptors. It has been shown that inappropriate or uncontrolled activation of many of these kinases, e.g. aberrant growth factor receptor kinase activity, for example due to overexpression or mutation, results in uncontrolled cell growth. Accordingly, aberrant activity of such kinases has been associated with malignant tissue growth. Therefore, inhibitors of such kinases may provide methods for treating cancer. Growth factor receptors include, for example, epidermal growth factor receptor (EGFr), platelet-derived growth factor receptor (PDGFr), erbB2, erbB4, vascular endothelial growth factor receptor (VEGFr), tyrosine kinase with immunoglobulin-like domains and epidermal growth factor homology domains (TIE -2), insulin growth factor receptor-I (IGFI), macrophage colony stimulating factor (cfms), BTK, ckit, cmet, fibroblast growth factor (FGF) receptors, Trk receptors (TrkA, TrkB and TrkC), ephrin (eph) receptors and the RET proto-oncogene. Several growth receptor inhibitors are under development, including ligand antagonists, antibodies, tyrosine kinase inhibitors, and antisense oligonucleotides. Growth factor receptors and agents that inhibit growth factor receptor function are described, for example, in Kath, John C., Exp. Opin. Ther. Patents (2000) 10(6):803-818; Shawver et al DDT Vol 2, No. 2 February 1997; and Lofts, F.J. et al, “Growth factor receptors as targets,” New Molecular Targets for Cancer Chemotherapy, ed. Workman, Paul and Kerr, David, CRC press 1994, London.

Where appropriate, the pharmaceutically active compounds of the present invention are used in combination with a VEGFR inhibitor, where appropriate 5-[[4-[(2,3-dimethyl-2H-indazol-6-yl)methylamino]-2-pyrimidinyl]amino ]-2-methylbenzenesulfonamide or a pharmaceutically acceptable salt thereof, as appropriate, a monohydrochloride salt thereof, as disclosed and claimed in International Application No. PCT/US 01/49367, having an international filing date of December 19, 2001, International Publication Number WO 02/ 059110 and an international publication date of August 1, 2002, the full description of which is incorporated herein by reference, and which is the compound of Example 69. 5-[[4-[(2,3-dimethyl-2H-indazole-6- yl)methylamino]-2-pyrimidinyl]amino]-2-methylbenzenesulfonamide can be prepared as described in International Application No. PCT/US 01/49367.

Where appropriate, 5-[[4-[(2,3-dimethyl-2H-indazol-6-yl)methylamino]-2-pyrimidinyl]amino]-2-methylbenzenesulfonamide is present in the monohydrochloride form. This salt form can be obtained by one skilled in the art as described in International Application No. PCT/US 01/49367, having an international filing date of December 19, 2001.

5-[[4-[(2,3-Dimethyl-2H-indazol-6-yl)methylamino]-2-pyrimidinyl]amino]-2-methylbenzenesulfonamide is sold as a monohydrochloride and is known by the generic name pazopanide and the trade name Votrient® (votrient).

Pazopanib is prescribed for the treatment of cancer and ocular disease/angiogenesis. Where appropriate, the present invention relates to the treatment of cancer ocular disease/angiogenesis, age-related macular degeneration, the methods comprising the compounds of Formula (I) alone in combination with pazopanib.

Tyrosine kinases that are not growth factor receptor kinases are called non-receptor tyrosine kinases. Non-receptor tyrosine kinases for use in the present invention that are targets or potential targets of anticancer drugs include cSrc, Lck, Fyn, Yes, Jak, cAbl, FAK (focal adhesion kinase), Bruton's tyrosine kinase and Bcr-Abl. Such non-receptor kinases and agents that inhibit the function of non-receptor tyrosine kinases are described in Sinh, S., Corey, S. J., (1999) Journal of Hematotherapy and Stem Cell Research 8 (5): 465-80; and Bolen, J.B., Brugge, J.S., (1997) Annual review of Immunology. 15: 371-404.

SH2/SH3 domain blockers are agents that disrupt SH2 or SH3 domain binding in various enzymes or adapter proteins, including the p85 PI3-K subunit, Src family kinases, adapter molecules (She, Crk, Nek, Grb2) and Ras-GAP. SH2/SH3 domains as targets for anticancer drugs are discussed in Smithgall, T.E. (1995), Journal of Pharmacological and Toxicological Methods. 34 (3) 125-32.

Serine/threonine kinase inhibitors, including blockers of the MAP kinase cascade, which include blockers of Raf kinases (rafk), mitogen or extracellular signal-regulated kinase (MEK) and extracellular signal-regulated kinase (ERK); and blockers of protein kinase C family members, including PKC (alpha, beta, gamma, epsilon, mu, lambda, iota, zeta) blockers. IkB family of kinases (IKKa, IKKb), PKB family kinases, akt kinase family members, PDK1 and TGF-beta kinases. Such serine/threonine kinases and their inhibitors are described in Yamamoto, T., Taya, S., Kaibuchi, K., (1999), Journal of Biochemistry. 126 (5) 799-803; Brodt, P, Samani, A., Navab, R. (2000), Biochemical Pharmacology, 60. 1101-1107; Massague, J., Weis-Garcia, F. (1996) Cancer Surveys. 27: 41-64; Philip, P.A., Harris, A.L. (1995), Cancer Treatment and Research. 78: 3-27, Lackey, K. et al Bioorganic and Medicinal Chemistry Letters, (10), 2000, 223-226; U.S. Patent no. 6,268,391; Pearce, L.R et al. Nature Reviews Molecular Cell Biology (2010) 11, 9–22. and Martinez-Iacaci, L., et al, Int. J. Cancer (2000), 88(1), 44-52.

When appropriate, the pharmaceutically active compounds of the present invention are used in combination with a MEK inhibitor. When appropriate, N-{3-[3-cyclopropyl-5-(2-fluoro-4-iodo-phenylamino)-6,8-dimethyl-2,4,7-trioxo-3,4,6,7- tetragadro-2H-pyrido[4,3-d]pyrimidin-1-yl]phenyl}acetamide, or a pharmaceutically acceptable solvate thereof, where appropriate a dimethyl sulfoxide solvate thereof, as disclosed and claimed in International Patent Application No. PCT/JP 2005/011082, having an international filing date of June 10, 2005; international publication number WO 2005/121142 and the international publication date of December 22, 2005, which is incorporated herein by reference in its entirety. N-{3-[3-cyclopropyl-5-(2-fluoro-4-iodo-phenylamino)-6,8-dimethyl-2,4,7-trioxo-3,4,6,7-tetrahydro-2H- Pyrido[4,3-d]pyrimidin-1-yl]phenyl}acetamide can be prepared as described in US Patent Publication US 2006/0014768, published January 19, 2006, the disclosure of which is incorporated herein by reference in its entirety.

When appropriate, the pharmaceutically active compounds of the present invention are used in combination with a B-Raf inhibitor. When appropriate, it is N-{3-[5-(2-Amino-4-pyrimidinyl)-2-(1,1-dimethylethyl)-1,3-thiazol-4-yl]-2-fluorophenyl}-2 ,6-difluorobenzenesulfonamide, or a pharmaceutically acceptable salt thereof, which are disclosed and claimed in International Patent Application No. PCT/US 2009/042682, having an international filing date of May 4, 2009, the contents of which are incorporated herein by reference in their entirety. N-3-[5-(2-amino-4-pyrimidinyl)-2-(1,1-dimethylethyl)-1,3-thiazol-4-yl]-2-fluorophenyl}-2,6-difluorobenzenesulfonamide can be prepared as described in International Patent Application No. PCT/US 2009/042682.

When appropriate, the pharmaceutically active compounds of the present invention are used in combination with an Akt inhibitor. When appropriate, it is N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazole-5 -yl)-2-furancarboxamide or a pharmaceutically acceptable salt thereof, which is described and claimed in international patent application No. PCT/US 2008/053269, having an international filing date of February 7, 2008; international publication number WO 2008/098104 and international publication date August 14, 2008, the disclosure of which is incorporated herein by reference in its entirety. N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)- 2-furancarboxamide is the compound of Example 224 and can be prepared as described in International Patent Application No. PCT/US2008/053269.

When appropriate, the pharmaceutically active compounds of the present invention are used in combination with an Akt inhibitor. When appropriate, this N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl )-2-thiophenecarboxamide or a pharmaceutically acceptable salt thereof, which is described and claimed in international patent application No. PCT/US 2008/053269, having an international filing date of February 7, 2008; international publication number WO 2008/098104 and international publication date August 14, 2008, the disclosure of which is incorporated herein by reference in its entirety. N-{(1S)-2-amino-1-[(3fluorophenyl)metal]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide is is the compound of Example 96 and can be prepared as described in International Patent Application No. PCT/US2008/053269. When appropriate, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl) -2-thiophenecarboxamide is presented in the form of the hydrochloride salt. A skilled person will be able to obtain the salt form based on the description in international patent application No. PCT/US 2010/022323, having an international filing date of January 28, 2010.

Inhibitors of members of the phosphotidylinositol 3 kinase family, including PI3-kinase, ATM, DNA-PK, and Ku blockers, can also be used in the present invention. Such kinases are discussed in Abraham, R.T. (1996), Current Opinion in Immunology. 8 (3) 412-8; Canman, C.E., Lim, D.S. (1998), Oncogene 17 (25) 3301-3308; Jackson, S.P. (1997), International Journal of Biochemistry and Cell Biology. 29 (7): 935-8; and Zhong, H. et al, Cancer res, (2000) 60(6), 1541-1545.

Also of interest to the present invention are inhibitors of myo-inositol signaling, such as phospholipase C blockers and myo-inositol analogues. Such signaling inhibitors are described in Powis, G. and Kozikowski A., (1994) New Molecular Targets for Cancer Chemotherapy ed., Paul Workman, and David Kerr, CRC press 1994, London.

Another group of signaling cascade inhibitors are Ras oncogene inhibitors. Such inhibitors include inhibitors of farnesyltransferase, geranylgeranyltransferase and CAAX proteases, as well as antisense oligonucleotides, ribozymes and immunotherapies. Such inhibitors have been shown to block ras activation in cells containing wild-type mutant ras, thereby acting as antiproliferative agents. Suppression of Ras oncogenes is discussed in Scharovsky, O. G., Rozados, V. R., Gervasoni, S. L. Matar, P. (2000), Journal of Biomedical Science. 7 (4) 292-8; Ashby, M.N. (1998), Current Opinion in Lipidology. 9 (2) 99-102; and BioChim. Biophys. Acta, (19899) 1423(3): 19-30.

As mentioned above, antibodies that antagonize receptor kinase ligand binding can also serve as signal transduction inhibitors. This group of signaling cascade inhibitors includes the use of humanized antibodies to the extracellular ligand-binding domain of receptor tyrosine kinases. For example, Imclone C225 EGFR-specific antibody (see Green, M. S. et al., Monoclonal Antibody Therapy for Solid Tumors, Cancer Treat. Rev., (2000), 26 (4), 269-286); Herceptin® (herceptin) is an antibody to erbB2 (see Tyrosine kinase signaling in breast cancer: ErbB family receptor tyrosine kinases, Breast Cancer Res, 2000, 2 (3), 176-183); and 2CB VEGFR2 specific antibody (see Brekken, R. A. et al., Selective Inhibition of VEGFR2 Activity by a monoclonal Anti-VEGF antibody blocks tumor growth in mice, Cancer Res. (2000) 60, 5117-5124).

Non-receptor kinase angiogenesis inhibitors can be used in the present invention. Inhibitors of VEGFR and TIE2, which are associated with angiogenesis, are discussed above in relation to signal transduction inhibitors (both receptor tyrosine kinases). Angiogenesis is generally associated with erbB2/EGFR signaling, as erbB2 and EGFR inhibitors have been shown to inhibit angiogenesis, primarily VEGF expression. Accordingly, non-receptor kinase inhibitors can be used in combination with the compounds of the present invention. For example, anti-VEGF antibodies, which do not recognize VEGFR (receptor tyrosine kinase) but bind to the ligand; low molecular weight integrin inhibitors (alpha, betase), which inhibit angiogenesis; endostatin and angiostatin (non-RTK) may also be useful in combination with the described compounds. (See Bruns CJ et al. (2000), Cancer Res., 60: 2926-2935; Schreiber AB, Winkler ME, Derynck R. (1986), Science, 232: 1250-1253; Yen L et al. (2000 ), Oncogene 19: 3460–3469).

Agents used in immunotherapeutic regimens may also be used in combination with compounds of Formula (I). There are a number of immunological strategies to generate an immune response. These strategies typically fall within the realm of tumor vaccination. The effectiveness of immunological approaches can be significantly increased by combined inhibition of signaling pathways using a small molecule inhibitor. A discussion of the immunological approach/tumor vaccine against erbB2/EGFR can be found in Reilly RT et al. (2000), Cancer Res. 60: 3569-3576; and Chen Y, Hu D, Eling DJ, Robbins J and Kipps TJ. (1998), Cancer Res. 58: 1965-1971.

Agents used in pro-apoptotic regimens (eg, bcl-2 antisense oligonucleotides) can also be used in combination according to the present invention. Members of the Bcl-2 family of proteins block apoptosis. Thus, up-regulation of bcl-2 is associated with chemoresistance. Studies have shown that epidermal growth factor (EGF) stimulates anti-apoptotic members of the bcl-2 family (i.e. mcl-1). Accordingly, strategies designed to suppress bcl-2 expression in tumors have demonstrated clinical efficacy and are now in phase II/III trials, specifically Genta's bcl-2 antisense oligonucleotide G3139. Such proapoptotic strategies using antisense oligonucleotide strategies for bcl-2 are discussed in Water JS et al. (2000), J. Clin. Oncol. 18: 1812-1823; and Kitada S. et al. (1994), Antisense Res. Dev. 4: 71-79.

Cell cycle signaling inhibitors inhibit molecules involved in cell cycle control. A family of protein kinases called cyclin-dependent kinases (CDKs) and their interaction with a family of proteins called cyclins control progression through the eukaryotic cell cycle. Coordinated activation and inactivation of various cyclin CDK complexes is essential for normal cell cycle progression. Several cell cycle signaling inhibitors are under development. For example, examples of cyclin-dependent kinases, including CDK2, CDK4 and CDK6, and their inhibitors are described, for example, in Rosania et al, Exp. Opin. Ther. Patents (2000) 10(2):215-230. In addition, p21WAF1/CIP1 has been described as a potent and versatile inhibitor of cyclin-dependent kinases (Cdks) (Ball et al., Progress in Cell Cycle Res., 3: 125 (1997)). Compounds known to induce p21WAF1/CIP1 expression are involved in the suppression of cell proliferation and have tumor suppressive activity (Richon et al., Proc. Nat Acad. Sci. USA 97 (18): 10014-10019 (2000).) , and are included as inhibitors of cell signaling. Histone deacetylase (HDAC) inhibitors are involved in the transcriptional activation of p21WAF1/CIP1 (Vigushin et al., Anticancer Drugs, 13 (1): 1-13 (Jan 2002)) and are suitable cell signaling inhibitors for use in combination herein.

Examples of such HDAC inhibitors include:

1. Vorinostat, including its pharmaceutically acceptable salts. Marks et al., Nature Biotechnology 25, 84 - 90 (2007); Stenger, Community Oncology 4, 384-386 (2007).

Vorinostat has the following chemical structure and name:

2. Romidepsin, including its pharmaceutically acceptable salts. Vinodhkumar et al., Biomedicine & Pharmacotherapy 62 (2008) 85-93. Romidepsin has the following chemical structure and name:

3. Panobinostat, including its pharmaceutically acceptable salts. Drugs of the Future 32(4): 315-322 (2007).

Panobinostat has the following chemical structure and name:

4. Valproic acid, including its pharmaceutically acceptable salts. Gottlicher, et al., EMBO J. 20(24): 6969–6978 (2001).

Valproic acid has the following chemical structure and name:

5. Mocetinostat (MGCD0103), including its pharmaceutically acceptable salts. Balasubramanian et al., Cancer Letters 280: 211-221 (2009).

Mocetinostat has the following chemical structure and name:

Additional examples of such HDAC inhibitors include those given in Bertrand European Journal of Medicinal Chemistry 45, (2010) 2095-2116, see in particular the compounds listed in Table 3 of this source, shown below.

Proteasome inhibitors are drugs that block the action of proteasomes, cellular complexes and destroy proteins such as the p53 protein. Several proteasome inhibitors are on the market or under investigation for the treatment of cancer. Suitable proteasome inhibitors for use in combination herein include:

1. Bortezomib (Velcade®), including its pharmaceutically acceptable salts. Adams J, Kaufftnan M (2004), Cancer Invest 22 (2): 304-11.

Botrezomib has the following chemical structure and name.

2. Disulfiram. including its pharmaceutically acceptable salts. Bouma et al. (1998). J. Antimicrob. Chemother. 42 (6): 817-20.

Disulfiram has the following chemical structure and name.

3. Epigallocatechin gallate (EGCG), including its pharmaceutically acceptable salts. Williamson et al., (December 2006), The Journal of Allergy and Clinical Immunology 118 (6): 1369-74.

Epigallocatechin gallate has the following chemical structure and name.

4. Salinosporamide A, including its pharmaceutically acceptable salts. Feling et at., (2003), Angew. Chem. Int. Ed. Engl. 42 (3): 355-7.

Salinosporamide A has the following chemical structure and name.

5. Carfilzomib, including its pharmaceutically acceptable salts. Kuhn DJ, et al, Blood, 2007, 110:3281-3290.

Carfilzomib has the following chemical structure and name.

The 70 kilodalton heat shock proteins (Hsp70) and the 90 kilodalton heat shock proteins (Hsp90) are families of ubiquitously expressed heat shock proteins. The expression of Hsp70 and Hsp90 proteins is increased in some types of cancer. Several Hsp70 and Hsp90 inhibitors are being investigated for the treatment of cancer. Suitable Hsp70 and Hsp90 inhibitors for use in combination herein include:

1. 17-AAG (geldanamycin), including its pharmaceutically acceptable salts. Jia W et al. Blood. 2003 Sep 1:102(5):1824-32.

17-AAG(geldanamycin) has the following chemical structure and name.

2. Radicol, including its pharmaceutically acceptable salts. (Lee et al., Mol Cell Endocrinol. 2002, 188.47-54)

Radicol has the following chemical structure and name.

Cancer Metabolism Inhibitors - Many tumor cells exhibit metabolism that is significantly different from normal tissue. For example, the rate of glycolysis, the metabolic process that converts glucose to pyruvate, is increased, and the pyruvate generated is reduced to lactate instead of being oxidized in the mitochondria in the tricarboxylic acid (TCA) cycle. This effect is often observed even under aerobic conditions and is known as the Warburg effect.

Lactate dehydrogenase A (LDH-A), one of the isoforms of lactate dehydrogenase, one of the isoforms of lactate dehydrogenase expressed in muscle cells, plays a very important role in the metabolism of tumor cells, reducing pyruvate to lactate, which can then be excreted from the cell. This enzyme has been shown to be up-regulated in many tumor types. Alterations in glucose metabolism, described in the Warburg effect, are critical for the growth and proliferation of cancer cells; and blocking LDH-A using RNA has been shown to reduce cell proliferation and tumor growth in xenograft models.

D.A. Tennant et. al., Nature Reviews, 2010, 267. P. Leder, et. al., Cancer Cell, 2006, 9, 425.

High levels of fatty acid synthase (FAS) have been found in precursors of cancerous lesions. Pharmacological inhibition of FAS affects the expression of key oncogenes involved in both the development and maintenance of cancer. Alli et al. Oncogene (2005) 24, 39-46. doi:10.1038

Cancer metabolism inhibitors, including LDH-A inhibitors and fatty acid biosynthesis inhibitors (or FAS inhibitors), are suitable for use in combination with the compounds of this invention.

In one embodiment, a method of treating cancer according to the claimed invention includes co-administration of a compound of Formula I, Ia, Ib, II or III and/or a pharmaceutically acceptable salt thereof and at least one antineoplastic agent, such as an agent selected from the group consisting of agents , acting on microtubules, platinum coordination complexes, alkylating agents, antibiotics, topoisomerase II inhibitors, antimetabolites, topoisomerase I inhibitors, hormones and hormone analogs, inhibitors of signaling cascades, non-receptor tyrosine kinase inhibitors of angiogenesis, immunotherapeutic agents, proapoptotic agents, cell signaling inhibitors cycle; proteasome inhibitors; and cancer metabolism inhibitors.

In one embodiment, a compound of Formula I, Ia and Ib is used as a chemosensitizer to increase the efficiency of killing tumor cells.

In one embodiment, a compound of Formula I, Ia, Ib, II, or III is used as a chemosensitizer to enhance tumor cell killing efficiency.

In one embodiment, a compound of Formula I, Ia, Ib, II or III is used in combination with a compound that inhibits the activity of the protein kinase R (PKR)-like ER kinase, PERK (PERK inhibitor).

Where appropriate, compounds of Formula I, Ia, Ib, II, III and their pharmaceutically acceptable salts may be co-administered with at least one other active agent known to be a PERK kinase (EIF2K3) inhibitor to treat or reduce the severity of neurodegenerative disease/injury such as Alzheimer's disease, spinal cord injury, traumatic brain injury, ischemic stroke, stroke, diabetes, Parkinson's disease, Huntington's disease, Creutzfeldt-Post-associated prion diseases, progressive supranuclear palsy, amyotrophic lateral sclerosis, myocardial infarction , cardiovascular disease, inflammation, fibrosis, chronic and acute liver diseases, chronic and acute lung diseases, chronic and mild kidney diseases, chronic traumatic encephalopathy (CTE, CTE), neurodegeneration, dementia, traumatic brain injury, cognitive impairment, atherosclerosis, eye diseases, arrhythmias, during organ transplantation and during transportation of organs for transplantation.

"Chemotherapeutic" or "chemotherapeutic agent" is used in accordance with its plain meaning and refers to a chemical composition or compound having antineoplastic properties or the ability to inhibit cell growth or proliferation.

Additionally, the compounds described herein can be co-administered with conventional immunotherapeutic agents, including, but not limited to, the following: immunostimulants (e.g., Bacillus Calmette-Guerin (BCG), levamisole, interleukin-2, alpha-interferon, etc.) , monoclonal antibodies (e.g. anti-CD20, anti-HER2, anti-CD52, anti-HLA-DR and anti-VEGF monoclonal antibodies), immunotoxins (e.g. anti-CD33 conoclonal antibody calicheamicin conjugate, anti-CD22 monoclonal antibody-Pseudomonas aeruginosa endotoxin conjugate, etc. .), and radioimmunotherapeutic agents (for example, anti-CD20 antibody conjugated to ¹¹¹ In, ⁹⁰ Υ or ¹³¹ Ι, etc.).

In another embodiment, the compounds described herein can be co-administered with conventional radiotherapeutic agents, including, but not limited to, radionuclides such as ⁴⁷ Sc, ⁶ MC, ⁶⁷ C, ⁸⁹ Sr, ⁸⁶ Y, ⁸⁷ Υ and ²¹² Bi, optionally conjugated with antibodies directed against tumor antigens.

Additional examples of other active ingredient or ingredients (antineoplastic agents) for use in combination or co-administration with the present compounds include anti-PD-L1 agents.

Antibodies against PD-L1 and methods of preparation are known in the art. Such anti-PD-L1 antibodies may be polyclonal or monoclonal, and/or recombinant, and/or humanized. Examples of antibodies to PD-L1 are disclosed in:

US Patent No. 8,217,149; 12/633.339;

US Patent No. 8,383,796; 13/091.936;

US Patent No. 8,552,154; 13/120.406;

US patent No. 20110280877; 13/068337;

US patent No. 20130309250; 13/892671;

WO2013019906;

WO2013079174;

US Patent Application 13/511,538 (filed August 7, 2012), which is a US national phase application based on International Application No. PCT/US10/58007 (filed 2010;

And

US Patent Application 13/478,511 (filed May 23, 2012).

Additional examples of antibodies to (also called CD274 or B7-H1) and methods of use are disclosed in US Patent No. 7,943,743; US 20130034559, WO 2014055897, US Patent 8,168,179 and US Patent 7,595,048. Antibodies to PD-L1 are being developed as immunomodulatory agents for the treatment of cancer.

In one embodiment, the anti-PD-L1 antibody is the antibody disclosed in US Pat. No. 8,217,149. In another embodiment, the anti-PD-L1 antibody comprises the CDR regions of the antibody disclosed in US Pat. No. 8,217,149.

In another embodiment, the anti-PD-L1 antibody is the antibody disclosed in US Patent Application No. 13/511,538. In another embodiment, the anti-PD-L1 antibody comprises the CDR regions of the antibody disclosed in US Patent Application No. 13/511,538.

In another embodiment, the anti-PD-L1 antibody is the antibody disclosed in Patent Application No. 13/478,511. In another embodiment, the anti-PD-L1 antibody comprises the CDR regions of the antibody disclosed in US Patent Application No. 13/478,511.

In one embodiment, the anti-PD-L1 antibody is BMS-936559 (MDX-1105). In another embodiment, the anti-PD-L1 antibody is MPDL3280A (RG7446). In another embodiment, the anti-PD-L1 antibody is MEDI4736.

Additional examples of additional active ingredient or ingredients (antitumor agent) for use in combination or with the ATF4 pathway inhibitory compounds of the present invention include PD-1 antagonists

"PD-1 antagonist" means any chemical compound or biological molecule that blocks the binding of PD-L1 expressed on a cancer cell to PD-1 expressed on an immune cell (T cell, B cell or ΝΚΤ cell) and preferably also blocks the binding of PD-L2 expressed on the cancer cell to PD-1 expressed on the immune cell. Additional names or synonyms for PD-1 and its ligands include: PDCD1, PD1, CD279, and SLEB2 for PD-1; PDCD1L1, PDL1, B7H1, B7-4, CD274 and B7-H for PD-L1; and PDCD1L2, PDL2, B7-DC, Btdc and CD273 for PD-L2. In any embodiments of aspects or embodiments of the present invention that are intended to treat a human, the PD-1 antagonist blocks binding of human PD-L1 to human PD-1, and preferably blocks both binding of human PD-L1 and binding of human PD-L2 with human PD-1. The amino acid sequences of human PD-1 can be found at NCBI, locus no.: NP 005009. The amino acid sequences of human PD-L1 and PD-L2 can be found at NCBI, locus no.: NP_054862 and NP_079515, respectively.

PD-1 antagonists that can be used in any of the aspects of the present invention include a monoclonal antibody (mAb, mAb), or antigen binding fragment thereof, that specifically binds to PD-1 or PD-L1, and preferably specifically binds to human PD-1 or human PD-L1. The mAb may be a human antibody, a humanized antibody, or a chimeric antibody, and may include a human constant region. In some embodiments, the human constant region is selected from the group consisting of IgG1, IgG2, IgG3, and IgG4 constant regions, and in preferred embodiments, the human constant region is an IgG1 or IgG4 constant region. In some embodiments, the antigen binding fragment is selected from the group consisting of Fab, Fab'-SH, F(ab')2, scFv, and Fv fragments.

Examples of MATs that bind to human PD-1 and can be used in various aspects and embodiments of the present invention are described in US 7488802, US 7521051, US 8008449, US 8354509, US 8168757, WO 2004/004771, WO 2004/072286, WO 2004/056875 and US 2011/0271358.

Specific human anti-PD-1 mAbs that can be used as a PD-1 antagonist in any of the aspects and embodiments of the present invention include: MK-3475, a humanized IgG4 Mab with the structure described in WHO Drag Information, Vol.27, No. . 2, 161-162 (2013) and which contains the amino acid sequences of the heavy and light chains shown in Fig. 6; nivolumab, a human IgG4 MAb, the structure of which is described in WHO Drug Information, Vol.27, No. 1, 68-69 (2013), which contains the amino acid sequences of the heavy and light chains shown in Fig. 7; humanized antibodies h409Al 1, h409A16 and I409A17, which are described in WO 2008/156712, and AMP-514, which is being developed by Medimmune.

Other PD-1 antagonists that can be used in any of the aspects and embodiments of the present invention include an immunoadhesin that specifically binds to PD-1, and preferably specifically binds to human PD-1, for example, a fusion protein containing extracellular or PD-1 1-binding portion of PD-L1 or PD-L2 fused to a constant region, such as the Fc region of an immunoglobulin molecule. Examples of immunoadhesion molecules that specifically bind to PD-1 are described in WO 2010/027827 and WO 2011/066342. Specific fusion proteins that can be used as a PD-1 antagonist for the treatment methods, medicinal products and applications of the present invention include AMP-224 (also known as B7-DCIg), which is a PD-L2-FC fusion protein and binds with human PD-1.

Other examples of mAbs that bind to human PD-L1 and can be used in the treatments, formulations and applications of the present invention are described in WO 2013/019906, WO 2010/077634 A1 and US 8383796. Specific monoclonal antibodies against PD-L1 human used as a PD-1 antagonist for the method of treatment, medicinal products and use according to the present invention include MPDL3280A, BMS-936559, MEDI4736, MSB0010718C.

KEYTRUDA/pembrolizumab is an anti-PD-1 antibody. marketed for the treatment of lung cancer by Merck. The amino acid sequence of pembrolizumab and methods of its use are disclosed in US Patent No. 8,168,757.

Opdivo/nivolumab is a fully human monoclonal antibody marketed by Bristol Myers Squibb directed against the negative human cell surface immunoregulatory receptor PD-1 (programmed cell death-1 or programmed cell death-1/PCD-1) and has immunopotentiating properties. activity. Nivolumab binds to and blocks the activation of PD-1, a transmembrane protein of the Ig superfamily, by its ligands PD-L1 and PD-L2, resulting in activation of T cells and cell-mediated immune responses against tumor cells or pathogens. Activated PD-1 negatively regulates the activation of T cell effector function and by suppressing the activation of the P13k/Akt pathway. Other names for nivolumab include: BMS-936558, MDX-1106, and ONO-4538. The amino acid sequence for nivolumab, as well as methods of use and preparation, are disclosed in US Patent No. 8,008,449.

Additional examples of additional active ingredient or ingredients (antitumor agent) for use in combination or with a compound of the present invention include immunomodulators.

As used herein, “immunomodulators” refers to any substance, including monoclonal antibodies, that affects the immune system. ICOS-binding proteins according to the present invention can be considered as immunomodulators. Immunomodulators can be used as antitumor agents to treat cancer. For example, immunomodulators include, but are not limited to, anti-CTLA-4 antibodies such as ipilimumab (YERVOY) and anti-PD-1 antibodies (Opdivo/nivolumab and Keytruda/pembrolizumab). Other immunomodulators include, but are not limited to: antibodies to OX-40, antibodies to PD-L1, antibodies to LAG3, antibodies to TIM-3, antibodies to 41 BB and antibodies to GITR.

Yervoy (ipilimumab) is a fully human anti-CTLA-4 antibody marketed by Bristol Myers Squibb. The protein structure of ipilimumab and methods of its use are described in US patents No. 6,984,720 and 7,605,238.

In another embodiment, the present invention provides a compound of Table 1 described herein, or Formula (I), (Ia), (Ib), (II) or (III), or a pharmaceutically acceptable salt or prodrug thereof, for use in treating a disease, a condition or disorder associated with the hepatitis B virus. The present invention provides a compound of Table 1, or a pharmaceutically acceptable salt or prodrug thereof, for use in the treatment of a disease, condition or disorder associated with the hepatitis B virus, wherein said disease, condition or disorder, associated with hepatitis B virus, may be jaundice, liver cancer, liver inflammation, liver fibrosis, liver cirrhosis, liver failure, diffuse inflammatory hepatocellular disease, hemophagocytic syndrome or serum hepatitis).

In further embodiments, the compound of the present invention of Formula (I), (Ia), (Ib), (II) or (III), or a pharmaceutically acceptable salt thereof, is selected from the group of compounds presented in Table 1. Additionally, the present invention also covers each of these compounds separately and its pharmaceutically acceptable salts.

In another embodiment, a pharmaceutical composition is provided comprising a pharmaceutically acceptable diluent and a therapeutically effective amount of a compound of Formula I, Ia, Ib, II or III or a pharmaceutically acceptable salt thereof.

In some embodiments, the compound(s) of the present invention, or a pharmaceutically acceptable salt, are selected from those presented in Table 1. The compounds of the present invention, or a pharmaceutically acceptable salt of such a compound, may be presented in the form of a pharmaceutically acceptable salt. The term "pharmaceutically acceptable salt" refers to salts derived from pharmaceutically acceptable inorganic and organic acids and bases. Accordingly, the word “or” in the context of “a compound or a pharmaceutically acceptable salt thereof” should be understood to refer to either the compound or a pharmaceutically acceptable salt thereof (alternative) or the compound and a pharmaceutically acceptable salt thereof (in combination).

As used herein, the term "pharmaceutically acceptable" refers to compounds, materials, compositions and dosage forms that are suitable for use with human and animal tissues without excessive toxicity, irritation or other problems or complications.

One skilled in the art will appreciate that pharmaceutically acceptable salts of compounds corresponding to formulas I, Ia, Ib, II or III can be prepared. These pharmaceutically acceptable salts can be prepared in situ during the final isolation and purification of the compound or by separately reacting the purified compound in free acid or free base form with a suitable base or acid, respectively.

Exemplary pharmaceutically acceptable acid salts of a compound of the present invention may be prepared from the following acids, including, without limitation, formic, acetic, propionic, benzoic, succinic, glycolic, gluconic, lactic, maleic, malic, tartaric, citric, nitric, ascorbic, glucuronic , maleic, formic, pyruvic, aspartic, glutamic, benzoic, hydrochloric, hydrobromic, hydroiodic, isocitric, trifluoroacetic, pamoic, propionic, nthranilic, methanesulfonic, oxaloacetic, oleic, stearic, salicylic, p-hydroxybenzoic, nicotinic, phenylacetic almond, almond, embon (pamoic), methanesulfonic, phosphoric, phosphonic, ethanesulfonic, benzenesulfonic, pantothenic, toluenesulfonic, 2-hydroxyethanesulfonic, sulfanilic, sulfuric, salicylic, cyclohexylaminosulfonic, algenic, -hydroxybutyric, galactaric and galacturic acids. Preferred pharmaceutically acceptable acids include the salts of hydrochloric acid and trifluoroacetic acid.

Exemplary pharmaceutically acceptable inorganic base salts of the compounds of the present invention include metal ions. More preferred metal ions include, but are not limited to, suitable alkali metal salts, alkaline earth metal salts and other physiologically acceptable metal ions. Salts derived from inorganic bases include aluminum, ammonium, calcium, copper, ferric, ferrous, magnesium, manganese, manganese, potassium, sodium, zinc and the like. and according to their usual valences. Examples of base salts include aluminum, calcium, lithium, magnesium, potassium, sodium and zinc. Other examples of base salts include ammonium, calcium, magnesium, potassium and sodium salts. Other examples of base salts include, for example, hydroxides, carbonates, hydrides and alkoxides, including NaOH, KOH, Na ₂ CO ₃ , K ₂ CO ₃ , NaH and potassium t-butoxide.

Salts derived from pharmaceutically acceptable non-toxic organic bases include salts of primary, secondary and tertiary amines, including, in part, trimethylamine, diethylamine, N,N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine (N-methylglucamine) and procaine ; substituted amines, including natural substituted amines; cyclic amines; quaternary ammonium cations; and basic ion exchange resins such as arginine, betaine, caffeine, choline, N,N-dibenzylethylenediamine, diethylamine, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethylmorpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, hydraba min , isopropylamine, lysine, methylglucamine, morpholine, piperazine, piperidine, polyamine resins, procaine, purines, theobromine, triethylamine, trimethylamine, tripropylamine, tromethamine, etc.

All of the above salts can be prepared by those skilled in the art by conventional methods from the corresponding compound of the present invention. For example, the pharmaceutically acceptable salts of the present invention can be synthesized from a parent compound that contains a basic or acidic moiety by conventional chemical methods. Typically, such salts can be prepared by reacting the free such compounds in free acid or base form with a stoichiometric amount of a suitable base or acid in water, an organic solvent, or mixtures thereof; Non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol or acetonitrile are generally preferred. The salt can be precipitated from solution and collected by filtration or can be isolated by evaporation of the solvent. The degree of ionization of a salt can vary from completely ionized to almost non-ionized. Lists of suitable salts can be found in Remington's Pharmaceutical Sciences. 17th ed., Mack Publishing Company, Easton, Pa., 1985, p.1418, also in Berge, J. Pharm. Sci., 1977, 66, 1-19, or those listed in P Η Stahl and C G Wermuth, editors, Handbook of Pharmaceutical Salts; Properties, Selection and Use, Second Edition Stahl/Wermuth: Wiley-VCH/VHCA, 2011 (see http://www.wiley.com/WileyCDA/WileyTitle/productCd-3906390519.html, the contents of which are incorporated herein in their entirety by references are only to the list of suitable salts.

The compounds of Formula (I), (Ia), (Ib), (II) or (III) according to the present invention may exist in both unsolvated and solvated forms. The term "solvate" includes a compound of the invention and one or more molecules of a pharmaceutically acceptable solvent, for example ethanol. The term "hydrate" is used when said solvent is water. Pharmaceutically acceptable solvates include hydrates and other solvates, and the crystallization solvent may be substituted with an isotope, for example, D ₂ O, d ₆ -acetone, d ₆ -DMSO.

Compounds of Formula (I), (Ia), (Ib), (II) or (III) containing one or more asymmetric carbon atoms may exist as two or more stereoisomers. In the case where the compound of Formula (I), (Ia), (Ib), (II) or (III) contains an alkenyl group or an alenylene group or a cycloalkyl group, geometric cis/trans (or Z/E) isomers may exist. In the case where the compound contains, for example, a keto group or an oxime group, tautomer isomerism (tautomerism) may occur. Therefore, one compound can have more than one type of isomerism.

Included within the scope of the claimed compounds of the present invention are all stereoisomers, geometric isomers and tautomeric forms of the compounds of Formula I, Ia, Ib, II or III, including compounds exhibiting more than one type of isomerism, and mixtures of one or more of them. Also included are acid or base addition salts in which the counterion is optically active, such as D-lactate or L-lysine, or racemates, such as DL-tartrate or DL-arginine.

Cis/trans isomers can be separated by conventional techniques well known to those skilled in the art, for example by chromatography or fractional crystallization.

Conventional methods for preparing/isolating individual enantiomers include chiral synthesis from a suitable optically pure precursor or resolution of the racemate (or racemate salt or derivative) using, for example, chiral high pressure chromatography (HPLC).

Alternatively, the racemate (or racemic precursor) can be reacted with a suitable optically active compound, for example an alcohol, or, in the case where the compound of formula I, Ia, Ib, II or III contains an acidic or basic moiety, an acid or a base such as tartaric acid or 1-phenylethylamine. The resulting diastereomeric mixtures can be separated by chromatography and/or fractional crystallization, and one or both diastereoisomers can be converted to the corresponding pure enantiomer(s) by means well known to those skilled in the art. The chiral compounds of the present invention (and their chiral precursors) can be obtained in enantiomerically enriched form using chromatography, typically HPLC, on resin a with an asymmetric stationary phase and a mobile phase consisting of a hydrocarbon, typically heptane or hexane, containing from 0 to 50% isopropanol, usually 2 to 20%, and 0 to 5% alkylamine, usually 0.1% diethylamine. Concentrating the eluate produces a rich mixture.

Mixtures of stereoisomers can be separated by any conventional techniques known to those skilled in the art [see, for example, "Stereochemistry of Organic Compounds", E L Eliel (Wiley, New York, 1994).]

The present invention includes all pharmaceutically acceptable isotopically labeled compounds of Formula (I), (Ia), (Ib), (II) or (III) in which one or more atoms are replaced by atoms having the same atomic number, but atomic mass or mass number are different from the atomic mass or mass number typically found in nature.

Examples of isotopes suitable for inclusion in the compounds of the present invention include isotopes of hydrogen such as ² H and ³ H, carbon such as ¹¹ C, ¹³ C and ¹⁴ C, chlorine such as ³⁶ Cl, fluorine such as ¹⁸ F , iodine such as ¹²³ I and ¹²⁵ I, nitrogen such as ¹³ N and ¹⁵ N, oxygen such as ¹⁵ O, ¹⁷ O and ¹⁸ O, phosphorus such as ³² P, and sulfur such as ³⁵ S. Certain isotopically labeled compounds of Formulas (I), (Ia), (II) and (IIa), for example, compounds that include a radioactive isotope, are suitable for studies of the distribution of drugs and/or substrates in tissues. The radioactive isotopes of tritium, i.e., ³ H, and carbon-14, i.e., ¹⁴ C, are most suitable for this purpose due to the ease of their inclusion and the ready means of detecting them. Substitution with heavier isotopes such as deuterium, i.e., ^2H , may provide certain therapeutic benefits associated with greater metabolic stability, such as increased in vivo half-life or reduced dosage requirements, and may therefore be preferred in some circumstances.

Isotopically labeled compounds of formulas (I), (Ia), (Ib), (II) or (III) can generally be prepared by conventional methods known to those skilled in the art, or by methods similar to those described herein, using suitable isotopically labeled reagents instead of the previously used unlabeled reagent.

The compounds of the present invention can be administered as prodrugs. Thus, certain derivatives of the compounds of Formula (I), (Ia), (Ib), (II) or (III), which may themselves have little or no pharmacological activity, when administered to or on the body, can be converted into compounds of Formula (I), (Ia), (Ib), (II) or (III) as “prodrugs”.

Administration of the chemical compounds and combinations of such compounds described herein may be by any of the acceptable routes of administration for agents that serve similar functions, including, but not limited to, oral, sublingual, subcutaneous, intravenous, intranasal, topical, transdermal, intraperitoneal, intramuscular , intrapulmonary, vaginal, rectal or intraocular. In some embodiments, oral or parenteral administration is used.

Pharmaceutical compositions or formulations include solid, semi-solid, liquid and aerosol dosage forms such as, for example, tablets, capsules, powders, liquids, suspensions, suppositories, aerosols and the like. Chemical compounds can also be administered in sustained or controlled release dosage forms, including depot injections, osmotic pumps, pills, transdermal (including electrotransport) patches, and the like, for long-term and/or temporary pulse administration at a predetermined rate. In some embodiments, the compositions are presented in unit dosage forms suitable for single administration of a precise dose. The active ingredient can be compressed into granules or small cylinders and implanted subcutaneously or intramuscularly as injectable depots or implants. Implants may use inert materials such as biodegradable polymers or synthetic silicones such as silastic or silicone rubber.

Chemical compounds can also be administered in the form of liposome-based delivery systems, such as small unilamellar vesicles, large unilamellar vesicles, and multilamellar vesicles. Liposomes can be formed from various phospholipids, such as cholesterol, stearylamine, or phosphatidylcholines. Liposomal preparations of tyrosine kinase inhibitors can also be used in the methods of the present invention. Liposomal versions of tyrosine kinase inhibitors can be used to improve tolerance to the inhibitors.

Chemical compounds can also be delivered using monoclonal antibodies as individual carriers to which the compound molecules bind.

Chemical compounds can also be prepared with soluble polymers, such as soluble polymers, as targetable drug carriers. Such polymers may include polyvinylpyrrolidone, pyran copolymer, polyhydroxypropyl methacrylamide phenol, polyhydroxyethyl aspartamide phenol, or polyethylene oxide polylysine substituted with palmitoyl residues. In addition, chemical compounds with biodegradable polymers can be prepared that can be used to obtain controlled release forms of the drug, for example, polylactic acid, polyglycolic acid, copolymers of polylactic acid and polyglycolic acid, polyepsilon caprolactone, polyhydroxybutyric acid, polyorthoesters, polyacetals, polydihydropyrans, polycyanoacrylates or cross-linked or amphipathic block copolymers or hydrogels.

The chemical compounds described herein can be administered either alone or typically in combination with a conventional pharmaceutical carrier, excipient or the like (e.g., mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc, cellulose, croscarmellose sodium, glucose, gelatin, sucrose, magnesium carbonate, etc.). If desired, the pharmaceutical composition may also contain minor amounts of non-toxic excipients such as wetting agents, emulsifiers, solubilizers, pH buffers and the like (for example, sodium acetate, sodium citrate, cyclodextrin derivatives, sorbitan monolaurate, triethanolamine acetate, triethanolamine oleate, etc. .P.). Typically, depending on the intended route of administration, the pharmaceutical composition will contain from about 0.005% to 95%; in some embodiments, from about 0.5% to 50% by weight of the chemical compound. Actual methods for preparing such dosage forms are known or will be apparent to those skilled in the art; for example, see Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pennsylvania.

In some embodiments, said compositions will be in the form of a pill or tablet, and thus the composition will contain, along with the active ingredient, a diluent such as lactose, sucrose, dicalcium phosphate or the like; a lubricant such as magnesium stearate or similar substances; and a binder such as starch, gum arabic, polyvinylpyrrolidine, gelatin, cellulose, cellulose derivatives and the like. In another solid dosage form, the powder, marum, solution or suspension (eg, in propylene carbonate, vegetable oils or triglycerides) is encapsulated in a gelatin capsule.

Liquid compositions suitable for pharmaceutical use can, for example, be prepared by dissolving, dispersing, etc. at least one chemical compound and optionally pharmaceutical excipients in a carrier (eg, water, saline, aqueous dextrose, glycerin, glycols, ethanol, etc.) to form a solution or suspension. Injectable preparations may be in conventional forms, as liquid solutions or suspensions, as emulsions, or in solid forms suitable for dissolution or suspension in liquid for injection. The percentage of chemical compounds contained in such parenteral compositions depends greatly on their specific nature, as well as on the activity of the chemical compounds and the needs of the subject. However, a percentage of active ingredient in solution of 0.01% to 10% may be used and will be higher if the composition is a solid which is subsequently diluted to the above percentages. In some embodiments, the composition may include from about 0.2 to 2% active agent in solution.

Pharmaceutical compositions of the chemical compounds described herein can also be administered to the respiratory tract as an aerosol or nebulizer solution or as a fine powder for insufflation, alone or in combination with an inert carrier such as lactose. In such a case, the particles of the pharmaceutical composition have a diameter of less than 50 microns, in some embodiments, less than 10 microns.

In general, the proposed chemical compounds will be administered in a therapeutically effective amount by any of the accepted routes of administration for agents that serve similar purposes. The dosage regimen using the chemical compounds described herein may be selected according to various factors, including the type, species, age, weight, sex and type of disease being treated, the severity (i.e., stage) of the disease being treated. treat; routes of administration; liver and kidney functions in the patient; and the particular compound or salt used. The dosage regimen can be used, for example, to prevent, suppress (completely or partially), or block the progression of the disease. The drug can be administered more than once a day, for example, once or twice a day.

Intravenously or subcutaneously, the patient may receive the chemical compounds described herein in therapeutically effective amounts sufficient to deliver from about 0.001 to 200 mg per kilogram of body weight per day, for example, about 0.005 to 100 mg/kg/day, for example, from about 0.005 to 1 mg/kg/day.

Accordingly, for administration to a 70 kg person, the dosage range would be approximately 0.35-70 mg per day. Such amounts can be administered in a number of suitable ways, for example, large volumes of low concentrations of chemicals over one extended period of time or several times a day. Such amounts may be administered over one or more consecutive days, spaced days apart, or a combination of both over a week (7-day period). Alternatively, low volumes of high concentrations of chemical compounds over a short period of time, such as once a day for one or more days consecutively, at intervals, or a combination of both over a week (7-day period).

In accordance with the present invention, the chemical compounds described herein can be administered using continuous dosing or dosing at intervals. For example, administration of a chemical compound at intervals may be administration from one to six days per week, or it may mean administration in cycles (e.g., daily administration for two to eight consecutive weeks, then a remaining period without administration for up to one week) or it may mean administration every other day. The compositions can be administered in cycles with the remaining periods between cycles (eg, treatment for two to eight weeks with the remainder of the period up to a week between treatments).

Formulations for subcutaneous administration can be prepared according to procedures known in the art at a pH ranging between about 5 and about 12, such preparations including suitable buffers and isotonicity agents.

In general, the chemical compounds will be administered in the form of pharmaceutical compositions by one of the following routes: oral, systemic (eg, transdermal, intranasal or suppository), or parenteral (eg, intramuscular, intravenous or subcutaneous) administration. In some embodiments, oral administration may be used at a convenient daily dosage that can be adjusted according to the extent of the lesion. The compositions may be in the form of a tablet, pill, capsule, semi-solid, powder, sustained release formulation, solution, suspension, elixir, aerosol or any other suitable composition. Another method of administration of the provided chemicals is inhalation.

The choice of dosage form depends on various factors such as the route of drug administration and the bioavailability of the drug substance. For delivery by inhalation, the chemical compound may be formulated as a liquid solution, suspension, aerosol, or dry powder and loaded into a suitable dispenser for administration. There are several types of pharmaceutical inhalation devices: nebulizer inhalers, metered dose inhalers (MDIs), and dry powder inhalers (DPIs). Nebulizers create a high-velocity air stream that causes therapeutic agents (which are formulated in liquid form) to be sprayed into a mist that enters the patient's respiratory tract. MDI is usually formulated as a compressed gas formulation. When activated, the device releases a measured amount of therapeutic agent using pressurized gas, thereby providing a reliable method of administering a set amount of agent. The DPI releases therapeutic agents in the form of a free-flowing powder that can be dispersed in the air stream by the device as the patient inhales during breathing. To obtain a free-flowing powder, the therapeutic agent is formulated with an excipient such as lactose. A measured amount of therapeutic agent is stored in capsule form and released with each squeeze.

Recently, pharmaceutical compositions have been developed for drugs that exhibit low bioavailability, based on the principle that bioavailability can be increased by increasing the surface area, i.e. reducing particle size. For example, US Patent No. 4,107,288 describes a pharmaceutical composition having particles ranging in size from 10 to 1000 nm, in which the active material is deposited on a cross-linked matrix of macromolecules. US Patent No. 5,145,684 describes the manufacture of a pharmaceutical drug in which the drug substance is reduced to nanoparticles (average particle size 400 nm) in the presence of a surface modifier and then dispersed in a liquid medium, resulting in a pharmaceutical drug that exhibits exceptionally high bioavailability.

These compositions typically consist of one chemical compound described herein in combination with one pharmaceutically acceptable excipient. Suitable excipients are non-toxic, facilitate administration, and do not adversely affect the therapeutic effect of the at least one chemical compound described herein. Such excipient may be any solid, liquid, semi-solid or, in the case of an aerosol composition, gaseous excipient that is generally available to one skilled in the art.

Solid excipients include starch, cellulose, talc, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, dried skim milk, and the like. Liquid and semi-solid excipients may be selected from glycerin, propylene glycol, water, ethanol and various oils including those derived from petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, etc. . Liquid carriers for injection solutions include water, volitional solution, aqueous dextrose solution and glycols.

Compressed gases can be used to disperse the chemical compound described herein into an aerosol form. Inert gases suitable for this purpose are nitrogen, carbon dioxide, etc. Other suitable pharmaceutical excipients and their preparations are described in Remington's Pharmaceutical Sciences, ed. E.W. Martin (Mack Publishing Company, 18th ed., 1990).

The amount of chemical can vary within the range employed by those skilled in the art. Typically the composition will contain, in percent by weight (wt.%), from about 0.01-99.99 wt. % of at least one chemical compound described herein, based on the entire composition, the balance being one or more suitable pharmaceutical excipients. In some embodiments, the at least one chemical compound described herein is present at a level of about 1-80 wt. %.

In various embodiments, the pharmaceutical compositions of the present invention include compounds of Formula (I), (Ia), (Ib), (II) or (III), salts thereof, and combinations of the foregoing.

The various administration modes, dosages and schedules described herein are merely indicative of specific embodiments and should not be construed as limiting the broad scope of the invention. Any permutations, variations and combinations of dosages and administration schedules are included within the scope of the present invention.

The compounds of the present invention can be prepared in accordance with various schemes described below.

Synthesis methods

Methods for synthesizing the proposed chemical compounds utilize readily available starting materials and the general methods and procedures described below. It is clear that in cases where typical or preferred process conditions are given (i.e., reaction temperatures, time values, molar ratios of reagents, solvents, pressure values, etc.), other process conditions can also be used if not otherwise stated. Optimal reaction conditions may vary for the particular reagents or solvents used, but one skilled in the art will be able to establish such conditions through routine optimization procedures.

In addition, protecting groups can be used in the methods of the present invention to prevent certain functional groups from participating in undesired reactions. Suitable protecting groups for various functional groups, as well as suitable conditions for protecting and deprotecting functional groups are well known in the art. For example, numerous protecting groups are described in T. W. Greene and G. M. Wuts, Protecting Groups in Organic Synthesis, Third Edition, Wiley, New York, 1999, and references cited therein.

In addition, the chemical compounds of the invention may contain one or more chiral centers, and such compounds may be prepared or isolated as pure stereoisomers, ie, as individual enantiomers or diastereomers, or as stereomerically enriched mixtures. All such stereoisomers (and enriched mixtures) are included within the scope of this specification unless otherwise indicated. Pure stereoisomers (or enriched mixtures) can be prepared using, for example, optically active starting materials or stereoselective reagents well known in the art. Alternatively, racemic mixtures of such compounds can be prepared using, for example, chiral column chromatography, chiral resolving agents, and the like.

The starting materials for the reactions described below are generally known compounds or can be prepared using known procedures or obvious modifications thereof. For example, many starting materials can be purchased from commercial suppliers such as Aldrich Chemical Co. (Milwaukee, WI, USA), Bachem (Torrance, CA, USA), Ernka-Chemce or Sigma (St. Louis, MO, USA). Others can be prepared by following procedures or obvious modifications of procedures described in standard texts such as Fieser and Fieser's Reagents for Organic Synthesis, Vol. 1-15 (John Wiley and Sons, 1991), Rodd's Chemistry of Carbon Compounds, Vol. 1 -5 and Supplemental (Elsevier Science Publishers, 1989), Organic Reactions, Vol.1-40 (John Wiley and Sons, 1991), March's Advanced Organic Chemistry, (John Wiley and Sons, 4th Edition), and Larock's Comprehensive Organic Transformations ( VCH Publishers Inc., 1989).

Unless otherwise specified, the reactions described herein can take place at atmospheric pressure, typically in the temperature range from -78°C to 200°C. Further, except as used in the Examples or as otherwise indicated, the reaction times and conditions indicated are approximate, for example, reactions occur at approximately atmospheric pressure over a temperature range of from about -78°C to about 110°C for a period of from about 1 to approximately 24 hours; the reactions are allowed to proceed overnight for an average of approximately 16 hours.

The terms “solvent,” “organic solvent,” and “inert solvent” each mean a solvent that is inert under the reaction conditions described in connection therewith, including, for example, benzene, toluene, acetonitrile, tetrahydrofuranyl (“THF”), dimethylformamide (“THF”). DMF"), chloroform, methylene chloride (or dichloromethane), diethyl ether, methanol, N-methylpyrrolidone ("NΜΡ"), pyridine, etc.

Isolation and purification of the chemical compounds and intermediates described herein can, if desired, be accomplished by any suitable separation or purification procedure, such as filtration, extraction, crystallization, column chromatography, thin layer chromatography or thick layer chromatography, or a combination of these procedures. Specific illustrations of suitable separation and isolation procedures are provided in the examples below. However, other equivalent separation or separation procedures may also be used.

If desired, the (R)- and (S)-isomers can be separated by methods known to those skilled in the art, for example, by forming diastereomeric salts or complexes, which can be separated, for example, by crystallization; through the formation of diastereomeric derivatives, which can be separated, for example, by crystallization, gas-liquid or liquid chromatography; by selectively reacting one enantiomer with an enantiomer-specific reagent, such as enzymatic oxidation or reduction, followed by separation of modified and unmodified enantiomers; or gas-liquid or liquid chromatography in a chiral environment, for example, on a chiral support such as silicon with a bound chiral ligand, or in the presence of a chiral solvent. Alternatively, a particular enantiomer may be synthesized by asymmetric synthesis using optically active reagents, catalysts or solvents, or by converting one enantiomer to another by asymmetric conversion.

EXAMPLES

The following examples serve to more fully describe the manner in which the invention described above can be made and used. It is understood that this description is in no way intended to limit the true scope of the invention, but is provided for purposes of illustration. In the examples below and the synthesis schemes above, the following abbreviations have the following meanings. If an abbreviation is not specified, it has the generally accepted meaning.

water -Aqueous

µl - microliters

µM - micromole

NMR - nuclear magnetic resonance

Boc - tert-butoxycarbonyl

Br - wide

Cbz - Benzyloxycarbonyl

d - doublet

Δ - chemical shift

°C - degrees Celsius

DCM - dichloromethane

dd - doublet of doublets

DMAP - 4-(dimethylamino)pyridine

DMEM - Dulbecco's modified Eagle's medium

DMF - N,N-dimethylformamide

DMP - 2,2-dimethoxypropane

DMSO - dimethyl sulfoxide

EtOAc - ethyl acetate

ESI (electrospray) - Electrospray ionization

G or g - gram

h or hour. - watch

HCV (HCV) - hepatitis C virus

HPLC - high performance liquid chromatography

Hz - Hertz

IU - International Units

IC ₅₀ - inhibitory concentration at 50% inhibition

J is the coupling constant (given in Hz unless otherwise noted)

LHMDS - lithium bis(trimethylsilyl)amide

M - multiplet

M - mole

M+H ⁺ - initial peak of the mass spectrum plus

Mr or mg - milligram

Min - Minutes

ml - milliliter

mm - millimolar

Mmol - millimole

MS (MS) - mass spectrum

Ti - nanomole

ppm - parts per million

p-TsOH - p-toluenesulfonic acid

q.s. - sufficient quantity

S - singlet

CT - Room temperature

sat. - rich

Τ - triplet

TBS-Cl - tert-yuutildimethylsilyl chloride

TFA (TFA) - trifluoroacetic acid

Description of equipment

¹ H-NMR spectra were recorded on a Varian spectrometer. Chemical shifts are expressed in parts per million (ppm, δ units). Interaction constants are given in units of Hertz (Hz). The splitting scheme describes apparent multiplicities as s (singlet), d (doublet), t (triplet), q (quartet), quint (quintet), m (multiplet), br (broad).

Low-resolution analytical mass spectra (MS) were recorded on a Waters device (Acquity). The following conditions were used, described below.

Device: Agilent 1200-6100

scan mode: Alternating positive/negative electrospray

Scan range: 100-1000 a.m.u.

LC conditions:

LCMS analysis was performed on a HALO C-18 column, 4.6*50 mm, 2.7 µm, C18 at 45°C.

1.0 µl of sample was injected

The following gradient was applied:

Mobile phase A: water +0.1% v/v. formic acid

Mobile phase B: Acetonitrile+0.1% v/v. formic acid

Time %A %B Flow rate

0.00 min 95 5 1.8 ml/min

1.0 min 5 95 1.8 ml/min

2.0 min 5 95 1.8 ml/min

2.5 min 95 5 1.8 ml/min

UV detection was carried out by the total absorption of singal when scanning at 214 nm and 254 nm

Device: Shimadzu ZHMS-2020

Scan Mode: Alternating Positive/Negative Electrospray

Scan range: 100-2000 amu

LC conditions:

LCMS analysis was performed on a HALO C-18 column, 4.6*50 mm, 2.7 µm, C18 at 45°C.

1.0 µl of sample was injected

The following gradient was applied

Mobile phase A: water +0.1% v/v. formic acid

Mobile phase B: acetonitrile+0.1% v/v. formic acid

Time %A %B Flow rate

0.00 min 95 5 1.5 ml/min

1.0 min 5 95 1.5 ml/min

2.0 min 5 95 1.5 ml/min

2.5 min 95 5 1.5 ml/min

3.0 min 95 5 1.5 ml/min

UV detection was carried out by the total absorption of singal when scanning at 214 nm and 254 nm

Designs and experimental procedures

The following schemes and procedures show how the compounds of the present invention can be prepared. The specific solvents and reaction conditions indicated are also illustrative and not intended to be limiting. Compounds that are not described are either commercially available or can be easily prepared by one skilled in the art using readily available starting materials. The examples given herein are disclosed for illustrative purposes only and are not intended to limit the present invention.

Additional examples contained herein are determined to be of the configuration shown by spectroscopy techniques well known to those skilled in the art, including, but not limited to, 1D and 2D NMR techniques. Compounds of Formula (I), (Ia), (Ib), (II) or (III) can, for example, be synthesized according to Schemes 1-6.

In one embodiment, the compound of Formula 1.12 can be prepared as shown in Scheme 1. The bicyclic ring system in Formulas 1.5 and 1.6 can be formed using a 4-way Ugi reaction between carboxylic acid 1.1, isocyanide 1.2, aldehyde 1.3 and ammonia to yield dipeptide 1.4 with followed by acid deprotection and cyclization. Compounds of Formulas 1.5 and 1.6 can be synthesized using the asymmetric Ugi synthesis with the addition of chiral reagents such as chiral phosphoric acids (Jian Zhang, et al, Science, 2018, 361, 1087). Isocyanides (Isocyanide Chemistry: Application in Synthesis and Material Science, V. Nenajdenko, Wiley-VCH, 1 ^st Ed) can be synthesized by dehydrogenation of formamides using, for example, phosphorus oxychloride, phosgene, diphosgene, toluenesulfonyl chloride, etc.

Formamides, in turn, can be prepared by formatting the amine with ethyl formate, mixed formic anhydride, acetic anhydride, acetic acid/carbodiimides, and activated formic ester. The aldehyde of Formula 1.3 (M. Vamos, et al, ACS Chem. Biol., 2013, 8, 725-732) can be prepared by di-methylation of 4,4-dimethoxybutanenitrile followed by reduction with DIBAL-H. This compound of Formula 1.8 can be prepared by coupling Boc-N-Methyl-L-Ala-OH 1.7 with the desired diastereomer 1.5 using standard amide coupling reagents such as T3P, HATU, HBTU, EDC/HOBt, TBTU, etc. .P. in the presence of bases such as Huenig's base, N-methylmorpholine and the like, in a suitable solvent such as DMF, DCM and the like. The alkyne of Formula 1.8 can be selectively reduced by hydrogenation in the presence of a Lindlar catalyst or alternatively to yield the alkene of Formula 1.9. The alkene of Formula 1.9 can be dimerized using Grubbs olefin metathesis to give the compound of Formula 1.10. The olefin of Formula 1.10 can be reduced using hydrogenation in the presence of a metal catalyst such as palladium on carbon, platinum, to produce a compound of Formula 1.11, the Boe protecting groups therein can be removed in an acidic environment such as HCl, TFA, and the like.

Scheme 1

In another embodiment, intermediate Formula 2.8 can be prepared in accordance with Scheme 2. Intermediate 2.8 is a universal intermediate for the preparation of Formula I, Ia, Ib, II or III by combination with various diamines known to one skilled in the art. The bicyclic compound of Formula 2.5 can be prepared using a 4-way Ugi reaction between acid 2.1, isocyanide 2.2, aldehyde 2.3 and ammonia to give the dipeptide of Formula 2.4. The compound of Formula 2.5 can be prepared by treating the dipeptide 2.4 with an acid, which can result in the formation of a bicyclic ring structure as well as an indolamide (O. Kreye, et al, SYNLETT, 2007, p 3188-3192). Compound of Formulas 2.6 and 2.7 can be prepared by coupling Boc-N-Methyl-L-Ala-OH 1.7 with compound 2.5 using standard amide coupling reagents such as T3P, HATU, HBTU, EDC/HOBt, TBTU, etc. in the presence of a base such as Huenig's base, N-methyl morpholine and the like, in a suitable solvent such as DMF, DCM and the like. The acid of Formula 2.8 can be prepared by basic hydrolysis of the indolamide of Formula 2.6 in the presence of sodium hydroxide or the like in a solvent such as methanol.

Scheme 2

In another embodiment, intermediate Formula 3.7 can be prepared according to Scheme 3. Intermediate 3.7 is a versatile intermediate for preparing compounds of Formula I, Ia, Ib, II or III by coupling with various diamines known to those skilled in the art.

Scheme 3. The activated intermediate reagent of Formula 3.4 can be prepared as follows. Amide coupling of Boc-N-methyl-L-Ala-OH 1.7 with a diamine of Formula 3.1 using mixed anhydride coupling conditions or alternative coupling conditions provides the compound of Formula 3.2. Thionation of amide 3.2 using phosphorus pentasulfide in the presence of a base such as sodium carbonate or the like in a solvent such as THF provides the thioamide of Formula 3.3. The nitrobenzotriazole reagent of Formula 3.4 can be prepared by treating thioamide 3.3 with sodium nitrite in acetic acid in solvents such as THF and the like. (M. Ashraf Shalaby, et al, J. Org. Chem. 1996, 61, 9045-9048). The compound of Formulas 3.5 and 3.6 can be prepared using the reaction of indolamide 2.5 and the activated thioacylation reagent of Formula 3.4 in the presence of a base such as Huenig's base, triethylamine and the like, in solvents such as DCM, DMF and the like. The separated diastereoisomer of Formula 3.5 can be treated with an aqueous base such as sodium hydroxide in an alcoholic solvent such as methanol to give the intermediate of Formula 3.7.

Scheme 3

In another embodiment, compounds of Formula 4.3 and 4.5 can be prepared according to Scheme 4. Compounds of Formula 4.2 and 4.4 can be prepared using the coupling of intermediates 2.8 or 3.7 with diamine 4.1 in the presence of a coupling reagent or via activated esters in the presence of a base. such as Huenig's base, triethylamine, etc., in solvents such as DMF, THF, DCM, etc. In coupling reactions, coupling reagents such as HATU, TBTU, BOP can be used. RuVOR, DEPBT, EDC/HOBt, EEDQ, but not limited to those listed. Compounds of Formulas 4.3 and 4.5 can be prepared by removing the Boc protecting group in compounds 4.2 and 4.4 under acidic conditions such as HCl, TFA, and the like.

Scheme 4

Diamines for coupling intermediates 2.8 and 3.7 are readily available from commercial suppliers or can be prepared by known methods. Various examples are shown in Scheme 5, without limitation by the type of chemical components or functional groups used for linkers. the amines of Formulas 5.3 and 5.5 can be prepared by bis-alkylation of amino alcohols 5.1 or 5.4, where X is a leaving group such as a halide, tosylate, mesylate, and the like, in the presence of a base such as sodium hydride, and the like. , in solvents such as DMF, THF, etc. Compounds of Formulas 5.8 and 5.10 can be prepared using amide coupling reactions of the protected amino acids 5.6 and 5.9 followed by acid deprotection.

Scheme 5

Where is the rectangular frame is a linker.

In another embodiment, dimers of Formulas 6.7, 6.8, 6.9, 6.10 and 6.11 can be prepared according to Scheme 6. Compounds of Formulas 6.3, 6.4, 6.5 and 6.6 can be prepared by amide coupling of intermediates 2.8 and 3.7 with amines of Formulas 6.1 and 6.2 where X and Υ are linkers with functional groups at the ends that can be used for further reactions. Examples of functional groups include, but are not limited to: protected amine, protected carboxylic acid, protected thiols, alkyne, alkene, sulfonyl chloride, azide, hydroxyl, halides, nitriles, isocyanates. Monomers of Formulas 6.3 and 6.5 can dimerize to form dimers of Formulas 6.7 and 6.11, for example, if X contains an alkyne, alkene, amines, or alternative functional groups that can further react to form homodimers through the mechanism of copper-mediated alkyne coupling, olefin metathesis, formation urea or sulfonamide. Monomers of Formulas 6.3, 6.4, 6.5 and 6.6 can react with each other to form heterodimers of Formulas 6.8, 6.9 and 6.10, for example if X contains an amine and Υ contains a carboxylic acid, sulfonyl chloride, isocyanate, which can form an amide, sulfonamide or urea; or for example, if X is an alkyne and Υ is an azide, which can form a triazole; or if X contains hydroxy and Υ contains halogen, which can form an ether. The chemical reactions and reagents are not limited to those listed above, but also include other combinations known to those skilled in the art.

Intermediate I:

(4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)methyl)amino)propanamido)8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3] thiazepine-7-carboxylic acid

Step 1: (E)-1-(2-nitrostyryl)pyrrolidine

To a solution of 1-methyl-2-nitrobenzene (50 g, 365 mmol) in N,N-dimethylformamide (200 ml) was added pyrrolidine (31.1 g, 438 mmol) and 1,1-dimethoxy-N,N-dimethylmethanamine (52.2 g , 438 mmol). The resulting mixture was stirred at 60°C. After 5 hours, the temperature was raised to 80°C and stirred for 17 hours. After cooling to room temperature, the mixture was partitioned between methyl tert-butyl ether (500 ml) and water (1 L). The aqueous phase was separated and extracted with methyl tert-butyl ether (500 ml). The combined organic layers were washed with brine, dried using anhydrous sodium sulfate, filtered and concentrated to give (E)-1-(2-nitrostyryl)pyrrolidine (80 g, crude) as a dark red oil. It was used in the next step without further purification.

Step 2: 1-(2,2-dimethoxyethyl)-2-nitrobenzene

Trimethylchlorosilane (59.5 g, 550 mmol) was slowly added to a solution of (E)-1-(2-nitrostyryl)pyrrolidine (80 g, crude) in methanol (600 ml). The mixture was heated to reflux for 24 hours. The solution was then allowed to cool to room temperature and concentrated in vacuo to leave a residue. It was divided between ethyl acetate (500 ml) and 5% aqueous citric acid solution (800 ml). The aqueous layer was extracted with ethyl acetate (2×300 ml). The combined organic layers were washed with 5% aqueous sodium bicarbonate (300 ml) and then with brine. The crude product was dried with anhydrous sodium sulfate, filtered and concentrated to give 1-(2,2-dimethoxyethyl)-2-nitrobenzene (79 g, crude) as a dark red oil, which was used in the next step without further cleaning.

Step 3: 2-(2,2-dimethoxyethyl)aniline

Palladium on activated carbon (17.6 g) was added to a solution of 1-(2,2-dimethoxyethyl)-2-nitrobenzene (79 g, 374.4 mmol) in methanol (1L). The mixture was stirred under a hydrogen atmosphere at 50 psi. inch at room temperature for 17 hours. The mixture was filtered through diatomite and rinsed with methanol. The filtrate was concentrated to give the crude product. The crude product was dissolved in methyl tert-butyl ether (500 ml) and filtered. The filtrate was concentrated to give 2-(2,2-dimethoxyethyl)aniline (60 g, 331.5 mmol, 88.5% yield) as a dark red oil. It was used for the next step without further purification. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 6.98-6.89 (m, 2H), 6.63 (dd, J=7.9, 1.1 Hz, 1H), 6.51 (td, J=7.4, 1.2 Hz, 1H ), 4.80 (s, 2H), 4.55 (t, J=5.6 Hz, 1H), 3.25 (s, 6H), 2.72 (d, J=5.6 Hz, 2H).

Step 4: N-(2-(2,2-dimethoxyethyl)phenyl)formamide

A solution of 1 M lithium bis(trimethylsilyl)amide (597 ml, 597 mmol). The mixture was stirred at room temperature for 12 hours and then refluxed for 18 hours. Saturated ammonium chloride (200 ml) was then added and the mixture was extracted with ethyl acetate (3×200 ml). The organic phases were combined, dried using anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by silica gel chromatography [petroleum ether/ethyl acetate (6:1 v/v)] to give N-(2-(2,2 dimethoxyethyl)phenyl)formamide (58 g, 277.5 mmol, 83.7% yield) in the form of a dark red oil. LCMS (2.5 min, formic acid): Time. beat = 1.354 min, m/z: 209.1 [M+1] ⁺ , 231.9 [M+Na] ⁺ .

Step 5: 1-(2,2-dimethoxyethyl)-2-isocyanobenzene

Triethylamine (143 g, 1415.3 mmol) was added to a solution of N-(2-(2,2 dimethoxyethyl)phenyl)formamide (58 g, 277.5 mmol) in dichloromethane (500 ml) at 0°C, followed by phosphorus oxychloride (63.9 g , 416.3 mmol). The mixture was warmed to room temperature and stirred for 2 hours. It was then poured into saturated aqueous sodium bicarbonate (300 ml) and extracted with dichloromethane (3×200 ml). The organic layers were dried using anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by silica gel chromatography [petroleum ether/ethyl acetate (20:1 v/v)] to give 1-(2,2-dimethoxyethyl)-2-isocyanobenzene (42 g, 218.5 mmol, 79.2% yield ) as a pale brown oil. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 7.57-7.27 (m, 4H), 4.61 (t, J=5.6 Hz, 1H), 3.27 (s, 6H), 3.00 (d, J=5.6 Hz, 2H). LCMS (2.5 min, formic acid): Time. beat=1.455 min, m/z: 192.0 (M+1) ⁺ .

Step 6: 4,4-dimethoxy-2,2-dimethylbutanenitrile

To a solution of diisopropylamine (89.4 ml, 682 mmol) in tetrahydrofuran (1L) at -10°C in a nitrogen atmosphere was added a solution of 2.4 M n-butyllithium in hexane (288 ml, 682 mmol). After 30 minutes the mixture was cooled to -78°C and a solution of 4,4-dimethoxybutanenitrile (40 g, 310 mmol) in tetrahydrofuran (30 ml) was added. After 1 hour, methyl iodide (42.4 mL, 682 mmol) was added very slowly. The mixture was allowed to warm to room temperature and stirred overnight. It was then quenched with saturated aqueous ammonium chloride and extracted with ethyl acetate (3×400 ml). The organic layers were dried using anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by silica gel chromatography [petroleum ether/ethyl acetate (30:1 v/v)] to give 4,4-dimethoxy-2,2-dimethylbutanenitrile (35 g, 223 mmol, 71.9% yield) in as a pale yellow oil. ¹ H-NMR (400 MHz, CDCl ₃ ) δ ppm 4.60 (t, J=5.4 Hz, 1H), 3.36 (s, 6H), 1.83 (d,J=5.4 Hz, 2H), 1.39 (s, 6H) .

Step 7: 4,4-dimethoxy-2,2-dimethylbutanal

To a solution of 4,4-dimethoxy-2,2-dimethylbutanenitrile (27 g, 172 mmol) in dichloromethane (800 ml) was slowly added a solution of 1 M diisobutylaluminum hydride in hexane (189 ml, 189 mmol) at -78°C over 3.5 h After this, the mixture was warmed to room temperature and quenched with saturated aqueous ammonium chloride (400 ml) and Rochelle's salt (400 ml). The aqueous phase was extracted with dichloromethane (2×400 ml). The combined organic layers were washed with brine (400 ml), dried using anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by silica gel chromatography [petroleum ether/ethyl acetate (30:1 v/v)] to give 4,4-dimethoxy-2,2-dimethylbutanal (13 g, 81.1 mmol, 47.1% yield) in in the form of a colorless oil. LCMS (2.5 min, formic acid): Time. beat = 1.453 min, m/z: 182.9 (M+Na) ⁺ .

Step 8: (4S,9aS)-4-amino-7-(1H-indole-1-carbonyl)-8,8-dimethylhexahydropyrrolo[2,1-b][1,3]thiazepin-5(2H)-one

A. Blend of N-(tert-butoxycarbonyl)-S-trityl-L-homocysteine (11.8 g, 24.7 mmol), 1-(2,2-dimethoxyethyl)-2-isocyanobenzene (from Step 5) (4.5 g, 23.5 mmol), 4,4-dimethoxy-2,2-dimethylbutanal (from Step 7) (4.5 g, 28.2 mmol) and 7 M ammonia in methanol (10 ml) in 2,2,2-trifluoroethanol (150 ml) were stirred at 100°C for 2 hours. After this, the mixture was quenched with 1 M water. sodium hydroxide solution (200 ml) and extracted with ethyl acetate (3×150 ml). The combined organic phases were dried using anhydrous sodium sulfate, filtered and concentrated to give crude tert-butyl((2S)-1-((1-((2-(2,2-dimethoxyethyl)phenyl)amino)-5 ,5-dimethoxy-3,3-dimethyl-1-oxopentan-2-yl)amino)-1-oxo-4-(tritylthio)buten-2-yl)carbamate (26 g, crude) as a brown solid. It was used for the next step without any further purification.

b. After the step to a solution of crude tert-butyl((2S)-1-((1-((2-(2,2-dimethoxyethyl)phenyl)amino)-5,5-dimethoxy-3,3-dimethyl-1-oxopentane -2-yl)amino)-1-oxo-4-(tritylthio)buten-2-yl)carbamate (26 g, crude) in dichloromethane (200 ml) was added slowly with trifluoroacetic acid (20 ml). The mixture was stirred at 40°C for 2 hours. The solvent was concentrated and the crude product was purified by silica gel chromatography [dichloromethane/methanol (25:1 v/v)] to give (4S,9aS)-4-amino -7-(1H-indol-1-carbonyl)-8,8-dimethylhexahydropyrrolo[2,1-b][1,3]thiazepin-5(2H)-one (7.5 g, 21.0 mmol) as sand solid colors. LCMS (2.5 min, formic acid): Time. beat = 1.361 min, m/z: 357.9 (M+1) ⁺ .

Step 9: tert-butyl((S)-1-(((4S,7S,9aS)-7-(1H-indole-carbonyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][ 1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate

To a solution of (4S,9aS)-4-amino-7-(1H-indol-1-carbonyl)-8,8-dimethylhexahydropyrrolo[2,1-b][1,3]thiazepin-5(2H)-one ( 14 g, 39.2 mmol), N-(tert-butoxycarbonyl)-N-methyl-L-alanine (8.76 g, 43.1 mmol), 1-hydroxybenzotriazole (5.82 g, 43.1 mmol) and 4-methylmorpholine (11.88 g, 117.6 mmol ) in tetrahydrofuran (400 ml), N-(3-dimethylaminopropyl-N'-ethylcarbodiimide hydrochloride (8.27 g, 43.1 mmol) was added. The mixture was stirred at room temperature for 3 hours. After this, it was quenched with a saturated aqueous solution of sodium bicarbonate (300 ml ) and extracted with ethyl acetate (3×150 ml). The combined organic layers were washed with brine (200 ml), dried using anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by silica gel chromatography [petroleum ether/ethyl acetate (from 2:1 vol ./v. to 1:1 v./v.)], resulting in tert-butyl ((S)-1-(((4S,7R,9aS)-7-(1H-indole-1-carbonyl )-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate (5.2 g, 9.6 mmol , 24.5% yield) in the form of a sand flower solid and the target product tert-butyl((S)-1-(((4S,7S,9aS)-7-(1H-indole-1-carbonyl)-8,8- dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate (5.0 g, 9.2 mmol, 23.5% yield) in as a pale yellow solid. LCMS (2.5 min, formic acid): Time. beat = 1.740 min, m/z: 564.8 (M+1) ⁺ .

Step 10: (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b] [1,3]thiazepine-7-carboxylic acid

To a solution of tert-bottle ((S)-1-(((4S,7S,9aS)-7-(1H-indole-1-carbonyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b] [1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate (3.9 g, 7.19 mmol) in methanol (60 ml) was added 1 M aqueous solution of sodium hydroxide (60 ml) . The mixture was stirred at room temperature for 24 hours. The volatile solvent was removed under reduced pressure. The remaining aqueous phase was washed with ethyl acetate (50 ml) and the pH of the aqueous phase was adjusted to pH 3 with citric acid. The aqueous phase was extracted with ethyl acetate (3×60 ml). The combined organic phases were washed with brine (100 ml), dried using anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by silica gel chromatography [petroleum ether/ethyl acetate (1:2 v/v)] to give (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl) (methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxylic acid (2 g, 4.51 mmol, 62.7% yield) as a white solid substances. LCMS (2.5 min, formic acid): Time. beat = 1.493 min, m/z: 443.9 (M+1). ¹ H-NMR (400 MHz, CDCl ₃ ) δ ppm 12.57 (s, 1H), 7.75 (d, J=6.6 Hz, 1H), 5.46 (t, J=7.2 Hz. 1H), 4.64-4.60 (m, 1H ), 4.43 (s, 1H), 3.98 (s, 1H), 3.17-3.11 (m, 1H), 2.88 (dd, J=14.6, 3.0 Hz, 1H), 2.74 (s, 3H), 2.27 (dd, J=12.9, 7.5 Hz, 1H), 2.12 - 2.10 (m, 1H), 1.80 (dd, J=13.0, 7.1 Hz, 1H), 1.74-1.68(m, J=11.2 Hz, 1H), 1.40(s ,9H), 1.25 (d, J=7.1 Hz, 3H), 1.09 (d, J=10.6 Hz, 6H).

Intermediate II:

(4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8,9a-trimethyl-5-oxooctahydropyrrolo[2,1-b][ 1,3]thiazepine-7-carboxylic acid

Step 1: tert-butyl(S)-(1-((2-amino-5-nitrophenyl)amino)-1-oxopropan-2-yl)(methyl)carbamate

4-Methylmorpholine (20.2 g, 200 mmol) was added to a solution of N-(tert-butoxycarbonyl)-N-methyl-L-alanine (20.3 g, 100 mmol) in dry tetrahydrofuran (1.2 L). The mixture was stirred at -20°C for 10 min, after which isobutyl carbonochloridate (13.6 g, 100 mmol) was added dropwise. The mixture was stirred at -15°C for 2 hours and warmed to room temperature overnight. The mixture was diluted with ethyl acetate (1.6 L) and washed successively with 1 M water. disodium hydrogen phosphate solution (1 l), 5% aq. sodium bicarbonate solution (1 l) and saline solution (1 l). The organic phase was dried with anhydrous sodium sulfate, filtered and concentrated to give (S)-tert-butyl(1-((2-amino-5-nitrophenyl)amino)-1-oxopropan-2-yl)(methyl )carbamate (30 g, 88.7 mmol, 88.7% yield) as a dark red oil. LCMS (2.5 min, formic acid): Time. beat = 1.537 min, m/z: 360.9 (M+Na) ⁺ .

Step 2: tert-butyl(S)-(1-((2-amino-5-nitrophenyl)amino)-1-thioxopropan-2-yl)methyl)carbamate

Sodium carbonate (5.8 g, 55 mmol) was added to a solution of phosphorus (V) sulfide (24.4 g, 110 mmol) in dry tetrahydrofuran (1.6 L). The mixture was stirred for 1 hour at room temperature, which was then reduced to 0°C. Tert-butyl(S)-(1-((2-amino-5-nitrophenyl)amino)-1-oxopropan-2-yl)(methyl)carbamate (40 g, 110 mmol) was added to the reaction mixture. The mixture was stirred at room temperature for 3 hours. The solvent was concentrated in vacuo and diluted with ethyl acetate (1 L), then washed with 5% water. sodium bicarbonate solution (500 ml) and saline solution (500 ml). The organic layer was dried with anhydrous sodium sulfate, filtered and concentrated to give the product tert-butyl (S)-(1-((2-amino-5-nitrophenyl)amino)-1-thioxopropan-2-yl) (methyl)carbamate (33 g, 93.2 mmol, 84.7% yield) as an orange solid. LCMS (2.5 min, formic acid): Time. beat = 1.602 min, m/z: 376.8 (M+Na) ⁺ .

Stage 3; tert-butyl(S)-methyl(1-(6-nitro-1H-benzo[d][1,2,3]triazol-1-yl)-1-thioxopropan-2-yl)carbamate

To a solution of tert-butyl(S)-(1-((2-amino-5-nitrophenyl)amino)-1-thioxopropan-2-yl)(methyl)carbamate (30 g, 84.6 mmol) in dry tetrahydrofuran (250 ml ) and acetic acid (250 ml) was added sodium nitrite (9 g, 130.4 mmol). The mixture was stirred at 0°C for 1.5 hours. It was washed successively with water (3×500 ml), 5% aq. sodium bicarbonate solution (2×500 ml) and saline solution (500 ml). The organic layer was dried with anhydrous sodium sulfate, filtered and concentrated to give tert-butyl(S)-methyl(1-(6-nitro-1H-benzo[d][1,2,3]triazol-1- yl)-1-thioxopropan-2-yl)carbamate (20 g, 54.8 mmol, 64.8% yield) as a brown oil, which was used for the next step without further purification.

Step 4: tert-butyl((S)-1-(((4S,7S,9aS)-7-(1H-indole-1-carbonyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b ][1,3]thiazepin-4-yl)amino)-1-thioxopropan-2-yl)(methyl)carbamate

To a solution of (4S,9aS)-4-amino-7-(1H-indol-1-carbonyl)-8,8-dimethylhexahydropyrrolo[2,1-b][1,3]thiazepin-5(2H)-one ( 15 g, 42 mmol) and tert-butyl(S)-methyl(1-(6-nitro-1H-benzo[d][1,2,3]triazol-1-yl)-1-thioxopropan-2-yl )carbamate (20 g, 54.7 mmol) in dichloromethane (400 ml), triethylamine (8.6 g, 84.6 mmol) was added at 0°C. The mixture was stirred at room temperature overnight. The mixture was concentrated under reduced pressure to obtain the crude product. The crude product was purified by silica gel chromatography (ethyl acetate/petroleum ether=1/15) to give tert-butyl((S)-1-(((4S,7S,9aS)-7-(1H-indole-1- carbonyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-thioxopropan-2-yl)(methyl)carbamate) (3.0 g, 5.37 mmol, 25.5% yield) in the form of a yellow oil and the target diastereomer tert-butyl((S)-1-(((4S,7S,9aS)-7-(1H-indole-1-carbonyl)-8,8- dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-thioxopropan-2-yl)(methyl)carbamate (3.9 g, 6.98 mmol, 29.4% yield) in in the form of yellow oil. LCMS (2.5 min, formic acid): Time. beat = 1.905 min, m/z: 580.8 (M+Na) ⁺ .

Step 5: (4S,7S,9aS)-4-(2-((tert-6utoxycarbonyl)(methyl)amino)ethantioamido)-8,8,9a-trimethyl-5-oxooctahydropyrrolo[2,1-b] [1 ,3]thiazepine-7-carboxylic acid

To a solution of tert-butyl(2-(((4S,7S,9aS)-7-(1H-indole-1-carbonyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3 ]thiazepin-4-yl)amino)-2-thioxoethyl)(methyl)carbamate (1.5 g, 2.69 mmol) in methanol, 1 M aq. was slowly added. sodium hydroxide solution (60 ml). The mixture was stirred at room temperature overnight. The volatile solvent was removed under reduced pressure and the remaining solution was extracted with ethyl acetate (50 ml). The pH of the aqueous solution was adjusted to pH 4 with 20% aqueous citric acid and then extracted with ethyl acetate (3×100 ml). The organic layers were combined, washed with brine (100 ml), dried using anhydrous sodium sulfate, filtered and concentrated to give (4S,7S,9aS)-4-(2-((tert-butoxycarbonyl)(methyl)amino )ethantioamido)-8,8,9a-trimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxylic acid (1 g, 21.8 mmol, 81% yield) as a brown oil. LCMS (2.5 min, formic acid): Time. beat = 1.632 min, m/z: 481.8 (M+Na) ⁺ .

Example 1

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-(methylenebis(4,1-phenylene))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido )-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

Step 1: N, N'-(methylenebis(4,1-phenylene)) diformamide

Formic acid (4.64 g, 100.8 mmol) was added to a solution of 4,4'-methylenedianiline (5 g, 25.2 mmol) in toluene (40 ml). The mixture was stirred at 110°C for 2 hours. The reaction mixture was concentrated. The crude product was washed with dichloromethane and filtered to give the title product N,N'-(methylenebis(4,1-phenylene))diformamide (4.7 g, 18.5 mmol, 73.4% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 1.165 minutes, m/z: 255.1 (M+1) ⁺ .

Step 2: bis(4-isocyanophenyl)methane

Triethylamine (19 g, 188.7 mmol) was added to a solution of N,N'-(methylenebis(4,1-phenylene))diformamide (4.7 g, 18.5 mmol) in dichloromethane (150 ml) at 0°C, after which phosphorus oxychloride was added (8.5 g, 55.4 mmol). The mixture was warmed to room temperature and stirred for 2 hours. The reaction mixture was poured into saturated aqueous sodium bicarbonate (100 ml) and extracted with dichloromethane (3×60 ml). The organic layers were dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by silica gel chromatography [dichloromethane/methanol (25:1 v/v)] to obtain bis(4-isocyanophenyl)methane (1.6 g, 7.3 mmol, 39.6% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 1.715 minutes, m/z: 218.9 (M+1) ⁺ .

Step 3: (4S,4S,9aS,9a'S)-N,N'-(methylenebis(4,1-phenylene))bis(4-amino-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b] [1,3]thiazepine-7-carboxamide

Mixture of N-(tert-butoxycarbonyl)-S-trityl-L-homocysteine (2.4 g, 5.04 mmol), bis(4-isocyanophenyl)methane (500 mg, 2.29 mmol), 4,4-dimethoxy-2,2-dimethylbutanal (954 mg, 5.95 mmol) and 7 M ammonium in methanol (2 ml, 14 mmol) in 2,2,2-trifluoroethanol (10 ml) were stirred at 80°C for 30 minutes under microwave conditions. The mixture was quenched with 1 M aqueous sodium hydroxide (20 ml) and extracted with ethyl acetate (3×15 ml). The organic phases were combined, dried over anhydrous sodium sulfate, filtered and concentrated to give the crude product di-tert-butyl((2S,2'S)-((((methylenebis(4,1-phenylene))bis(azandiyl)) bis(5,5-dimethoxy-3,3-dimethyl-1-oxopentane-1,2-diyl))bis(azandiyl))bis(1-oxo-4-(tritylthio)butane-1,2-diyl)) dicarbamate (2.0 g, crude) as a brown solid. It was used in the next step without further purification. To a solution of crude di-tert-butyl((2S,2'S)-((((methylenebis(4,1-phenylene))bis(azandiyl))bis(5,5-dimethoxy-3,3-dimethyl-1-oxopentane -1,2-diyl))bis(azandiyl))bis(1-oxo-4-(tritylthio)butane-1,2-diyl))dicarbamate (2 g, crude) in dichloromethane (20 ml) trifluoroacetic acid was added slowly (5 ml). The mixture was stirred at 40°C for 2 hours. The reaction mixture was concentrated and purified by silica gel chromatography [dichloromethane/methanol (6:1 v/v)] to give (4S,4'S,9aS,9a'S)-N,N'-(methylenebis(4,1- phenylene))bis(4-amino-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) (500 mg, 0.74 mmol) as a sandy solid. LCMS (2.5 minutes, formic acid): Retention time = 1.263 minutes, m/z: 678.8 (M+1) ⁺ .

Step 4: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-(((methylenebis(4,1-phenylene))bis(azandiyl))bis( carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropane-1,2- diyl))bis(methylcarbamate)

To a solution of (4S,4'S,9aS,9a'S)-N,N'-(methylenebis(4,1-phenylene))bis(4-amino-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][ 1,3]thiazepine-7-carboxamide) (550 mg, 0.810 mmol), N-(mpem-butoxycarbonyl)-N-methyl-L-alanine (362 mg, 1.782 mmol), 1-hydroxybenzotriazole (241 mg, 1.782 mmol ) and 4-methylmorpholine (491 mg, 4.860 mmol) in tetrahydrofuran (30 ml), N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (342 mg, 1.782 mmol) was added. The mixture was stirred at room temperature for 3 hours. The mixture was quenched with saturated water. sodium bicarbonate solution (25 ml) and extracted with ethyl acetate (3×15 ml). The combined organic phases were washed with brine (20 ml), dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by silica gel chromatography [dichloromethane/methanol (25:1 v/v)] to yield the crude product, which was further purified by chiral-HPLC to yield the desired product di-tert-butyl( (2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-(((methylenebis(4,1-phenylene))bis(azandiyl))bis(carbonyl))bis(8,8- dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate) (55 mg, 0.052 mmol, yield 6.4%) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 1.828 minutes, m/z: 425 [(M - 2 Vos)+2] ⁺ /2,

Step 5: (4S,4'S,7S,7'S,9aS,9a'S)-N.N'-(methylenebis(4,1-phenylene))bis(8,8-dimethyl-4-((S)-2-( methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-(((methylenebis(4,1-phenylene))bis(azandiyl))bis(carbonyl ))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl) ))bis(methylcarbamate) (55 mg, 0.052 mmol) in dichloromethane (6 ml) was added 4 N. hydrogen chloride in 1,4-dioxane (1.5 ml). The mixture was stirred at room temperature for 2 hours. The solvent was removed under reduced pressure and the solid was dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-(methylenebis(4,1-phenylene))bis(8, 8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride (43 mg, 0.046 mmol, yield 88.5 %) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 10.08 (s, 2H), 9.27-9.24 (m, 2H), 8.87-8.84 (m, 2H), 8.80 (d, 3=6.8 Hz, 2H ), 7.52(d, J=8.0 Hz, 2H), 7.14(d, J=8.0 Hz, 2H), 5.47 (m, J=7.8 Hz, 2H), 4.71(t, J=9.4 Hz, 2H ), 4.26 (s, 2H), 3.84 (s, 2H), 3.71-3.65 (m, 2H), 3.17(t, J=12.4 Hz, 2H), 2.95-2.91 (m, 2H), 2.48-2.47 ( m, 6H), 2.23-2.18 (m, 2H), 2.14-2.10 (m, 2H), 1.96-1.90 (m, 2H), 1.85-1.76 (m, 2H), 1.42 (s, 4H), 1.39( d, J=7.2 Hz, 6H), 1.09 (m, 6H), 1.02 (m, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.268 minutes, t/g: 848.9 (M+1) ⁺ .

Example 2:

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-(methylenebis(4,1-phenylene))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido )-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

Step 1: di-tert-butyl((2S,2'S)-(4S,4'S,7S,7'S,9aS,9a'S)-(((methylenebis(4,1-phenylene))bis(azandiyl))bis(carbonyl) )bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropan-1,2diyl))bis (methylcarbamate)

To a solution of (4S,4'S,9aS,9a'S)-N,N'-(methylenebis(4,1-phenylene))bis(4-amino-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][ 1,3]thiazepine-7-carboxamide) (Example 1, Step 3) (260 mg, 0.38 mmol) in dichloromethane (10 ml) at 0 °C was added triethylamine (116.3 mg, 1.15 mmol). After 10 minutes, a solution of tert-butyl(S)-methyl(1-(6-nitro-1H-benzo[d][1,2,3]triazol-1-yl)-1-thioxopropan-2-yl)carbamate was added (321.9 mg, 0.88 mmol) in dichloromethane (5 ml). The mixture was stirred at room temperature for another 2 hours. The solvent was removed under reduced pressure to obtain a yellow syrup. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (1:4 v/v)] to give a yellow oil (200 mg, 0.18 mmol), which was further purified by chiral-HPLC to give title product (45 mg, 0.04 mmol, 10.9% yield). LCMS (2.5 minutes, formic acid): Retention time = 1.998 minutes, m/z: 980.6 (M - Boc+1) ⁺ .

Step 2: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-(methylenebis(4,1-phenylene))bis(8,8-dimethyl-4-((S)-2-( methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-(((methylenebis(4,1-phenylene))bis(azandiyl))bis(carbonyl ))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropan-1,2-diyl ))bis(methylcarbamate) (45 mg, 0.042 mmol) in diethyl ether (2 ml), hydrogen chloride (4 N in 1,4-dioxane, 1 ml) was added. The reaction mixture was stirred at room temperature for 6 hours. The mixture was concentrated under reduced pressure and dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-(methylenebis(4,1-phenylene))bis(8,8- dimethyl 4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride (22 mg, 0.025 mmol, 55% yield) as a light yellow solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 11.08-11.96 (m, 2H), 10.15 (s, 1H), 9.89 (s, 1H), 9.64 (s, 1H), 8.66 (s, 1H ), 8.42 (s, 1H), 7.52(d, J=8.0 Hz, 2H), 7.14(d, J=8.0 Hz, 2H), 5.43(t, J=7.6 Hz, 2H), 5.16-5.08 (m , 2H), 4.29-4.20 (m, 4H), 3.84 (s, 2H), 3.72-3.67 (m. 2H), 3.22-3.16 (m, 2H), 3.01-2.98 (m, 2H), 2.49 (s , 6H), 2.25-2.21 (m, 4H), 2.00-1.92 (m, 4H), 1.46-1.43 (m, 6H), 1.11 (m, 6H), 1.02 (m, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.298 minutes, m/z: 880.6 (M+1) ⁺ .

Example 3

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-(ethane-1,2-diylbis(2,1-phenylene))bis(8,8-dimethyl-4-((S)- 2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

Step 1: 2,2'-(ethane-1,2-diyl)dianiline

Palladium on activated carbon (1 g) was added to a solution of 1,2-bis(2-nitrophenyl)ethane (9.5 g, 34.9 mmol) in ethanol (200 ml). The mixture was stirred under a hydrogen atmosphere (1 atm) at room temperature for 5 hours. The catalyst was filtered and the filtrate was concentrated under reduced pressure. The crude product was purified by silica gel chromatography [petroleum ether/ethyl acetate (1:1 v/v)] to give 2,2'-(ethane-1,2-diyl)dianiline (5 g, 23.6 mmol, yield 67.6%) as a yellow solid. LCMS (2.5 minutes, formic acid): Retention time = 1.336 minutes, 212.9 (M+1) ⁺ .

Step 2: N.N'-(ethane-1,2-diylbis(2,1-phenylene))diformamide

Formic acid (4.3 g, 94.4 mmol) was added to a solution of 2,2'-(ethane-1,2-diyl)dianiline (5 g, 23.6 mmol) in toluene (100 ml). The mixture was stirred at reflux overnight. The mixture was concentrated under reduced pressure to give the crude product, which was washed with petroleum ether to give N,N'-(ethane-1,2-diylbis(2,1-phenylene))diformamide (5 g, 18.7 mmol , yield 79.2%) as a white solid.

Step 3: 1,2-bis(2-isocyanophenyl)ethane

Triethylamine (7.5 g, 74.6 mmol) was added to a solution of N,N'-(ethane-1,2-diylbis(2,1-phenylene))diformamide (2 g, 7.46 mmol) in dichloromethane (50 ml) at 0°C. after which phosphorus oxychloride (3.4 g, 22.4 mmol) was added. The mixture was warmed to room temperature and stirred for 4 hours. Then the reaction mixture was poured into saturated water. sodium bicarbonate solution (50 ml) and extracted with dichloromethane (3×30 ml). The combined organic phases were dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by silica gel chromatography [petroleum ether/ethyl acetate (4:1 v/v)] to give 1,2-bis(2-isocyanophenyl)ethane (1.5 g, 6.47 mmol, 86.7% yield) in as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 1.763 minutes, m/z: 233.0 (M+1) ⁺ .

Step 4: (4S,4'S,9aS,9a'S)-N,N'-(ethane-1,2-diylbis(2,1-phenylene))bis(4-amino-8,8-dimethyl-5-oxooctahydropyrrolo[ 2,1-b][1,3]thiazepine-7-carboxamide)

Mixture of N-(tert-butoxycarbonyl)-S-trityl-L-homocysteine (4.1 g, 8.6 mmol), bis(4-isocyanophenyl)methane (1 g, 4.3 mmol), 4,4-dimethoxy-2,2 -dimethylbutanal (1.45 g, 9.0 mmol) and 7 M ammonia in methanol (2.4 ml, 16.8 mmol) in 2,2,2-trifluoroethanol (20 ml) were stirred at 80°C for 30 minutes under microwave conditions. The reaction was quenched with 1M sodium hydroxide solution (40 ml) and extracted with ethyl acetate (3×30 ml). The combined organic layers were dried over anhydrous sodium sulfate, filtered and concentrated to give crude di-tert-butyl((2S,2'S)-((((ethane-1,2-diylbis(2,1-phenylene))bis(azandiyl) )bis(5.5-dimethoxy-3,3-dimethyl-1-oxopentane-1,2-diyl))bis(azandiyl))bis(1-oxo-4-(tritylthio)butan-1,2-diyl))dicarbamate (4.0 g, crude) as a brown solid. To a solution of crude di-tert-butyl((2S,2'S)-((((ethane-1,2-diylbis(2,1-phenylene))bis(azandiyl))bis(5,5-dimethoxy-3,3 -dimethyl-1-oxopentane-1,2-diyl))bis(azandiyl))bis(1-oxo-4-(tritylthio)butane-1,2-diyl))dicarbamate (4 g, crude) in dichloromethane (50 ml) trifluoroacetic acid (10 ml) was slowly added. The mixture was stirred at 40 °C for 2 hours. The reaction mixture was concentrated and purified by silica gel chromatography [dichloromethane/methanol (6:1 v/v)] to give (4S,4'S,9aS,9a'S)-N,N'-(ethane-1,2- diylbis(2,1-phenylene))bis(4-amino-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) (2.3 g, 3.32 mmol, yield 77.2%) as a yellow solid. LCMS (2.5 minutes, formic acid): Retention time = 1.317 minutes, m/z: 692.9 (M+1) ⁺ .

Step 5: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-(((ethane-1,2-diylbis(2,1-phenylene))bis (azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1- oxopropane-1,2-diyl))bis(methylcarbamate)

To a solution of (4S,4'S,9aS,9a'S)-N,N'-(ethane-1,2-diylbis(2,1-phenylene))bis(4-amino-8,8-dimethyl-5-oxooctagadropyrrolo[2 ,1-b][1,3]thiazepine-7-carboxamide) (1 g, 1.44 mmol), N-(tert-butoxycarbonyl)-N-methyl-L-alanine (580 mg, 2.88 mmol), 1-hydroxybenzotriazole (430 mg, 3.17 mmol) and 4-methylmorpholine (580 mg, 5.76 mmol) in tetrahydrofuran (30 ml), N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (580 mg, 3.04 mmol) was added. The mixture was stirred at room temperature for 3 hours. The reaction was quenched with saturated water. sodium bicarbonate solution (25 ml) and extracted with ethyl acetate (3×15 ml). The combined organic layers were washed with brine (20 ml), dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by chromatography on silica gel [petroleum ether/ethyl acetate (1:1 v/v)] to give di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S, 9aS,9a'S)-(((ethane-1,2-diylbis(2,1-phenylene))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b ][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate) (1.2 g, 1.13 mmol, 78.5% yield) as beige solid. LCMS (2.5 minutes, formic acid): Retention time = 1.910 minutes, m/z: 431.9[(M-2Boc)+2] ⁺ /2.

Step 6: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-(ethane-1,2-diylbis(2,1-phenylene))bis(8,8-dimethyl-4-(( S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-(((ethane-1,2-diylbis(2,1-phenylene))bis( azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropane) -1,2-diyl))bis(methylcarbamate) (90 mg, 0.085 mmol) in methanol (10 ml) was added 4 N. hydrogen chloride in 1,4-dioxane (5 ml). The mixture was stirred at room temperature for 4 hours. The mixture was then concentrated and crystallized from ether and methanol to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-(ethane-1,2-diylbis(2,1-phenylene))bis (8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctapndropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride (15 mg, 0.016 mmol , yield 18.8%) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₃ ) δ ppm 9.51 (s, 2H), 9.15 (s, 2H), 8.83-8.77 (m, 4H), 7.39-7.53 (m, 4H), 7.21-7.12 (m, 4H), 5.50(t, J=8.0 Hz, 2H), 4.74(t, J=9.6 Hz, 2H), 4.38 (s, 2H), 3.90-3.82 (m, 2H), 3.17-3.11 ( m, 2H), 2.99-2.82 (m, 6H), 2.48 (m, 6H), 2.26-2.21 (m, 2H), 2.04-1.95 (m, 4H), 1.72-1.63 (m, 2H), 1.36( d, J=6.4 Hz, 6H), 1.14 (m, 6H), 1.12 (m, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.293 minutes, m/z: 862.9 (M+1) ⁺ .

Example 4

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-(ethane-1,2-diylbis(2,1-phenylene))bis(8,8-dimethyl-4-((S)- 2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

Step 1: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-(((ethane-1,2-diylbis(2,1-phenylene))bis (azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1- thioxopropane-1,2-diyl))bis(methylcarbamate)

To a solution of (4S,4'S,9aS,9a'S)-N,N'-(ethane-1,2-diylbis(2,1-phenylene))bis(4-amino-8,8-dimethyl-5-oxooctahydropyrrolo[2 ,1-b][1,3]thiazepine-7-carboxamide) (300 mg, 0.44 mmol) in dichloromethane (20 ml) at 0 °C, triethylamine (132 mg, 1.31 mmol) and tert-butyl(S)- methyl (1-(6-nitro-1H-benzo[d][1,2,3]triazol-1-yl)-1-thioxopropan-2-yl)carbamate (400 mg, 1.09 mmol). The mixture was warmed to room temperature and stirred overnight. The mixture was washed with saturated water. sodium bicarbonate solution (15 ml) and saline solution (15 ml). The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by preparative HPLC, resulting in di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-(((ethane-1,2-diylbis(2 ,1-phenylene))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis( azandiyl))bis(1-thioxopropane-1,2-diyl))bis(methylcarbamate) (50 mg, 0.046 mmol, 10.5% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 2.173 minutes, m/z: 1116.6 (M+Na) ⁺ .

Step 2: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-(ethane-1,2-diylbis(2,1-phenylene))bis(8,8-dimethyl-4-(( S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-(((ethane-1,2-diylbis(2,1-phenylene))bis( azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane -1,2-diyl))bis(methylcarbamate) (50 mg, 0.046 mmol) in dichloromethane (5 ml) was added 4 N. hydrogen chloride in 1,4-dioxane (4 ml). The mixture was stirred at room temperature for 4 hours. The mixture was concentrated and dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-(ethane-1,2-diylbis(2,1-phenylene))bis(8 ,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride (35 mg, 0.036 mmol, yield 78.3%) as a yellow solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 10.85(d, J=6.8 Hz, 2H), 9.59 (s, 2H), 9.49 (s, 2H), 8.59 (s, 2H), 7.39- 7.33 (m, 4H), 7.21-7.11 (m, 4H), 5.45(t, J=8.0 Hz, 2H), 5.18(t, J=8.2 Hz, 2H), 4.41 (s, 2H), 4.25-4.23 (m, 2H), 3.72-3.65 (m, 2H), 3.51-3.47 (m, 2H), 3.16(t, J=12.4 Hz, 2H), 2.93-2.88 (m, 2H), 2.50 (s, 6H ), 2.28-2.16 (m, 4H), 2.06-2.00 (m, 2H), 1.84-1.75 (m, 2H), 1.41(d, J=6.4 Hz, 6H), 1.14 (m, 12H). LCMS (2.5 minutes, formic acid): Retention time = 1.389 minutes, m/z: 894.8 (M+1) ⁺ .

Example 5

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-(ethane-1,2-diylbis(4,1-phenylene))bis(8,8-dimethyl-4-((S)- 2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b](1,3]thiazepine-7-carboxamide) ditrifluoroacetate

Step 1: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-(((ethane-1,2-diylbis(4,1-phenylene))bis (azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1 - oxopropane-1,2-diyl))bis(methylcarbamate)

To a solution of (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][ 1,3]thiazepine-7-carboxylic acid (Intermediate I) (230 mg, 0.519 mmol) in 1,2-dichloroethane (20 ml) was added N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl (EEDQ) ( 175 mg, 0.709 mmol), N,N-diisopropylethylamine (120 mg, 0.930 mmol) and 4,4'-(ethane-1,2-diyl)dianiline (50 mg, 0.236 mmol). The mixture was stirred at 50°C overnight. The solvent was removed under reduced pressure, followed by chromatography on silica gel [petroleum ether/ethyl acetate (2:1 v/v)] to give the desired product di-tert-butyl((2S,2'S)-(((4S, 4'S,7S,7'S,9aS,9a'S)-(((ethane-1,2-diylbis(4,1-phenylene))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo [2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate) (100 mg, 0.094 mmol, yield 39.8%) as a yellow solid. LCMS (2.5 minutes, formic acid): Retention time = 1.828 minutes, m/z: 432.0 {[(M-2 Vos)+2]/2} ⁺ .

Step 2: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-(ethane-1,2-diylbis(4,1-phenylene))bis(8,8-dimethyl-4-(( 8)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide)ditrifluoroacetate

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-(((ethane-1,2-diylbis(4,1-phenylene))bis( azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropane) -1,2-diyl))bis(methylcarbamate) (100 mg, 0.094 mmol) in methanol (5 ml) was added 4 N. hydrogen chloride in methanol (5 ml). The mixture was stirred at room temperature for 6 hours. The mixture was concentrated and purified by preparative-HPLC to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-(ethane-1,2-diylbis(4,1-phenylene))bis(8 ,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide)ditrifluoroacetate (64 mg, 0.059 mmol, yield 62.8%) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 9.99 (s, 2H), 8.94 (s, 2H), 8.80-8.78 (m, 4H), 7.50(d, J=8.0 Hz, 4H), 7.17(d, J=8.0 Hz, 4H), 5.49(t, J=7.6 Hz, 2H), 4.73(t, J=9.0 Hz, 2H), 4.24 (s, 2H), 3.89-3.83 (m, 2H ), 3.21-3.15 (m, 2H), 3.12-3.09 (m, 2H), 2.80 (m, 2H), 2.50 (s, 6H), 2.24-2.20 (m, 2H), 2.13-2.11 (m, 2H ), 1.98-1.93 (m, 2H), 1.85-1.76 (m, 2H), 1.38(d. J=6.8 Hz, 6H), 1.10 (m, 6H), 1.03 (m, 6H). LCMS (2.5 minutes, formic acid): Retention time=1.284 minutes, m/z: 862.9 (M+1) ⁺ .

Example 6

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-(ethane-1,2-diylbis(4,1-phenylene))bis(8,8-dimethyl-4-((S)- 2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide)dihydrochloride

Step 1: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-(((ethane-1,2-diylbis(4,1-phenylene))bis (azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandium))bis(1 - thioxopropane-1,2-diyl))bis(methylcarbamate)

To a solution of (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][ 1,3]thiazepine-7-carboxylic acid (Intermediate II) (141 mg, 0.312 mmol) in 1,2-dichloroethane (20 ml) was added N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl (EEDQ) ( 105 mg, 0.423 mmol), N,N-diisopropylethylamine (72 mg, 0.564 mmol) and 4,4'-(ethane-1,2-diyl)dianiline (30 mg, 0.141 mmol). The mixture was stirred at 50°C overnight. The solvent was removed under reduced pressure. The crude product was purified by silica gel chromatography [petroleum ether/ethyl acetate (2:1 v/v)] followed by preparative-HPLC to give di-tert-butyl((2S,2'S)-(((4S,4'S ,7S,7'S,9aS,9a'S)-(((ethane-1,2-diylbis(4,1-phenylene))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[ 2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane-1,2-diyl))bis(methylcarbamate) (60 mg, 0.055 mmol, yield 39.0%) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 2.059 minutes.

Step 2: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-(ethane-1,2-diylbis(4,1-phenylene))bis(8,8-dimethyl-4-(( S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-6util((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-(((ethane-1,2-diylbis(4,1-phenylene))bis( azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane -1,2-diyl))bis(methylcarbamate) (70 mg, 0.064 mmol) in methanol (5 ml) was added 4 N. hydrogen chloride in methanol (3 ml). The mixture was stirred at room temperature overnight. The solvent was removed under reduced pressure to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-(ethane-1,2-diylbis(4,1-phenylene))bis(8,8 -dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride (43 mg, 0.044 mmol, 68.8% yield ) as a yellow solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 11.04(d, J=6.0 Hz, 2H), 10.95(d, J=6.8 Hz, 2H), 10.11-10.10 (m, 2H), 9.80 ( s, 1H), 9.56 (s, 1H), 8.64 (s, 1H), 8.43 (s, 1H), 7.51(d, J=8.0 Hz, 4H), 7.15(d, J=8.4 Hz, 4H), 5.45 (kV, J=5.6 Hz, 2H), 5.18-5.09 (m, 2H), 4.29 (s, 2H), 4.24-4.21 (m, 2H), 3.22-3.17 (m, 2H), 3.02-2.99 ( m, 2H), 2.80 (s, 2H), 2.50 (s, 6H), 2.26-2.22 (m, 4H), 2.02-1.91 (m, 4H), 1.46-1.43 (m, 6H), 1.12 (s, 6H), 1.04 (m, 12H). LCMS (2.5 minutes, formic acid): Retention time = 1.326 minutes, m/z: 895.1 (M+1) ⁺ .

Example 7

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-(1R,1'R,2R,2'R)-(piperazine-1,4-dicarbonyl)6is(1,2,3, 4-tetrahydronaphthalene-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine -7-carboxamide) dihydrochloride

Step 1: (1R,2R)-1-((tert-butoxycarbonyl(amino)-1,2,3,4-tetrahydronaphthalene-2-carboxylic acid

Sodium carbonate was added to a solution of (1R,2R)-1-amino-1,2,3,4-tetrahydronaphthalene-2-carboxylic acid hydrochloride (1.3 g, 5.71 mmol) in dioxane/water (1:1 v/v). vol., 100 ml) to adjust the pH to 8. Di-tert-butyl dicarbonate (1.62 g, 7.42 mmol) was then added. The mixture was stirred at room temperature overnight. Upon completion of the reaction, the pH of the mixture was adjusted to 4 using a 20% citric acid solution. The mixture was extracted with ethyl acetate (3×100 ml). The combined organic layers were washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by silica gel chromatography [petroleum ether/ethyl acetate (3/2 v/v)] to give (1R,2R)-1-((tert-butoxycarbonyl)amino)-1,2,3, 4-tetrahydronaphthalene-2-carboxylic acid (1.3 g, 4.46 mmol, 78.1% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 1.519 minutes, m/z: 289.9 (M-1) ^- .

Step 2: di-tert-butyl((1R,1'R,2R,2'R-(piperazine-1,4-dicarbonyl)bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl)) dicarbamate

To a solution of (1R,2R)-1-((tert-butoxycarbonyl)amino)-1,2,3,4-tetrahydronaphthalene-2-carboxylic acid (270 mg, 0.90 mmol) and piperazine (39.9 mg, 0.46 mmol) in Triethylamine (187.5 mg, 1.85 mmol) and diethyl cyanophosphonate (226.7 mg, 1.38 mmol) were slowly added to N,N-dimethylformamide (12 ml) at -10°C. The mixture was stirred for 20 minutes. The mixture was allowed to warm to room temperature and stirred for 3 hours. The reaction was quenched with ice water (50 ml) to give a precipitate which was filtered and dried to give di-tert-butyl((1R,1'R,2R,2'R)-(piperazine-1,4 -dicarbonyl)bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))dicarbamate (435 mg, 0.69 mmol, 68.7% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 1.74 minutes, m/z: 532.7 (M - Boc+1) ⁺ .

Step 3: Piperazin-1,4-diylbis(((1R,2R)-1-amino-1,2,3,4-tetrahydronaphthalene-2-yl)methanone) dihydrochloride

To a solution of di-tert-butyl((1R,1'R,2R,2'R)-(piperazine-1,4-dicarbonyl)bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl)) dicarbamate (435 mg, 1.0 mmol) in dichloromethane (20 ml) was slowly added 4 N. hydrogen chloride in 1,4-dioxane (2 ml). The mixture was stirred at room temperature overnight. The solvent was concentrated under reduced pressure to obtain crude piperazine-1,4-diylbis(((1R,2R)-1-amino-1,2,3,4-tetrahydronaphthalene-2-yl)methanone) dihydrochloride (402 mg ) as a white solid. It was used in the reaction without further purification. LCMS (2.5 minutes, formic acid): Retention time = 1.07 minutes, m/z: 432.9 (M+1) ⁺ .

Step 4: di-tert-butyl((2R,2'S)-(((4S,4'R,7S,7'S,9aS,9a'S)-((((1R,1'R,2R,2'R-( piperazine-1,4-dicarbonyl)bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2 ,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate)

Solution of piperazin-1,4-diylbis(((1R,2R)-1-amino-1,2,3,4-tetrahydronaphthalene-2-yl)methanone) dihydrochloride (150 mg, 0.297 mmol), (4S,7S, 9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7 -carboxylic acid (Intermediate I) (319 mg, 0.68 mmol), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide methiodide (200 mg, 1.02 mmol), 1-hydroxybenzotriazole (187 mg, 1.36 mmol) and N,N -diisopropylethylamine (269 mg, 2.04 mmol) in dichloromethane (10 ml) was stirred at room temperature overnight. The reaction was quenched with water (30 ml) and extracted with dichloromethane (3×30 ml). The combined organic layers were washed with brine, dried, filtered and concentrated. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (2/1 v/v)] to give the crude product (93 mg) as a yellow oil. This material was further purified by preparative HPLC to yield di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1R,1'R, 2R,2'R)-(piperazine-1,4-dicarbonyl)bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8 -dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate) ( 64 mg, 0.05 mmol, yield 13.9%) as a white solid. LCMS (3.0 minutes, formic acid): Retention time = 2.51 minutes, m/z: 1282.6 (M+1) ⁺ , 642.5 {[(M - 2Boc)+2]/2} ⁺ .

Step 5: (4S,4'S,7S,7'S,9aS,9a'S)-N.N'-((1R,1'R,2R,2'R)-piperazine-1,4-dicarbonyl)bis(1,2 ,3,4-tetrahadronaphthalene-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1, 3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1R,1'R,2R,2'R)-(piperazine- 1,4-dicarbonyl)bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1 -b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate) (64 mg, 0.05 mmol) in dichloromethane (5 ml) hydrogen chloride (4N in 1,4-dioxane, 1 ml) was added. The reaction mixture was stirred at room temperature overnight. The solvent was removed in vacuo to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1R,1'R,2R,2'R)-(piperazine-1,4- dusarbonyl)bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2, 1-b][1,3]thiazepine-7-carboxamide) dihydrochloride (50 mg, 0.043 mmol, 84.3% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 8.64 (s, 2H), 8.00(d, J=8.8 Hz, 1H), 7.87(d, J=8.4 Hz, 1H), 7.31-7.25 ( m, 2H), 7.19-7.07 (m, 6H), 5.50-5.45 (m, 2H), 5.40-5.34 (m, 2H), 4.70-4.64 (m, 2H), 3.78-3.65 (m, 6H), 3.62-3.59 (m, 2H), 3.49-3.47 (m, 2H), 3.22-3.11 (m, 4H), 3.08-3.03 (m, 4H), 2.93-2.91 (m, 2H), 2.76 (s, 4H ), 2.43 (m, 6H), 2.17-2.20 (m, 2H), 2.10-2.01 (m, 4H), 1.94-1.88 (m, 2H), 1.76-1.58 (m, 2H), 1.35-1.32 (m , 6H), 1.03-1.00 (m, 12H). LCMS (2.5 minutes, formic acid): Retention time = 1.407 minutes, m/z: 1082.8 (M+1) ⁺ .

Example 8

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1R,1'R,2R,2'R)-(piperazine-1,4-dicarbonyl)bis(1,2,3 ,4-tetrahydronaphthalene-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3] thiazepine-7-carboxamide) dihydrochloride

Step 1: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1R,1'R,2R,2'R)-(piperazine -1,4-dicarbonyl)bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2, 1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropan-1,2-diyl))bis(methylcarbamate)

Solution of piperazin-1,4-diylbis(((1R,2R)-1-amino-1,2,3,4-tetrahydronaphthalene-2-yl)methanone) dihydrochloride (Example 7, Step 3) (150 mg, 0.297 mmol ), (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][ 1,3]thiazepine-7-carboxylic acid (Intermediate II) (272.8 mg, 0.593 mmol), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide methiodide (170.7 mg, 0.89 mmol), 1-hydroxybenzotriazole (160.5 mg, 1.188 mmol) and N,N-diisopropylethylamine (230.2 mg, 1.782 mmol) in dichloromethane (10 ml) were stirred at room temperature overnight. The reaction was quenched with water (30 ml) and extracted with dichloromethane (3×30 ml). The combined organic layers were washed with brine, dried, filtered and concentrated. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (2/1 v/v)] to give the crude product (170 mg) as a yellow oil. This material was further purified by preparative HPLC to yield di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1R,1'R, 2R,2'R)-(piperazine-1,4-dicarbonyl)bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8 -dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropan-1,2-diyl))bis(methylcarbamate) ( 90 mg, 0.07 mmol, yield 23.6%) as a white solid. LCMS (3.0 minutes, formic acid): Retention time = 2.75 minutes, m/z: 1315.6 (M+1) ⁺ .

Step 2: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1R,1'R,2R,2'R)-(piperazine-1,4-dicarbonyl)bis(1, 2,3,4-tetrahadronaphthalene-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1 ,3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1R,1'R,2R,2'R)-(piperazine- 1,4-dicarbonyl)bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1 -b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropan-1,2-diyl))bis(methylcarbamate) (96 mg, 0.073 mmol) in dichloromethane (10 ml) hydrogen chloride (4N in 1,4-dioxane, 1 ml) was added. The mixture was stirred at room temperature overnight. The solvent was removed under reduced pressure to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1R,1'R,2R,2'R)-(piperazine-1,4 -dicarbonyl)bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2 ,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride (60 mg, 0.05 mmol, 68.8% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 11.12-10.98 (m, 1H), 10.89-10.87 (m, 1H), 9.81 (s, 1H), 9.62 (s, 1H), 8.67 (s , 1H), 8.44-8.36 (m, 1H), 8.15-8.07 (m, 1H), 7.95-7.88 (m, 1H), 7.26-7.25 (m, 2H), 7.15-7.09 (m, 6H), 5.47 -5.41 (m, 2H), 5.36-5.35 (m, 2H), 5.17-5.03 (m, 2H), 4.41-4.32 (m, 2H), 3.78-3.65 (m, 4H), 3.60-3.47 (m, 4H), 3.39 (s, 2H), 3.25-3.09 (m, 4H), 3.03-2.96 (m, 2H), 2.75 (s, 4H), 2.51 (s, 6H), 2.30-2.19 (m, 6H) , 2.02 (s, 2H), 1.91 (s, 2H), 1.66-1.62 (m, 2H), 1.45-1.41 (m, 6H), 1.04 (s, 6H), 1.00 (s, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.246 minutes, m/z: 1114.4 (M+1) ⁺ .

Example 9

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1R,1'R,2R,2'R)-(((1,4-phenylenebis(methylene))bis(azandiyl) )bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5- oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

Step 1: di-tert-bugyl((1R,1'R,2R,2'R)-(((1,4-phenylenebis(methylene))bis(azandiyl))bis(carbonyl))bis(1,2 ,3,4-tetrahydronaphthalene-2,1-diyl))dicarbamate

To a solution of (1R,2R)-1-((tert-butoxycarbonyl)amino)-1,2,3,4-tetrahydronaphthalene-2-carboxylic acid (114 mg, 0.39 mmol) and 1,4-phenylenedimethanamine (26 mg, 0.19 mmol) in N,N-dimethylformamide (5 ml) at -10°C, triethylamine (79 mg, 0.78 mmol) and diethyl cyanophosphonate (96 mg, 0.59 mmol) were slowly added. The mixture was stirred for 20 minutes. The mixture was allowed to warm to room temperature and stirred for 3 hours. The reaction was quenched with ice water (50 ml), resulting in a precipitate that was filtered and dried, resulting in di-tert-butyl((1R,1'R,2R,2')-(((1,4- phenylenebis(methylene))bis(azandiyl))bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))dicarbamate (180 mg, 0.26 mmol, 67.4% yield) as a white solid substances. LCMS (2.5 minutes, formic acid); Retention time = 1.736 minutes, ha/g: 704.8 (M+Na) ⁺ .

Step 2: (1R,1'R,2R,2'R)-N,N'-(1,4-phenylenebis(methylene))bis(1-amino-1,2,3,4-tetrahydronaphthalene-2- carboxamide) dihydrochloride

To a solution of di-tert-butyl((1R,1'R,2R,2'R)-(((1,4-phenylenebis(methylene))bis(azandiyl))bis(carbonyl))bis(1,2, 3,4-tetrahydronaphthalene-2,1-diyl))dicarbamate (180 mg, 0.26 mmol) in dichloromethane (10 ml) was slowly added 4 N. hydrogen chloride in 1,4-dioxane (1 ml). The mixture was stirred at room temperature for 4 hours and the solvent was removed under reduced pressure to obtain (1R,1'R,2R,2'R)-N,N'-(1,4-phenylenebis(methylene))bis (1-amino-1,2,3,4-tetrahydronaphthalene-2-carboxamide) dihydrochloride (150 mg) as a white solid. It was used in the next step without further purification. LCMS (2.5 minutes, formic acid): Retention time = 1.085 minutes, m/z: 482.9 (M+1) ⁺ .

Step 3: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1R,1'R,2R,2'R)-(( (1,4-phenylenebis(methylene))bis(azandiyl))bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1-tyl))bis(azandiyl))bis(carbonyl))bis (8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis (methyl carbamate)

Solution of (1R,1'R,2R,2'R)-N,N'-(1,4-phenylenebis(methylene))bis(1-amino-1,2,3,4-tetrahydronaphthalene-2-carboxamide) dihydrochloride (150 mg, 0.27 mmol), (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[ 2,1-b][1,3]thiazepine-7-carboxylic acid (Intermediate I) (240 mg, 0.54 mmol), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide methiodide (155.3 mg, 0.81 mmol), 1-Hydroxybenzotriazole (146 mg, 1.08 mmol) and N,N-diisopropylethylamine (209.3 mg, 1.62 mmol) in dichloromethane (10 ml) were stirred at room temperature overnight. The reaction was quenched with water (30 ml) and extracted with dichloromethane (3×30 ml). The combined organic layers were washed with brine, dried, filtered and concentrated. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (2:1 v/v)] to give the crude product (170 mg) as a yellow oil. This material was further purified by preparative HPLC to yield di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1R,1'R, 2R,2'R)-(((1,4-phenylenebis(methylene))bis(azandiyl))bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis( azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropane) -1,2-diyl))bis(methylcarbamate) (76 mg, 0.057 mmol, 21.1% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 1.80 minutes, m/z: 566.9 {[M-2Boc)=2]/2} ⁺ .

Step 4: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1R,1'R,2R,2'R)-(((1,4-phenylenebis(methylene))bis (azandiyl))bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methidamino)propanamido) -5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7S,9aS,9a'S)-((((1R,1'R,2R,2'R)-((( 1,4-phenylenebis(methylene))bis(azandiyl))bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(azandiyl))bis(carbonyl))bis( 8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis( methyl carbamate) (80 mg, 0.06 mmol) in dichloromethane (6 ml), hydrogen chloride (4 N in 1,4-dioxane, 1 ml) was added. The mixture was stirred at room temperature overnight. The mixture was concentrated and dried in high vacuum, resulting in (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1R,1'R,2R,2'R)-(((1 ,4-phenylenebis(methylene))bis(azandiyl))bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(8,8-dimethyl-4-((8 )-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride (46.2 mg, 0.038 mmol, 60.5% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 9.24 (s, 2H), 8.86-8.85 (m, 2H), 8.78(d, J=6.8 Hz, 2H), 8.36(t, J=5.2 Hz, 2H), 7.94(d, J=9.2 Hz, 2H), 7.31-7.29 (m, 2H), 7.22 (s, 4H), 7.14-7.12 (m, 4H), 7.09-7.06 (m, 3H) , 5.48(t, J=7.8 Hz, 2H), 5.43-5.30 (m, 2H), 4.72-4.67 (m, 2H), 4.38-4.33 (m, 2H), 4.14 (s, 2H), 4.08-4.03 (m, 2H), 3.91-3.86 (m, 2H), 3.21-3.15 (m, 2H), 2.96-2.87 (m, 4H), 2.82-2.68 (s, 4H), 2.47(t, J=4.4 Hz , 6H), 2.21-2.16 (m, 2H), 2.09-1.99 (m, 6H), 2.00-1.96 (m, 2H), 1.75-1.70 (m, 2H), 1.38(d, J=6.8 Hz, 6H ), 1.03 (s, 6H), 1.00 (s, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.453 minutes, m/z: 1133.7 (M+1) ⁺ , 1155.6 (M+Na) ⁺ .

Example 10

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1R,1'R,2R,2'R)-(((1,4-phenylenebis(methylene))bis(azandiyl) )bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5- oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide)

Stage 1: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1R,1'R,2R,2'R)-(( (1,4-phenylenebis(methylene))bis(azandiyl))bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(azandiyl))bis(carbonyl))bis (8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane-1,2-diyl))bis (methylcarbamate)

Solution of (1R,1'R,2R,2'R)-N,N'-(1,4-phenylenebis(methylene))bis(1-amino-1,2,3,4-tetrahydronaphthalene-2-carboxamide) dihydrochloride (Example 9, Step 2) (116 mg, 0.21 mmol), (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8.8 -dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxylic acid (Intermediate II) (201 mg, 0.44 mmol), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide methiodide ( 120 mg, 0.63 mmol), 1-hydroxybenzotriazole (113 mg, 0.84 mmol) and N,N-diisopropylethylamine (279 mg, 2.16 mmol) in dichloromethane (10 ml) were stirred at room temperature overnight. The reaction was quenched with water (30 ml) and extracted with dichloromethane (3×30 ml). The combined organic layers were washed with brine, dried, filtered and concentrated. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (2/1 v/v)] to give the crude product (110 mg) as a yellow oil, which was further purified by prep-HPLC to give di -tert-6util((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1R,1'R,2R,2'R)-(((1,4 -phenylenebis(methylene))bis(azandiyl))bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8 -dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropan-1,2-diyl))bis(methylcarbamate) ( 54 mg, 0.039 mmol, yield 18.9%) as a white solid. LCMS (3.0 minutes, formic acid): Retention time = 2.614 minutes, m/z: 1388 (M+Na) ⁺ .

Step 2: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1R,1'R,2R,2'R)-(((1,4-phenylenebis(methylene))bis (azandiyl))bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido) -5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide)

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1R,1'R,2R,2'R)-((( 1,4-phenylenebis(methylene))bis(azandiyl))bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(azandiyl))bis(carbonyl))bis( 8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane-1,2-diyl))bis( methyl carbamate) (54 mg, 0.04 mmol) in dichloromethane (5 ml), hydrogen chloride (4 N in 1,4-dioxane, 1 ml) was added. The reaction mixture was stirred at room temperature overnight. The solvent was removed under reduced pressure and diluted with water. The pH was adjusted to 8~9 with sodium bicarbonate and extracted with dichloromethane (3×10 ml). The combined organic layers were washed with brine, dried, filtered and concentrated under reduced pressure. The residue was purified by thin layer chromatography [dichloromethane/methanol (8/1 v/v)] to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1R,1 'R,2R,2'R)-(((1,4-phenylenebis(methylene))bis(azandiyl))bis(carbonyl))bis(1,2,3,4-tetrahadronaphthalene-2,1-diyl) )bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) (6 mg, 0.005 mmol, yield 13%) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 8.43-8.37 (m, 2H), 7.85-7.82 (m, 2H), 7.33-7.27 (m, 2H), 7.20 (s, 4H), 7.15 -7.13 (m, 4H), 7.08-7.06 (m, 2H), 5.51-5.46 (m, 2H), 5.40-5.37 (m, 2H), 5.10-5.06 (m, 2H), 4.40-4.34 (m, 2H), 4.16 (s, 2H), 4.04-4.00 (m, 2H), 3.49-3.42 (m, 2H), 3.22-3.14 (m, 2H), 2.98-2.91 (m, 4H), 2.79- 2.69 (m, 4H), 2.42-2.31 (m, 2H), 2.27-2.20 (m, 2H), 2.16 (m, 6H), 2.07-1.98 (m, 4H), 1.74-1.65 (m, 2H), 1.22-1.21 (m, 6H), 1.07-1.06 (m, 6H), 1.03-1.02 (m, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.52 minutes, 1164.7 (M+1) ⁺ .

Example 11

(4S,7S,9aS)-8,8-dimethyl-4-[(2S)-2-(methylamino)propanamido]-5-oxo-N-[(1R,2R)-2-{1(1rs,4rs )-4-[(1R,2R)-1-[(4S,7S,9aS)-8,8-dimethyl-4-[(2S)-2-(methylamino)propanamido]-5-oxo-octahydropyrrolo[2 ,1-b][1,3]thiazepine-7-amido]-1,2,3,4-tetrahydronaphthalene-2-amido]cyclohexyl]carbamoyl}-1,2,3,4-tetrahydronaphthalene-1-yl] -octahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide dihydrochloride

Step 1: di-tert-butyl((1R,1'R,2,2'R)-((((1R,4R)-cyclohexane-1,4-diyl)bis(azandiyl))bis(carbonyl)) bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))dicarbamate

To a solution of (1R,2R)-1-((tert-butoxycarbonyl)amino)-1,2,3,4-tetrahydronaphthalene-2-carboxylic acid (250 mg, 0.858 mmol) and (1r,4r)-cyclohexane-1 ,4-diamine (49 mg, 0.429 mmol) in N,N-dimethylformamide (10 ml) at -10°C, N,N-diisopropylethylamine (221 mg, 1.716 mmol) and diethyl cyanophosphonate (210 mg, 1.287 mmol) were slowly added. The mixture was stirred for 20 minutes. The mixture was allowed to warm to room temperature and stirred for 3 hours. The reaction was quenched with ice water (100 ml) to give a precipitate which was filtered to give di-tert-butyl((1R,1'R,2R,2'R)-((((1R,4R) -cyclohexane-1,4-diyl)bis(azandiyl))bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))dicarbamate (240 mg, 0.363 mmol, yield 84.6%) as an orange solid. LCMS (2.5 minutes, formic acid): Retention time = 1.724 minutes, m/z: 628.8 (M+Na) ⁺ .

Step 2: (1R,1'R,2R,2'R)-N,N'-((1R,4R)-cyclohexane-1,4-diyl)bis(1-amino-1,2,3,4 -tetrahydronaphthalene-2-carboxamide) dihydrochloride

To a solution of di-tert-butyl((1R,1'R,2R,2'R)-((((1R,4R)-cyclohexane-1,4-diyl)bis(azandiyl))bis(carbonyl))bis (1,2,3,4-tetrahydronaphthalene-2,1-diyl))dicarbamate (150 mg, 0.23 mmol) in dichloromethane (5 ml) was slowly added 4 N. hydrogen chloride in 1,4-dioxane (0.5 ml). The mixture was stirred at room temperature overnight. The mixture was concentrated under reduced pressure to give (1R,1'R,2R,2'R)-N,N'-((1R,4R)-cyclohexane-1,4-diyl)bis(1-amino- 1,2,3,4-tetrahydronaphthalene-2-carboxamide) dihydrochloride (130 mg, crude) as a yellow syrup. LCMS (2.5 minutes, formic acid): Retention time = 1.122 minutes, m/z: 461.1 (M+1) ⁺

Step 3: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1R,1'R,2R,2'R)-cyclohexane- 1,4-diyl)bis(azandiyl))bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8 -dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate)

Solution of (1R,1'R,2R,2'R)-N,N'-((1R,4R)-cyclohexane-1,4-diyl)bis(1-amino-1,2,3,4-tetrahydronaphthalene -2-carboxamide) dihydrochloride (130 mg, 0.24 mmol), (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl -5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxylic acid (Intermediate 1) (216.2 mg, 0.49 mmol), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide methiodide (140.1 mg , 0.73 mmol), 1-hydroxybenzotriazole (131.7 mg, 0.97 mmol) and N,N-diisopropylethylamine (189 mg, 1.46 mmol) in dichloromethane (10 ml) were stirred at room temperature overnight. The reaction was quenched with water (50 ml) and extracted with dichloromethane (3×50 ml). The combined organic layers were washed with brine, dried, filtered and concentrated. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (2/1 v/v)] to give the crude product (170 mg) as a yellow oil. This material was further purified by preparative HPLC to yield di-tert-6util((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1R,1'R, 2R,2'R)-((((1R,4R)-cyclohexane-1,4-diyl)bis(azandiyl))bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1- diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl)) bis(1-oxopropane-1,2-diyl))bis(methylcarbamate) (86 mg, 0.06 mmol, 26.8% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 1.96 minutes, m/z: 555.9 {[M-2Boc)+2]/2} ⁺ .

Step 4: (4S,7S,9aS)-8,8-dimethyl-4-[(2S)-2-(methylamino)propanamido]-5-oxo-N-{(1R,2R)-2-{[( 1rs,4rs)-4-[(1R,2R)-1-[(4S,7S,9aS)-8,8-damethyl-4-[(2S)-2-(methylamino)propanamido]-5-oxo- octahydropyrrolo[2,1-b][1,3]thiazepine-7-amido]-1,2,3,4-tetrahydronaphthalene-2-amido]cyclohexyl]carbamoyl}-1,2,3,4-tetrahydronaphthalene-1 -yl]-octahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1R,1'R,2R,2'R)-((( (1R,4R)-cyclohexane-1,4-diyl)bis(azandiyl))bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(azandiyl))bis( carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropane-1,2- diyl))bis(methylcarbamate) (80 mg, 0.073 mmol) in dichloromethane (10 ml), hydrogen chloride (4 N in 1,4-dioxane, 1 ml) was added. The reaction mixture was stirred at room temperature overnight. The solvent was concentrated under reduced pressure and the solid was dried under high vacuum to give the title compound (62 mg, 0.052 mmol, 79.8% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 9.29 (s, 1H), 8.89-8.88 (m, 1H), 8.78(d, J=6.8 Hz, 2H), 7.90(d, J =9.2 Hz, 2H), 7.74(d, J=7.6 Hz, 2H), 7.28-7.26 (m, 2H), 7.12-7.05 (m, 6H), 5.46(t, J=7.6 Hz, 2H) , 5.36-5.33 (m, 2H), 4.71-4.67 (m, 2H), 4.15 (s, 2H), 3.90 (s, 2H), 3.41-3.39 (m, 2H), 3.16(t, J= 11.8 Hz, 2H), 2.96-2.92 (m, 2H), 2.79-2.64 (m, 6H), 2.48 (s, 6H), 2.19-2.11 (m, 4H), 2.01-1.94 (m, 6H) , 1.78-1.68 (m, 6H), 1.40(d, J=6.8 Hz, 6H), 1.20-1.12 (m, 4H), 1.02 (s, 6H), 1.00 (s, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.280 minutes, m/z: 1110.8 (M+1) ⁺ .

Example 12

(4S,7S,9aS)-8,8-dimethyl-4-[(2S)-2-(methylamino)propanethioamido]-5-oxo-N-[(1R,2R)-2-{[(1rs,4rs )-4-[(1R,2R)-1-[(4S,7S,9aS)-8,8-dimethyl-4-[(2S)-2-(methylamino)propanethioamido]-5-oxo-octahydropyrrolo[2 ,1-b][1,3]thiazepine-7-amido]-1,2,3,4-tetrahydronaphthalene-2-amido]cyclohexyl]carbamoyl}-1,2,3,4-tetrahydronaphthalene-1-yl] -octahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide dihydrochloride

Stage 1: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1R,1'R,2R,2'R)-(( ((1R,4R)-cyclohexane-1,4-diyl)bis(azandiyl))bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(azandiyl))bis (carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane-1,2 -diyl))bis(methylcarbamate)

Mixture of (1R,1'R,2R,2'R)-N,N'-((1R,4R)-cyclohexane-1,4-diyl)bis(1-amino-1,2,3,4-tetrahydronaphthalene -2-carboxamide) dihydrochloride (Example 11, Step 2) (200 mg, 0.375 mmol), (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido )-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxylic acid (Intermediate II) (413 mg, 0.901 mmol), N-(3-dimethylaminopropyl)- N-ethylcarbodiimide hydrochloride (216 mg, 1.125 mmol), 1-hydroxybenzotriazole (203 mg, 1.5 mmol) and N,N-diisopropylethylamine (290 mg, 2.25 mmol) in dichloromethane (15 ml) were stirred at room temperature for 4 hours. The reaction mixture was poured into water (15 ml) and extracted with dichloromethane (2×10 ml). The combined organic phase was dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was then purified by preparative-TLC [petroleum ether/ethyl acetate (1:2 v/v)] followed by preparative-HPLC to give di-tert-butyl((2S,2'S)-(((4S, 4'S,7S,7'S,9aS,9a'S)-((((1R,1'R,2R,2'R)-((((1R,4R)-cyclohexane-1,4-diyl)bis(azandiyl)) bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1- b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropan-1,2-diyl))bis(methylcarbamate) (140 mg, 0.104 mmol, yield 28.0%) in as a beige solid. LCMS (2.5 minutes, formic acid): Retention time = 2.115 minutes, m/z: 572.1 {[(M-2Boc)+2]/2} ⁺ .

Step 2: (4S,7S,9aS)-8,8-dimethyl-4-[(2S)-2-(methylamino)propanethioamido]-5-oxo-N-[(1R,2R)-2-{[( 1rs,4rs)-4-[(1R,2R)-1-[(4S,7S,9aS)-8,8-dimethyl-4-[(2S)-2-(methylamino)propanethioamido]-5-oxo- octahydropyrrolo[2,1-b][1,3]thiazepine-7-amido]-1,2,3,4-tetrahydronaphthalene-2-amido]cyclohexyl]carbamoyl}-1,2,3,4-tetrahydronaphthalene-1 -yl]-octahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide dihydrochdoride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1R,1'R,2R,2'R)-((( (1R,4R)-cyclohexane-1,4-diyl)bis(azandiyl))bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(azandiyl))bis( carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane-1,2- diyl))bis(methylcarbamate) (140 mg, 0.104 mmol) in dichloromethane (5 ml) was added 4 N. hydrogen chloride in 1,4-dioxane (0.5 ml). The mixture was stirred at room temperature overnight. The solvent was removed under reduced pressure and dried under high vacuum to give the title compound (70 mg, 0.058 mmol, 55.3% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 11.04-11.00 (m, 2H), 10.91 (s, 2H), 8.67 (s, 1H), 8.43 (s, 1H), 7.97(t, J =8.4 Hz, 2H), 7.76-7.75 (m, 2H), 7.27-7.25 (m, 2H), 7.15-7.06 (m, 6H), 5.45-5.33 (m, 4H), 5.15-5.09 (m, 2H ), 4.32 (s, 2H), 4.18(d, J=9.2 Hz, 2H), 3.51-3.47 (m, 2H), 3.22-3.17 (m, 2H), 3.07-3.00 (m, 2H), 2.79- 2.66 (m, 6H), 2.48 (s, 6H), 2.33-2.18 (m, 4H), 2.05-1.94 (m, 6H), 1.79-1.74 (m, 6H), 1.45 (s, 6H), 1.24- 1.14 (m, 4H), 1.04-1.03 (m, 6H), 1.00 (m, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.242 minutes, m/z: 1144.4 (M+1) ⁺ , 572.3 [(M+2)/2] ⁺ .

Example 13

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-(hexa-2,4-diyne-1,6-diylbis(oxy)) bis(2,3-dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamio)propanamido)-5-oxooctahydropyrrolo [2,1- b][1,31 thiazepine-7-carboxamide) dihydrochloride

Step 1: (1S,2R)-2-(prop-2-yn-1-yloxy)-2,3-dihydro-1H-inden-1-amine

Sodium hydride (60%, dispersion in Paraffin Oil) (0.59 g, 14.7 mmol). The mixture was allowed to warm to room temperature. Then 3-bromoprop-1-yne (1.75 g, 14.7 mmol) was added and the resulting mixture was heated to 70°C. It was stirred at 70°C overnight. The mixture was quenched with ice water (50 ml) and extracted with ethyl acetate (3×30 ml). The combined organic layers were washed with brine (50 ml), dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by silica gel chromatography [petroleum ether/ethyl acetate (3:2 v/v)] to give (1S,2R)-2-(prop-2-yn-1-yloxy)-2,3 -dihydro-1H-inden-1-amine (1.2 g, 6.4 mmol, 47.8% yield) as a black oil. LCMS (electrospray, m/z): 187.1, 188.1 [M+H] ⁺ , retention time 0.942 minutes. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 7.36-7.29 (m, 1H), 7.22-7.13 (m, 3H), 4.25 (dd, J=4.2, 2.4 Hz, 2H), 4.22-4.15 (m, 2H), 3.43(t, J=2.4 Hz, 1H), 2.93 (kvd, J=16.1,3.5 Hz, 2H), 1.75 (s, 2H).

Step 2: tert-butyl((S)-1-(((4S,7S,9aS)-8,8-dimethyl-5-oxo-7-(((1S,2R)-2-(prop-2- in-1-yloxy)-2,3-dihydro-1H-inden-1-yl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-oxopropan-2 -yl)(methyl)carbamate

To a solution of (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][ 1,3]thiazepine-7-carboxylic acid (260 mg, 0.587 mmol), 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (305 mg, 0.801 mmol) and N,N- diisopropylethylamine (138 mg, 1.068 mmol) in 1,2-dichloroethane (10 ml) was added (1S,2R)-2-(prop-2-yn-1-yloxy)-2,3-dihydro-1H-inden-1 -amine (100 mg, 0.534 mmol). The mixture was stirred at 50°C overnight. The solvent was removed under reduced pressure. The crude product was purified by silica gel chromatography [petroleum ether/ethyl acetate (1:1 v/v)] and further purified by thin layer chromatography [ethyl acetate/petroleum ether (3/2 v/v)] to give tert-butyl((S)-1-(((4S,7S,9aS)-8,8-dimethyl-5-oxo-7-(((1S,2R)-2-(prop-2-in-1 -yloxy)-2,3-dihydro-1H-inden-1-yl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl) (methyl)carbamate (160 mg, 0.261 mmol, yield 48.9%). LCMS (2.5 minutes, formic acid): Retention time = 1.662 minutes, m/z: 634.8 (M+Na) ⁺ .

Step 3: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-(hexa-2 ,4-diyne-1,6-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl -5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate)

A. To a solution of tert-butyl((S)-1-(((4S,7S,9aS)-8,8-dimethyl-5-oxo-7-(((1S,2R)-2-(prop-2-yne -1-yloxy)-2,3-dihydro-1H-inden-1-yl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-oxopropan-2- yl)(methyl)carbamate (160 mg, 0.261 mmol) and pyridine (124 mg, 1.566 mmol) in acetonitrile (7 ml), copper acetate (57 mg, 0.313 mmol) was added. The mixture was stirred at 85°C for 1 hour. The mixture was cooled, concentrated and diluted with ethyl acetate (15 ml). Aqueous ammonia (20-fold dilution, 15 ml) was added. The aqueous phase was extracted with ethyl acetate (2×10 ml). The combined organic layers were washed with brine (15 ml), dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by thin layer chromatography [ethyl acetate/petroleum ether (2/1 v/v)] followed by preparative-HPLC to give di-tert-butyl((2S,2'S)-(((4S,4'S ,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-(hexa-2,4-diyne-1,6-diylbis(oxy))bis(2,3-dihydro -1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4 -diyl))bis(azandiyl))bis(1-oxopropane-1,2-diyl))bis(methylcarbamate) (80 mg, 0.065 mmol, 50.2% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 1.853 minutes, m/z: 511.8 {[(M-2Boc)+2]/2} ⁺ .

b. To a solution of tert-butyl((S)-1-(((4S,7S,9aS)-8,8-dimethyl-5-oxo-7-(((1S,2R)-2-(prop-2-yne -1-yloxy)-2,3-dihydro-1H-inden-1-yl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-oxopropan-2- yl)(methyl)carbamate (1.0 g, 1.63 mmol) and pyridine (775 mg, 9.79 mmol) in acetonitrile (20 ml), copper acetate (366 mg, 1.96 mmol) was added. The mixture was stirred at 85°C for 1 hour. The reaction mixture was cooled, concentrated and diluted with ethyl acetate (100 ml). A solution of 20-fold diluted ammonia (50 ml) was added. The aqueous phase was extracted with ethyl acetate (2×50 ml). The organic layer was combined and washed with brine. Dried over anhydrous sodium sulfate and concentrated to give the crude product. The residue was purified by silica gel column chromatography using ethyl acetate/petroleum ether = 1/1 to give the crude product. The crude product was then purified by preparative-HPLC to give di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R )-(hexa-2,4-diyne-1,6-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis (8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis (methylcarbamate) (800 mg, 0.65 mmol, 80.2% yield) as a white solid. LCMS (electrospray, m/z): 1222.6, 512.2 [M/2-Voc+H] ⁺ , retention time 1.735 minutes. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 7.96 (d, J=8.8 Hz, 2H), 7.77(d, J=6.5 Hz, 2H), 7.24 (ddd, J=14.9, 8.9, 2.8 Hz, 8H), 5.48(t, J=7.9 Hz, 2H), 5.38(dd, J=8.7, 5.3 Hz, 2H), 4.67-4.62 (m, 2H), 4.30 (m, 6H), 4.23 (s , 2H), 3.15(t, J=11.9 Hz, 2H), 3.03(d, J=4.4 Hz, 2H), 2.88(d, J=16.4 Hz, 2H), 2.73 (s,6H), 2.26-2.17 (m, 2H), 2.16-2.05 (m, 6H), 1.76 (dt, J=23.3, 10.1 Hz, 4H), 1.40 (s, 18H). 1.24(d, J=7.1 Hz, 6H), 1.07(d, J=14.9 Hz, 12H).

Step 4: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R-(hexa-2,4-diyne-1,6-diylbis(oxy ))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2, 1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-(hexa-2, 4-diyne-1,6-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl- 5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate) (80 mg, 0.065 mmol) in dichloromethane (5 ml) was added 4 N. hydrogen chloride in 1,4-dioxane (1.5 ml). The mixture was stirred at room temperature overnight. The solvent was removed under reduced pressure and the solid was dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-( hexa-2,4-diyne-1,6-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S) -2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride (55 mg, 0.050 mmol, 76.9% yield) as a white solid. ¹ H-NMR (400 MHz. DMSO-d ₆ ) δ ppm 9.53-9.50 (m, 2H), 8.95-8.91 (m, 2H), 8.88(d, J=7.2 Hz, 2H), 8.00(d , J=8.8 Hz, 2H), 7.28-7.20 (m, 8H), 5.51(t, J=7.8 Hz, 2H), 5.38(dd, J=8.6, 5.4 Hz, 2H), 4.76-4.71 (m, 2H), 4.24-4.28 (m, 6H), 4.23 (s, 2H), 3.93-3.85 (m, 2H), 3.22-3.16 (m. 2H), 3.10-3.00 (m, 4H), 2.94-2.90 ( m, 2H), 2.47(t, J=5.2 Hz, 6H), 2.29-2.14 (m, 4H), 1.87-1.79 (m, 4H), 1.42(d, J=6.8 Hz, 6H), 1.10 (s , 6Н), 1.06 (s, 6Н). LCMS (2.5 minutes, formic acid): Retention time = 1.328 minutes, m/z: 512.0 [(M+2)/2] ⁺ .

Example 14

(4S,7S,9aS)-N-((1S,2R)-2-((6-(((1S,2R)-1-((4S,7S,9aS)-8,8-dimethyl-4- ((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamido)-2,3-dihydro-1H-inden-2-yl)oxy )hexa-2,4-diin-1-yl)oxy)-2,3-dihydro-1H-indei-1-yl)-8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido )-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide

Step 1: tert-butyl((S)-1-(((4S,7S,9aS)-8,8-dimethyl-5-oxo-7-(((1S,2R)-2-(prop-2- in-1-yloxy)-2,3-dihydro-1H-inden-1-yl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-thioxopropane-2 -yl)(methyl)carbamate

To a solution of (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][ 1,3]thiazepine-7-carboxylic acid (500 mg, 1.088 mmol), 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (621 mg, 1.632 mmol) and N,N-diisopropylethylamine (309 mg, 2.393 mmol) in 1,2-dichloroethane (15 ml) was added (1S,2R)-2-(prop-2-yn-1-yloxy)-2,3-dihydro-1H -inden-1-amine (224 mg, 1.197 mmol). The mixture was stirred at 50°C overnight. The mixture was concentrated and purified by silica gel chromatography [petroleum ether/ethyl acetate (3:2 v/v)] followed by preparative TLC [petroleum ether/ethyl acetate (2:3 v/v)] to give tert -butyl((8)-1-(((4S,7S,9aS)-8,8-dimethyl-5-oxo-7-(((1S,2R)-2-(prop-2-yn-1- yloxy)-2,3-dihydro-1H-inden-1-yl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-thioxopropan-2-yl) methyl)carbamate (400 mg, 0.636 mmol, yield 58.5%). LCMS (2.5 minutes, formic acid): Retention time = 1.812 minutes, t/g: 650.8 (M+Na) ⁺ .

Step 2: tert-butyl((S)-1-(((4S,7S,9aS)-7-(((1S,2R)-2-((6-(((1S,2R)-1-( (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1, 3]thiazepine-7-carboxamido)-2,3-dihydro-1H-inden-2-yl)oxy)hexa-2,4-diin-1 -yl)oxy)-2,3-dihydro-1H-inden-1- yl)carbamoyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate

To a solution of tert-butyl((S)-1-(((4S,7S,9aS)-8,8-dimethyl-5-oxo-7-(((1S,2R)-2-(prop-2-yne -1-yloxy)-2,3-dihydro-1H-inden-1-yl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-oxopropan-2- yl)(methyl)carbamate (390 mg, 0.636 mmol), tert-butyl((S)-1-(((4S,7S,9aS)-8,8-dimethyl-5-oxo-7-(((1S ,2R)-2-(prop-2-yn-1-yloxy)-2,3-dihydro-1H-inden-1-yl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepine-4 -yl)amino)-1-thioxopropan-2-yl)(methyl)carbamate (400 mg, 0.636 mmol) and pyridine (301 mg, 3.816 mmol) in acetonitrile (15 ml) was added copper acetate (277 mg, 1.526 mmol) . The mixture was stirred at 85°C for 40 minutes. After cooling, the solvent was removed under reduced pressure. The crude product was diluted with ethyl acetate (20 ml) and aqueous ammonia (20-fold dilution, 20 ml). The aqueous phase was extracted with ethyl acetate (2×15 ml). The combined organic layers were washed with brine (20 ml), dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by preparative-TLC [petroleum ether/ethyl acetate (2:3 v/v)] and preparative-HPLC to give tert-butyl((S)-1-(((4S,7S,9aS) -7-(((1S,2R)-2-((6-(((1S,2R)-1-((4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl )(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamido)-2,3-dihydro-1H-inden-2-yl )oxy)hexa-2,4-diin-1-yl)oxy)-2,3-dihydro-1H-inden-1-yl)carbamoyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b ][1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate (50 mg, 0.040 mmol, yield 6.29%) and di-tert-butyl((2S,2'S) -(((4S,4'S,7S,7'S,9a8S9a'S)-((((1S,1'S,2R,2'R)-(hexa-2,4-diyne-1,6-diylbis(oxy))bis( 2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3] thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane-1,2-diyl))bis(methylcarbamate) (30 mg, 0.024 mmol, 3.77% yield), both as white solids.

Step 3: (4S,7S,9aS)-N-((1S,2R)-2-((6-(((1S,2R)-1-((4S,7S,9aS)-8,8-dimethyl -4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamido)-2,3-dihydro-1H-indene-2- yl)oxy)hexa-2.4-diin-1-yl)oxy)-2.3-dihydro-1H-inden-1-yl)-8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido) -5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide dihydrochloride

To a solution of tert-butyl((S)-1-(((4S,7S,9aS)-7-(((1S,2R)-2-((6-(((1S,2R)-1-(( 4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctagadropyrrolo[2,1-b][1,3 ]thiazepine-7-carboxamido)-2,3-dihydro-1H-inden-2-yl)oxy)hexa-2,4-diin-1-yl)oxy)-2,3-dihydro-1H-inden-1 -yl)carbamoyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate (50 mg, 0.040 mmol) in dichloromethane (5 ml) was added 4 N. hydrogen chloride in 1,4-dioxane (0.5 ml). The mixture was stirred at room temperature overnight. The mixture was concentrated and dried, resulting in (4S,7S,9aS)-N-((1S,2R)-2-((6-(((1S,2R)-1-((4S,7S,9aS) -8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamido)-2,3-dihydro- 1H-inden-2-yl)oxy)hexa-2,4-diin-1-yl)oxy)-2,3-Dihydro-1H-inden-1-yl)-8,8-dimethyl-4-(( S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide dihydrochloride (20 mg, 0.018 mmol, 45% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d6) δ ppm 11.03-10.93 (m, 2H), 9.74-9.58 (m, 1H), 9.28 (s, 1H), 8.86-8.84 (m, 2H ), 8.65-8.45 (m, 1H), 8.11-8.05 (m, 1H), 8.02-8.00 (m, 1H), 7.27-7.18 (m, 8H), 5.52-5.43 (m, 2H), 5.40-5.37 (m, 2H), 5.17 (kV, J=6.4 Hz, 1H), 4.76-4.65 (m, 1H), 4.38-4.23 (m, 8H), 3.91-3.88 (m, 1H), 3.73-3.65 (m , 1H), 3.51-3.46 (m, 1H), 3.22-3.16 (m, 2H), 3.10-2.97 (m, 4H), 2.95-2.90 (m, 1H), 2.49 (s, 6H), 2.33-2 ,12 (m, 4H), 1.96-1.76 (m, 4H), 1.45(d, J=6.4 N, 3H), 1.41(d, J=6.8 N, 3H), 1.10-1.06 (m, 12H). LCMS (2.5 minutes, formic acid): Retention time = 1.643 minutes, m/z: 520.0 [(M+2)/2] ⁺ .

Example 15

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-(hexa2,4-diyne-l,6-diylbis(oxy))bis( 2,3-dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b] [1,3]thiazepine-7-carboxamide)dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-(hexa-2, 4-diyne-1,6-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimetal- 5-oxooctahydropyrrolo[2,1-b][1,3]taazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropan-1,2-diyl))bis(methylcarbamate) (Example 14, Step 2) (35 mg, 0.028 mmol) in dichloromethane (5 ml) was added 4 N. hydrogen chloride in 1,4-dioxane (0.5 ml). The mixture was stirred at room temperature overnight. The solvent was removed under reduced pressure and dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-(hexa2, 4-diyne-1,6-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-( methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride (12 mg, 0.011 mmol, 39.3% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 11.00-10.91 (m, 2H), 9.66-9.51 (m, 2H), 8.62-8.44 (m, 2H), 8.08 (dd, J=13.9, 9.0 Hz, 2H), 7.28-7.18 (m, 8H), 5.46 (kv, J=9.3 Hz, 2H), 5.38(dd, J=8.6, 5.4 Hz, 2H), 5.17(t, J=10.2 Hz, 2H), 4.38-4.26 (m, 10H), 3.23-3.17 (m, 2H), 3.06-2.99 (m, 6H), 2.50 (s, 6H), 2.33-2.17 (m, 4H), 1.95- 1.84 (m, 4H), 1.44(d, J=6.4H, 6H), 1.10 (s, 6H), 1.08 (s, 6H). LCMS (2.5 minutes, formic acid): Retention time=1.505 minutes, m/z: 1055.6 (M+1) ⁺ .

Example 16

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-(butane-1,4-diylbis(oxy))bis(2,3- dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3 ]thiazepine-7-carboxamide)

Step 1: (1S,2R)-1-isocyano-2-(prop-2-yn-1-yloxy)-2.3-dihydro-1H-indene

A suspension of (1S,2R)-2-(prop-2-yn-1-yloxy)-2,3-dihydro-1H-inden-1-amine (3.31 g, 17.68 mmol) and heated in ethyl formate (2S,8 ml , 354 mmol) at 70°C for 21 hours. After cooling, the solvent was removed under reduced pressure to obtain crude formamide (3.71 g). Et was added to a suspension of crude formamide in dichloromethane (DCM) (35 ml) at 0°C₃N (12.32 ml, 88 mmol) followed by POCl₃ (2.471 ml, 26.5 mmol). After 2 hours, the crude product was poured into a mixture of DCM (150 ml) and sat.water. NaHCO₃ (60 ml). The aqueous phase was separated and extracted with dichloromethane (50 ml). The combined organic layers were washed with brine (40 ml), dried (Na₂SO₄), filtered and concentrated. The crude product was absorbed on Celite^® and purified by silica gel chromatography [1-20% EtOAc in hexanes] to give (1S,2R)-1-isocyano-2-(prop-2-yn-1-yloxy)-2,3-dihydro-1H -indene, 0.15 ethyl acetate (solvate) (1.88 g, 8.93 mmol, 50.5% yield) as a light yellow oil.¹H-NMR (400 MHz, DMSO-d₆) δ ppm 2.99(dd, J=16.4, 5.9 Hz, 1H), 3.11(dd, J=16.0, 6.2 Hz, 1H), 3.53(t, J=2.3 Hz, 1H), 4.26-4.38 (m, 2H ), 4.44 (kv, J=5.6 Hz, 1H), 5.34-5.45 (m, 1H), 7.28-7.38 (m, 3H), 7.44(d, J=7.0 Hz, 1H); LCMS(electrospray) m/z: 171.0 (M-(NC))⁺.

Step 2: (4S,7S,9aS)-4-amino-8,8-dimethyl-5-oxo-N-((1S,2R)-2-(prop-2-yn-1-yloxy)-2, 3-dihydro-1H-inden-1-yl)octahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide and (4S,7R,9aS)-4-amino-8,8-dimethyl-5 -oxo-N-((1S,2R)-2-(prop-2-yn-1-yloxy)-2.3-dihydro-1H-inden-1-yl)octahydropyrrolo[2,1-b][1,3 ]thiazepine-7-carboxamide

A mixture of N-(tert-butoxycarbonyl)-S-trityl-1-homocysteine (2.05 g, 4.29 mmol), (1S,2R)-1-isocyano-2-(prop-2-yn-1-yloxy)-2, 3-dihydro-1H-indene, 0.15 ethyl acetate (solvate) (0.903 g, 4.29 mmol), 4,4-dimethoxy-2,2-dimethylbutanal (1.2 g, 7.49 mmol) and ammonia, 7 M in MeOH (1.226 ml, 8.58 mmol) in trifluoroethanol (16 ml) was heated at 80°C. After 1 hour, the solvent was removed under reduced pressure. The crude product was diluted with dichloromethane (100 ml) and washed with 1H. NaOH (15 ml). The aqueous layer was separated and extracted with ethyl acetate (75 ml). The combined organic layers were washed with brine (30 ml), dried (MgSO ₄ ), filtered and concentrated to give a foam. To this material were added dichloromethane (DCM) (20 ml) and TFA (4 ml, 51.9 mmol). The mixture was heated at 35-40°C. After 1 hour, TFA (2 ml) was added to the mixture and heated for 1.5 hours. The mixture was left to stir at room temperature. during the night. TFA (2 ml) was added and the mixture was heated at 50°C for 1 hour. The crude product was absorbed onto Celite® and purified with C18 using an ISCO device [20-30% ACN gradient, 0.1% formic acid], resulting in 2 fractions. The lyophilized fractions were individually diluted with ethyl acetate (150 ml) and washed with sat.water. NaHCO ₃ (25 ml), dried (Na ₂ SO ₄ ), filtered and concentrated. Two diastereoisomers were obtained - (4S,7S,9aS)-4-amino-8,8-dimethyl-5-oxo-N-((1S,2R)-2-(prop-2-yl-1-yloxy)-2 ,3-dihydro-1H-inden-1-yl)octahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide (290.1 mg, yield 15.8%) and (4S,7R,9aS)-4- amino-8,8-dimethyl-5-oxo-N-((1S,2R)-2-(prop-2-yn-1-yloxy)-2,3-dihydro-1H-inden-1-yl)octahydropyrrolo [2,1-b][1,3]thiazepine-7-carboxamide (283.3 mg, 15.4%), both isolated as foam.

7S diastereoisomer data: ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 1.06 (s, 3H), 1.09 (s, 3H), 1.67-1.82 (m, 2H), 1.96-2.05 (m, 1H) , 2.23(dd, J=12.9, 7.4 Hz, 1H), 2.81 (dt, J=11.5,2.6 Hz, 1H), 2.96 - 3.17 (m, 3H), 3.43(t, J=2.3 Hz, 1H ), 3.68(d, J=9.8 Hz, 1H), 4.13(t, J=2.5 Hz, 2H), 4.16 -4.19 (m, 1H), 4.28 - 4.35 (m, 1H), 5.27 - 5.43 (m, 2H), 7.13 - 7.32 (m, 4H), 7.81(d, J=8.6 Hz, 1H); LCMS (electrospray) m/z: 42S.3 (M+1) ⁺ .

Data for diastereoisomer 7R: ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 1.05 (s, 3H), 1.31 (s, 3H), 1.55 - 1.67 (m, 1H), 1.69(d, J= 13.3 Hz, 1H), 1.94 (br. s., 1H), 2.00-2.06 (m, 1H), 2.77 (dt, J=l 1.6, 2.8 Hz, 1H), 2.97(dd, J=16.4, 3.1 Hz , 1H), 3.08(dd, J=16.4, 5.5 Hz, 1H), 3.14 - 3.24 (m, 1H), 3.39(t, J=2.1 Hz, 1H), 3.69(d, J=9.8 Hz, 1H), 4.16 - 4.23 (m, 1H), 4.26 - 4.37 (m, 3H), 5.33(dd, J=8.6, 5.5 Hz, 1H), 5.48(d, J=9.0 Hz, 1H), 7.11- 7.27 (m, 4 N), 8.35 (d, J=9.0 Hz, 1H); LCMS (electrospray) m/z: 42S.7 (M+1) ⁺ .

Step 3: tert-butyl((S)-1-(((4S,75.9a5)-8,8-dimethyl-5-oxo-7-(((1S,2R)-2-(prop-2-yne -1-yloxy)-2.3-dihydro-1H-inden-1-yl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl) (methyl)carbamate

To a solution of (4S,7S,9aS)-4-amino-8,8-dimethyl-5-oxo-N-((1S,2R)-2-(prop-2-yn-1-yloxy)-2,3 -dihydro-1H-inden-1-yl)octahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide (287 mg, 0.671 mmol) and Boc-N-Me-Ala-OH (205 mg, 1.007 mmol) in N,N-dimethylformamide (DMF) (3 ml) at 0°C, Hunig's base (0.586 ml, 3.36 mmol) was added, followed by dropwise addition of T3P, 50 wt. % in EtOAc (0.699 ml, 1.175 mmol). After 45 minutes, the mixture was diluted with ethyl acetate (100 ml) and washed with sat.water. NaHCO ₃ (25 ml), then brine (25 ml), dried (Na ₂ SO ₄ ), filtered and concentrated. The crude product was absorbed onto Celite® and purified by silica gel chromatography [20-80% EtOAc in hexanes] to give tert-butyl((S)-1-(((4S,7S,9aS)-8,8-dimethyl -5-oxo-7-(((1S,2R)-2-(prop-2-yn-1-yloxy)-2,3-dihydro-1H-inden-1-yl)carbamoyl)octahydropyrrolo[2,1 -b][1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate (314.5 mg, 0.513 mmol, 76% yield) as a white solid. ¹ H-NMR (400 MHz, CHLOROFORM-d) δ ppm 1.13 (s, 3H), 1.20 (s, 3H), 1.35(d, J=7.0 Hz, 3H), 1.48 (s, 9H), 1.79 - 1.90 (m, 1H), 1.97 - 2.12 (m, 1H), 2.29(dd, J=13.3, 7.0 Hz, 2H), 2.50 (br. s., 1H), 2.77 - 2.84 (m, 4H ), 3.04 - 3.16 (m, 2H), 3.25 - 3.36 (m, 1H), 4.10(dd, J=15.6, 2.3 Hz, 1H), 4.17(dd, J=15.6,2.3 Hz, 1H), 4.32 ( s, 1H), 4.49 (kv, J=5.1 Hz, 1H), 4.55(dd, J=10.0, 6.1 Hz, 1H), 5.17(dd, J=9.2, 7.6 Hz, 1H), 5.54(dd, J =8.2, 5.9 Hz, 1H), 7.17 - 7.25 (m, 3H), 7.31(d, J=6.2 Hz, 1H), 7.42(d, J=8.6 Hz, 2H); LCMS (electrospray) m/z: 613.4 (M+1) ⁺ .

Step 4: tert-butyl((S)-1-(((4S,7S,9aS)-7-(((1S,2R)-2-(allyloxy)-2,3-dihydro-1H-indene-1 -yl)carbamoyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,31 thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate

A suspension of tert-butyl((S)-1-(((4S,7S,9aS)-8,8-dimethyl-5-oxo-7-(((1S,2R)-2-(prop-2-in- 1-yloxy)-2,3-dihydro-1H-inden-1-yl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl )(methyl)carbamate (51.5 mg, 0.084 mmol) and Lindlar catalyst (12.8 mg, 6.01 μmol) were stirred under hydrogen atmosphere (1 atm) in MeOH (10 ml) for 2.5 hours. The suspension was filtered through a 0.45 μm disk and the filtrate was evaporated under reduced pressure to obtain tert-butyl((S)-1-(((4S,7S,9aS)-7-(((1S,2R)-2-( allyloxy)-2,3-dihydro-1H-inden-1-yl)carbamoyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)- 1-oxopropan-2-yl)(methyl)carbamate (51.4 mg, 0.071 mmol, 85% yield, 85% purity) as a film. LCMS (electrospray) m/z: 615.4, 617.6 (M+1) mixture of olefin and O-propyl (85:15 ratio according to proton NMR).

Step 5: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2')-(((E/ Z)-butyl-2-ene-1,4-diyl)bis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis (8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis (methylcarbamate)

A mixture of tert-butyl((S)-1-(((4S,7S,9aS)-7-(((1S,2R)-2-(allyloxy)-2,3-dihydro-1H-inden-1-yl )carbamoyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate (51.4 mg, 0.084 mmol) and 2nd generation Grubbs catalyst (6.39 mg, 7.52 µmol) were stirred in dichloromethane (DCM) (350 µl) at room temperature under a nitrogen atmosphere. After 1 day, a second batch of 2nd generation Grubbs catalyst (6.39 mg, 7.52 µmol) was added to this mixture. After 4 days, the crude mixture was purified by silica gel chromatography [20-100% EtOAC in hexanes], resulting in the adduct as a mixture of cis - and trans isomers (10.9 mg, 21.8%). LCMS (electrospray) m/z: 1199.7 (M-1).

Step 6: di-tert-butyl((2S,2'S,)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-(butyn- 1,4-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[ 2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate)

Suspension of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-(((E/Z )-but-2-en-1,4-diyl)bis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis( 8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis( methylcarbamate) (13 mg, 10.82 µmol) and palladium, 10 wt. % on activated carbon, Degussa, type E101 (1.151 mg, 1.082 µmol) was stirred under a hydrogen atmosphere (1 atm) in methanol (4 ml). After 1 day, the mixture was filtered through a 0.45 µm disk and re-hydrogenated at 30 psi. inch to MeOH. A new batch of Pd/C was added and the mixture was stirred under a hydrogen atmosphere at 50 psi. inch. After 4 days, the suspension was filtered through a 0.45 μm disk and the solvent was evaporated under reduced pressure. The crude product was purified C18 using an ISCO device [50-90% ACN gradient, 0.1% formic acid], resulting in di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS ,9a'S)-((((1S,1'S,2R,2'R)-(butane-1,4-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl)) bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1 -oxopropane-1,2-diyl))bis(methylcarbamate) (4.5 mg, 3.74 µmol, 34.6% yield) as a white solid. ¹ H-NMR (400 MHz, CHLOROFORM-d) δ ppm 1.08 (s, 3H), 1.17 (s, 3H), 1.35(d, J=7.0 Hz, 3H), 1.41-1.51 (m, 12H) , 1.75-1.86 (m, 1H), 1.91(dd, J=13.3, 9.4 Hz, 1H),2.13 - 2.29 (m, 2H), 2.56 - 2.68 (m, 1H), 2.80 (s, 3H) , 2.90 - 3.03 (m, 2H), 3.14(t, J=12.7 Hz, 1H), 3.31-3.51 (m, 2H), 4.14 (kv, 1=4.3 Hz, 1H), 4.28 (s, 1H), 4.51(dd, J=10.2, 5.9 Hz, 1H), 5.12(t, J=8.4 Hz, 1H), 5.46(dd, J=8.2, 5.9 Hz, 1H), 7.14 - 7.25 (m, 4 N), 7.29(d, J=7.0 Hz, 1H), 7.35(d, J=4.3 Hz, 1H); LCMS (electrospray) m/z: 502.4 {[(M - 2 Vos)+2]/2} ⁺ .

Step 7: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-(butane-1,4-diylbis(oxy))bis(2 ,3-dihydro-1H-indene-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][ 1,3]thiazepine-7-carboxamide)

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-(butane-1, 4-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2, 1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate) (4.5 mg, 3.74 µmol) in dichloromethane ( DCM) (1 ml) at room temperature, hydrogen chloride (4Mb 1,4-dioxane) (0.2 ml, 0.800 mmol) was added. After 5 hours, the solvent was removed under reduced pressure. The crude product was purified C18 using an ISCO device [10-100% ACN gradient, 0.1% formic acid], resulting in (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S ,2R,2'R)-(butane-1,4-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-( (S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) (2.8 mg, 2.73 µmol, 73.1% yield) as a white solid. ¹ H-NMR (400 MHz, CHLOROFORM-d) δ ppm 1.11 (s, 3H), 1.17 (s, 3H), 1.29(d, J=7.0 Hz, 3H), 1.53 (br. s., 2H), 1.79 - 1.98 (m, 2H), 2.16 - 2.32 (m, 2H), 2.43 (s, 3H), 2.72(dd, J=14.8, 2.3 Hz, 1H), 2.99(d, J=4.7 Hz, 2H), 3.14 (kv, J=7.0 Hz, 1H), 3.24(t, J=12.9 Hz, 1H), 3.33 - 3.43 (m, 1H), 3.50(d, J=9.0 Hz, 1H), 4.18 ( kv, J=4.7 Hz, 1H), 4.30 (s, 1H), 4.59(dd, J=10.1, 7.0 Hz, 1H), 5.17(t, J=8.4 Hz, 1H), 5.45(dd, J=8.4 , 5.7 Hz, 1H), 7.15 - 7.25 (m, 3H), 7.29 -7.39 (m, 2H), 8.34 (d,. J=6.6 Hz, 1H); LCMS (electrospray) m/z: 1003.5 (M+1) ⁺ .

Example 17

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-(butane-1,4-diylbis(oxy))bis(2,3- dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3 ]thiazepine-7-carboxamide) dihydrochloride

Step 1: Butane-1,4-diylbis(4-methylbenzenesulfonate)

To a solution of butane-1,4-diol (2 g, 22.19 mmol) and triethylamine (8.98 g, 48.82 mmol) in dichloromethane (100 ml) was added 4-dimethylaminopyridine (0.54 g, 4.44 mmol) followed by the addition of p -tosyl chloride (9.31 g, 48.82 mmol). The mixture was stirred at room temperature for 3 hours. The mixture was concentrated. The crude product was purified by silica gel chromatography [petroleum ether/ethyl acetate (3:1 v/v)] to give butane-1,4-diylbis(4-methylbenzenesulfonate) (4 g, 10.04 mmol, 45.2% yield). as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 1.731 minutes, m/z: 420.8 (M+Na) ⁺ .

Step 2: (1S,1'S,2R,2'R)-2,2'-(butane-1,4-diylbis(oxy))bis(2.3-dihydro-1H-inden-1-amine)

Sodium hydride (60%, dispersion in Paraffin Oil) (221 mg, 5.52 mmol). The mixture was allowed to warm to room temperature. Butane 1,4-diylbis(4-methylbenzenesulfonate) (1 g, 2.51 mmol) was then added. The resulting mixture was stirred at 70°C overnight. The reaction was quenched with ice water (50 ml) and extracted with ethyl acetate (3 x 30 ml). The combined organic layers were washed with brine (50 ml), dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by silica gel chromatography [dichloromethane/methanol (10:1 v/v) to give (1S,1'S,2R,2'R)-2,2'-(butane-1,4-diylbis (hydroxy))bis(2,3-dihydro-1H-inden-1-amine) (220 mg, 0.62 mmol, 24.7% yield) as a brown solid. LCMS (2.5 minutes, formic acid): Retention time - 1.206 minutes, m/z: (M+1) ⁺ .

Step 3: di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-(butane-1 ,4-diylbis(oxy))bis(2.3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1 -b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropan-1,2-diyl))bis(methylcarbamate)

To a mixture of (1S,1'S,2R,2'R)-2,2'-(butane-1,4-diylbis(oxy))bis(2,3-dihydro-1H-inden-1-amine) (130 mg , 0.369 mmol) and (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1- b][1,3]thiazepine-7-carboxylic acid (Intermediate II) (373 mg, 0.812 mmol) in 1,2-dichloroethane (15 ml) was added N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl ( 274 mg, 1.107 mmol) and N,N-diisopropylethylamine (190 mg, 1.476 mmol). The resulting mixture was stirred at 50°C overnight. The reaction was quenched with water (50 ml) and extracted with dichloromethane (3 × 50 ml). The combined organic layers were washed with brine, dried, filtered and concentrated. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (1/1 v/v)] followed by preparative-HPLC to give di-tert-butyl((2S,2'S)-(((4S,4'S ,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-(butane-1,4-diylbis(oxy))bis(2,3-dihydro-1H-indene-2 ,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis( azandiyl))bis(1-thioxopropane-1,2-diyl))bis(methylcarbamate) (60 mg, 0.049 mmol, 13.3% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 2.154 minutes, m/z: 517.9 {[(M-2 Vos)+2]/2} ⁺ .

Step 4: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-(butane-1,4-diylbis(oxy))bis(2 ,3-dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][ 1,3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-(butane-1, 4-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2, 1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane-1,2-diyl))bis(methylcarbamate) (60 mg, 0.049 mmol) in dichloromethane ( 5 ml) added 4 N. hydrogen chloride in 1,4-dioxane (3 ml). The mixture was stirred at room temperature for 3 hours. The solvent was concentrated under reduced pressure and the solid was dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-( butane-1,4-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino) propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride (30 mg, 0.027 mmol, 57.7% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 11.01 (s, 1H), 10.93 (s, 1H), 9.63 (s, 1H), 9.48 (s, 1H), 8.64 (s, 2H), 8.47 (s, 2H), 7.98-7.93 (m, 2H), 7.24-7.20 (m, 8H), 5.46 (kV, J=8.8 Hz, 2H), 5.35-5.32 (m, 2H), 5.19- 5.14 (m, 2H), 4.28-4.26 (m, 4H), 4.10-4.09 (m, 2H), 3.73-3.65 (m, 2H), 3.51-3.47 (m, 2H), 3.39-3.38 (m, 2H ), 3.20-3.14 (m, 2H), 2.96-2.95 (m, 4H), 2.50 (s, 6H), 2.27-2.13 (m, 4H), 1.94-1.82 (m, 4H), 1.45 (s , 10H), 1.07 (m, 12H). LCMS (2.5 minutes, formic acid): Retention time = 1.408 minutes, m/z: 518.0 [(M+2)/2] ⁺ .

Example 18

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-((oxybis(ethane-2,1-diyl))bis(oxy)) bis(2,3-dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1- b][1,3]thiazepine-7-carboxamide) dihydrochloride

Step 1: (1S,1'S,2R,2'R)-2,2'-((oxybis(ethane-2,1-diyl))bis(oxy))bis(2,3-dihydro-1H-inden- 1-amine)

Sodium hydride (60%, dispersion in Paraffin Oil) (241 mg, 10.04 mmol) at 0°C in a nitrogen atmosphere. The mixture was stirred at room temperature for 30 minutes and then oxybis(ethane-2,1-diyl)bis(4-methylbenzenesulfonate) (1.0 g, 2.44 mmol) was added. The mixture was refluxed and stirred for 5 hours. The mixture was carefully quenched with water (150 ml) and extracted with ethyl acetate (3 x 50 ml). The combined organic layers were washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The residue was purified by thin layer chromatography (dichloromethane/methanol (8:1 v/v)] to give (1S,1'S,2R,2'R)-2,2'-((oxybis(ethane-2 ,1-diyl))bis(oxy))bis(2,3-dihydro-1H-inden-1-amine) (410 mg, 1.11 mmol, 53% yield) as a yellow oil. LCMS (2.5 minutes, formic acid ): Retention time =1.107 minutes, m/z: 368.9 (M+1) ⁺ .

Stage 2: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-((oxybis( ethane-2,1-diyl))bis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl -5-oxooctahydropyrrolo[2,1-b[1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate)

Solution of (1S,1'S,2R,2'R)-2,2'-((oxybis(ethane-2,1-diyl))bis(oxy))bis(2,3-dihydro-1H-inden-1- amine) (100 mg, 0.27 mmol), (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo [2,1-b][1,3]thiazepine-7-carboxylic acid (Intermediate 1) (252.8 mg, 0.57 mmol), N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl (201.3 mg, 0.81 mmol) N,N-diisopropylethylamine (140.3 mg, 1.09 mmol) in 1,2-dichloroethane (6 ml) was stirred at 50°C overnight. The solvent was removed under reduced pressure and the residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (1/1 v/v)] to give the product (260 mg) as a yellow oil. This material was further purified by preparative HPLC to yield di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R, 2'R)-((oxybis(ethane-2,1-diyl))bis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl ))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl) ))bis(methylcarbamate) (180 mg, 0.15 mmol, 54.4% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time =1.85 minutes, [1/2(M-Boc)+H] ⁺ =509.9 {[(M-2 Boc)+2]/2}.

Step 3: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-((oxybis(ethane-2,1-diyl))bis( oxy))bis(2.3-dihydro-1H-indene-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1 -b][1,3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-((oxybis(ethane -2,1-diyl))bis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl- 5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate) (180 mg, 0.12 mmol) in dichloromethane (5 ml), hydrogen chloride (4 N in 1,4-dioxane, 1 ml) was added. The reaction mixture was stirred at room temperature overnight.

The solvent was concentrated under reduced pressure and the solid was dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-( (oxybis(ztan-2,1-diyl))bis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S) -2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride (12S.4 mg, 0.12 mmol, 80% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 9.56 (m, 2H), 8.95-8.90 (m, 4H), 7.89(d, J=8.4 Hz, 2H), 7.23-7.20 (m, 8H ), 5.51(t, J=7.6 Hz, 2H), 5.34-5.30 (m, 2H), 4.73(t, J=8.4 Hz, 2H), 4.22-4.18 (m, 4H), 3.91-3.89 (m, 2H), 3.54-3.53 (m, 4H), 3.46 (s, 4H), 3.19(t, J=12.2 Hz, 2H), 2.98-2.90 (s, 6H), 2.46 (s, 6H), 2.24-2 .14 (m, 4H), 1.86-1.77 (m, 4H), 1.42-1.40 (m, 6H), 1.06-1.05 (m, 12H). LCMS (2.5 minutes, formic acid): Retention time=1.318 minutes, m/z: 1018.7 (M+1) ⁺ .

Example 19

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-((oxybis(ethane-2,1-diyl))bis(oxy)) bis(2,3-dihydro-1H-indene-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1- b|[1,3]thiazepine-7-carboxamide) dihydrochloride

Step 1: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-((oxybis( ethane-2,1-diyl))bis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl -5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropan-1,2-diyl))bis(methylcarbamate)

Solution of (1S,1'S,2R,2'R)-2,2'-((oxybis(ethane-2,1-diyl))bis(oxy))bis(2,3-dihydro-1H-inden-1- amine) (100 mg, 0.27 mmol), (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo [2,1-b][1,3]thiazepine-7-carboxylic acid (Intermediate II) (262 mg, 0.57 mmol), N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl (201.3 mg, 0.81 mmol) and N,N-diisopropylethylamine (140.3 mg, 1.09 mmol) in 1,2-dichloroethane (6 ml) were stirred at 50°C overnight. The solvent was removed under reduced pressure and the crude product was purified by thin layer chromatography [ethyl acetate/petroleum ether (1/1 v/v)] to obtain the product (200 mg) as a yellow oil. This material was further purified by preparative HPLC to yield di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R, 2'R)-((oxybis(ethane-2,1-diyl))bis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl ))bis(8,8-dimethyl-5-oxooctapfopyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropan-1,2-diyl ))bis(methylcarbamate) (150 mg, 0.13 mmol, 44.1% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 2.11 minutes, m/z: 526.1 {[(M-2 Vos)+2]/2} ⁺ .

Step 2: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-((oxybis(ethane-2,1-diyl))bis( oxy))bis(2,3-dihydro-1H-indene-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2 ,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-((oxybis(ethane -2,1-diyl))bis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl- 5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropan-1,2-diyl))bis(methylcarbamate) (150 mg, 0.122 mmol) in dichloromethane (5 ml) was added hydrogen chloride (4 N in 1,4-dioxane, 1 ml). The reaction mixture was stirred at room temperature overnight. The solvent was concentrated under reduced pressure and the solid was dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-( (oxybis(ethane-2,1-diyl))bis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S) -2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride (80.1 mg, 0.071 mmol, 60% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 11.06-10.93 (m, 2H), 9.76 (s, 1H), 9.58 (s, 1H), 8.65 (s, 1H), 8.45 (s, 1H ), 7.98(t, J=10.0 Hz, 2H), 7.23-7.20 (m, 8H), 5.46 (kV, J=7.6 Hz, 2H), 5.34-5.31 (m, 2H), 5.19-5.13 (m, 2H), 4.30-4.25 (m, 4H), 4.18-4.17 (m, 2H), 3.54-3.53 (m, 4H), 3.47-3.46 (m, 4H), 3.20(t, J=12.2 Hz, 2H) , 3.00-2.98 (m, 6H), 2.50(s, 6H), 2.33-2.21 (m, 4H), 1.96-1.82 (m, 4H), 1.45-1.43 (m, 6H), 1.07 (s, 12H) . LCMS (2.5 minutes, formic acid): Retention time = 1.404 minutes, m/z: 1072.7 (M+Na) ⁺ .

Example 20

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-(hexane-1,6-diylbis(oxy))bis(2,3- dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3 ]thiazepine-7-carboxamide) dihydrochloride

Step 1: (1S,1'S,2R,2'R)-2,2'-(hexane-l,6-diylbis(oxy))bis(2,3-dihydro-1H-inden-1-amine)

Sodium hydride (60 %, dispersion in Paraffin Oil) (428 mg, 10.70 mmol). The mixture was allowed to warm to room temperature. Then 1,6-dibromohexane (1 g, 4.12 mmol) was added. The resulting mixture was stirred at 70°C overnight. The mixture was quenched with ice water (50 ml) and extracted with ethyl acetate (3 x 30 ml). The combined organic layers were washed with brine (50 ml), dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by silica gel chromatography [ethyl acetate/methanol (10:1 v/v)] to give (170 mg, 0.45 mmol, 10.9% yield) as a brown solid. LCMS (2.5 minutes, formic acid): Retention time = 1.284 minutes, m/z: 381.0 (M+1) ⁺ .

Stage 2: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-(hexane-1.6 -diylbis(oxy))bis(2,3-dihydro-1H-indene-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1 -b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate)

To a mixture of (1S,1'S,2R,2'R)-2,2'-(hexane-1,6-diylbis(oxy)bis(2,3-dihydro-1H-inden-1-amine) (120 mg, 0.315 mmol) and (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b ][1,3]thiazepine-7-carboxylic acid (Intermediate I) (307 mg, 0.694 mmol) in 1,2-dichloroethane (8 ml) was added N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl (233 mg, 0.945 mmol) and N,N-diisopropylethylamine (162 mg, 1.26 mmol). The resulting mixture was stirred at 50°C overnight. The solvent was removed under reduced pressure. The crude product was purified by thin layer chromatography [ethyl acetate/petroleum ether (3 /2 v/v)] followed by preparative HPLC, resulting in di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((( (1S,1'S,2R,2'R)-(hexane-1,6-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis( carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropane-1,2- diyl))bis(methylcarbamate) (60 mg, 0.049 mmol, yield 15.6%) as a colorless oil. LCMS (2.5 minutes, formic acid): Retention time = 2.218 minutes, m/z: 515.9 {[(M-2 Vos)+2]/2} ⁺ .

Step 3: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-Hhexane-1,6-diylbis(oxy))bis(2.3- dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3 ]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-(hexane-1, 6-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2, 1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate) (60 mg, 0.049 mmol) in methanol ( 5 ml) added 4 N. hydrogen chloride in 1,4-dioxane (4 ml). The mixture was stirred at room temperature for 2 hours. The solvent was removed under reduced pressure and the solid was dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-( hexane-1,6-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino) propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride (30 mg, 0.027 mmol, 55.1% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 9.33 (s, 2H), 8.87-8.85 (m, 4H), 7.91(d, J=8.4 Hz, 2H), 7.24-7.21 (m, 8H), 5.50(t, J=7.8 Hz, 2H), 5.35-5.31 (m, 2H), 4.76-4.72 (m, 2H), 4.24 (s, 2H), 4.11-4.10 (m , 2H), 3.91-3.87 (m, 2H), 3.72-3.65 (m, 2H), 3.51-3.47 (m, 2H), 3.39-3.37 (m, 4H), 3.19(t, J=12.4 Hz , 2H), 2.98-2.97 (m, 4H), 2.93-2.89 (m, 2H), 2.48 (s, 6H), 2.24-2.13 (m, 4H), 1.84-1.79 (m, 4H), 1.41 -1.39 (m, 10H), 1.08 (m, 6H), 1.05 (m, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.365 minutes, m/z: 1030.8 (M+1) ⁺ .

Example 21

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-(hexane-1,6-diylbis(oxy))bis(2,3- dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3 ]thiazepine-7-carboxamide) dihydrochloride

Step 1: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-(hexane-1 ,6-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2 ,1-b][1,3]thiazegn-7,4-diyl))bis(azandiyl))bis(1-thioxopropan-1,2-diyl))bis(methylcarbamate)

To a mixture of (1S,1'S,2R,2'R)-2,2'-(hexane-1,6-diylbis(oxy)bis(2,3-dihydro-1H-inden-1-amine) (60 mg, 0.158 mmol) and (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b ][1,3]thiazepine-7-carboxylic acid (Intermediate II) (159 mg, 0.347 mmol) in 1,2-dichloroethane (5 ml) was added N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl (117 mg, 0.474 mmol) and N,N-diisopropylethylamine (81 mg, 0.632 mmol). The mixture was stirred at 50°C overnight. The solvent was removed under reduced pressure. The crude product was purified by thin layer chromatography [ethyl acetate/petroleum ether (1/ 1 v/v)] followed by preparative-HPLC, resulting in di-tert-butyl((2S,2,S)-(((4S,4'S,7S,7'S,9aS,9a'S)-(( ((1S,1'S,2R,2'R)-(hexane-1,6-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis (carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane-1,2 -diyl))bis(methylcarbamate) (30 mg, 0.024 mmol, yield 15.2%) as a colorless oil. LCMS (2.5 minutes, formic acid): Retention time = 2.218 minutes, m/z: 532.8 {[(M-2 Vos)+2]/2} ⁺ .

Step 2: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-(hexane-1,6-diylbis(oxy))bis(2 ,3-dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1][1, 3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-(hexane-1, 6-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2, 1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane-1,2-diyl))bis(methylcarbamate) (30 mg, 0.024 mmol) in dichloromethane ( 5 ml) added 4 N. hydrogen chloride in 1,4-dioxane (2 ml). The mixture was stirred at room temperature overnight. The solvent was removed under reduced pressure and the solid was dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-( hexane-1,6-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(8,8-damethyl-4-((S)-2-(methylamino) propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride (13 mg, 0.011 mmol, 48.3% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 11.02(d, J=6.4 Hz, 2H), 10.94(d, J=6.4 Hz, 2H), 9.71 (s, 1H), 9.54 (s, 1H), 8.64 (s, 1H), 8.44 (s, 1H), 8.01-7.95 (m, 2H), 7.24-7.21 (m, 8H), 5.46 (kV, J=8.0 Hz, 2H), 5.35-5.32 (m, 2H), 5.21-5.13 (m, 2H), 4.29-4.27 (m, 4H), 4.11-4.07 (m, 2H), 3.72-3.65 (m, 2H), 3.41-3.36 (m, 6H) , 3.23-3.17 (m, 2H), 3.01-2.97 (m, 6H), 2.51 (s, 6H), 2.33-2.23 (m, 4H), 1.96-1.83 (m, 4H), 1.45-1.43 (m, 10H), 1.08 (m, 12H). LCMS (2.5 minutes, formic acid): Retention time=1.449 minutes, m/z: 532.0 [(M+2)/2] ⁺ .

Example 22

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-((1,4-phenylenebis(methylene))bis(oxy))bis( 2,3-dihydro-1H-indene-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b] [1,3]thiazepine-7-carboxamide)

Step 1: (1S,1'S,2R,2'R)-2,2'-((1,4-phenylenebis(methylene))bis(oxy))bis(2,3-dihydro-1H-indene-1- amine)

Sodium hydride (60 %, dispersion in Paraffin Oil) (244 mg, 10.04 mmol) in a nitrogen atmosphere. The mixture was stirred at room temperature for 30 minutes, after which 1,4-bis(bromomethyl)benzene (644 mg, 2.43 mmol) was added. The mixture was refluxed for 5 hours. The mixture was carefully quenched with water (150 ml) and extracted with dichloromethane (3 x 50 ml). The combined organic layers were washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by thin layer chromatography [dichloromethane/methanol (7:1 v/v)] to give (1S,1'S,2R,2'R)-2,2'-((1,4- phenylenebis(methylene))bis(oxy))bis(2,3-dihydro-1H-inden-1-amine) (200 mg, 0.53 mmol, 22% yield) as a yellow oil. LCMS (2.5 minutes, formic acid): Retention time = 1.208 minutes, m/z: 400.9 (M+1) ⁺ .

Stage 2: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-((1, 4-phenylenebis(methylene))bis(oxy)')bis(2.3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5- oxooctahydropyrrolo[2,1-b][3,1]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl)1bis(methylcarbamate)

Solution of (1S,1'S,2R,2'R)-2,2'-((1,4-phenylenebis(methylene))bis(oxy))bis(2,3-dihydro-1H-inden-1-amine) (80 mg, 0.21 mmol), (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2 ,1-b][1,3]thiazepine-7-carboxylic acid (Intermediate 1) (198 mg, 0.45 mmol), N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl (157.6 mg, 0.64 mmol) and N,N-diisopropylethylamine (110 mg, 0.85 mmol) in 1,2-dichloroethane (5 ml) was stirred at 50°C overnight. The solvent was concentrated under reduced pressure. The crude product was purified by thin layer chromatography [ethyl acetate/petroleum ether (1/1 v/v)] to give the product (110 mg) as a yellow oil. This material was further purified by preparative HPLC to yield di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R, 2'R)-((1,4-phenylenebis(methylene))bis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl)) bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl)) bis(methylcarbamate) (68 mg, 0.045 mmol, 26.1% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 1.86 minutes, m/z: 526.2 {[(M-2 Vos)+2]/2} ⁺ .

Step 3: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-(1S,1'S,2R,2'R)-((1,4-phenylenebis(methylene))bis(oxy)) bis(2,3-dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1- b][1,3]thiazepine-7-carboxamide)

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-((1,4 -phenylenebis(methylene))bis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5- Oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate) (68 mg, 0.055 mmol ) in dichloromethane (5 ml) was added hydrogen chloride (4 N in 1,4-dioxane, 1 ml). The mixture was stirred at room temperature overnight. The solvent was removed under reduced pressure. The crude product was diluted with water and adjusted to pH 8~9 with sodium bicarbonate and extracted with dichloromethane (3 x 20 ml). The combined organic layers were washed with brine, dried, filtered and concentrated. The residue was purified by thin layer chromatography [dichloromethane/methanol (9/1 v/v)] to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S ,2R,2'R)-((1,4-phenylenebis(methylene))bis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl -4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) (38.8 mg, 0.037 mmol, 67.3% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 8.63-8.62 (m, 2H), 7.98(d, J=9.2 Hz, 2H), 7.26-7.23 (m, 12H), 5.50(t, J =7.8 Hz, 2H), 5.41-5.37 (m, 2H), 4.67-4.72 (m, 2H), 4.51 (s, 4H), 4.25-4.20 (m, 4H), 3.58-3.56 (m, 2H), 3.16-2.95 (m, 6H), 2.74-2.61 (s, 2H), 2.40 (s, 6H), 2.34-2.19 (m, 2H), 2.05-2.02 (m, 2H), 1.81-1.76 (m , 2H), 1.73-1.68 (m, 2H), 1.30(d, J=6.4 Hz, 6H), 1.04 (m, 12H). LCMS (2.5 minutes, formic acid): Retention time = 1.397 minutes, m/z: 1051.7 (M+1) ⁺ .

Example 23

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-((1,4-phenylenebis(methylene))bis(oxy))bis( oxy))bis(2,3-dihydro-1H-indene-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2 ,1-b][1,3]thiazepine-7-carboxamide)

Step 1: tert-butyl((S)-1-(((4S,7S,9aS)-7-(((1S,2R)-2-((4-((((1S,2R)-1- ((4S,7S,9aS)-4-((S)-2-tert-butoxycarbonyl)methyl)amino)propanethioamido)8,8-dimethyl-5-oxooctagadropyrrolo[2,1-b][1,3]thiazepine -7-carbothioamido)-2,3-dihydro-1H-inden-2-yl)oxy)methyl)benzyl)oxy)2,3-digadro-1H-inden-1-yl)carbamoyl)-8,8-dimethyl -5-oxooctahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-thioxopropan-2-yl)(methyl)carbamate

Solution of (1S,1'S,2R,2'R)-2,2'-((1,4-phenylenebis(methylene))bis(oxy))bis(2,3-dihydro-1H-inden-1-amine) (80 mg, 0.21 mmol), (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2 ,1-b][1,3]thiazepine-7-carboxylic acid (Intermediate II) (205.1 mg, 0.45 mmol), N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl (157.6 mg, 0.64 mmol) and N,N-diisopropylethylamine (110 mg, 0.85 mmol) in 1,2-dichloroethane (5 ml) was stirred at 50°C overnight. The solvent was removed under reduced pressure and the crude product was purified by thin layer chromatography [ethyl acetate/petroleum ether (1/1 v/v)] to obtain the product (120 mg) as a yellow oil. This material was further purified by preparative HPLC to give tert-butyl((S)-1-(((4S,7S,9aS)-7-(((1S,2R)-2-((4-(( ((1S,2R)-1-((4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo [2,1-b][1,3]thiazepine-7-carbothioamido)-2,3-dihydro-1H-inden-2-yl)oxy)methyl)benzyl)oxy)-2,3-dihydro-1H- inden-1-yl)carbamoyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-thioxopropan-2-yl)(methyl) carbamate (60 mg, 0.047 mmol, 22.4% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 2.144 minutes, m/z: 541.9 {[(M-2 Vos)+2]/2} ⁺ .

Step 2: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-((1,4-phenylenebis(methylene))bis(oxy) )bis(2.3-dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b ][1,3]thiazepine-7-carboxamide) To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S, 2R,2'R)-((1,4-phenylenebis(methylene))bis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azandiyl))bis(carbonyl ))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropan-1,2-diyl ))bis(methylcarbamate) (60 mg, 0.047 mmol) in dichloromethane (5 ml), hydrogen chloride (4 N in 1,4-dioxane, 1 ml) was added. The reaction mixture was stirred at room temperature overnight. The mixture was concentrated under reduced pressure. The crude product was diluted with water and adjusted to pH 8~9 with sodium bicarbonate and extracted with dichloromethane (3*20 ml). The combined organic layers were washed with brine, dried, filtered and concentrated. The residue was purified by thin layer chromatography [dichloromethane/methanol (10/1 v/v)] to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S ,2R,2'R)-((1,4-phenylenebis(methylene))bis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl -4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) (21.9 mg, 0.020 mmol, 42.6% yield) as white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 7.98 (d, J=8.8 Hz, 2H), 7.24 (m, 12H), 5.51-5.46 (m, 2H), 5.42-5.39 (m , 2H), 5.11 (d, J=10.4 Hz, 2H), 4.51 (s, 4H), 4.29(d, J=10.4 Hz, 2H), 4.24-4.21 (m, 2H), 3.31 (s, 4H) , 3.17-3.09 (m, 2H), 3.05-2.97 (s, 4H), 2.79-2.73 (m, 2H), 2.26-2.26 (m, 10H), 1.81-1.73 (m, 2H), 1.68-1.66 ( m, 2H), 1.29-1.28 (m, 6H), 1.06-1.05 (m, 12H). LCMS (2.5 minutes, formic acid): Retention time = 1.443 minutes, m/z: 1083.7 (M+1) ⁺ .

Example 24

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-((1,4-phenylenebis(methylene))bis(azandiyl))bis(2-oxo-1- phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7 -carboxamide)

Step 1: (S)-2-((tert-butoxycarbonyl)amino)-2-phenylacetic acid

To a solution of (S)-2-amino-2-phenylacetic acid (3.0 g, 19.8 mmol) in 1 M sodium hydroxide solution (28 ml) was added a solution of di-tert-butyl dicarbonate (4.75 g, 21.78 mmol) in tert-butyl alcohol (16 ml). The resulting suspension was stirred at room temperature for 1 hour. The volatile solvent was removed under reduced pressure and the pH of the remaining solution was adjusted to pH 3 with citric acid. The solid was filtered and dried to give (S)-2-((tert-butoxycarbonyl)amino)-2-phenylacetic acid (4.1 g, 16.3 mmol, 82% yield). LCMS (2.5 minutes, formic acid): Retention time =1.48 minutes, [M+H] ⁺ =273.9,

Step 2: di-tert-butyl((1S,1'S)-((1,4-phenylenebis(methylene))bis(azandiyl))bis(2-oxo-1-phenylethane-2,1-diyl))dicarbamate

1,4-Phenylenedimethanamine ( 189 mg, 1.39 mmol) in N,N-dimethylformamide (5 ml). Then diethyl cyanophosphonate (680 mg, 4.17 mmol) and triethylamine (562 mg, 5.56 mmol) were added sequentially. The mixture was stirred at room temperature overnight. The reaction was quenched with water (400 ml), resulting in a precipitate, which was filtered and dried in high vacuum, resulting in di-tert-butyl((1S,1'S)-((1,4-phenylenebis(methylene))bis (azandiyl))bis(2-oxo-1-phenylethan-2,1-diyl))dicarbamate (1.1 g, 1.83 mmol, 59.6% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 1.56 minutes, m/z: 502.7 [(M-Boc)+1] ⁺ .

Step 3: (2S,2'S)-N,N'-(1,4-phenylenebis(methylene))bis(2-amino-2-phenylacetamide) dihydrochloride

To a solution of di-tert-butyl((1S,1'S)-((1,4-phenylenebis(methylene))bis(azandiyl))bis(2-oxo-1-phenylethan-2,1-diyl))dicarbamate (1.1 g, 1.83 mmol) in dichloromethane (10 ml) was added hydrogen chloride (4 N in 1,4-dioxane, 2 ml) at room temperature. The reaction mixture was stirred at room temperature overnight and the solvent was removed under reduced pressure to obtain (2S,2'S)-N,N'-(1,4-phenylenebis(methylene))bis(2-amino-2-phenylacetamide ) dihydrochloride (810 mg, crude) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 0.38 minutes, m/z: 403.0 (M+1) ⁺ .

Step 4: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-(((1S,1'S)-((1,4-phenylenebis(methylene))) bis(azandiyl))bis(2-oxo-1-phenylethan-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b] [1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate)

Solution of (2S,2'S)-N,N'-(1,4-phenylenebis(methylene))bis(2-amino-2-phenylacetamide) dihydrochloride (200 mg, 0.43 mmol), (4S,7S,9aS)-4 -((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxylic acid ( 379 mg, 0.86 mmol), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide methiodide (246 mg, 1.28 mmol), 1-hydroxybenzotriazole (231 mg, 1.71 mmol) and N,N'-diisopropylethylamine (331 mg, 2.56 mmol ) in dichloromethane (10 ml) was stirred at room temperature overnight. The reaction was quenched with water (50 ml) and extracted with dichloromethane (3 × 50 ml). The combined organic layers were washed with brine, dried, filtered and concentrated. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (2/1 v/v)] to give the crude product (96 mg) as a yellow oil. This material was further purified by preparative HPLC to yield di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S)-( (1,4-phenylenebis(methylene))bis(azandiyl))bis(2-oxo-1-phenylethane-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl- 5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate) (67 mg, 0.053 mmol, yield 12.6%) as a white solid. LCMS (3.0 minutes, formic acid): Retention time = 2.55 minutes, m/z: 526.5 {[(M-2 Boc)+2]/2} ⁺ , 1153.4 (M-Boc+1) ⁺ .

Step 5: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-((1,4-phenylenebis(methylene))bis(azandiyl))bis(2-oxo -1-phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3 ]thiazepine-7-carboxamide)

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1R,1'R,2R,2'R)-((( 1,4-phenylenebis(methylene))bis(azandiyl))bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(azandiyl))bis(carbonyl))bis( 8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane-1,2-diyl))bis( methyl carbamate) (67 mg, 0.05 mmol) in dichloromethane (10 ml), hydrogen chloride (4 N in 1,4-dioxane, 1 ml) was added at room temperature. The mixture was stirred at room temperature overnight. The solvent was removed under reduced pressure to obtain the crude product. The crude product was diluted with water, adjusted to pH 8~9 with sodium bicarbonate and extracted with dichloromethane (3 x 20 ml). The combined organic layers were washed with brine, dried, filtered and concentrated. The residue was purified by thin layer chromatography [dichloromethane/methanol (8/1 v/v)] to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S )-((1,4-phenylenebis(methylene))bis(azandiyl))bis(2-oxo-1-phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)- 2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) (47.5 mg, 0.045 mmol, 84% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 8.79 (t, J=5.8 Hz, 2H), 8.52(d, J=8.0 Hz, 2H), 8.21(d, J=6.8 Hz, 2H) , 7.46-7.44 (m, 4H), 7.38-7.29 (m, 6H), 6.96 (s, 4H), 5.55-5.50 (m, 4H), 4.69-4.65 (m, 2H), 4.23 ( s, 6H), 3.22-3.16 (m, 2H), 2.96-2.88 (m, 4H), 2.22 (s, 8H), 2.14-2.09 (m, 2H), 1.84-1.71 (m, 4H), 1.12(d, J=7.2 Hz, 6H), 1.05 (s, 6H), 0.90 (s, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.248 minutes, m/z: 1052.7 (M+1) ⁺ .

Example 25

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-((1,4-phenylembis(methylene))bis(azandiyl))bis(2-oxo-1- phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7 -carboxamide)dihydrochloride

Step 1: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S)-((1,4-phenylenebis(methylene) )bis(azandiyl))bis(2-oxo-1-phenylethan-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b ][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropan-1,2-diyl))bis(methylcarbamate)

Solution of (2S,2'S)-N,N'-(1,4-phenylenebis(methylene))bis(2-amino-2-phenylacetamide) dihydrochloride (200 mg, 0.42 mmol), (4S,7S,9aS)-4 -((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxylic acid ( Intermediate II) (391 mg, 0.85 mmol), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide methiodide (243 mg, 1.27 mmol), 1-hydroxybenzotriazole (228 mg, 1.69 mmol) and N,N-diisopropylethylamine (327 mg, 2.53 mmol) in dichloromethane (10 ml) was stirred at room temperature overnight. The mixture was quenched with water (50 ml) and extracted with dichloromethane (3 x 50 ml). The combined organic layers were washed with brine, dried, filtered and concentrated. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (2/1 v/v)] to give the crude product (96 mg) as a yellow oil. This material was further purified by preparative HPLC to yield di-tert-6ynui((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S)-( (1,4-phenylenebis(methylene))bis(azandiyl))bis(2-oxo-1-phenylethane-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl- 5-oxooctahydroxyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropan-1,2-diyl))bis(methylcarbamate) (63 mg, 0.049 mmol, yield 11.7%) as a white solid. LCMS (3.0 minutes, formic acid): Retention time = 2.76 minutes, m/z: 542.9 {[(M-2 Vos)+2]/2} ⁺ , 1185.6 (M-Boc+1) ⁺ .

Step 2: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(1,4-phenylenebis(methylene))bis(azandiyl))bis(2-oxo- 1-phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine -7-carboxamide)dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1R,1'R,2R,2'R)-((( 1,4-phenylenebis(methylene))bis(azandiyl))bis(carbonyl))bis(1,2,3,4-tetrahydronaphthalene-2,1-diyl))bis(azandiyl))bis(carbonyl))bis( 8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane-1,2-diyl))bis( methyl carbamate) (63 mg, 0.049 mmol) in dichloromethane (5 ml), hydrogen chloride (4 N in 1,4-dioxane, 1 ml) was added. The reaction mixture was stirred at room temperature overnight. The solvent was removed under reduced pressure and dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-((1,4-phenylenebis(methylene ))bis(azandiyl))bis(2-oxo-1-phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo [2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride (33.2 mg, 0.029 mmol, 57.8% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 8.83(t, J=6.0 Hz, 2H), 8.61(d, J=6.4 Hz, 2H), 7.46-7.44 (m , 4H), 7.38-7.29 (m, 6H), 6.95 (s, 4H), 5.56-5.53 (m, 2H), 5.51-5.46 (m, 2H), 5.17-5.13 (m, 2H), 4.27-4.20 (m, 4H), 4.12-4.08 (m, 2H), 3.72-3.65 (m, 1H), 3.52-3.47 (m, 1H), 3.25-3.18 (m, 2H), 3.01-2.97 (m, 2H) , 2.42(d, J=4.8 Hz, 6H), 2.34-2.26 (m, 4H), 2.01-1.90 (m, 2H), 1.81-1.76 (m, 2H), 1.39(d, J=5.4 Hz , 6Н), 1.08 (s, 6Н), 0.93 (s, 6Н). LCMS (2.5 minutes, formic acid): Retention time = 1.312 minutes, m/z: 1085.7 (M+1) ^+.

Example 26

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-piperazine-1,4-diylbis(2-oxo-1-phenylethane-2,1-diyl))bis (8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

Step 1: di-tert-butyl((1S,1'S)piperazine-1,4-diylbis(2-oxo-1-phenylethane-2,1-diyl))dicarbamate

To a solution of (S)-2-((tert-butoxycarbonyl)amino)-2-phenylacetic acid (500 mg, 2.1 mmol) in N,N-dimethylformamide (15 ml) at -15°C piperazine (85.6 mg, 1.0 mmol) in N,N-dimethylformamide (5 ml), diethyl cyanophosphonate (488 mg, 3.0 mmol) and triethylamine (402.7 mg, 4.0 mmol). The mixture was stirred at room temperature overnight. The mixture was poured into water (300 ml), resulting in a precipitate, which was filtered and dried, resulting in di-tert-butyl((1S,1'S)-piperazine-1,4-diylbis(2-oxo-1- phenylethan-2,1-diyl))dicarbamate (640 mg, 1.2 mmol, 58.2% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 1.57 minutes, m/z: 575.8 (M+Na) ⁺ .

Step 2: (2S,2'S)-1,1'-(piperazine-1,4-diyl)bis(2-amino-2-phenylethan-1-one) dihydrochloride

To a solution of di-tert-butyl((1S,1'S)-piperazine-1,4-diylbis(2-oxo-1-phenylethane-2,1-diyl))dicarbamate (200 mg, 0.32 mmol) in dichloromethane (10 ml ) hydrogen chloride (4N in 1,4-dioxane, 1 ml) was added at room temperature. The mixture was stirred at room temperature overnight. The mixture was concentrated under reduced pressure and dried under high vacuum to give crude (2S,2'S)-1,1'-(piperazin-1,4-diyl)bis(2-amino-2-phenylethan-1-one) dihydrochloride (150 mg) as a white solid, which was used in the next step without further purification. LCMS (2.5 minutes, formic acid): Retention time = 0.39 minutes, m/z: 352.9 (M+1) ⁺ .

Step 3: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S)-piperazine-1,4-diylbis(2- oxo-1-phenylethane-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7, 4-diyl))bis(azandiyl))bis(1-oxopropane-1,2-diyl))bis(methylcarbamate)

Solution of (2S,2'S)-1,1'-(piperazin-1,4-diyl)bis(2-amino-2-phenylethan-1-one) dihydrochloride (300 mg, 0.85 mmol), (4S,7S,9aS )-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7- carboxylic acid (750 mg, 1.69 mmol), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide methiodide (490 mg, 2.56 mmol), 1-hydroxybenzotriazole (460 mg, 3.40 mmol) and N,N-diisopropylethylamine (660 mg, 5.11 mmol) in dichloromethane (20 ml) was stirred at room temperature overnight. The reaction was quenched with water (100 ml) and extracted with dichloromethane (3 × 10 ml). The combined organic layers were washed with brine, dried, filtered and concentrated. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (2/1 v/v)] to give the crude product (170 mg) as a yellow oil. This material was further purified by preparative HPLC to yield di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S)-piperazine -1,4-diylbis(2-oxo-1-phenylethan-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b] [1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropane-1,2-diyl))bis(methylcarbamate) (80 mg, 0.067 mmol, 13.5% yield) as white solid matter. LCMS (2.5 minutes, formic acid): Retention time =1.73 minutes, m/z: 502.0 {[(M-2 Boc)+2]/2} ⁺ , [M-Boc+H] ⁺ =1104.8 (M-Boc +1) ⁺ .

Step 3: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-piperazine-1,4-diylbis(2-oxo-1-phenylethane-2,1-diyl ))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S)-piperazine-1,4-diylbis(2-oxo -1-phenylethane-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4 -diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate) (80 mg, 0.067 mmol) in dichloromethane (5 ml) added hydrogen chloride (4 N in 1.4 -dioxane, 1 ml). The mixture was stirred at room temperature overnight. The solvent was removed under reduced pressure and dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-piperazine-1,4-diylbis(2 -oxo-1-phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1, 3]thiazepine-7-carboxamide) dihydrochloride (36 mg, 0.033 mmol, 49.3% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 8.56-8.51 (m, 2H), 8.47(d, J=7.6 Hz, 2H), 7.37-7.33 (m, 10H), 5.88-5.81 (m , 2H), 5.50(t, J=7.6 Hz, 2H), 4.68(t, J=7.4 Hz, 2H), 4.10-4.08 (m, 2H), 3.55-3.37 (m, 4H), 3.25- 3.13 (m, 6H), 2.97-2.90 (m, 4H), 2.32 (s, 6H), 2.18-2.13 (m, 4H), 1.97-1.87 (m, 2H), 1.57-1.49 (m , 2H), 1.24(d, J=5.6 Hz, 6H), 1.00 (s, 6H), 0.81-0.78 (m, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.368 minutes, m/z: 1003.8 (M+1) ⁺ .

Example 27

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-piperazine-1,4-diylbis(2-oxo-1-phenylethane-2,1-diyl))bis (8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

Step 1: di-tert-butyl(2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S)-piperazine-1,4-diylbis(2-oxo -1-phenylethane-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4 -diyl))bis(azandiyl))bis(1-thioxopropane-1,2-diyl))bis(methylcarbamate)

Solution of (2S,2'S)-1,1'-(piperazine-1,4-diyl)bis(2-amino-2-phenylethan-1-one) dihydrochloride (200 mg, 0.47 mmol), (4S,7S,9aS )-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7- carboxylic acid (Intermediate II) (432.2 mg, 0.94 mmol), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide methiodide (270.4 mg, 1.41 mmol), 1-hydroxybenzotriazole (254.1 mg, 1.88 mmol) and N, N-diisopropylethylamine (364.5 mg, 2.82 mmol) in dichloromethane (10 ml) was stirred at room temperature overnight. The reaction was quenched with water (80 ml) and extracted with dichloromethane (3 x 80 ml). The combined organic layers were washed with brine, dried, filtered and concentrated. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (2/1 v/v)] to give the crude product (170 mg) as a yellow oil. This material was further purified by preparative-HPLC to give the title product (90 mg, 0.073 mmol, 15.5% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time =2.04 minutes, m/z: 641.0 [M+2Na]/2,

Step 2: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-piperazine-1,4-diylbis(2-oxo-1-phenylethane-2,1-diyl ))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S)-piperazine-1,4-diylbis(2-oxo -1-phenylethane-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4 -diyl))bis(azandiyl))bis(1-thioxopropane-1,2-diyl))bis(methylcarbamate) (90 mg, 0.073 mmol) in dichloromethane (5 ml) added hydrogen chloride (4 N in 1.4 -dioxane, 1 ml). The mixture was stirred at room temperature overnight. The mixture was concentrated under reduced pressure and dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-piperazine-1,4-diylbis(2 -oxo-1-phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1, 3]thiazepine-7-carboxamide) dihydrochloride (52.3 mg, 0.047 mmol, 64.2% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 8.53(d, J=7.6 Hz, 2H), 7.41-7.34 (m, 12H), 5.89-5.82 (m, 2H), 5.49-5.43 (m, 2H), 5.14(t, J=9.6 Hz, 2H), 4.17-4.09 (m, 4H), 3.57 (s, 2H), 3.41 (s, 2H), 3.23-3.07 (m, 5H), 3.01-2.96 (m, 3H), 2.44 (s, 6H), 2.33-2.26 (m, 2H), 2.20-2.17 (m, 2H), 2.08-1.99 (m, 2H), 1.60-1.57 (m , 2H), 1.40(t, J=7.6 Hz, 6H), 1.02 (s, 6H), 0.86-0.82 (m, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.341 minutes, m/z: 1035.7 (M+1) ⁺ .

Example 28

(2S)-N-[(4S,7S,9aS)-8,8-dimethyl-5-oxo-7-{[(S)-phenyl({[(1rs,4rs)-4-[(2S)- 2-{[(4S,7S,9aS)-8,8-dimethyl-4-[(2S)-2-(methylamino)propanamido]-5-oxo-octahydropyrrolo[2,1-b][1,3] thiazepin-7-yl]formamido}-2-phenylacetamido]cyclohexyl]carbamoyl})methyl]carbamoyl}-octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl]-2-(methylamino)propanamide dihydrochloride

Step 1: di-tert-butyl((1S,1'S)-(((1S,4S)-cyclohexane-1,4-diyl)bis(azandiyl))bis(2-oxo-1-phenylethane-2,1- diyl))dicarbamate

To a solution of (S)-2-((tert-butoxycarbonyl)amino)-2-phenylacetic acid (600 mg, 2.1 mmol) in N,N-dimethylformamide (20 ml) at -15°C was successively added (1 g ,4 g)-cyclohexane-1,4-diamine (136.3 mg, 1.0 mmol), diethyl cyanophosphonate (584 mg, 3.0 mmol) and triethylamine (483 mg, 4.0 mmol). The reaction mixture was stirred at room temperature overnight. The mixture was poured into water (300 ml), resulting in a precipitate, which was filtered and dried, resulting in di-tert-butyl((1S,1'S)-(((1S,4S)-cyclohexane-1,4- diyl)bis(azandiyl))bis(2-oxo-1-phenylethane-2,1-diyl))dicarbamate (640 mg, 1.1 mmol, 46.2% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 1.61 minutes, m/z: 480.8 (M-Boc+1) ⁺ .

Step 2: (2S,2'S)-N,N'-((1S,4S)-cyclohexane-1,4-diyl)bis(2-amino-2-phenylacetamide) dihydrochloride

To a solution of di-tert-butyl((1S,1'S)-(((1S,4S)-cyclohexane-1,4-diyl)bis(azandiyl))bis(2-oxo-1-phenylethane-2,1-diyl ))dicarbamate (460 mg, 0.32 mmol) in dichloromethane (10 ml), hydrogen chloride (4 N in 1,4-dioxane, 2 ml) was added. The reaction mixture was stirred at room temperature overnight. The solvent was removed under reduced pressure and dried under vacuum to obtain (2S,2'S)-N,N'-((1S,4S)-cyclohexane-1,4-diyl)bis(2-amino-2-phenylacetamide) dihydrochloride (crude, 400 mg) as a white solid. This material was used in the next step without further purification. LCMS (2.5 minutes, formic acid): Retention time =0.37 minutes, m/z: 381.0 (M+1).

Step 3: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S)-(((1R,4R)-cyclohexane- 1,4-diyl)bis(azandiyl))bis(2-oxo-1-phenylethane-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[ 2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate)

Solution of (2S,2'S)-N,N'-((1S,4S)-cyclohexane-1,4-diyl)bis(2-amino-2-phenylacetamide) dihydrochloride (200 mg, 0.44 mmol), (4S,7S ,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine- 7-carboxylic acid (387 mg, 0.87 mmol), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide methiodide (239 mg, 1.25 mmol), 1-hydroxybenzotriazole (225 mg, 1.67 mmol) and N,N-diisopropylethylamine (323 mg, 2.50 mmol) in dichloromethane (10 ml) was stirred at room temperature overnight. The reaction was quenched with water (50 ml) and extracted with dichloromethane (3 × 50 ml). The combined organic layers were washed with brine, dried, filtered and concentrated. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (2/1 v/v)] to give the crude product (110 mg) as a yellow oil. This material was further purified by preparative HPLC to yield di-tert-butyl di-tert-6ymu((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S ,1'S)-(((1R,4R)-cyclohexane-1,4-diyl)bis(azandiyl))bis(2-oxo-1-phenylethane-2,1-diyl))bis(azandiyl))bis(carbonyl ))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl) ))bis(methylcarbamate) (61 mg, 0.049 mmol, 11.2% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time=1.68 minutes, m/z: 1130.7 (M-Boc+1) ⁺ .

Step 4: (2S)-N-[(4S,7S,9aS)-8,8-dimethyl-5-oxo-7-{[(S)(phenyl({[(1rs,4rs)-4-[( 2S)-2-{[(4S,7S,9aS)-8,8-dimethyl-4-[(2S)-2-(methylamino)propanamido]-5-oxo-octahydropyrrolo[2,1-b][1 ,3]thiazepin-7-yl]formamido}-2-phenylacetamido]cyclohexyl]carbamoyl})methyl]carbamoyl}-octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl]-2-(methylamino )propanamide dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S)-(((1R,4R)-cyclohexane-1, 4-diyl)bis(azandiyl))bis(2-oxo-1-phenylethan-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2, 1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate) (61 mg, 0.05 mmol) in dichloromethane ( 5 ml) hydrogen chloride (4N in 1,4-dioxane, 1 ml) was added. The reaction mixture was stirred at room temperature overnight. The solvent was concentrated under reduced pressure and dried under high vacuum to give the title compound (36.6 mg, 0.033 mmol, 66.5% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 9.25 (s, 2H), 8.91-8.82 (m, 4H), 8.49(d, J=8.4 Hz, 2H), 8.23(d, J =7.6 Hz, 2H), 7.42-7.40 (m, 4H), 7.35-7.31 (m, 4H), 7.28-7.24 (m, 2H), 5.52(t, J=8.0 Hz, 2H), 5.46(d, J=8.0 Hz, 2H), 4.75-4.70 (m, 2H), 4.19 (m, 2H), 3.87 (m, 2H), 3.72-3.65 (m, 1H), 3.50-3.39 (m, 3H), 3.25-3.19 (m, 2H), 2.96-2.92 (m, 2H), 2.48 (s, 6H), 2.24-2.13 (m, 4H), 1.92-1.69 (m, 6H), 1.58- 1.56 (m, 2H), 1.39(d, J=6.8 Hz, 6H), 1.04 (s, 6H), 0.94 (s, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.404 minutes, m/z: 1031.7 (M+1) ⁺ .

Example 29

(2S)-2-{[(4S,7S,9aS)-8,8-dimethyl-4-[(2S)-2-(methylamino)propanethioamido]-5-oxo-octahydropyrrolo[2,1-b][ 1,3]thiazepin-7-yl]formamido}-2-phenyl-N-[(1rs,4rs)-4-[(2S)-2-{[(4S,7S,9aS)-8,8-dimethyl -4-[(2S)-2-(methylamino)propanethioamido]-5-oxo-octahydropyrrolo[2,1-b][1,3]thiazepin-7-yl|formamido}-2-phenylacetamido]cyclohexyl]acetamide dihydrochloride

Step 1: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S)-(((1R,4R)-cyclohexane- 1,4-diyl)bis(azandiyl))bis(2-oxo-1-phenylethane-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydrosphrolo[ 2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane-1,2-diyl))bis(methylcarbamate)

Solution of (2S,2'S)-N,N'-((1S,4S)-cyclohexane-1,4-diyl)bis(2-amino-2-phenylacetamide) dihydrochloride (170 mg, 0.45 mmol), (4S,7S ,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine- 7-carboxylic acid (Intermediate II) (362 mg, 0.79 mmol), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide methiodide (216 mg, 1.13 mmol), 1-hydroxybenzotriazole (203 mg, 1.5 mmol) and N, N-diisopropylethylamine (291 mg, 2.25 mmol) in dichloromethane (10 ml) was stirred at room temperature overnight. The reaction was quenched with water (50 ml) and extracted with dichloromethane (3 × 50 ml). The combined organic layers were washed with brine, dried, filtered and concentrated. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (2/1 v/v)] to give the product (210 mg) as a yellow oil. This material was further purified by preparative HPLC to yield di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S)-( ((1R,4R)-cyclohexane-1,4-diyl)bis(azandiyl))bis(2-oxo-1-phenylethane-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8 ,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropan-1,2-diyl))bis(methylcarbamate ) (127 mg, 1.0 mmol, 26.8% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 2.182 minutes, m/z: 532.1 {[(M-2 Vos)+2]/2} ⁺ .

Step 2: (2S)-2-{[(4S,7S,9aS)-8,8-dimethyl-4-((2S)-2-(methylamino)propanethioamido 1-5-oxo-octahydropyrrolo[2,1- b][1,3]thiazepin-7-yl]formamido}-2-phenyl-N-[(1rs,4rs)-4-[(2S)-2-{[(4S,7S,9aS)-8, 8-dimethyl-4-[(2S)-2-(methylamino)propanethioamido]-5-oxo-octahydropyrrolo[2,1-b][1,3]thiazepin-7-yl]formamido}-2-phenylacetamido]cyclohexyl ]acetamide dihydrochloride

To a solution of di-tert-butyl(2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S)-(((1R,4R)-cyclohexane-1, 4-diyl)bis(azandiyl))bis(2-oxo-1-phenylethan-2,1-diyl))bis(azandiyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2, 1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane-1,2-diyl))bis(methylcarbamate) (127 mg, 0.10 mmol) in dichloromethane ( 10 ml) hydrogen chloride (4N in 1,4-dioxane, 1 ml) was added. The reaction mixture was stirred at room temperature overnight. The mixture was concentrated under reduced pressure and the solid was dried under high vacuum to give the title compound (100 mg, 0.08 mmol, 87.4% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 11.02-10.90 (m, 2H), 9.75 (s, 1H), 9.58 (s, 1H), 8.63-8.44 (m, 4H), 8.26(d , J=7.6 Hz, 2H), 7.42-7.40 (m, 4H), 7.35-7.31 (m, 4H), 7.28-7.25 (m, 2H), 5.50-5.45 (m, 4H), 5.18 -5.12 (m, 2H), 4.27-4.21 (m, 4H), 3.48-3.93 (m, 2H), 3.26-3.17 (m, 2H), 3.10-2.98 (m, 4H), 2.48 (s, 6H) , 2.33-2.23 (m, 4H), 2.03-1.95 (m, 2H), 1.81-1.74 (m, 4H), 1.58 (d, J=7.2 Hz, 2H), 1.45-1.43 (m, 6H), 1.07 (s, 8H), 0.92 (s, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.351 minutes, m/z: 1063.6 (M+1) ⁺ .

Example 30

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(hexa-2,4-diyne-1,6-diylbis(azandiyl))bis(2-oxo- 1-phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine -7-carboxamide) dihydrochloride

Step 1: tert-butyl (S)-(2-oxo-1-phenyl-2-(prop-2-yn-1-ylamino)ethyl)carbamate

To a solution of (S)-2-((tert-butoxycarbonyl)amino)-2-phenylacetic acid (600 mg, 2.3 mmol) in dichloromethane (18 ml) was added prop-2-yne-1-amine (131.5 mg, 2.3 mmol ), 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.82 g, 4.8 mmol) and N,N-diisopropylethylamine (925.8 mg, 7.2 mmol). The mixture was stirred at room temperature overnight. The mixture was quenched with water (300 ml) and extracted with dichloromethane (3 x 200 ml). The combined organic layers were washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (1/3 v/v)] to give tert-butyl (S)-(2-oxo-1-phenyl-2-(prop-2- in-1-ylamino)ethyl)carbamate (crude, 300 mg) as a yellow oil. LCMS (3.0 minutes, formic acid): Retention time = 1.677 minutes, m/z: 289 (M+1) ⁺ .

Step 2: (S)-2-amino-2-phenyl-N-(prop-2-yn-1-yl)acetamide hydrochloride

Hydrogen chloride was added to a solution of tert-butyl(S)-(2-oxo-l-phenyl-2-(prop-2-yn-1-ylamino)ethyl)carbamate (300 mg, 1.04 mmol) in dichloromethane (12 ml). (4N in 1,4-dioxane, 1 ml). The mixture was stirred at room temperature overnight. The solvent was removed under reduced pressure to obtain tert-butyl(S)-(2-oxo-1-phenyl-2-(prop-2-yn-1-ylamino)ethyl)carbamate (300 mg) as a yellow solid substances that were used in the next step without further purification. LCMS (3.0 minutes, formic acid): Retention time =0.801 minutes, m/z: 189 (M+1) ⁺ .

Step 3: tert-butyl((S)-1-(((4S,7S,9aS)-8,8-dimethyl-5-oxo-7-(((S)-2-oxo-1-phenyl-2 -(prop-2-yn-1-ylamino)ethyl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate

To a solution of (S)-2-amino-2-phenyl-N-(prop-2-yn-1-yl)acetamide hydrochloride (250 mg, 1.1 mmol) in 1,2-dichloroethane (15 ml) was added (4S, 7S,9aS)-4-((S)-3-((tert-butoxycarbonyl)(methyl)amino)-2-oxobutyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1, 3]thiazepine-7-carboxylic acid (Intermediate I) (589 mg, 1.3 mmol), 2-(7-azabenzotriazol-1-yl)-N,N,'N'-tetrametaluronium hexafluorophosphate (808 mg, 2 .1 mmol) and N,N-diisopropylethylamine (412 mg, 3.2 mmol). The mixture was stirred at room temperature overnight. The reaction was quenched with water (300 ml) and extracted with dichloromethane (3 × 60 ml). The combined organic layers were washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (2/1 v/v)] to give tert-butyl((S)-1-(((4S,7S,9aS)-8.8 -dimethyl-5-oxo-7-(((S)-2-oxo-1-phenyl-2-(prop-2-yn-1-ylamino)ethyl)carbamoyl)octahydropyrrolo[2,1-b][1 ,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate (578 mg, 0.919 mmol, 83.5% yield) as a yellow oil. LCMS (3.0 minutes, formic acid): Retention time - 1.794 minutes, m/z: 636 (M+Na) ⁺ .

Step 4 di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-7,7'-(3S,14S)-4,13-dioxo-3,14 -diphenyl-2,5,12,15-tetraazahexadeca-7,9-diyne-1,16-dioii)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine- 7,4-diyl))bis(azandiyl))bis(1-oxopropane-2,1-diyl))bis(methylcarbamate)

To a mixture of tert-butyl((S)4-(((4S,7S,9aS)-8,8-dimethyl-5-oxo-7-(((S)-2-oxo-1-phenyl-2-( prop-2-yn-1-ylamino)ethyl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate (170 mg, 0.27 mmol) in acetonitrile (8 ml) and pyridine (131.6 mg, 1.62 mmol), copper (II) acetate (60.4 mg, 0.33 mmol) was added. The resulting mixture was stirred at 85°C for 1 hour under a nitrogen atmosphere. The reaction mixture was cooled to room temperature, quenched with water (50 ml) and extracted with dichloromethane (3 x 50 ml). The combined organic layers were washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (2/1 v/v)] to give the crude product (86 mg) as a yellow oil. This material was further purified by preparative HPLC to yield di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-7,7'-((3S,14S )-4,13-dioxo-3,14-diphenyl-2,5,12,15-tetraazahexadeca-7,9-diyne-1,16-dioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2, 1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-2,1-diyl))bis(methylcarbamate) (58 mg, 0.047 mmol, 17.1% yield ) as a white solid. LCMS (3.0 minutes, formic acid): Retention time = 2.044 minutes, m/z: 1247 (M+Na) ⁺ .

Step 5: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,l'S)-(hexa2,4-diyne-1,6-diylbis(azandiyl))bis(2-oxo -1-phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3] thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-7,7'-((3S,14S)-4,13-dioxo-3, 14-diphenyl-2,5,12,15-tetraazahexadeca-7,9-diyne-1,16-dioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine -7,4-diyl))bis(azandiyl))bis(1-oxopropane-2,1-diyl))bis(methylcarbamate) (38 mg, 0.03 mmol) in dichloromethane (7 ml), hydrogen chloride (4 N) was added. in 1,4-dioxane, 1 ml). The reaction mixture was stirred at room temperature for 4 hours. The solvent was removed under reduced pressure and the product was dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(hexa-2,4-diyne -1,6-diylbis(azandiyl))bis(2-oxo-1-phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)- 5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride (30 mg, 0.027 mmol, 88.3% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 9.08-8.81 (m, 8H), 8.52(d, J=8.0 Hz, 2H), 7.42-7.40 (m, 3H) , 7.37-7.28 (m, 5H), 5.54-5.47 (m, 4H), 4.76-4.71 (m, 2H), 4.19 (s, 2H), 4.0(d, J=5.2 Hz, 4H), 3.89-3.84 (m, 2H), 3.25-3.18 (m, 2H), 2.97-2.91 (m, 2H), 2.49 (s, 6H), 2.24-2.19 (m, 2H), 2.17-2.12 ( m, 2H), 1.93-1.83 (m, 2H), 1.75-1.70 (m, 2H), 1.38(d, J=6.4 Hz, 6H), 1.05 (s, 6H), 0.91 (s, 6H) . LCMS (2.5 minutes, formic acid): Retention time = 1.309 minutes, m/z: 1025.7 (M+1) ⁺ .

Example 31

(4S,7S,9aS)-N-((S)-2-((6-((S)-2-((4S,7S,9aS)-8,8-dimethyl-4-((S)- 2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamido)-2-phenylacetamido)hexa-2,4-diin-1-yl)amino)-2 -oxo-1-phenylethyl)-8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide dihydrochloride

Step 1: tert-butyl((S)-1-(((4S,7S,9aS)-8,8-dimethyl-5-oxo-7-(((S)-2-oxo-1-phenyl-2 -(prop-2-yn-1-ylamino)ethyl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-thioxopropan-2-yl)(methyl)carbamate

(4S, 7S,9aS)-4-((S)-3-((tert-butoxycarbonyl)(methyl)amino)-2-oxobutyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1, 3]thiazepine-7-carboxylic acid (527 mg, 1.15 mmol), 2-(7-azabenzotriazol-1-yl)-N,N,N'N'-tetramethyluronium hexafluorophosphate (700 mg, 1.84 mmol) and N,N -diisopropylethylamine (356 mg, 2.76 mmol). The mixture was stirred at room temperature overnight. The mixture was quenched with water (100 ml) and extracted with dichloromethane (3×100 ml). The combined organic layers were washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (2/1 v/v)] to give tert-butyl((S)-1-(((4S,7S,9aS)-8.8 -dimethyl-5-oxo-7-(((S)-2oxo-1-phenyl-2-(prop-2-yn-1-ylamino)ethyl)carbamoyl)octahydropyrrolo[2,1-b][1,3 ]thiazepin-4-yl)amino)-1-thioxopropan-2-yl)(methyl)carbamate (500 mg, crude) as a yellow oil. LCMS (3.0 minutes, formic acid): Retention time = 2.004 minutes, m/z: 652 (M+Na) ⁺ .

Step 2: tert-butyl((S)-1-(((4S,7S,9aS)-7-(((S)-2-((6-((S)-2-((4S,7S, 9aS)-4-((S)2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7- carboxamido)-2-phenylacetamido)hexa-2,4-diin-1-yl)amino)-2-oxo-1-phenylethyl)carbamoyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][ 1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate and di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS ,9а'S)-7,7'-((3S,14S)-4,13-dioxo-3,14-diphenyl-2,5,12,15-tetraazahexadeca-7,9-diyne-1,16-dioyl) bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,31thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane-2,1-diyl))bis( methylcarbamate)

To a mixture of tert-butyl((S)-1-(((4S,7S,9aS)-8,8-dimethyl-5-oxo-7-(((S)-2-oxo-1-phenyl-2- (prop-2-yn-1-ylamino)ethyl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate ( 300 mg, 0.5 mmol) and tert-butyl((S)-1-(((4S,7S,9aS)-8,8-dimethyl-5-oxo-7-(((S)-2-oxo-1 -phenyl-2-(prop-2-yn-1-ylamino)ethyl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-thioxopropan-2-yl) (methyl)carbamate (308 mg, 0.5 mmol) in acetonitrile (8 ml) and pyridine (232 mg, 2.9 mmol), copper (II) acetate (107 mg, 0.6 mmol) was added. The mixture was heated to 85°C and stirred for 1 hour. The mixture was cooled to room temperature, diluted with water (50 ml) and extracted with dichloromethane (3×50 ml). The organic layer was combined, washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (2/1 v/v)] to give tert-butyl((S)-1-(((4S,7S,9aS)-7-( ((S)-2-((6-((S)-2-((4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)- 8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamido)-2-phenylacetamido)hexa-2,4-diin-1-yl)amino)-2-oxo -1-phenylethyl)carbamoyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate (20 mg, 0.016 mmol, yield 3.3%) [LCMS (3.0 minutes, formic acid): retention time = 2.100 minutes, m/z: 1263 (M+Na) ⁺ ] and di-tert-butyl((2S,2'S )-(((4S,4'S,7S,7'S,9aS,9a'S)-7,7-((3S,14S)-4,13-dioxo-3,14-diphenyl-2,5,12,15-tetraazahexadeca -7,9-diyne-1,16-dioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl)) bis(1-thioxopropane-2,1-diyl))bis(methylcarbamate) (8 mg, 0.006 mmol, 1.4% yield) [LCMS (3.0 minutes, formic acid): Retention time = 2.367 minutes, m/z: 1279 (M+Na) ⁺ ] as white solids. The other diastereoisomer was not collected.

Step 3: (4S,7S,9aS)-N-((S)2-((6-((S)-2-((4S,7S,9aS)8,8-dimethyl-4-((S) -2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamido)-2-phenylacetamido)hexa-2,4-diin-1-yl)amino)- 2-oxo-1-phenylethyl)-8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide dihydrochloride

To a solution of tert-butyl((S)-1-(((4S,7S,9aS)-7-(((S)-2-((6-((S)-2-((4S,7S,9aS )-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)iropanthioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7 -carboxamido)-2-phenylacetamido)hexa-2,4-diin-1-yl)amino)-2-oxo-1-phenylethyl)carbamoyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b] [1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate (20 mg, 0.016 mmol) in dichloromethane (8 ml) was added hydrogen chloride (4 N in 1.4 -dioxane, 0.5 ml). The reaction mixture was stirred at room temperature for 4 hours. The solvent was concentrated under reduced pressure and the solid was dried under high vacuum to give (4S,7S,9aS)-N-((S)-2-((6-((S)-2-((4S,7S ,9aS)-8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamido)-2-phenylacetamido )hexa-2,4-diin-1-yl)amino)-2-oxo-1-phenylethyl)-8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[ 2,1-b][1,3]thiazepine-7-carboxamide dihydrochloride (13 mg, 0.012 mmol, 72.2% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 8.84-8.81 (m, 3H), 8.57-8.48 (m, 4H), 8.27-8.24 (m, 2H), 7.43-7.30 (m, 11H) , 5.53-5.46 (m, 5H), 5.12-5.09 (m, 1H), 4.69-4.64 (s, 2H), 4.26(d, J=5.6 Hz, 1H), 4.21 (m, 1H), 4.00(d , J=5.2 Hz, 4H), 3.24-3.16 (m, 3H), 3.01-2.88 (m, 4H), 2.23 (s, 3H), 2.16(d, J=4.0 Hz, 2H), 1.83-1.69 ( m, 6H), 1.24-1.20 (m, 6H), 1.05(d, J=8.0 Hz, 6H), 0.92-0.90 (m, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.425 minutes, m/z: 1040.6 (M+1) ⁺ .

Example 32

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(hexa-2,4-diyne-1,6-diylbis(azandiyl))bis(2-oxo- 1-phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine -7-carboxamide)dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-7,7'-((3S,14S)-4,13-dioxo-3, 14-diphenyl-2,5,12,15-tetraazahexadeca-7,9-diyne-1,16-dioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine -7,4-diyl))bis(azandiyl))bis(1-thioxopropane-2,1-diyl))bis(methylcarbamate) (Example 31, Step 2) (8 mg, 0.006 mmol) in dichloromethane (8 ml) hydrogen chloride (4 N in 1,4-dioxane, 0.5 ml) was added. The reaction mixture was stirred at room temperature for 4 hours. The solvent was concentrated under reduced pressure and dried under high vacuum to give the title compound (2 mg, 0.002 mmol, 27.8% yield) as a white solid. ¹ H-NMR (400 MHz, CD ₃ OD-d ₄ ) δ 7.47-7.46 (m, 4H), 7.40-7.34 (m, 6H), 5.58-5.53 (m, 2H), 5.50 (m, 2H), 5.28-5.25 (m, 2H), 4.23(d, J=3.2 Hz, 2H), 4.03 (s, 4H), 3.79-3.71 (m, 2H), 3.47-3.41 (m, 2H), 3.05-3.00 ( m, 2H), 2.44(d, J=9.6 Hz, 6H), 2.39-2.34 (m, 2H), 2.28-2.21 (m, 2H), 1.83-1.77 (m, 2H), 1.62-1.55 (m, 2H), 2H), 1.31 (s, 6H), 1.61 (s, 6H), 0.96 (s, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.546 minutes, m/z: 1056.6 (M+1) ⁺ .

Example 33

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(hexa-2,4-diyne-1,6-diylbis(oxy))bis(1-phenylethane- 2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide ) dihydrochloride

Step 1: (S)-1-phenyl-2-(prop-2-yn-1-yloxy)ethan-1-amine

To a solution of (S)-2-amino-2-phenylethan-1-ol (6 g, 43.7 mmol) in dry tetrahydrofuran (200 ml) at 0°C was added sodium hydride (60%, dispersion in Paraffin Oil) (1.9 g , 48.1 mmol). The mixture was stirred at 0°C for 20 minutes. Then 3-bromoprop-1-yne (5.72 g, 48.1 mmol) was added. The mixture was heated at 70°C overnight. After cooling, ice water (200 ml) was added to this mixture and the mixture was extracted with ethyl acetate (3×100 ml). The combined organic layers were washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by silica gel chromatography [petroleum ether/ethyl acetate (1:1 v/v)] to give (S)-1-phenyl-2-(prop-2-yn-1-yloxy)ethane- 1-amine (2.5 g, 14.3 mmol, 32.65% yield) as an orange oil. ¹ H-NMR 1 (400 MHz, DMSO-d ₆ ) δ ppm 7.44-7.14 (m, 5H), 4.18-4.12 (m, 2H), 4.08-4.00 (m, 1H), 3.55-3.47 (m, 1H ), 3.44-3.37 (m, 2H), 1.84 (s, 2H).

Step 2: tert-butyl((S)-1-(((4S,7S,9aS)-8,8-dimethyl-5-oxo-7-(((S)-1-phenyl-2-(prop- 2-yn-1-yloxy)ethyl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate

(4S,7S,9aS)- 4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxylic acid (650 mg, 1.47 mmol), 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (948 mg, 2.49 mmol) and N,N-diisopropylethylamine (454 mg, 3.52 mmol) at room temperature. The mixture was stirred overnight. The reaction was quenched with water (300 ml) and extracted with dichloromethane (3×20 ml). The combined organic layers were washed with brine, dried, filtered and concentrated. The residue was purified by silica gel chromatography [ethyl acetate/petroleum ether (1/5 v/v)] to give tert-butyl((S)-1-(((4S,7S,9aS)-8,8- dimethyl-5-oxo-7-(((S)-1-phenyl-2-(prop-2-yn-1-yloxy)ethyl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepine- 4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate (194 mg, 0.32 mmol, 22.63% yield) as a yellow oil. LCMS (3.0 minutes, formic acid): Retention time = 1.70 minutes, m/z: 601 (M+1) ⁺ .

Step 3: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,14S)-3,14-diphenyl-5,12-dioxa- 2,15-diazahexadeca-7,9-diindioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis (1-oxopropane-1,2-diyl))bis(methylcarbamate)

A mixture of tert-butyl((S)-1-(((4S,7S,9aS)-8,8-dimethyl-5-oxo-7-(((S)-1-phenyl-2-(prop-2- in-1-yloxy)ethyl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate (194 mg, 0. 32 mmol), copper (II) acetate (70.4 mg, 0.39 mmol) and pyridine (50.6 mg, 0.64 mmol) in acetonitrile (10 ml) were stirred at 85°C for 1 hour. Aqueous ammonia (20-fold dilution) was added to this mixture until it turned blue and the mixture was extracted with dichloromethane (3×30 ml). The combined organic layers were washed with brine, dried, filtered and concentrated. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (2/1 v/v)] to give the crude product (130 mg). This material was further purified by preparative HPLC to yield di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,14S)-3.14 -diphenyl-5,12-dioxa-2,15-diazahexadeca-7,9-diindioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4- diyl))bis(azandiyl))bis(1-oxopropane-1,2-diyl))bis(methylcarbamate) (70 mg, 0.058 mmol) as a white powder. LCMS (3.0 minutes, formic acid): Retention time = 2.10 minutes, m/z: 1199.7 (M+1) ⁺ .

Step 4: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(hexa-2,4-diyne-1,6-diylbis(oxy))bis(1 -phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine- 7-carboxamide) dihydrochloride

To a solution of di-tert-butyl-((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,14S)-3,14-diphenyl-5,12-dioxa- 2,15-diazahexadeca-7,9-diindioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis (1-oxopropane-1,2-diyl))bis(methylcarbamate) (70 mg, 0.058 mmol) in dichloromethane (15 ml) was added hydrogen chloride (4 N in 1,4-dioxane, 1 ml). The reaction mixture was stirred at room temperature overnight. The solvent was concentrated under reduced pressure and dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(hexa-2,4-diyne- 1,6-diylbis(oxy))bis(1-phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2 ,1-b][1,3]taazepine-7-carboxamide) dihydrochloride (50 mg, 0.047 mmol, 79.36% yield) as a white solid. 1H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 9.24 (s, 2H), 8.86(d, J=6.4 Hz, 2H), 8.81(d, J=7.2 Hz, 2H), 8.38(d, J =8.0 Hz, 2H), 7.39-7.32 (m, 8H), 7.29-7.25 (m, 2H), 5.47(t, J=8.0 Hz, 2H), 5.04 (kV, J=6.8 Hz, 2H), 4.73 -4.69 (m, 2H), 4.30 (s, 4H), 4.17 (s, 2H), 3.86 (kV, J=6.9 Hz, 2H), 3.62(d, J=6.0 Hz, 4H), 3.19-3.13 ( m, 2H), 2.92-2.87 (m, 2H), 2.47 (s, 6H), 2.22-2.17 (m, 2H), 2.13-2.09 (m, 2H), 1.87(dd, J=12.4, 8.8 Hz, 2H), 1.80-1.72 (m, 2H), 1.38(d, J=6.8 Hz, 6H), 1.06 (s, 6H), 1.01 (s, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.28 minutes, m/z: 999.7 (M+1) ⁺ .

Example 34

(4S,7S,9aS)-N-((S)-2-((6-((S)-2-((4S,7S,9aS)-8,8-dimethyl-4-((S)- 2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamido)-2-phenylethoxy)hexa-2,4-diin-1-yl)oxy)-1 -phenylethyl)-8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide

Step 1: tert-butyl((S)-1-(((4S,7S,9aS)-8,8-dimethyl-5-oxo-7-(((S)-1-phenyl-2-(prop- 2-yn-1-yloxy)ethyl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-thioxopropan-2-yl)(methyl)carbamate

To a solution of (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][ 1,3]thiazepine-7-carboxylic acid (500 mg, 1.088 mmol), 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (624 mg, 1.64 mmol) and N,N-Diisopropylethylamine (281 mg, 2.18 mmol) in 1,2-dichloroethane (15 ml) was added (S)-1-phenyl-2-(prop-2-yn-1-yloxy)ethan-1-amine 210 mg, 1.20 mmol). The mixture was stirred at room temperature overnight. The mixture was purified by silica gel chromatography [petroleum ether/ethyl acetate (2:1 v/v)] and preparative-TLC [petroleum ether/ethyl acetate (1:1 v/v)] to give tert-butyl( (S)-1-(((4S,7S,9aS)-8,8-dimethyl-5-oxo-7-(((S)-1-phenyl-2-(prop-2-yn-1-yloxy )ethyl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-thioxopropan-2-yl)(methyl)carbamate (400 mg, 0.65 mmol, yield 59.1%) . LCMS (2.5 minutes, formic acid): Retention time = 1.988 minutes, m/z: 638.8 (M+Na) ⁺ .

Step 2: di-trct-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,14S)-3,14-diphenyl-5,12-dioxa- 2,15-diazahexadeca-7,9-diindioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis (1-oxopropane-1,2-diyl))bis(methylcarbamate), tert-butyl((S)-1-(((4S,7S,9aS)-7-(((S)-2-((6 -((S)-2-((4S,7S,9aS)-4-((S)2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2 ,1-b][1,3]thiazepine-7-carboxamido)-2-phenylethoxy)hexa-2,4-diin-1-yl)oxy-)-1-phenylethyl)carbamoyl)-8,8-dimethyl- 5-oxooctahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate and di-tert-butyl((2S,2'S)-( ((4S,4'S,7S,7'S,9aS,9a'S)-((3S, 14)-3,14-diphenyl-5,12-dioxa-2,15-diazahexadeca-7,9-diindioyl)bis(8, 8-dimethyl-5-oxooctahydropyrrolo[2,1-b1[1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropan-1,2-diyl))bis(methylcarbamate)

To a solution of tert-butyl((S)-1-(((4S,7S,9aS)-8,8-dimethyl-5-oxo-7-(((1S,2R)-2-(prop-2-yne -1-yloxy)-2,3-dihydro-1H-inden-1-yl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-thioxopropan-2- yl)(methyl)carbamate (378 mg, 0.616 mmol), tert-butyl((S)-1-(((4S,7S,9aS)-8,8-dimethyl-5-oxo-7-(((S )-1-phenyl-2-(prop-2-yn-1-yloxy)ethyl)carbamoyl)octahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)-1-oxopropane-2 -yl)(methyl)carbamate (370 mg, 0.616 mmol) and pyridine (292 mg, 3.696 mmol) in acetonitrile (15 ml), copper (II) acetate (269 mg, 1.478 mmol) was added. The mixture was stirred at 85°C for 40 minutes. The reaction mixture was concentrated and diluted with ethyl acetate (20 ml) and aqueous ammonia (20-fold dilution, 20 ml) was added. The aqueous phase was separated and extracted with ethyl acetate (2×15 ml). The combined organic phase was washed with brine (20 ml), dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by preparative-TLC [petroleum ether/ethyl acetate (2:3 v/v)] and preparative-HPLC to give the target products di-tert-butyl((2S,2'S)-(((4S,4,S )7S,7'S,9aS,9a'S)-((3S,14S)-3,14-diphenyl-5,12-dioxa-2,15-diazahexadeca-7,9-diindioyl)bis(8,8-dimethyl-5 -oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate) (100 mg, 0.083 mmol, yield 13.5%) [LCMS (2.5 minutes, formic acid): retention time = 1.914 minutes, m/z: 499.8 {[(M-2Boc)+2]/2} ⁺ ], tert-butyl((S) -1-(((4S,7S,9aS)-7-(((S)-2-((6-((S)-2-((4S,7S,9aS)-4-((S)- 2-((tert-butoxycarbonyl)(methyl)amino)1phopanthioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamido)-2-phenylethoxy)hexa- 2,4-diin-1-yl)oxy)-1-phenylethyl)carbamoyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepin-4-yl)amino)- 1-oxopropan-2-yl)(methyl)carbamate (66 mg, 0.054 mmol, yield 8.77%) [LCMS (2.5 minutes, formic acid): retention time = 2.042 minutes, m/z: 507.8 {[(M-2Boc )+2]/2} ⁺ ] and di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,14S)-3,14-diphenyl -5,12-dioxa-2,15-diazahexadeca-7,9-diindioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl) )bis(azandiyl))bis(1-thioxopropane-1,2-diyl))bis(methylcarbamate) (40 mg, 0.032 mmol, 5.19% yield) [LCMS (2.5 minutes, formic acid): Retention time = 2.186 minutes, m/z: 516.1 {[(M-2Vos)+2]/2} ⁺ ].

Step 3: (4S,7S,9aS)-N-((S)-2-((6-((S)-2-((4S,7S,9aS)-8,8-dimethyl-4-(( S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamido)-2-phenylethoxy)hexa-2,4-diin-1-yl)oxy )-1-phenylethyl)-8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide

To a solution of tert-butyl((S)-1-(((4S,7S,9aS)-7-(((S)-2-((6-((S)-2-((4S,7S,9aS )-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7- carboxamido)-2-phenylethoxy)hexa-2,4-diin-1-yl)oxy)-1-phenylethyl)carbamoyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3] thiazepin-4-yl)amino)-1-oxopropan-2-yl)(methyl)carbamate (60 mg, 0.049 mmol) in dichloromethane (5 ml) was added 4 N. hydrogen chloride in 1,4-dioxane (1 ml). The mixture was stirred at room temperature overnight. The solvent was concentrated and the crude product was purified by preparative TLC [dichloromethane/methanol (5:1 v/v)] to give (4S,7S,9aS)-N-((S)-2((6-( (S)-2-((4S,7S,9aS)-8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3 ]thiazepine-7-carboxamido)-2-phenylethoxy)hexa-2,4-diin-1-yl)oxy)-1-phenylethyl)-8,8-dimethyl-4-((S)-2-(methylamino )propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide (30 mg, 0.029 mmol, 59.2% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 8.36-8.33 (m, 1H), 8.29(d, J=8.0 Hz, 1H), 8.18(d, J=6.8 Hz, 1H), 7.39- 7.33 (m, 8H), 7.29-7.26 (m, 2H), 5.50-5.44 (m, 2H), 5.11-5.01 (m, 3H), 4.67-4.63 (m, 1H), 4.30 (s, 4H), 4.23-4.18 (m, 2H), 3.62(d, J=6.0 Hz, 4H), 3.40-3.35 (m, 2H), 3.20-3.12 (m, 2H), 2.97-2.85 (m, 3H), 2.38- 2.33 (m, 1H), 2.22 (s, 6H), 2.16-2.15 (m, 2H), 1.91-1.83 (m, 2H), 1.78-1.65 (m, 2H), 1.24 (s, 3H), 1.1 l (d, J=6.8 Hz, 3H), 1.07(d, J=8.4 Hz, 6H), 1.00(d, J=6.8 Hz, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.251 minutes, m/z: 1015.4 (M+1) ⁺ .

Example 35

(4S,4'S,7S,7'S,9aS,9a'S)-N,N,-((1S,1'S)-(hexa-2,4-diyne-1,6-diylbis(oxy))bis(1-phenylethane- 2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide )

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,14S)-3,14-diphenyl-5,12-dioxa-2 ,15-diazahexadeca-7,9-diindioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis( 1-thioxopropane-1,2-diyl))bis(methylcarbamate) (Example 34, Step 2) (40 mg, 0.032 mmol) in dichloromethane (5 ml) was added 4 N. hydrogen chloride in 1,4-dioxane (1 ml). The mixture was stirred at room temperature overnight. The solvent was concentrated and the crude product was purified by preparative TLC (dichloromethane/methanol = 5:1) to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-( hexa-2,4-diyne-1,6-diylbis(oxy))bis(1-phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino) propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) (19 mg, 0.018 mmol, 56.2% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 8.39-8.36 (m, 2H), 7.73-7.67 (m, 2H), 7.39-7.33 (m, 8H), 7.30-7.25 (m, 2H) , 5.49-5.44 (m, 2H), 5.11-5.02 (m, 4H), 4.30 (m, 3H), 4.14(dd, J=5.6, 3.6 Hz, 1H), 3.62(d, J=6.0 Hz, 4H ), 3.56 (s, 2H), 3.20-3.13 (m, 2H), 2.96-2.89 (m, 2H), 2.35-2.31 (m, 2H), 2.24-2.17 (m, 8H), 1.91-1.86 (m , 2H), 1.79-1.61 (m, 4H), 1.26-1.21 (m, 8H), 1.08 (s, 6H), 1.01 (s, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.314 minutes, m/z: 1031.4 (M+1) ⁺ .

Example 36

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(butane-1,4-diylbis(oxy))bis(1-phenylethane-2,1-diyl) )bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

Step 1: (1S,1'S)-2,2'-(butane-1,4-diylbis(oxy))bis(1-phenylethan-1-amine)

To a solution of (S)-2-amino-2-phenylethan-1-ol (1 g, 7.29 mmol) in tetrahydrofuran (80 ml) at 0°C was slowly added sodium hydride (60%, dispersion in Paraffin Oil) (321 mg , 8.02 mmol). The mixture was allowed to warm to room temperature. Then 1,4-Dibromobutane (787 mg, 3.65 mmol) was added. The resulting mixture was heated to 70°C and stirred overnight. After cooling, ice water (50 ml) was added and the mixture was extracted with ethyl acetate (3×30 ml). The combined organic layers were washed with brine (50 ml), dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by thin layer chromatography [dichloromethane/methanol (10:1 v/v)] to give the product (1S,1'S)-2,2'-(butane-1,4-diylbis(oxy) )bis(1-phenylethan-1-amine) (190 mg, 0.58 mmol, yield 15.9%) as a black oil. LCMS (2.5 minutes, formic acid): Retention time = 1.162 minutes, m/z: 329.0 (M+1) ⁺ .

Step 2: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,12S)-3,12-diphenyl-5,10-dioxa- 2,13-diazatetradecanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropane-1.2 -diyl))bis(methylcarbamate)

To a mixture of (1S,1'S)-2,2'-(butane-1,4-diylbis(oxy))bis(1-phenylethan-1-amine) (90 mg, 0.274 mmol) and (4S,7S,9aS) -4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxylic acid (Intermediate I) (267 mg, 0.603 mmol) in 1,2-dichloroethane (12 ml) added N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl (203 mg, 0.822 mmol) and N,N-diisopropylethylamine (141 mg, 1.096 mmol). The mixture was stirred at 50°C overnight. The solvent was removed under reduced pressure. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (2/1 v/v)] followed by preparative-HPLC to give di-tert-butyl((2S,2,S)-(((4S ,4'S,7S,7'S,9aS)9a'S)-((3S,12S)-3,12-diphenyl-5,10-dioxa-2,13-diazatetradecanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2 ,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate) (48 mg, 0.041 mmol, yield 14.6 %) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 1.835 minutes, m/z: 489.9 {[(M-2Boc)+2]/2} ⁺ .

Step 3: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(butane-1,4-diylbis(oxy))bis(1-phenylethane-2,1 -diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,12S)-3,12-diphenyl-5,10-dioxa-2 ,13-diazatetradecanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropane-1, 2-diyl))bis(methylcarbamate) (48 mg, 0.041 mmol) in dichloromethane (5 ml) was added 4 N. hydrogen chloride in 1,4-dioxane (1 ml). The mixture was stirred at room temperature for 3 hours. The mixture was concentrated and dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(butane-1,4-diylbis(oxy)) bis(1-phenylethan-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3 ]thiazepine-7-carboxamide) dihydrochloride (34 mg, 0.032 mmol, 79.2% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 9.34 (s, 1H), 8.62 (s, 1H), 8.81(d, J=7.2 Hz, 2H), 8.34(d, J=8.0 Hz, 2H), 7.37-7.30 (m, 8H), 7.27-7.23 (m, 2H), 5.47(t, J=8.0 Hz, 2H), 4.99 (kV, J=6.4 Hz, 2H), 4.71(t, J =8.4 Hz, 2H), 4.17 (s, 2H), 3.88-3.84 (m, 2H), 3.49-3.48 (m, 4H), 3.41-3.29 (m, 4H), 3.16(t, J=12.4 Hz, 2H), 2.90-2.87 (m, 2H), 2.46 (s, 6H), 2.22-2.19 (m, 2H), 2.12-2.10 (m, 2H), 1.89-1.84 (m, 2H), 1.79-1.70 ( m, 2H), 1.42 (s, 4H), 1.39(d, J=6.8 Hz, 6H), 1.06 (m, 6H), 1.00 (m, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.323 minutes, m/z: 978.8 (M+1) ⁺ .

Example 37

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(butane-1,4-diylbis(oxy))bis(1-phenylethane-2,1-diyl) )bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

Step 1: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,12S)-3,12-diphenyl-5,10-dioxa- 2,13-diazatetradecanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane-1 ,2-diyl))bis(methylcarbamate)

To a mixture of (1S,1'S)-2,2'-(butane-1,4-diylbis(oxy))bis(1-phenylethan-1-amine) (100 mg, 0.304 mmol) and (4S,7S,9aS) -4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxylic acid (Intermediate II) (308 mg, 0.670 mmol) in 1,2-dichloroethane (12 ml) added N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl (226 mg, 0.912 mmol) and N,N-diisopropylethylamine (157 mg, 1.216 mmol). The mixture was stirred at 50°C overnight. The solvent was removed under reduced pressure. The crude product was purified by thin layer chromatography (ethyl acetate/petroleum ether = 1/1) followed by preparative-HPLC to give di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S, 9aS,9a'S)-((3S,12S)-3,12-diphenyl-5,10-dioxa-2,13-diazatetradecanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1 ,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane-1,2-diyl))bis(methylcarbamate) (55 mg, 0.045 mmol, yield 14.8%) as a colorless oil. LCMS (2.5 minutes, formic acid): Retention time = 2.044 minutes, m/z: 506 {[(M-2Boc)+2]/2} ⁺ .

Step 2: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(butane-1,4-diylbis(oxy))bis(1-phenylethane-2,1 -diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,12S)-3,12-diphenyl-5,10-dioxa-2 ,13-diazatetradecanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane-1, 2-diyl))bis(methylcarbamate) (55 mg, 0.045 mmol) in dichloromethane (5 ml) was added 4 N. hydrogen chloride in 1,4-dioxane (1 ml). The mixture was stirred at room temperature for 2 hours. The solvent was removed under reduced pressure and the product was dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(butane-1,4-diylbis (hydroxy))bis(1-phenylethan-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b] [1,3]thiazepine-7-carboxamide) dihydrochloride (35 mg, 0.032 mmol, 71.4% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 10.96 (s, 1H), 10.89 (s, 1H), 9.71 (s, 1H), 9.55 (s, 1H), 8.61 (s, 1H), 8.40(t, J=8.2 Hz, 2H), 7.37-7.30 (m, 8H), 7.27-7.23 (m, 2H), 5.42 (kV, J=8.0 Hz, 2H), 5.16-5.11 (m, 2H) , 5.02-4.98 (m, 2H), 4.26-4.23 (m, 2H), 4.21-4.20 (m, 2H), 3.49-3.48 (m, 4H), 3.33 (s, 4H), 3.19-3.13 (m, 2H), 2.96-2.92 (m, 2H), 2.48 (s, 6H), 2.24-2.21 (m, 4H), 1.93-1.88 (m, 4H), 1.43-1.42 (m, 6H), 1.08 (m, 6H), 1.02 (m, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.326 minutes, m/z: 506.0 [(M+2)/2] ⁺ .

Example 38

(4S,4'S,7S,7'S,9aS,9a'S)-N,N,-((1S,1'S)-((oxybis(ethane-2,1-diyl))bis(oxy))bis(1-phenylethane- 2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide ) dihydrochloride

Step 1: Oxybis(ethane-2,1-diyl)bis(4-methylbenzenesulfonate)

KOH (14.27 g, 25.4 mmol). The mixture was left to stir overnight. Ice water (150 ml) was added to this mixture, followed by extraction with dichloromethane (3×200 ml). The combined organic layers were dried using anhydrous magnesium sulfate, filtered and concentrated. The residue was crystallized from anhydrous methanol to give oxybis(ethane-2,1-diyl)bis(4-methylbenzenesulfonate) (9.3 g, 22.4 mmol, 79%) as a white solid. ¹ H-NMR 1 (400 MHz, DMSO-d ₆ ) δ ppm 7.78(d, J=8.0 Hz, 4H), 7.47(d, J=8.0 Hz, 4H), 4.07- 4.05 (m, 4H), 3.53 -3.51 (m, 4H), 2.42 (s, 6H); LCMS (2.5 minutes, formic acid): Retention time = 1.675 minutes, m/z: 414.5 (M+1)+, 436.8 (M+Na) ⁺ .

Step 2: (1S,1'S)-2,2'-((oxybis(ethane-2,1-diyl))bis(oxy))bis(1-phenylethan-1-amine)

To a solution of (S)-2-amino-2-phenylethan-1-ol (364.1 mg, 2.65 mmol) in dry tetrahydrofuran (10 ml) at 0°C, a suspension of sodium hydride (60%, dispersion in Paraffin Oil) was added in portions ( 144.8 mg, 6.03 mmol) in dry tetrahydrofuran (10 ml) under a nitrogen atmosphere. The mixture was stirred at room temperature for 2 hours. Oxybis(ethane-2,1-diyl)bis(4-methylbenzenesulfonate) (500 mg, 1.21 mmol) was added to this mixture and the mixture was stirred at room temperature for 12 hours. The mixture was quenched with water (50 ml) and extracted with ethyl acetate (3×50 ml). The combined organic layers were washed with brine, dried, filtered and concentrated. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (1/1 v/v)] to give (1S,1'S)-2,2'-((oxybis(ethane-2,1-diyl) )bis(oxy))bis(1-phenylethan-1-amine) (260 mg, 0.76 mmol, 62% yield) as a yellow oil. LCMS (2.5 minutes, formic acid): Retention time = 1.085 minutes, m/z: 345.0 (M+1) ⁺ .

Step 3: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,13S)-3,13-diphenyl-5,8,11- trioxa-2,14-diazapentadecanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropane -1.2-diyl))bis(methylcarbamate)

Solution of (1S,1'S)-2,2'-((oxybis(ethane-2,1-diyl))bis(oxy))bis(1-phenylethan-1-amine) (150 mg, 0.44 mmol), (4S ,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3] thiazepine-7-carboxylic acid (405.6 mg, 0.91 mmol), N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl (323 mg, 1.31 mmol) and N,N-diisopropylethylamine (225.1 mg, 1.74 mmol) in 1. 2-dichloroethane (8 ml) was stirred at 50°C overnight. The mixture was concentrated under reduced pressure and purified by thin layer chromatography [ethyl acetate/petroleum ether (2/1 v/v)] to give the crude product (360 mg) as a yellow oil. This material was further purified by preparative HPLC to yield di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,13S)-3.13 -diphenyl-5,8,11-trioxa-2,14-diazapentadecanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis (azandiyl))bis(1-oxopropane-1,2-diyl))bis(methylcarbamate) (180 mg, 0.15 mmol, 33.5% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 1.79 minutes, m/z: 498.1 {[(M-2Boc)+2]/2} ⁺ .

Step 4: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-((oxybis(ethane-2,1-diyl))bis(1-oxy))bis (1-phenylethan-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine -7-carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,13S)-3,13-diphenyl-5,8,11-trioxa -2,14-diazapentadecanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropane- 1,2-diyl))bis(methylcarbamate) (180 mg, 0.15 mmol) in dichloromethane (6 ml) was added hydrogen chloride (4 N in 1,4-dioxane, 2 ml) at room temperature. The reaction mixture was stirred at room temperature overnight. The mixture was concentrated under reduced pressure and dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-((oxybis(ethane-2,1 -diyl))bis(oxy))bis(1-phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2 ,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride (130 mg, 0.131 mmol, 76%) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 9.50 (s, 2H), 8.91 (s, 2H), 8.83(d, J=6.4 Hz, 2H), 8.37(d, J=7.6 Hz, 2H), 7.38-7.31 (m, 8H), 7.27-7.23 (m, 2H), 5.47(t, J=7.8 Hz, 2H), 5.00 (kV, J=7.2 Hz, 2H), 4.70(t , J=8.8 Hz, 2H), 4.17 (s, 2H), 3.88-3.82 (m, 2H), 3.56-3.40 (m, 12H), 3.15(t, J=12.2 Hz, 2H ), 2.91-2.87 (m, 2H), 2.45 (s, 6H), 2.22-2.09 (m, 4H), 1.90-1.71 (m, 4H), 1.39(d, J=6.8 Hz, 6H ), 1.06 (m, 6H), 1.01 (m, 6H); LCMS (2.5 minutes, formic acid): Retention time = 1.284 minutes, m/z: 995.8 (M+1) ⁺ .

Example 39

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-((oxybis(ethane-2,1-diyl))bis(oxy))bis(1-phenylethane- 2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide ) dihydrochloride

Step 1: di-tert-butyl((2S,2'S)-((4S,4'S,7S,7'S',9aS,9a'S)-((3S,13S)-3,13-diphenyl-5,8,11- trioxa-2,14-diazapentadecanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane -1,2-diyl))bis(methylcarbamate)

Solution of (1S,1'S)-2,2'-((oxybis(ethane-2,1-diyl))bis(oxy))bis(1-phenylethan-1-amine) (50 mg, 0.15 mmol), (4S ,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3] thiazepine-7-carboxylic acid (Intermediate II) (140.1 mg, 0.30 mmol), N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl (107.7 mg, 0.45 mmol) and N,N-diisopropylethylamine (75 mg, 0.60 mmol) in 1,2-dichloroethane (5 ml) was stirred at 50°C overnight. The solvent was removed under reduced pressure. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (1/1 v/v)] to give the crude product (360 mg) as a yellow oil. This material was further purified by preparative HPLC to yield di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,13S)-3.13 -diphenyl-5,8,11-trioxa-2,14-diazapentadecanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis (azandiyl))bis(1-thioxopropane-1,2-diyl))bis(methylcarbamate) (100 mg, 0.082 mmol, 60% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 2.02 minutes, m/z: 514.0 {[(M-2Boc)+2]/2} ⁺ .

Step 2: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-((oxybis(ethane-2,1-diyl))bis(oxy))bis(1 -phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1.3]thiazepine-7- carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,13S)-3,13-diphenyl-5,8,11-trioxa -2,14-diazapentadecanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-thioxopropane- 1,2-diyl))bis(methylcarbamate) (100 mg, 0.082 mmol) in dichloromethane (5 ml) was added hydrogen chloride (4 N in 1,4-dioxane, 1 ml) at room temperature. The reaction mixture was stirred at room temperature overnight. The solvent was removed under reduced pressure and dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-((oxybis(ethane-2,1 -diyl))bis(oxy))bis(1-phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2 ,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride (50 mg, 0.05 mmol, 60% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 10.95(d, J=6.4 Hz, 1H), 10.88(d, J=6.4 Hz, 1H), 9.70 (s, 1H), 9.53 (s, 1H), 8.61 (s, 1H), 8.44-8.40 (m, 3H), 7.37-7.31 (m, 8H), 7.27-7.24 (m, 2H), 5.42 (kv, J=8.0 Hz, 2H), 5.13 (kv, J=7.6 Hz, 2H), 5.03-4.98 (m, 2H), 4.25-4.20 (m, 4H), 3.55-3.54 (m, 4H), 3.51-3.47 (m, 4H), 3.44 (s , 4H), 3.16(t, J=12 Hz, 2H), 2.48 (s, 6H), 2.24-2.21 (m, 4H), 1.94-1.89 (m, 4H), 1.43(d, J=6.4 Hz, 6H), 1.08 (m, 6H), 1.03 (m, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.355 minutes, m/z: 1026.8 (M+1) ⁺ .

Example 40

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(hexane-1,6-diylbis(oxy))bis(1-phenylethane-2,1-diyl) )bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

Step 1: (1S,1'S)-2,2'-(hexane-1,6-diylbis(oxy))bis(1-phenylethan-1-amine)

To a mixture of (S)-2-amino-2-phenylethan-1-ol (1.0 g, 7.20 mmol) in dry tetrahydrofuran (20 ml) at 0°C, sodium hydride (60%, dispersion in Paraffin Oil) was slowly added in portions ( 330 mg, 13.8 mmol) in a nitrogen atmosphere. The mixture was stirred at room temperature for 30 minutes and a solution of 1,6-dibromohexane (810 mg, 3.31 mmol) in dry tetrahydrofuran (10 ml) was added. The mixture was refluxed and stirred for another 5 hours. After cooling, water (300 ml) was carefully added to this mixture, followed by extraction with dichloromethane (3×100 ml). The combined organic layers were washed with brine, dried, filtered and concentrated. The residue was purified by thin layer chromatography (dichloromethane/methanol (7:1 v/v)] to give (1S,1'S)-2,2'-(hexane-1,6-diylbis(oxy))bis (1-phenylethan-1-amine) (410 mg, 1.15 mmol, 25.6% yield) as a yellow oil. LCMS (2.5 minutes, formic acid): Retention time = 1.24 minutes, m/z: 357.0 (M+1) ⁺ .

Step 2: di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,14S)-3,14-diphenyl-5,12-dioxa- 2,15-diazahexadecanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropane-1 ,2-diyl))bis(methylcarbamate)

Solution of (1S,1'S)-2,2'-(hexane-1,6-diylbis(oxy))bis(1-phenylethan-1-amine) (90 mg, 0.25 mmol), (4S,7S,9aS)- 4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxylic acid (235.2 mg, 0.53 mmol), N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl (187.3 mg, 0.76 mmol) and diisopropylethylamine (130.5 mg, 1.01 mmol) in 1,2-dichloroethane (5 ml) were stirred at 50 °C overnight. The solvent was removed under reduced pressure. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (1:1 v/v)] to give the crude product (120 mg) as a yellow oil. This material was further purified by preparative HPLC to yield di-tert-butyl((2S,2'S)-(((4S,4,S,7S,7'S,9aS,9a,S)-((3S,14S) -3,14-diphenyl-5,12-dioxa-2,15-diazahexadecanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl) )bis(azandiyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate) (50 mg, 0.041 mmol, 16.4% yield) as a white solid. LCMS (2.5 minutes, formic acid): Retention time = 1.89 minutes, m/z: 503.9 {[(M-2Boc)+2]/2} ⁺ .

Step 3: (4S,4'S,7S,7'S,9aS,9a'S')-N,N'-((1S,1'S)-(hexane-1,6-diylbis(oxy))bis(1-phenylethane-2, 1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,14S)-3,14-diphenyl-5,12-dioxa-2 ,15-diazahexadecanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azandiyl))bis(1-oxopropane-1, 2-diyl))bis(methylcarbamate) (100 mg, 0.083 mmol) in dichloromethane (5 ml) was added hydrogen chloride (4 N in 1,4-dioxane, 1 ml). The mixture was stirred at room temperature overnight. The mixture was concentrated under reduced pressure and dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(hexane-1,6-diylbis( oxy))bis(1-phenylethan-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][ 1,3]thiazepine-7-carboxamide) dihydrochloride (41.9 mg, 0.038 mmol, 45.8% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 9.34 (s, 2H), 8.88-8.86 (m, 2H), 8.82(d, J=7.8 Hz, 2H), 8.36(d, J=8.4 Hz, 2H), 7.38-7.31 (m, 8H), 7.27-7.23 (m, 2H), 5.47(t, J=7.8 Hz, 2H), 5.48-5.02 (m, 2H), 4.73-4.68 (m, 2H), 4.17 (s, 2H), 3.88-3.83 (m, 2H), 3.72-3.65 (m, 2H), 3.51-3.47 (m, 6H), 3.32-3.28 (m, 4H), 3.19-3.13 ( m, 2H), 2.90-2.87 (m, 2H), 2.46(t, J=4.4H, 6H), 2.22-2.17 (m, 2H), 2.13-2.09 (m, 2H), 1.89-1.84 (m, 2H), 2H), 1.79-1.34 (m, 2H), 1.39-1.38 (m, 10H), 1.06 (s, 6H), 1.01 (m, 6H). LCMS (2.5 minutes, formic acid): Retention time = 1.258 minutes, m/z: 1006.8 (M+1) ⁺ .

Example 41

(4S,4'S,7S,7'S,9aS,9a'S)-N,N',-((1S,1'S)-(hexane-1,6-dilbis(oxy))bis(1phenylethane-2,1-diyl)) bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

Step 1: di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,14S)-3,14-diphenyl-5,12-dioxa- 2,15-diazahexadecanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azanediyl))bis(1-thioxopropane-1 ,2-diyl))bis(methylcarbamate)

Solution of (1S,1'S)-2,2'-(hexane-1,6-diylbis(oxy))bis(1-phenylethan-1-amine) (90 mg, 0.25 mmol), (4S,7S,9aS)- 4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxylic acid (243.7 mg, 0.53 mmol), N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl (187.3 mg, 0.76 mmol) and N,N-diisopropylethylamine (130.5 mg, 1.01 mmol) in 1,2-dichloroethane (5 ml ) was stirred at 50°C overnight. The solvent was removed under reduced pressure. The residue was purified by thin layer chromatography [ethyl acetate/petroleum ether (1/1 v/v)] to give the crude product (120 mg) as a yellow oil. This material was then purified by preparative HPLC to yield di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,14S)-3,14- diphenyl-5,12-dioxa-2,15-diazahexadecanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azanediyl) )bis(1-thioxopropane-1,2-diyl))bis(methylcarbamate) (130 mg, 0.104 mmol, 41.4% yield) as a white solid. LCMS (2.5 min, formic acid): Bp. beat = 2.094 min, m/z: 520.0 {[(M-2Vos)+2]/2} ⁺ .

Step 2: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(hexane-1,6-diylbis(oxy))bis(1-phenylethane-2,1 -diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,14S)-3,14-diphenyl-5,12-dioxa-2 ,15-diazahexadecanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azanediyl))bis(1-thioxopropane-1, 2-diyl))bis(methylcarbamate) (130 mg, 0.10 mmol) in dichloromethane (5 ml) was added hydrogen chloride (4 N in 1,4-dioxane, 1 ml). The reaction mixture was stirred at room temperature overnight. The mixture was concentrated under reduced pressure and dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(hexane-1,6-diylbis( oxy))bis(1-phenylethan-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][ 1,3]thiazepine-7-carboxamide) dihydrochloride (78.4 mg, 0.07 mmol, 70.0% yield) in the form of a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 10.96-10.88 (m, 2H), 9.62 (s, 2H), 8.61 (s, 1H), 8.42 (t, J=8.4 Hz, 3H), 7.37-7.31 (m, 8H), 7.27-7.23 (m, 2H), 5.42 (q, J=8.0 Hz, 2H), 5.17-5.10 (m, 2H), 5.03-4.98 (m, 2H), 4.24- 4.20 (m, 4H), 3.57 (s, 2H), 3.54-3.47 (m, 4H), 3.40-3.38 (m, 2H), 3.32-3.28 (m, 4H), 3.19-3.13 (m, 2H), 2.96-2.93 (m, 2H), 2.48-2.47 (m, 6H), 2.24-2.21 (m, 4H), 1.94-1.81 (m, 4H), 1.44-1.42 (m, 10H), 1.09 (s, 6H ), 1.03 (m, 6H). LCMS (2.5 min, formic acid): Bp. beat = 1.300 min, m/z: 1038.7 (M+1) ⁺ .

Example 42

(4S,4'S,7S,7,S,9aS,9a'S)-N,N,-((1S,1'S)-((1,4-phenylenebis(methylene))bis(oxy))bis(1-phenylethane- 2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide ) dihydrochloride

Step 1: (1S,1'S)-2,2'-((1,4-phenylenebis(methylene))bis(oxy))bis(1-phenylethan-1-amine)

To a solution of (S)-2-amino-2-phenylethan-1-ol (2.2 g, 16.0 mmol) in dry tetrahydrofuran (30 ml) was added sodium hydride (60%, dispersion in liquid paraffin) (760 mg, 31.6 mmol) . After 30 minutes, 1,4-bis-bromomethylbenzene (2.0 g, 7.6 mmol) was added. The mixture was stirred at room temperature overnight. The mixture was quenched with ice water (50 ml) and extracted with ethyl acetate (3×60 ml). The combined organic layers were washed with brine, dried (Na ₂ SO ₄ ), filtered and concentrated. The crude product was purified by silica gel chromatography (dichloromethane/methanol (20:1 v/v)] to give (1S,1'S)-2,2'-((1,4-phenylenebis(methylene))bis( hydroxy))bis(1-phenylethan-1-amine) (1.2 g, 3.2 mmol, 31% yield) as a yellow oil. LCMS (2.5 min, formic acid): Bp.sp = 1.14 min, m/z: 377.0 (M+1) ⁺ .

Step 2: tert-butyl-di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S)-((1,4- phenylenebis(methylene))bis(oxy))bis(1-phenylethane-2,1-diyl))bis(azanediyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b ][1,3]thiazepine-7,4-diyl))bis(azanediyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate) Solution of (1S,1'S)-2,2'-( (1,4-phenylenebis(methylene))bis(oxy))bis(1-phenylethan-1-amine) (100 mg, 0.266 mmol), (4S,7S,9aS)-4-((S)-2- ((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxylic acid (247.5 mg, 0.56 mmol), N -ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl (197.1 mg, 0.80 mmol) and N,N-diisopropylethylamine (137.3 mg, 0.29 mmol) in 1,2-dichloroethane (6 ml) were stirred at 50°C overnight . The mixture was concentrated under reduced pressure and purified by thin layer chromatography [ethyl acetate/petroleum ether (2:1 v/v)] to give the crude product (200 mg) as a yellow oil. This material was then purified by preparative HPLC to give tert-butyl-di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S )-((1,4-phenylenebis(methylene))bis(oxy))bis(1-phenylethane-2,1-diyl))bis(azanediyl))bis(carbonyl))bis(8,8-dimethyl-5 -oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azanediyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate) (160 mg, 0.130 mmol, 49.1% yield) as a white solid. LCMS (2.5 min, formic acid): Bp. beat = 1.86 min, m/z: 514.1 {[(M-2Vos)+2]/2} ⁺ .

Step 3: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-((1,4-phenylenebis(methylene))bis(oxy))bis(1-phenylethane -2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7- carboxamide) dihydrochloride

To a solution of di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S)-((1,4-phenylenebis(methylene))) bis(oxy))bis(1-phenylethan-2,1-diyl))bis(azanediyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3 ]thiazepine-7,4-diyl))bis(azanediyl))bis(1-oxopropane-1,2-diyl))bis(methylcarbamate) (160 mg, 0.13 mmol) in dichloromethane (15 ml), hydrogen chloride (4 N in 1,4-dioxane, 1 ml). The reaction mixture was stirred at room temperature overnight. The mixture was concentrated under reduced pressure and dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-((1,4-phenylenebis(methylene ))bis(oxy))bis(1-phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1 -b][1,3]thiazepine-7-carboxamide) dihydrochloride (110 mg, 0.11 mmol, 78% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 9.39 (s, 2H), 8.88-8.86 (m, 2H), 8.81 (d, J=6.8 Hz, 2H), 8.42 (d, J=8.0 Hz, 2H), 7.39-7.32 (m,8H), 7.28-7.25 (m, 2H), 7.20 (s, 4H), 5.47 (t, J=7.6 Hz, 2H), 5.08 (q, J=6.0 Hz , 2H), 4.70 (t, J=9.0 Hz, 2H), 4.49-4.43 (m, 4H), 4.18 (s, 2H), 3.86 (s, 2H), 3.72-3.63 (m, 2H), 3.55- 3.47 (m, 2H), 3.13 (t, J=12.2 Hz, 2H), 2.82-2.78 (m, 2H), 2.46 (s, 6H), 2.21-2.16 (m, 2H), 2.09-2.06 (m, 2H), 1.88-1.83 (m, 2H), 1.77-1.68 (m, 2H), 1.39 (d, J=6.8 Hz, 6H), 1.05 (m, 6H), 0.97 (m, 6H). LCMS (2.5 min, formic acid): Bp. beat = 1.334 min, m/z: 1027.8 (M+1) ⁺ .

Example 43

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1,S)-((1,4-phenylenebis(methylene))bis(oxy))bis(1-phenylethane- 2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide ) dihydrochloride

Step 1: di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S)-((1,4-phenylenebis(methylene) )bis(oxy))bis(1-phenylethane-2,1-diyl))bis(azanediyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1 ,3]thiazepine-7,4-diyl))bis(azanediyl))bis(1-thioxopropan-1,2-diyl))bis(methylcarbamate)

To a solution of (1S,1'S)-2,2'-((1,4-phenylenebis(methylene))bis(oxy))bis(1-phenylethan-1-amine) (100 mg, 0.266 mmol), (4S, 7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanethioamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine -7-carboxylic acid (intermediate II) (256.4 mg, 0.56 mmol), -N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl (197.1 mg, 0.80 mmol) and N,N-diisopropylethylamine (137.3 mg, 0.29 mmol) in 1,2-dichloroethane (6 ml) was stirred at 50°C overnight. The mixture was concentrated and purified by thin layer chromatography [ethyl acetate/petroleum ether (1:1 v/v)] to give the crude product (200 mg) as a yellow oil. This material was then purified by preparative HPLC to yield di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S)-(( 1,4-phenylenebis(methylene))bis(oxy))bis(1-phenylethane-2,1-diyl))bis(azanediyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2 ,1-b][1,3]thiazepine-7,4-diyl))bis(azanediyl))bis(1-thioxopropane-1,2-diyl))bis(methylcarbamate) (100 mg, 0.08 mmol, 30% yield) as a white solid. LCMS (2.5 min, formic acid): Bp. beat = 2.08 min, m/z: 530.6 {[(M-2Vos)+2]/2} ⁺ .

Step 2: (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-((1,4-phenylenebis(methylene))bis(oxy))bis(1-phenylethane -2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7- carboxamide) dihydrochloride

To a solution of di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S)-((1,4-phenylenebis(methylene))) bis(oxy))bis(1-phenylethan-2,1-diyl))bis(azanediyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3 ]thiazepine-7,4-diyl))bis(azanediyl))bis(1-thioxopropane-1,2-diyl))bis(methylcarbamate) (100 mg, 0.08 mmol) in dichloromethane (5 ml), hydrogen chloride (4 N in 1,4-dioxane, 1 ml) at room temperature. The reaction mixture was stirred at room temperature overnight. The mixture was concentrated under reduced pressure and dried under high vacuum to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-((1,4-phenylenebis(methylene ))bis(oxy))bis(1-phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanethioamido)-5-oxooctahydropyrrolo[2,1 -b][1,3]thiazepine-7-carboxamide) dihydrochloride (53 mg, 0.05 mmol, 63% yield) as a white solid. ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ ppm 10.97 (d, J=6.0 Hz, 1H), 10.89 (d, J=6.0 Hz, 1H), 9.74 (s, 1H), 9.57 (s, 1H), 8.62 (s, 1H), 8.49-8.45 (m, 3H), 7.39-7.32 (m, 8H), 7.28-7.25 (m, 2H), 7.20 (s, 4H), 5.42 (q, J= 7.6 Hz, 2H), 5.16-5.06 (m, 4H), 4.49-4.43 (m, 4H), 4.27-4.21 (m, 4H), 3.65-3.59 (m, 2H), 3.42-3.38 (m, 2H) , 3.14 (t, J=12 Hz, 2H), 2.89-2.86 (m, 2H), 2.48-2.47 (m, 6H), 2.24-2.18 (m, 4H), 1.92-1.76 (m, 4H), 1.43 (d, J=6.4 Hz, 6H), 1.07 (m, 6H), 0.99 (m, 6H). LCMS (2.5 min, formic acid): Bp. beat = 1.397 min, m/z: 1058.7 (M+1) ⁺ .

Examples 44-55

Examples 44-55 were prepared similarly to other compounds described herein. These compounds were found to be characterized by the data presented below.

Example 44

(4S,7S,9aS)-N-[(1R,2R)-2-({[4-({[(1R,2R)-1-[(4S,7S,9aS)-8,8-dimethyl- 4-[(2S)-2-(methylamino)propanethioamido]-5-oxo-octahydropyrrolo[2,1-b][1,3]thiazepine-7-amido]-2,3-dihydro-1H-indene-2 -yl]formamido}methyl)phenyl]methyl}carbamoyl)-2,3-dihydro-1H-inden-1-yl]-8,8-dimethyl-4-[(2S)-2-(methylamino)propanethioamido]- 5-oxo-octahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide

LCMS (electrospray, m/z): 1137.6 [M+H] ⁺ , retention time 1.265 min.

¹ H-NMR (400 MHz, DMSO-d ₆ ): δ ppm 10.90 (d, J=34.6 Hz, 2H), 9.81-9.43 (m, 2H), 8.62 (s, 1H), 8.52-8.36 (m, 3H ), 7.94 (dd, J=16.9, 9.3 Hz, 2H), 7.34-7.12 (m, 12H), 5.67 (t, J=8.6 Hz, 2H), 5.45 (q, J=8.3 Hz, 2H), 5.20 -5.05 (m, 2H), 4.43 (d, J=14.8 Hz, 2H), 4.30 (s, 2H), 4.13 (d, J=13.3 Hz, 2H), 3.95 (dd, J=15.1, 4.3 Hz, 2H), 3.48-3.39 (m, 2H), 3.28-3.16 (m, 4H), 3.11-3.01 (m, 2H), 3.01-2.91 (m, 2H), 2.48 (s, 6H), 2.39-2.16 ( m, 6H), 1.83-1.65 (m, 2H), 1.43 (d, J=6.0 Hz, 6H), 1.19-0.90 (m, 12H).

Example 45

(4S,7S,9aS)-N-[(1R,2R)-2-({[4-({[(1R,2R)-1-[(4S,7S,9aS)-8,8-dimethyl- 4-[(2S)-2-(methylamino)propanamido]-5-oxo-octahydropyrrolo[2,1-b][1,3]thiazepine-7-amido]-2,3-dihydro-1H-indene-2 -yl]formamido}methyl)phenyl]methyl}carbamoyl)-2,3-dihydro-1H-inden-1-yl]-8,8-dimethyl-4-[(2S)-2-(methylamino)propanamido]- 5-oxo-octahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide

LCMS (electrospray, m/z): 1105.7 [M+H] ⁺ , retention time 1.268 min.

¹ H-NMR (400 MHz, DMSO-d ₆ ): δ ppm 9.07 (s, 2H), 8.92-8.72 (m, 4H), 8.48-8.38 (m, 2H), 7.88 (d, J=8.9 Hz, 2H), 7.41-6.98 (m, 12H), 5.71-5.62 (m, 2H), 5.57-5.43 (m, 2H), 4.76-4.65 (m, 2H), 4.44 (dd,J=14.7, 6.7 Hz, 2H), 4.11 (s, 2H), 4.00-3.91 (m, 2H), 3.91-3.82 (m, 2H), 3.47-3.41 (m, 2H), 3.25-3.12 (m, 4H), 3.05 (dd, J=16.2, 8.6 Hz, 2H), 2.90 (d, J=13.0 Hz, 2H), 2.50-2.42 (m, 6H), 2.28-2.15 (m, 4H), 2.13-2.02 (m, 2H), 1.76 -1.63 (m, 2H), 1.43-1.32 (m, 6H), 0.98 (s, 12H).

Example 46

(4S,7S,9aS)-N-[(1R,2R)-2-{4-[(1R,2R)-1-[(4S,7S,9aS)-8,8-dimethyl-4-[( 2S)-2-(methylamino)propanamido]-5-oxo-octahydropyrrolo[2,1-b][1,3]thiazepine-7-amido]-2,3-dihydro-1H-indene-2-carbonyl]piperazine -1-carbonyl}-2,3-dihydro-1H-inden-1-yl]-8,8-dimethyl-4-[(2S)-2-(methylamino)propanamido]-5-oxo-octahydropyrrolo[2, 1-b][1,3]thiazepine-7-carboxamide

LCMS (electrospray, m/z): 1055.3 [M+H] ⁺ , retention time 1.185 min.

¹ H-NMR (400 MHz, DMSO-d ₆ ): δ ppm 9.66-9.32 (m, 2H), 9.06-8.71 (m, 4H), 7.98-7.85 (m, 1H), 7.67 (d, J=9.5 Hz, 1H), 7.38-7.11 (m, 8H), 5.78-5.59 (m, 2H), 5.55-5.40 (m, 2H), 4.72-4.58 (m, 2H), 4.09-3.80 (m, 6H), 3.77-3.47 (m, 10H), 3.46-3.32 (m, 4H), 3.29-3.12 (m, 2H), 3.02-2.77 (m, 4H), 2.50-2.43 (m, 6H), 2.28-2.09 (m , 4H), 1.46-1.37 (m, 6H), 1.07-0.83 (m, 12H).

Example 47

(4S,7S,9aS)-N-[(1R,2R)-2-{4-[(1R,2R)-1-[(4S,7S,9aS)-8,8-dimethyl-4-[( 2S)-2-(methylamino)propanethioamido]-5-oxo-octahydropyrrolo[2,1-b][1,3]thiazepine-7-amido]-2,3-dihydro-1H-indene-2-carbonyl]piperazine -1-carbonyl}-2,3-Dihydro-1H-inden-1-yl]-8,8-dimethyl-4-[(2S)-2-(methylamino)propanethioamido]-5-oxo-octahydropyrrolo[2, 1-b][1,3]thiazepine-7-carboxamide

LCMS (electrospray, m/z): 1086.6 [M+H] ⁺ , retention time 1.337 min.

¹ H-NMR (400 MHz, DMSO-d ₆ ): δ ppm 11.37-10.79 (m, 2H), 9.95-9.38 (m, 2H), 8.80-8.22 (m, 2H), 7.97 (dd, J=28.6, 9.8 Hz, 1H), 7.72 (d, J=9.4 Hz, 1H), 7.38-7.09(m, 8H), 5.79-5.59 (m, 2H), 5.44 (dd, J=16.3, 8.2 Hz, 2H), 5.22-4.91 (m, 2H), 4.71-4.31 (m, 2H), 4.15-3.79 (m, 4H), 3.80-3.38 (m, 10H), 3.33-3.12 (m, 4H), 3.04-2.83 (m , 4H), 2.51-2.49 (m, 6H), 2.37-2.00 (m, 6H), 1.48-1.38 (m, 6H), 1.01 (d, J=9.6 Hz, 12H).

Example 48

(4S,7S,9aS)-N-[(1S,2R)-2-[(8-{[(1S,2R)-1-[(4S,7S,9aS)-8,8-dimethyl-4- [(2S)-2-(methylamino)propanamido]-5-oxo-octahydropyrrolo[2,1-b][1,3]thiazepin-7-amido]-2,3-dihydro-1H-inden-2-yl |oxy}octyl)oxy]-2,3-dihydro-1H-inden-1-yl]-8,8-dimethyl-4-[(2S)-2-(methylamino)propanamido]-5-oxo-octahydropyrrolo[ 2,1-b][1,3]thiazepine-7-carboxamide

LCMS (electrospray, m/z): 1059.7 [M+H] ⁺ , retention time 1.348 min.

¹ H-NMR (400 MHz, DMSO-d ₆ ) d ppm δ 9.50 (s, 2H), 8.93 (s, 2H), 8.87 (d, J=6.6 Hz, 2H), 7.91 (d, J=8.7 Hz , 2H), 7.27-7.19 (m, 8H), 5.51 (t, J=7.9 Hz, 2H), 5.33 (dd, J=8.6, 5.4 Hz, 2H), 4.78-4.70 (m, 2H), 4.24 ( s, 2H), 4.11 (dd, J=9.3, 4.1 Hz, 2H), 3.89 (dd, J=10.5, 6.1 Hz, 2H), 3.44-3.38 (m, 4H), 3.20 (t, J=11.8 Hz , 2H), 2.98 (d, J=3.7 Hz, 4H), 2.95-2.85 (m, 2H), 2.47 (s, 6H), 2.27-2.11 (m, 4H), 1.89-1.76 (m, 4H), 1.47-1.36 (m, 10H), 1.24-1.17 (m, 8H), 1.08 (s, 6H), 1.06 (s, 6H).

Example 49

(4S,7S,9aS)-N-[(1R,2R)-2-[(6-{[(1R,2R)-1-[(4S,7S,9aS)-8,8-dimethyl-4- [(2S)-2-(methylamino)propanamido]-5-oxo-octahydropyrrolo[2,1-b][1,3]thiazepin-7-amido]-2,3-dihydro-1H-inden-2-yl ]formamido}hexa-2,4-diin-1-yl)carbamoyl1-2,3-dihydro-1H-inden-1-yl]-8,8-dimethyl-4-[(2S)-2-(methylamino) propanamido]-5-oxo-octahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide

LCMS (electrospray, m/z): 1105.7 [M+H] ⁺ , retention time 1.370 min.

¹ H-NMR (400 MHz, DMSO-d ₆ ) d ppm δ 9.05 (s, 2H), 8.77 (d, J=7.0 Hz, 4H), 8.45 (s, 2H), 7.87 (d, J=9.3 Hz, 2H), 7.29 (d, J=8.2 Hz, 2H), 7.17-7.05 (m, 6H), 5.46 (t, J=8.0 Hz, 2H), 5.37 (dd, J=9.1, 5.4 Hz, 2H), 4.72-4.63 (m, 2H), 4.12-4.01 (m, 4H), 3.89 (dd, J=12.1, 6.5 Hz, 2H), 3.82 (d, J=4.3 Hz, 1H), 3.77 (d, J= 4.8 Hz, 1H), 3.65 (s, 1H), 3.57 (s, 1H), 3.21-3.11 (m, 2H), 2.96-2.88 (m, 2H), 2.87-2.80 (m, 2H), 2.78-2.64 (m, 4H), 2.18 (dd, J=12.9, 7.3 Hz, 2H), 2.12-1.90 (m, 8H), 1.77-1.67 (m, 2H), 1.37(d, J=6.8 Hz, 6H), 1.24 (s, 4H), 0.99 (d, J=13.7 Hz, 12H).

Example 50

(4S,7S,9aS)-N-[(1S)-2-[2-(4-{[(2S)-2-{[(4S,7S,9aS)-8,8-dimethyl-4-[ (2S)-2-(methylamino)propanamido]-5-oxo-octahydropyrrolo[2,1-b][1,3]thiazepin-7-yl]formamido}-2-phenylethoxy]methyl}-1H-1,2 ,3-triazol-1-yl)ethoxy]-1-phenylethyl]-8,8-dimethyl-4-[(2S)-2-(methylamino)propanamido]-5-oxo-octahydropyrrolo[2,1-b] [1,3]thiazepine-7-carboxamide

LCMS (electrospray, m/z): 1032.7 [M+H] ⁺ , retention time 1.224 min.

¹ H-NMR (400 MHz, DMSO-d ₆ ) d ppm δ 9.74-9.45 (m, 2H), 8.92 (d, J=5.8 Hz, 2H), 8.85 (d, J=7.0 Hz, 2H), 8.39 ( d, J=8.0 Hz, 2H), 7.79(s, 1H), 7.42-7.15 (m, 10H), 5.46 (t, J=7.5 Hz, 2H), 5.01 (td, J=14.0, 6.5 Hz, 2H ), 4.73-4.65 (m, 2H), 4.49-4.45 (m, 4H), 4.17 (d, J=3.4 Hz, 2H), 3.92-3.81 (m, 2H), 3.87 (t, J=4.7 Hz, 2H), 3.63-3.50 (m, 4H), 3.23-3.06 (m, 2H), 2.95-2.80 (m, 2H), 2.45 (t, J=5.0 Hz, 6H), 2.26-2.03 (m, 4H) , 1.92-1.66 (m, 4H), 1.39 (d, J=6.8T4, 6H), 1.04 (s, 6H), 0.96 (s, 6H).

Example 51

(4S,7S,9aS)-N-[(1S,2R)-2-[3-(3-{[(1S,2R)-1-[(4S,7S,9aS)-8,8-dimethyl- 4-[(2S)-2-(methylamino)propanamido]-5-oxo-octahydropyrrolo[2,1-b][1,3)thiazepine-7-amido]-2,3-dihydro-1H-indene-2 -yl]oxy}propoxy)propoxy]-2,3-dihydro-1H-inden-1-yl]-8,8-dimethyl-4-[(2S)-2-(methylamino)propanamido)-5-oxo- Octahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide

LCMS (electrospray, m/z): 1047.7 [M+H] ⁺ , retention time 1.147 min.

¹ H-NMR (400 MHz, DMSO-d ₆ ) d ppm δ 9.47 (s, 2H), 8.99-8.81 (m, 4H), 7.91 (d, J=8.7 Hz, 2H), 7.28-7.18 (m, 8H), 5.51 (t, J=7.9 Hz, 2H), 5.34 (dd, J=8.6, 5.4 Hz, 2H), 4.74 (dd, J=9.9, 7.7 Hz, 2H), 4.24 (s, 2H), 4.12 (dd, J=9.1, 4.0 Hz, 2H), 3.89 (dd, J=11.1, 6.4 Hz, 2H), 3.52-3.39 (m, 6H), 3.32-3.30 (m, 2H), 3.25-3.15 ( m, 2H), 2.98 (d, J=3.5 Hz, 4H), 2.95-2.87 (m, 2H), 2.47 (s, 6H), 2.30-2.10 (m, 4H), 1.88-1.75 (m, 4H) , 1.73-1.58 (m, 4H), 1.41 (d, J=6.9 Hz, 6H), 1.07 (d, J=9.5 Hz, 12H).

Example 52

(4S,7S,9aS)-N-[(1S)-2-[2-(4-{[(2S)-2-{[(4S,7S,9aS)-8,8-dimethyl-4-[ (2S)-2-(methylamino)propanethioamido)-5-oxo-octahydropyrrolo[2,1-b][1,3]thiazepin-7-yl]formamido}-2-phenylethoxy]methyl}-1H-1,2 ,3-triazol-1-yl)ethoxy1-1-phenylethyl]-8,8-dimethyl-4-[(2S)-2-(methylamino)propanethioamido]-5-oxo-octahydropyrrolo[2,1-b][ 1,3]thiazepine-7-carboxamide

LCMS (electrospray, m/z): 1064.6 [M+H] ⁺ , retention time 1.267 min.

¹ H-NMR (400 MHz, DMSO-d ₆ ) d ppm δ 11.02-10.87 (m, 2H), 9.65 (d, J=70.2 Hz, 2H), 8.62 (s, 1H), 8.43 (t, J= 7.0 Hz, 3H), 7.78 (s, 1H), 7.37-7.23 (m, 10H), 5.42 (q, J=7.6 Hz, 2H), 5.17-5.07 (m, 2H), 5.07-4.95 (m, 2H ), 4.53-4.42 (m, 4H), 4.30-4.16 (m, 4H), 3.61-3.54 (m, 4H), 3.21-3.09 (m, 2H), 2.99-2.88 (m, 2H), 2.49-2.44 (m, 6H), 2.29-2.14 (m, 4H), 1.95-1.77 (m, 4H), 1.43 (d, J=6.3 Hz, 6H), 1.24 (s, 2H), 1.07 (s, 6H), 0.98 (s, 6H).

Example 53

(4S,7S,9aS)-N-[(1S)-2-[3-(4-{[(2S)-2-{[(4S,7S,9aS)-8,8-dmethyl-4-[ (2S)-2-(methylamino)propanethioamido]-5-oxo-octahydropyrrolo[2,1-b][1,3]thiazepin-7-yl]formamndo}-2-phenylethoxy]methyl}-1H-1,2 ,3-triazol-1-yl)propoxy)-1-phenylethyl]-8,8-dimethyl-4-[(2S)-2-(methylamino)propanethioamido]-5-oxo-octahydropyrrolo[2,1-b] [1,3]thiazepine-7-carboxamide

LCMS (electrospray, m/z): 1079.7 [M+H] ⁺ , retention time 1.148 min.

¹ H-NMR (400 MHz, DMSO-d ₆ ): d ppm δ 10.99 (d, J=3.8 Hz, 1H), 10.90 (d, J=6.0 Hz, 1H), 9.75 (s, 1H), 9.57 ( s, 1H), 8.63 (s, 1H), 8.51-8.31 (m, 3H), 7.88 (s, 1H), 7.40-7.23 (m, 10H), 5.49-5.35 (m, 2H).5.13 (dd, J=16.0, 9.1 Hz, 2H), 5.07-4.98 (m, 2H), 4.50 (s, 2H), 4.36-4.15 (m, 6H), 3.61-3.55 (m, 4H), 3.39-3.28 (m, 2H), 3.21-3.10 (m, 2H), 3.01-2.88 (m, 2H), 2.49-2.40 (m, 6H), 2.30-2.14 (m, 4H), 2.02-1.81 (m, 6H), 1.43 ( d, J=6.4 Hz, 6H), 1.11-1.04 (m, 6H), 1.03 (s, 3H), 0.96 (s, 3H).

Example 54

(4S,7S,9aS)-8,8-dimethyl-4-[(2S)-2-(methylamino)propanethioamido]-5-oxo-N-[(1R,2R)-2-{[(1rs,4rs )-4-[(1R,2R)-1-[(4S,7S,9aS)-8,8-dimethyl-4-[(2S)-2-(methylamino)propanethioamido]-5-oxo-octahydropyrrolo[2 ,1-b][1,3]thiazepine-7-amido]-2,3-dihydro-1H-inden-2-amido]cyclohexyl]carbamoyl}-2,3-dihydro-1H-inden-1-yl] -octahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide

LCMS (electrospray, m/z): 1115.6 [M+H] ⁺ , retention time 1.136 min.

¹ H-NMR (400 MHz, DMSO-d ₆ ): d ppm δ 11.00-10.80 (m, 2H), 9.56 (s, 1H), 9.41 (s, 1H), 8.64 (s, 1H), 8.46 (s , 1H), 8.00-7.82 (m, 4H), 7.45-7.12 (m, 8H), 5.60 (t, J=16.0 Hz, 2H), 5.50-5.37 (m, 2H), 5.17-5.07 (m, 2H ), 4.41-4.26 (m, 2H), 4.14(d, J=8.0 Hz, 2H), 3.75-3.65 (m, 2H), 3.35-3.27 (m, 2H), 3.25-3.07 (m, 4H), 3.05-2.91 (m, 4H), 2.50 (s, 6H), 2.30-2.02 (m, 6H), 1.85-1.67 (m, 6H), 1.44 (d, J=4.0 Hz, 6H), 1.25-1.10 ( m, 4H), 1.03 (d, J=8.0 Hz, 12H).

Example 55

(4S,7S,9aS)-8,8-dimethyl-4-[(2S)-2-(methylamino)propanamido]-5-oxo-N-[(1R,2R)-2-{[(1rs,4rs )-4-[(1R,2R)-1-[(4S,7S,9aS)-8,8-dimethyl-4-[(2S)-2-(methylamino)propanamido]-5-oxo-octahydropyrrolo[2 ,1-b][1,3]thiazepin-7-amido]-2,3-dihydro-1H-inden-2-amido]cyclohexyl1carbamoyl}-2,3-dihydro-1H-inden-1-yl]-octahydropyrrolo [2,1-b][1,3]thiazepine-7-carboxamide

LCMS (electrospray, m/z): 1083.7 [M+H] ⁺ , retention time 1.091 min.

¹ H-NMR (400 MHz, DMSO-d ₆ ): d ppm δ 9.17 (s, 2H), 8.92 (s, 2H), 8.75 (d, J=4.0 Hz, 2H), 7.90 (s, 2H), 7.84 (d, J=8.0 Hz, 2H), 7.30-7.05 (m, 8H), 5.60 (t, J=16.0 Hz, 2H), 5.48 (t, J=16.0 Hz, 2H), 4.75-4.60(m , 2H), 4.11 (s, 2H), 3.98-3.85 (m, 2H), 3.38-3.28 (m, 2H), 3.24-3.10 (m, 4H), 3.07-2.97 (m, 2H), 2.95-2.85 (m, 2H), 2.50-2.43 (m, 6H), 2.25-2.00 (m, 6H), 1.87-1.73 (m, 4H), 1.73-1.62 (m, 2H), 1.40 (d, J=8.0 Hz , 6H), 1.25-1.17 (m, 2H), 1.17-1.10 (m, 2H), 1.02 (s, 12H).

Example 56

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-((naphthalene-2,7-diylbis(methylene))bis(oxy))bis(1-phenylethane- 2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide )

Synthesis of 2,7-bis(bromomethyl)naphthalene

2,2'-azobis-(2-methylpropanenitrile) was added to a solution of 2,7-dimethylnaphthalene (1 g, 6.40 mmol) and 1-bromopyrrolidine-2,5-dione (2.5 g, 14.08 mmol) in perchloromethane (40 ml). (105 mg, 0.64 mmol). The mixture was stirred at 80°C overnight. The insoluble solid was removed by filtration through a pad of celite. The filtrate was washed with saturated sodium bicarbonate solution (20 ml), dried using anhydrous sodium sulfate, filtered and concentrated to give the crude product. It was purified by silica gel column chromatography (petroleum ether/ethyl acetate = 100:1) to provide 2,7-bis(bromomethyl)naphthalene (600 mg, 1.91 mmol, 29.9% yield) as a white solid.

Synthesis of (1S,1'S)-2,2'-((naphthalene-2,7-diylbis(methylene))bis(oxy))bis(1-phenylethan-1-amine)

To a solution of (S)-2-amino-2-phenylethan-1-ol (585 mg, 3.92 mmol) in tetrahydrofuran (20 ml) at 0°C was added sodium hydride (60%, dispersion in liquid paraffin) (171 g) in portions , 4.27 mmol). The mixture was warmed to room temperature naturally. Then 2,7-bis(bromomethyl)naphthalene (560 mg, 1.78 mmol) was added and the resulting mixture was heated to 70°C. It was stirred at 70°C overnight. The reaction mixture was quenched with ice water (30 ml) and extracted with ethyl acetate (3×20 ml). The organic layers were combined, washed with brine (20 ml), dried using anhydrous sodium sulfate, filtered and concentrated to obtain the crude product. It was purified by silica gel column chromatography (dichloromethane/methanol = 15:1) to give (1S, 1'S)-2,2'-((naphthalene-2,7-diylbis(methylene))bis(oxy))bis (1-phenylethan-1-amine) (200 mg, 0.469 mmol, 26.3% yield) as black oil.

LCMS (electrospray, m/z): 426.8 [M+H] ⁺ , retention time 1.047 min.

Synthesis of tert-butyl((S)-1-(((4S,7R,9aS)-7-(((S)-2-((7-(((S)-2-((4S,7S,9aS )-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7- carboxamido)-2-phenylethoxy)methyl)naphthalene-2-yl)methoxy)-1-phenylethyl)carbamoyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-4- yl)amino)-1-oxopropan-2-yl)(methyl)carbamate

To a solution of (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][ 1,3]thiazepine-7-carboxylic acid (499 mg, 1.13 mmol), ethyl 2-ethoxyquinolinyl-1(2H)-carboxylate (325 mg, 1.31 mmol) and N,N-diisopropylethylamine (243 mg, 1.88 mmol) (1S,1'S)-2,2'-((naphthalene-2,7-diylbis(methylene))bis(oxy))bis(1-phenylethan-1-amine) was added to 1,2-dichloroethane (10 ml) (200 mg, 0.47 mmol). The mixture was stirred at 50°C overnight. The reaction mixture was concentrated to obtain the crude product. It was purified by silica gel column chromatography (petroleum ether/ethyl acetate = 1:4) to give the crude product. The crude product was then purified by preparative HPLC to give the product (110 mg, 0.086 mmol, 18.3% yield) as a white solid.

LCMS (electrospray, m/z): 539.3 [M/2-Boc+H] ⁺ , retention time 1.770 min.

Synthesis of (4S,4,S,7S,7'S,9aS,9a'S)-N,N'-((1S,1,S)-((naphthalene-2,7-diylbis(methylene))bis(oxy))bis (1-phenylethane-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3] thiazepine-7-carboxamide)

To a solution of tert-butyl ((S)-1-(((4S,7R,9aS)-7-(((S)-2-((7-(((S)-2-((4S,7S, 9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7 -carboxamido)-2-phenylethoxy)methyl)naphthalene-2-yl)methoxy)-1-phenylethyl)carbamoyl)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-4 -yl)amino)-1-oxopropan-2-yl)(methyl)carbamate (110 mg, 0.086 mmol) in dichloromethane (5 ml) was added 4 N. hydrochloric acid in dioxane (0.5 ml). The mixture was stirred at room temperature overnight. The reaction mixture was concentrated to give the title product (90 mg, 0.078 mmol, 90.9% yield) as a white solid. This compound was then lyophilized to remove residual solvent.

LCMS (electrospray, m/z): 1077.4 [M+H] ⁺ , retention time 1.253 min.

¹ H-NMR (400 MHz, DMSO-di) δ ppm 9.48 (s, 2H), 9.01 - 8.77 (m, 4H), 8.47 (d, J = 8.1 Hz, 2H), 7.85 (d, J = 8.4 Hz , 2H), 7.68 (s, 2H), 7.45 - 7.33 (m, 10H), 7.31 - 7.25 (m, 2H), 5.46 (t, J = 7.9 Hz, 2H), 5.14 (dd, J = 13.1, 6.6 Hz, 2H), 4.74 - 4.59 (m, 6H), 4.20 (s, 2H), 3.85 (s, 2H), 3.72 - 3.60 (m, 4H), 3.13 (t, J = 12.3 Hz, 2H), 2.84 - 2.73 (m, 2H), 2.45 (s, 6H), 2.18 (dd, J = 12.6, 7.0 Hz, 2H), 2.11 - 2.02 (m, 2H), 1.87 (dd, J = 12.5, 9.0 Hz, 2H ), 1.73 (dd, J = 22.6, 11.5 Hz, 2H), 1.40 (d, J = 6.9 Hz, 6H), 1.05 (s, 6H), 0.99 (s, 6H).

Example 57

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-(decane-1,10-diylbis(oxy))bis(2,3- dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3 ]thiazepine-7-carboxamide)dihydrochloride

Synthesis of (1S,1'S,2R,2'R)-2,2'-(decane-1,10-diylbis(oxy))bis(2,3-dihydro-1H-inden-1-amine)

Sodium hydride (60%, dispersion in liquid paraffin) (293 mg, 7.32 mmol). The mixture was warmed to room temperature naturally. Then 1,10-dibromodecane (1.0 g, 3.05 mmol) was added. The resulting mixture was stirred at 70°C overnight. The reaction mixture was quenched with ice water (30 ml) and extracted with ethyl acetate (3 x 30 ml). The organic layer was combined, washed with brine (50 ml), dried using anhydrous sodium sulfate, filtered and concentrated to obtain the crude product. It was purified by Combi-Flash chromatography using dichloromethane/methanol = 20:1 for elution and thin-wall chromatography using ethyl acetate/petroleum ether = 3/1 for development, resulting in the desired product (100 mg, 0.23 mmol, 7.5% output) in the form of dark oil.

LCMS (electrospray, m/z): 437.0 [M+H] ⁺ , retention time 1.117 min.

Synthesis of di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-(decane-1,10 -diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azanediyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1 -b][1,3]thiazepine-7,4-diyl))bis(azanediyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate)

Mixture of (1S,1'S,2R,2'R)-2,2'-(decane-1,10-diylbis(oxy))bis(2,3-dihydro-1H-inden-1-amine) (100 mg, 0.229 mmol) and (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b ][1,3]thiazepine-7-carboxylic acid (220 mg, 0.505 mmol) in 1,2-dichloroethane (8 ml) was added N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl (170 mg, 0.687 mmol) and N,N-diisopropylethylamine (118 mg, 0.916 mmol). The resulting mixture was stirred at 50°C overnight. The reaction mixture was concentrated to obtain the crude product. It was purified by thin layer chromatography using ethyl acetate/petroleum ether = 2/1 for development to give the crude product. The crude product was then purified by preparative HPLC to give the product (100 mg, 0.077 mmol, 33.9% yield) as a beige solid.

LCMS (electrospray, m/z): 543.6 [M/2-Boc+H] ⁺ , retention time 2.072 min.

Synthesis of (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-(decane-1,10-diylbis(oxy))bis(2,3 -dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo|2,1-b][1, 3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-(decane-1, 10-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azanediyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2, 1-b][1,3]thiazepine-7,4-diyl))bis(azanediyl))bis(1-oxopropane-1,2-diyl))bis(methylcarbamate) (100 mg, 0.078 mmol) in dichloromethane ( 5 ml) added 4 N. hydrochloric acid in dioxane (0.7 ml). The mixture was stirred at room temperature overnight. The reaction mixture was concentrated to give the title product (62 mg, 0.053 mmol, 67.9% yield) as a white solid.

LCMS (electrospray, m/z): 1087.8 [M-2HCl+H] ⁺ (Calc. M-2HCl+H=1087.6), retention time 1.254 min.

¹ H-NMR (400 MHz, DMSO) δ ppm 9.43 (s, 2H), 8.99 - 8.76 (m, 4H), 7.90 (d, J = 8.7 Hz, 2H), 7.34 - 7.09 (m, 8H), 5.51 (t, J = 7.7 Hz, 2H), 5.34 (dd, J = 8.3, 5.5 Hz, 2H), 4.82 - 4.67 (m, 2H), 4.24 (s, 2H), 4.12 (dd, J = 8.4, 3.7 Hz, 2H), 3.89 (dd, J = 11.0, 6.0 Hz, 2H), 3.42 - 3.36 (m, 4H), 3.20 (t, J = 12.1 Hz, 2H), 2.98 (d, J = 3.2 Hz, 4H ), 2.95 - 2.86 (m, 2H), 2.50 - 2.44 (m, 6H), 2.29 - 2.09 (m, 4H), 1.90 - 1.74 (m, 4H), 1.54 - 1.35 (m, 10H), 1.28 - 1.15 (m, 12H), 1.09 (s, 6H), 1.06 (s, 6H).

Example 58

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-(1S,1'S)-(octane-1,8-diylbis(oxy))bis(1-phenylethane-2,1-diyl)) bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

Synthesis of (1S,1'S)-2,2'-(octane-1,8-diylbis(oxy))bis(1-phenylethan-1-amine)

To a solution of (S)-2-amino-2-phenylethan-1-ol (1 g, 7.29 mmol) in tetrahydrofuran (60 ml) at 0°C was added sodium hydride (60%, dispersion in liquid paraffin) (318 mg) in portions , 7.94 mmol). The mixture was warmed to room temperature naturally. Then 1,8-dibromooctane (901 mg, 3.31 mmol) was added. The resulting mixture was stirred at 70°C overnight. The reaction mixture was quenched with ice water (30 ml) and extracted with ethyl acetate (3 x 30 ml). The organic layer was combined, washed with brine (50 ml), dried using anhydrous sodium sulfate, filtered and concentrated to obtain the crude product. It was purified on a Combi-Flash column eluting with dichloromethane/methanol = 25:1 and then thin layer chromatography using ethyl acetate/petroleum ether = 3/1 for development to give the desired product (400 mg, 1.04 mmol, 31.4 % yield) as a yellow oil.

LCMS (electrospray, m/z): 385.0 [M+H] ⁺ , retention time 1.037 min.

Synthesis of di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,16S)-3,16-diphenyl-5,14-dioxa-2, 17-diazaoctadecanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azanediyl))bis(1-oxopropane-1,2 -diyl))bis(methylcarbamate)

Mixture of (1S,1'S)-2,2'-(octane-1,8-diylbis(oxy))bis(1-phenylethan-1-amine) (100 mg, 0.26 mmol) and (4S,7S,9aS)- 4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxylic acid (252 mg, 0.57 mmol) in 1,2-dichloroethane (10 ml) was added to N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl (193 mg, 0.78 mmol) and N,N-iisopropylethylamine (134 mg, 1.04 mmol). The resulting mixture was stirred at 50°C overnight. The reaction mixture was concentrated to obtain the crude product. It was purified by thin layer chromatography using ethyl acetate/petroleum ether = 3/1 for development to give the crude product. The crude product was then purified by preparative HPLC to give the product (100 mg, 0.081 mmol, 31.2% yield) as a white solid.

LCMS (electrospray, m/z): 517.8 [1/2M-Boc+H] ⁺ , retention time 1.859 min.

Synthesis of (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(octane-1,8-diylbis(oxy))bis(1-phenylethane-2,1-diyl ))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide)dihydrochloride

To a solution of di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,16S)-3,16-diphenyl-5,14-dioxa-2 ,17-diazaoctadecanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azanediyl))bis(1-oxopropane-1, 2-diyl))bis(methylcarbamate) (100 mg, 0.081 mmol) in dichloromethane (5 ml) was added 4 N. hydrochloric acid in dioxane (0.7 ml). The mixture was stirred at room temperature overnight. The reaction mixture was concentrated to give the title product (60 mg, 0.054 mmol, 66.7% yield) as a white solid.

LCMS (electrospray, m/z): 1035.7 [M-2HCl+H] ⁺ (Calc. M-2HCl+H=1035.6), retention time 1.211 min.

¹ H-NMR (400 MHz, DMSO) δ ppm 9.45 (s, 2H), 8.89 (d, J = 6.1 Hz, 2H), 8.82 (d, J = 7.0 Hz, 2H), 8.37 (d, J = 8.1 Hz, 2H), 7.40 - 7.30 (m, 8H), 7.28 - 7.21 (m, 2H), 5.46 (t, J = 7.8 Hz, 2H), 5.00 (dd, J = 13.4, 6.6 Hz, 2H), 4.75 - 4.65 (m, 2H), 4.17 (s, 2H), 3.85 (d, J = 5.6 Hz, 2H), 3.55 - 3.47 (m, 4H), 3.39 - 3.33 (m, 4H), 3.16 (t, J = 12.0 Hz, 2H), 2.94 - 2.82 (m, 2H), 2.45 (s, 6H), 2.19 (dd, J = 12.6, 7.0 Hz, 2H), 2.14 - 2.06 (m, 2H), 1.87 (dd, J = 12.4, 8.8 Hz, 2H), 1.75 (dd, J = 22.3, 11.4 Hz, 2H), 1.47 - 1.35 (m, 10H), 1.24 - 1.16 (m, 8H), 1.06 (s, 6H), 1.01 (s, 6H).

Example 59

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-(dodecane-1,12-diylbis(oxy))bis(2,3- dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3 ]thiazepine-7-carboxamide)dihydrochloride

Synthesis of (1S,1'S,2R,2'R)-2,2'-(dodecane-1,12-diylbis(oxy))bis(2,3-dihydro-1H-inden-1-amine)

Sodium hydride (60%, dispersion in liquid paraffin) (249 mg, 6.22 mmol). The mixture was warmed to room temperature naturally. Then 1,12-dibromododecane (0.85 g, 2.59 mmol) was added. The resulting mixture was stirred at 70°C overnight. The reaction mixture was quenched with ice water (30 ml) and extracted with ethyl acetate (3 x 30 ml). The organic layer was combined, washed with brine (50 ml), dried using anhydrous sodium sulfate, filtered and concentrated to obtain the crude product. It was purified by thin layer chromatography using ethyl acetate/petroleum ether = 3/1 developing to give the desired product (160 mg, 0.34 mmol, 13.3% yield) as a dark oil.

LCMS (electrospray, t/g): 465.0 [M+H] ⁺ , retention time 1.149 min.

Synthesis of di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-(dodecane-1,12 -diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azanediyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo(2,1 -b][1,3)thiazepine-7,4-diyl))bis(azanediyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate)

Mixture of (1S,1'S,2R,2'R)-2,2'-(dodecane-1,12-diylbis(oxy))bis(2,3-dihydro-1H-inden-1-amine) (110 mg, 0.237 mmol) and (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b ][1,3]thiazepine-7-carboxylic acid (231 mg, 0.521 mmol) in 1,2-dichloroethane (8 ml) was added to N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl (176 mg, 0.711 mmol ) and N,N-diisopropylethylamine (122 mg, 0.948 mmol). The resulting mixture was stirred at 50°C overnight. The reaction mixture was concentrated to obtain the crude product. It was purified by thin layer chromatography using ethyl acetate/petroleum ether = 3/1 for development to give the crude product. The crude product was then purified by preparative HPLC to give the product (105 mg, 0.080 mmol, 33.7% yield) as a beige solid.

LCMS (electrospray, m/z): 557.9 [1/2M-Boc+H] ⁺ , retention time 2.312 min.

Synthesis of (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-(dodecane-1,12-diylbis(oxy))bis(2,3 -dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1, 3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-(dodecane-1, 12-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azanediyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2, 1-b][1,3]thiazepine-7,4-diyl))bis(azanediyl))bis(1-oxopropane-1,2-diyl))bis(methylcarbamate) (105 mg, 0.080 mmol) in dichloromethane ( 5 ml) added 4 N. hydrochloric acid in dioxane (0.7 ml). The mixture was stirred at room temperature overnight. The reaction mixture was concentrated to give the title product (65 mg, 0.055 mmol, 68.6% yield) as a white solid.

LCMS (electrospray, m/z): 558.0 [1/2M-HCl+H] ⁺ , retention time 1.448 min.

¹ H-NMR (400 MHz, DMSO) δ ppm 9.45 (s, 2H), 9.03 - 8.77 (m, 4H), 7.90 (d, J = 8.7 Hz, 2H), 7.29 - 7.14 (m, 8H), 5.51 (t, J = 7.8 Hz, 2H), 5.34 (dd, J = 8.4, 5.5 Hz, 2H), 4.78 - 4.69 (m, 2H), 4.24 (s, 2H), 4.11 (dd, J = 8.8, 4.0 Hz, 2H), 3.89 (dd, J = 12.9, 6.1 Hz, 2H), 3.47 - 3.36 (m, 4H), 3.20 (t, J = 12.5 Hz, 2H), 2.98 (d, J = 3.3 Hz, 4H ), 2.95 - 2.86 (m, 2H), 2.47 (s, 6H), 2.26 - 2.07 (m, 4H), 1.90 - 1.73 (m, 4H), 1.49 - 1.36 (m, 10H), 1.25 - 1.17 (s , 16Н), 1.08(s, 6Н), 1.06(s, 6Н).

Example 60

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(decane-1,10-diylbis(oxy))bis(1-phenylethane-2,1-diyl) )bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide)dihydrochloride

Synthesis of (1S,1'S)-2,2'-(decane-1,10-diylbis(oxy))bis(1-phenylethan-1-amine)

To a solution of (S)-2-amino-2-phenylethan-1-ol (2.1 g, 15.4 mmol) in tetrahydrofuran (40 ml) sodium hydride (0.672 g, 16.8 mmol) was added in batches at 0°C. The mixture was stirred at room temperature for 40 minutes. Then 1,10-dibromodecane (2.1 g, 7 mmol) was added and the mixture was stirred at room temperature for 10 min and heated to 50°C for 3 h. The reaction was quenched by adding water (100 ml). Then the reaction mixture was extracted with ethyl acetate (3*100 ml). The combined organic layers were washed with brine, dried using anhydrous sodium sulfate and concentrated in vacuo to give the crude product. It was purified by silica gel column chromatography (dichloromethane/methanol = 15:1) and TLC (petroleum ether/ethyl acetate = 1:3) to give (1S,1'S)-2,2'-(decane-1,10- diylbis(oxy))bis(1-phenylethan-1-amine) (0.5 g, 1.21 mmol, 7.9% yield) as a yellow oil.

LCMS (electrospray, m/z): 413.0 [M+H] ⁺ , retention time 1.073 min.

Synthesis of di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,18S)-3,18-diphenyl-5,16-dioxa-2, 19-diazaeicosanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azanediyl))bis(1-oxopropane-1,2 -diyl))bis(methylcarbamate)

To a solution of (1S,1'S)-2,2'-(decane-1,10-diylbis(oxy))bis(1-phenylethan-1-amine) (150 mg, 0.364 mmol) and (4S,7S,9aS) -4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxylic acid (355 mg, 0.800 mmol) in 1,2-dichloroethane (10 ml), 2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquinolinyl (270 mg, 1.091 mmol) and N,N-diisopropylethylamine (188 mg, 1.454 mmol). The resulting mixture was stirred at room temperature overnight. At this time, it was diluted with water (10 ml), then it was extracted with dichloromethane (3 * 20 ml). The organic layers were combined, washed with brine, dried using anhydrous sodium sulfate and concentrated to give the crude product. It was purified by preparative TLC (petroleum ether/ethyl acetate = 1:3) to give the crude product. The crude product was then purified by preparative HPLC to give di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,18S)-3,18-diphenyl-5 ,16-dioxa-2,19-diazaeicosanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azanediyl))bis( 1-oxopropane-1,2-diyl))bis(methylcarbamate) (70 mg, 0.055 mmol, 15.2% yield) as a brown solid.

LCMS (electrospray, m/z): 532.1 [1/2M-Boc+H] ⁺ , retention time 1.994 min.

Synthesis of (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(decane-1,10-diylbis(oxy))bis(1-phenylethane-2,1-diyl ))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide)dihydrochloride

To a solution of di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,18S)-3,18-diphenyl-5,16-dioxa-2 ,19-diazaeicosanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azanediyl))bis(1-oxopropane-1, 2-diyl))bis(methylcarbamate) (70 mg, 0.055 mmol) in dichloromethane (5 ml) was added 4 M hydrochloric acid (0.7 ml) in dioxane. The resulting mixture was stirred for 4 hours at room temperature. It was then concentrated to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(decane-1,10-diylbis(oxy))bis(1-phenylethane- 2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide )dihydrochloride (60 mg, 0.053 mmol, 96.0% yield) in the form of a light yellow solid.

LCMS (electrospray, m/z): 1062.8 [M-2HCl+H] ⁺ (Calc. M-2HCl+H=1063.6), retention time 1.213 min.

¹ H-NMR (400 MHz, DMSO-d6): δ ppm 9.42 (s, 2H), 8.99 - 8.77 (m, 4H), 8.38 (d, J = 8.0 Hz, 2H), 7.43 - 7.21 (m, 10H ), 5.56 - 5.42 (t, 2H), 5.05 - 4.98 (t, 2H), 4.79 - 4.65 (t, 2H), 4.19 (s, 2H), 3.87 (s, 2H), 3.57 - 3.46 (t, 4H ), 3.42 - 3.35 (m, 4H), 3.23 - 3.11 (t, 2H), 2.90 (d, J = 12.0 Hz, 2H), 2.47 (m, 6H), 2.26 - 2.17 (m, 2H), 2.16 - 2.07 (m, 2H), 1.93 - 1.83 (dd, J = 12.0, 8.0 Hz, 2H), 1.83 - 1.70 (m, 2H), 1.50 - 1.35 (m, 10H), 1.21 (d, J = 16.0 Hz, 12H), 1.06 (d, J = 20.0 Hz, 12H).

Example 61

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(dodecane-1,12-diylbis(oxy))bis(1-phenylethane-2,1-diyl) )bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide)dihydrochloride

Synthesis of (1S,1'S)-2,2'-(dodecane-1,12-diylbis(oxy))bis(1-phenylethan-1-amine)

To a solution of (S)-2-amino-2-phenylethan-1-ol (0.920 g, 6.71 mmol) in tetrahydrofuran (50 ml) sodium hydride (0.293 g, 7.31 mmol) was added in batches at 0°C. The mixture was stirred at room temperature for 40 minutes. Then 1,12-dibromododecane (1 g, 3.05 mmol) was added and the mixture was stirred at room temperature for 10 min and heated to 50°C for 3 h. The reaction was then quenched by adding water (50 ml). Then the reaction mixture was extracted with ethyl acetate (3*50 ml). The combined organic layers were washed with brine, dried using anhydrous sodium sulfate and concentrated in vacuo to give the crude product. It was purified by silica gel column chromatography (dichloromethane/methanol = 15:1) and preparative TLC (petroleum ether/ethyl acetate = 1:3) to give (1S,1'S)-2,2'-(dodecane-1,12 -diylbis(oxy))bis(1-phenylethan-1-amine) (70 mg, 0.159 mmol, 5.2% yield) as a brown oil.

LCMS (electrospray, m/z): 441.0 [M+H] ⁺ , retention time 1.162 min.

Synthesis of di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,20S)-3,20-diphenyl-5,18-dioxa-2, 21-diazadocosanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azanediyl))bis(1-oxopropane-1,2 -diyl))bis(methylcarbamate)

To a solution of (1S,1'S)-2,2'-(dodecane-1,12-diylbis(oxy))bis(1-phenylethan-1-amine) (70 mg, 0.159 mmol) and (4S,7S,9aS) -4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxylic acid (211.4 mg, 0.477 mmol) in 1,2-dichloroethane (5 ml), 2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquinolinyl (157 mg, 0.635 mmol) and N,N-diisopropylethylamine (123 mg, 0.953) were added mmol). The resulting mixture was stirred at 50°C overnight. After this, it was diluted with water (10 ml), then it was extracted with dichloromethane (3 * 20 ml). The organic layers were combined, washed with brine, dried using anhydrous sodium sulfate and concentrated to give the crude product. It was purified by preparative TLC (petroleum ether/ethyl acetate = 1:3) to give the crude product. The crude product was then purified by preparative HPLC to give di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,20S)-3,20-diphenyl-5 ,18-dioxa-2,21-diazadocosanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azanediyl))bis( 1-oxopropane-1,2-diyl))bis(methylcarbamate) (20 mg, 0.016 mmol, 9.7% yield) as a brown solid.

LCMS (electrospray, m/z): 546.1 [1/2M-Boc+H] ⁺ , retention time 2.192 min.

Synthesis of (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-{dodecane-1,12-diylbis(oxy))bis(1-phenylethane-2,1-diyl ))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((3S,20S)-3,20-diphenyl-5,18-dioxa-2 ,21-diazadocosanedioyl)bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7,4-diyl))bis(azanediyl))bis(1-oxopropane-1, 2-diyl))bis(methylcarbamate) (20 mg, 0.016 mmol) in dichloromethane (5 ml) was added 4 M hydrochloric acid (0.5 ml) in dioxane. The resulting mixture was stirred for 4 hours at room temperature. This was then concentrated to give (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-(dodecane-1,12-diylbis(oxy))bis(1-phenylethane-2 ,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide) dihydrochloride (11 mg, 0.009 mmol, 60.9% yield) in the form of a white solid.

LCMS (electrospray, m/z): 546.1 [M/2-HCl+H] ⁺ (Calc. M/2-HCl+H=546.3), retention time 1.397 min.

¹ H-NMR (400 MHz, MeOD-d6): δ ppm 8.36 (d, J = 8.0 Hz, 2H), 7.39 (d, J = 8.0 Hz, 4H), 7.34 - 7.27 (t, 4H), 7.27 - 7.21 (t, 2H), 5.51 - 5.43 (t, 2H), 5.12 - 5.05 (dd, J = 4.0, 4.0 Hz, 2H), 4.75 (d, J = 8.0 Hz, 2H), 4.22 (s, 2H) , 3.89 (d, J = 8.0 Hz, 2H), 3.66 - 3.59 (m, 4H), 3.50 - 3.43 (m, 2H), 3.40 - 3.33 (m, 2H), 2.96 - 2.87 (m, 2H), 2.67 (d, J = 4.0 Hz, 6H), 2.38 - 2.29 (m, 2H), 2.29 - 2.20 (d, J = 16.0 Hz, 2H), 2.06 - 1.99 (d, J = 12.0 Hz, 2H), 1.99 - 1.91 (m, 2H), 1.57 - 1.46 (m, 10H), 1.26 (s, 18H), 1.15 (s, 6H), 1.04 (s, 6H).

Example 62

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S)-((naphthalene-2,6-diylbis(methylene))bis(oxy))bis(1-phenylethane- 2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7-carboxamide )

Synthesis of (1S,1'S)-2,2'-((naphthalene-2,6-diylbis(methylene))bis(oxy))bis(1-phenylethan-1-amine)

To a solution of (S)-2-amino-2-phenylethan-1-ol (480 mg, 3.5 mmol) in tetrahydrofuran (20 ml) at 0°C was added sodium hydride (60%, dispersion in liquid paraffin) (166 g) in portions , 4.1 mmol). The mixture was warmed to room temperature naturally. Then 2,6-bis(bromomethyl)naphthalene (500 mg, 1.6 mmol) was added and the resulting mixture was heated to 70°C. It was stirred at 70°C overnight. The reaction mixture was quenched with ice water (30 ml) and extracted with ethyl acetate (3 x 20 ml). The organic layers were combined, washed with brine (20 ml), dried using anhydrous sodium sulfate, filtered and concentrated to obtain the crude product. It was purified by silica gel column chromatography (dichloromethane/methanol = 15:1) to give (1S,1'S)-2,2'-((naphthalene-2,6-diylbis(methylene))bis(oxy))bis (1-phenylethan-1-amine) (400 mg, 0.938 mmol, 58.9% yield) as black oil.

LCMS (electrospray, m/z): 427.2 [M+H] ⁺ , retention time 1.037 min.

Synthesis of di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S)-((naphthalene-2,6-diylbis(methylene) )bis(oxy))bis(1-phenylethan-2,1-diyl))bis(azanediyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1, 3]thiazepine-7,4-diyl))bis(azanediyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate)

To a solution of (4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][ 1,3]thiazepine-7-carboxylic acid (259 mg, 0.59 mmol), ethyl 2-ethoxyquinolinyl-1(2H)-carboxylate (162 mg, 0.66 mmol) and N,N-diisopropylethylamine (121 mg, 0.94 mmol) in To 1,2-dichloroethane (5 ml) was added (1S,1'S)-2,2'-((naphthalene-2,6-diylbis(methylene))bis(oxy))bis(1-phenylethan-1-amine) ( 100 mg, 0.23 mmol). The mixture was stirred at 50°C overnight. The reaction mixture was concentrated to obtain the crude product. It was purified by silica gel column chromatography (petroleum ether/ethyl acetate = 1:4) to give the crude product. The crude product was then purified by preparative HPLC to give the product (100 mg, 0.078 mmol, 33.4% yield) as a white solid.

LCMS (electrospray, m/z): 539.3 [M/2-Boc+H] ⁺ , retention time 1.778 min.

Synthesis of (4S,4'S,7S,7'S,9aS,9aS)-N,N'-((1S,1'S)-((naphthalene-2,6-diylbis(methylene))bis(oxy))bis(1-phenylethane -2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3]thiazepine-7- carboxamide)

To a solution of di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S)-((naphthalene-2,6-diylbis(methylene ))bis(oxy))bis(1-phenylethane-2,1-diyl))bis(azanediyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b][1 ,3]thiazepine-7,4-diyl))bis(azanediyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate) (92 mg, 0.072 mmol) in dichloromethane (5 ml) was added 4 N . hydrochloric acid in dioxane (0.5 ml). The mixture was stirred at room temperature overnight. The reaction mixture was concentrated to give the title product (20 mg, 0.017 mmol, 24.2% yield) as a white solid. This compound was then lyophilized to remove residual solvent.

LCMS (electrospray, m/z): 1077.7 [M-2HCl+H] ⁺ , retention time 1.426 min.

¹ H-NMR (400 MHz, DMSO-d6) δ ppm 9.30 (s, 2H), 8.91 - 8.77 (m, 4H), 8.45 (d, J = 8.2 Hz, 2H), 7.82 - 7.72 (m, 4H) , 7.45 - 7.32 (m, 10H), 7.28 (t, J = 7.2 Hz, 2H), 5.46 (t, J = 7.9 Hz, 2H), 5.13 (dd, J = 13.3, 6.6 Hz, 2H), 4.74 - 4.59 (m, 6H), 4.20 (s, 2H), 3.90 - 3.80 (m, 2H), 3.72 - 3.61 (m, 4H), 3.13 (t, J = 12.4 Hz, 2H), 2.83 - 2.73 (m, 2H), 2.49 - 3.42 (m, 6H), 2.18 (dd, J = 12.5, 6.8 Hz, 2H), 2.10 - 2.02 (m, 2H), 1.86 (dd, J = 12.7, 8.8 Hz, 2H), 1.73 (dd, J = 22.5, 11.2 Hz, 2H), 1.40 - 1.33 (m, 6H), 1.05 (s, 6H), 0.98 (s, 6H).

Example 63

(4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-{octane-1,8-diylbis(oxy))bis(2,3- dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1,3 ]thiazepine-7-carboxamide)dihydrochloride

Synthesis of (1S,1'S,2R,2'R)-2,2'-(octane-1,8-diylbis(oxy))bis(2,3-dihydro-1H-inden-1-amine)

Sodium hydride (60%, dispersion in liquid paraffin) (380 mg, 9.57 mmol). The mixture was warmed to room temperature naturally. Then 1,8-dibromooctane (1.0 g, 3.68 mmol) was added. The resulting mixture was stirred at 70°C overnight. The reaction mixture was quenched with ice water (30 ml) and extracted with ethyl acetate (3 x 30 ml). The organic layer was combined, washed with brine (50 ml), dried using anhydrous sodium sulfate, filtered and concentrated to obtain the crude product. It was purified using a Combi-Flash eluting with dichloromethane/methanol = 10:1 and then thin layer chromatography using ethyl dichloromethane/methanol = 10/1 for development to give the target product (170 mg, 0.42 mmol, 11.4% output) in the form of dark oil.

Synthesis of di-tert-butyl ((2S,2'S)-((((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-(octane-1, 8-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azanediyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2, 1-b][1,3]thiazepine-7,4-diyl))bis(azanediyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate)

(1S,1S,2R,2'R)-2,2'-(octane-1,8-diylbis(oxy))bis(2,3-dihydro-1H-inden-1-amine) (150 mg, 0.367 mmol) and ((4S,7S,9aS)-4-((S)-2-((tert-butoxycarbonyl)(methyl)amino)propanamido)-8,8-dimethyl-5-oxooctahydropyrrolo[2,1-b ][1,3]thiazepine-7-carboxylic acid (358 mg, 0.808 mmol) in 1,2-dichloroethane (10 ml) was added to N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinolinyl (272 mg, 1.101 mmol ) and N,N-diisopropylethylamine (189 mg, 1.468 mmol). The resulting mixture was stirred at 50° C. overnight. The reaction mixture was concentrated to give the crude product. It was purified by thin layer chromatography using ethyl acetate/petroleum ether = 3/ 1, resulting in the crude product. The crude product was then purified by preparative HPLC to give the product (150 mg, 0.119 mmol, 32.4% yield) as a beige solid.

LCMS (electrospray, m/z): 529.9 [1/2M-Voc+H] ⁺ , retention time 2.027 min.

Synthesis of (4S,4'S,7S,7'S,9aS,9a'S)-N,N'-((1S,1'S,2R,2'R)-(octane-1,8-diylbis(oxy))bis(2,3 -dihydro-1H-inden-2,1-diyl))bis(8,8-dimethyl-4-((S)-2-(methylamino)propanamido)-5-oxooctahydropyrrolo[2,1-b][1, 3]thiazepine-7-carboxamide) dihydrochloride

To a solution of di-tert-butyl ((2S,2'S)-(((4S,4'S,7S,7'S,9aS,9a'S)-((((1S,1'S,2R,2'R)-(octane-1, 8-diylbis(oxy))bis(2,3-dihydro-1H-inden-2,1-diyl))bis(azanediyl))bis(carbonyl))bis(8,8-dimethyl-5-oxooctahydropyrrolo[2, 1-b][1,3]thiazepine-7,4-diyl))bis(azanediyl))bis(1-oxopropan-1,2-diyl))bis(methylcarbamate) (150 mg, 0.119 mmol) in dichloromethane ( 5 ml) added 4 N. hydrochloric acid in dioxane (0.5 ml). The mixture was stirred at room temperature overnight. The reaction mixture was concentrated to give the title product (85 mg, 0.075 mmol, 63.1% yield) as a white solid.

LCMS (electrospray, m/z): 1058.8 [M-2HCl+H] ⁺ (Calc. M-2HCl+H=1059.6), retention time 1.348 min.

¹ H-NMR (400 MHz, DMSO) δ ppm 9.50 (s, 2H), 8.93 (s, 2H), 8.87 (d, J = 6.6 Hz, 2H), 7.91 (d, J = 8.7 Hz, 2H), 7.27 - 7.19 (m, 8H), 5.51 (t, J = 7.9 Hz, 2H), 5.33 (dd, J = 8.6, 5.4 Hz, 2H), 4.78 - 4.70 (m, 2H), 4.24 (s, 2H) , 4.11 (dd, J = 9.3, 4.1 Hz, 2H), 3.89 (dd, J = 10.5, 6.1 Hz, 2H), 3.44 - 3.38 (m, 4H), 3.20 (t, J = 11.8 Hz, 2H), 2.98 (d, J = 3.7 Hz, 4H), 2.95 - 2.85 (m, 2H), 2.47 (s, 6H), 2.27 - 2.11 (m, 4H), 1.89 - 1.76 (m, 4H), 1.47 - 1.36 ( m, 10H), 1.24 - 1.17 (m, 8H), 1.08 (s, 6H), 1.06 (s, 6H).

• Latency reversal analysis in Jurkat cells.

• Latency reversal assay on Jurkat cells.

Jurkat clones with HIV luciferase were maintained in RPMI 1640 medium (Gibco from Life Technologies) containing 10% (v/v) fetal bovine serum (SAFC/Sigma-Aldrich) and 25 U/ml penicillin, 25 U/ml streptomycin (Gibco from Life Technologies), and were divided 1:4 every 3-4 days while maintaining a cell density of ~0.3-1 million cells/ml. Jurkat clones were maintained on medium supplemented with 500 nM EFV. Three Jurkat cell clones (C16, I15, and N6), each carrying one or two integrated HIV proviruses expressing a luciferase reporter gene, were added in equal amounts for a total of 5000 cells per well into 384-well plates. , containing titrated dilutions of the compound. Dose-response testing was performed with compounds dissolved in dimethyl sulfoxide (DMSO; Fisher Scientific, Merelbeke, Belgium) distributed into serial 3-fold 14-point titration dilutions obtained in duplicate using a D300e Digital Droplet Dispenser ( Hewlett-Packard), with final assay concentrations ranging from 10 µM to 2.1 pM in 50 µl of media with a final concentration of 0.5% DMSO (v/v). Cells and compound were incubated at 37°C for 48 hours unless otherwise stated, followed by the addition of 20 μl Steady-Glo® luciferase (Promega). Luminescence resulting from induction of virus-expressed luciferase was measured using an EnVision 2102 multichannel plate reader (Perkin Elmer). Dose-response relationships were analyzed using GraphPad PRISM 6 using a four-parameter logistic regression model to calculate the concentration of compound that produces half-maximal response (EC ₅₀ ) and maximum percent activation compared to vehicle control.

The results of the above analysis are shown in Table 3.

Pharmacokinetic data

Pharmacokinetic (PK) data of several SMAC mimetic compounds of formula I in rodents were compared with PK data of SMACm AZD5582 (Fig. 1). As can be seen in FIG. 1, plasma drug concentration-time curves for compounds of Formula I demonstrate a PK relationship comparable to that observed for AZD5582.

Induction of the NFkB2 gene

5x10 ⁵ CD4 T cells from healthy donors were treated for 24 hours with 6-fold 7-point serial dilutions of the compounds, starting with 1.0 μM. Total RNA was isolated using the RNEasy Mini Kit (Qiagen) following the manufacturer's instructions. The following TaqMan primer probe sets were obtained from Applied Biosystems: Hs00174517_m1 (NFKB2) and #02800695 (HPRT1). TaqMan-based real-time PCR (Fast Virus 1-Step Master Mix, Applied Biosystems) was used to amplify host genes of interest. Gene expression was normalized to HPRT1 and the comparative threshold cycle (CT) method (ΔΔCT) was used to measure the relative fold change in gene expression compared to untreated cells. Data were analyzed on a QuantStudio3 real-time PCR system. The results are shown in Table 4.

Line p100/p52 WB

Cell culture and processing

Cell cultures were established to evaluate several SMACm compounds. Frozen PBMCs from healthy donors were thawed and seeded into 2 ml deep well plates at a density of 2×10 ⁶ cells/ml. Serial dilutions of each compound were prepared by diluting 7-fold 1:6, starting with a starting final dose of 1000 nM. The cells were then combined with the compound and kept at 37°C for 24 hours. The next day, the cells were pelleted and stored at -80°C until lysed.

Collection of lysed whole cells

In preparation for cell lysis, frozen pelleted cells and an aliquot of NP40 cell lysis buffer (Invitrogen, cat. no. FNN0021), as well as an aliquot of 10x protease inhibitor cocktail (Sigma, cat. no. P-2714) are thawed on ice. After thawing, prepare a buffer for complete lysis by adding 10% of the final volume of the protease inhibitor cocktail to the NP40 buffer, and then a sufficient volume of 0.1 M PMSF (Sigma, cat. no. 93482) and 1 M DTT (Sigma, cat. no. 43816) to obtain a final concentration of 1 mM of each in buffer for complete lysis. Cell lysis is then carried out by resuspending each cell pellet in 30 µl per 10^6 cells, followed by incubation on ice for 30 minutes with vigorous vortexing every 10 minutes. The lysed cells are then centrifuged at 13,000 RPM for 10 minutes at 4°C in a refrigerated microcentrifuge. The supernatants (lysates) were then transferred to new microcentrifuge tubes and either stored at -80°C or immediately used for protein concentration analysis and Western blotting.

Bradford microplate assay procedure

The protein concentration of each lysate was determined using a detergent-compatible Bradford assay (Pierce, cat. no. 23246) following the microplate manufacturer's instructions.

Protein separation and immunodetection

Capillary Western blotting was performed using the ProteinSimple Jess system. A total of 1 μg of cell lysate was prepared according to the suggested protocol from ProteinSimple. Anti-p100/p52 primary antibody (Cell, Signaling #3017) was diluted 1:10 for use in the Jess system. The 12-230 kDa Jess Separation Module (SM-W004) is used in combination with a secondary NIR dye-conjugated anti-rabbit antibody (043-819). The separation module contains prefilled plates that contain samples, primary and secondary antibodies, protein standardization reagent, and diluents for separation and detection. Once analyzed, the data were analyzed using Compass software provided by ProteinSimple.

Immunoblotting analysis

As an alternative to capillary electrophoresis, traditional immunoblotting analyzes were performed by loading 10 μg of cell lysate onto a well on 4–20% Tris-glycine SDS-PAGE gels. Protein from SDS-PAGE gels was transferred to Turbo Midi PVDF Transfer Packs (BioRad) using the “mixed molecular weight” protocol for a single medium format gel (2.5 A DC to 25 V, for 7 minutes) Trans-Blot Turbo Transfer System (Bio-Rad) with a ready-made Trans-Blot module, following the manufacturer's instructions. After transfer, PVDF membranes were blocked in 5% bovine serum albumin (BSA) in 1x TBS (BioRad) with 0.1% Tween-20 for 1 hour at room temperature with gentle shaking. Primary antibodies were added and incubated overnight at 4°C (anti-p100/p52 antibody, Cell Signaling Technology #3017, 1:1000; HRP conjugated anti-actin antibody, Abcam #49900, 1:30000). After initial staining, the membrane was washed three times with 1x Tris-buffered saline (TBS)+0.1% TWEEN® 20, each time for 10 minutes. After washing, the membrane was incubated in 5% BSA in 1x TBS+0.1% TWEEN® 20 with an appropriate secondary antibody for 2 hours at room temperature. After secondary staining, the membrane was washed twice for 10 minutes with 1x TBS+0.1% TWEEN® 20 followed by a 10-minute wash with 1x TBS. The membrane was then dried with filter paper and an image of the undeveloped membrane was captured on a ChemiDoc MP imaging system using Image Lab software (BioRad). Sufficient ECL reagent (GE Healthcare) was used to coat the membrane and a series of images were acquired, starting at 0.001 seconds and doubling/tripling the exposure time until luminescence from the developed membrane saturated the image. The developed membrane was then washed three times with 1x TBS for 5 minutes to remove residual ECL reagent and stored at 4°C in enough 1x TBS to completely submerge the membrane. Densitometry of the developed membrane images was then performed using Image Lab software. Some membranes were stripped for 1 minute with One Minute Plus Western Blot Stripping Buffer (GM Biosciences) followed by three washes for 10 minutes with 1x TBS. Purified membranes were then blocked in 5% BSA in 1x TBS+0.1% TWEEN® 20 for an hour and reprobed overnight with new primary antibody. The results of the p100/p52 WB line analysis are shown in Table 4.

HIV cell-associated RNA(caRNA)

During the productive phase of the viral life cycle, HIV produces a significant number of differentially spliced transcripts, collectively called HIV cell-associated RNA (HIV cRNA), in some of the infected cells. In HIV-infected individuals receiving suppressive antiretroviral therapy (ART), changes in HIV caRNA levels are a recognized surrogate for the effectiveness of reversing HIV latency.

To measure HIV caRNA, peripheral blood mononuclear cells (PBMCs) are isolated from leukocytes obtained by flow leukopheresis. Total CD4 ⁺ T cells were isolated from PBMCs by negative selection using the EasySep Human CD4 ⁺ T cell Enrichment kit (StemCell, Vancouver, Canada) following the manufacturer ^'s recommendations. Resting CD4 ⁺ T cells were isolated by negative selection using an immunomagnetic column as described previously (25) and either immediately cryopreserved or maintained for two days in IMDM medium (Gibco) with 10% FBS, 2 μg/ml IL- 2 (Peprotech) and antiretroviral drugs to prevent the virus from reproducing.

For SMACm treatment, 3-5 replicates of 2-5×10 ⁶ CD4 ⁺ T cells were treated for 48 hours at 37°C in 1 ml of RPMI 1640 medium with 10% FBS, 10 μg/ml enfuvirtide (Sigma) and 200 nM rilpivirine . 10 nM phorbol 12-myristate 13-acetate (PMA; Sigma) with 1 µM ionomycin (Sigma) was used as a positive control to activate LRAs (latency altering agents) and 0.2% DMSO base was used as a negative control. Following treatment, cells were lysed and RNA and DNA were co-extracted using the AllPrep 96 RNA/DNA Kit (Qiagen, Valencia, CA) following the manufacturer's instructions, adjusting the lysis buffer volume to 0.6 ml, adding on-column DNase I treatment (Qiagen ) and eluting the RNA in 50 µl of water.

RT-qPCR was performed in triplicate for each of three replicate wells using TaqMan Fast Virus 1-step RT-qPCR Master Mix (Applied Biosciences) with 5 μl of isolated RNA and 900 nM capsid primers HIV HIV-gag (5'-ATCAAGCAGCTATGCAAATGTT-3' (SEQ ID NO: 1)) and reverse gag (5'-CTGAAGGGTACTAGTAGTTCCTGCTATGTC-3' (SEQ ID NO: 2)), and 250 nM FAM/ZEN/IABFQ HIV probe -gag (5'-ACCATCAATGAGGAAGCTGCAGAATGGGA-3' (SEQ ID NO: 3)). Samples were amplified and data collected using a QuantStudio™ 3 Real-Time PCR System (Applied Biosystems) with the following cycling conditions: one cycle at 50°C for 5 minutes (reverse transcription), one cycle at 95°C for 20 seconds (inactivation of reverse transcriptase); 50 cycles at 95°C for 3 seconds; and 60°C for 20 seconds (denaturation and annealing/extension).

The absolute copy number of HIV gag RNA per reaction was determined using the HIV gag gBlock qPCR standard corresponding to the DNA sequence of the qPCR product (5'-ATCAAGCAGCCATGCAAATGTTAAAAGAGACCATCAATGAGGAAGCTGCAGAATGGGATAGATTGCATCCAGTGCATGCAGGGCCTATTGCACCAGGCCAGATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAG -3' (SEQ ID NO: 4); Integrated DNA Technologies), and copy number normalized by the number of cells counted using bright-field microscopy. The efficiency of RT-qPCR was required to be between 90% and 110%. Analytical values with a positive signal that were less than the lower limit of detection (LLOD) of 7 copies of HIV gag per reaction were set to LLOD. Analysis was performed using QuantStudio™ Design and Analysis Software (Applied Biosystems) and the R software package (described in detail below).

Table 4 provides comparative data from the Jurkat EC50, p100/p52 WB, NFkB2 gene induction, and caRNA assays for several SMAC mimics described herein and competitor mimics.

The compounds of the present invention (namely, Examples 33, 13, 42, 40 and 20) are potent dimeric SMACs that are capable of activating the ncNF-kB pathway and inducing HIV expression. These molecules effectively deplete cIAP1 and cIAP2, lead to the cleavage of p100 releasing p52, activate the ncNF-kB pathway and induce HIV expression. In addition, they have properties that engage the ncNF-κB pathway in vivo. In particular, Examples 13 and 20 are believed to have the best combination of unexpected and surprising properties.

Where:

and the described SBI dimer of formula F:

Cytotoxicity

Jurkat cell viability was determined using the CellTiter-Glo® Luminescent Cell Viability Assay (Promega), a uniform method for determining ATP levels in a culture well that are consistent with the presence of metabolically active cells in culture. Cells were cultured as described for Jurkat cell assays. To assess SMACm-mediated toxicity in the context of TNF-α, 10 ng/ml TNF-α (R&D Systems) was added to the culture. A portion of the cells was removed and 30 μl of Promega CellTiter-Glo® reagent was added to each well containing cells and luminescence was measured using a Perkin Elmer EnVision plate reader. Dose-response relationships were analyzed using GraphPad PRISM 6, using a four-parameter logistic regression model to calculate the concentration of compound that reduced cell viability by 50% compared to untreated controls ( _CC50 ).

Efforts have been made to ensure the accuracy of the numerical values used (e.g. quantities, temperatures, etc.), but the possibility of experimental errors and deviations should be taken into account.

One skilled in the art will recognize many methods and materials similar or equivalent to those described herein that are suitable for use in the practice of the invention described herein. The present disclosure is in no way limited to the methods and materials described.

Unless otherwise specified, technical and scientific terms used herein have the meanings commonly known to those skilled in the art to which the subject matter belongs and are consistent with the references: Singleton et al (1994) Dictionary of Microbiology and Molecular Biology, 2nd Ed., J. Wiley & Sons, New York, NY; and Janeway, C., Travers, P., Walport, M., Shlomchik (2001) Immunobiology, 5th Ed., Garland Publishing, New York.

Throughout this specification and the claims, the terms “comprise,” “comprises,” and “comprising” are used in a non-exclusive sense, unless the context requires otherwise. It should be understood that the embodiments described herein include embodiments including the terms “consisting of” and/or “consisting essentially of”.

As used herein, the term "about" in relation to the meaning covers, in some embodiments, variations of ±50%, in some embodiments ±20%, in some embodiments ±10%, in some embodiments ±5% , according to some implementation options - ±1%, according to some implementation options - ±0.5%; and in some embodiments, ±0.1% of the stated amount if such variations are appropriate for carrying out the methods described or using the compositions described.

When a range of values is given, it is understood that every intermediate value, up to tenths of a unit from the lower limit of the values, is included, unless the context clearly dictates otherwise, between the upper and lower limit of the range, as well as any other specified or intermediate value within the specified range. The upper and lower limits of these minor ranges, which may be independently included in the smaller ranges, are also included, subject to the fact that any limit within the specified range may be specifically excluded. If a specified range includes one or both limits, ranges excluding either one or both of those included limits are also included.

One skilled in the art to which the subject matter of the present invention relates will be able to appreciate many modifications and other embodiments of the invention described herein, taking into account the advantages of the teachings set forth in the descriptions above and in the accompanying drawings. Thus, it is to be understood that the subject matter of the invention is not limited to the specific embodiments disclosed, and that modifications and other embodiments are included within the scope of the appended claims. Although specific terms are used herein, they are for general and descriptive purposes only and are not intended to be limiting.

Claims (11)

1. A compound having the structure: or a pharmaceutically acceptable salt thereof. 2. Salt according to claim 1, characterized in that said salt is a hydrochloride. 3. Salt according to claim 2, characterized in that said hydrochloride is a dihydrochloride. 4. A pharmaceutical composition for the treatment of HIV infection, containing from 0.5% to 50% by weight of the compound according to claim 1 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient. 5. The composition according to claim 4, characterized in that said composition is adapted for parenteral administration. 6. A compound having the structure: 7. A pharmaceutical composition for the treatment of HIV infection, containing from 0.5% to 50% by weight of the compound according to claim 6 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient. 8. The composition according to claim 7, characterized in that said composition is adapted for parenteral administration.

Images