RU2803155C1 - Test card and test kit for detection of brassica yellows virus - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: test kit for detection of brassica yellows virus BrYV is described. The test kit contains a test card for detection of the specified virus and a composition of primers for the detection of the virus. A method for detecting the BrYV virus and using the test kit to detect the virus is also described.

EFFECT: development of a test kit for rapid and sensitive detection of Brassica yellows virus.

14 cl, 7 dwg

Description

Field of technology

The invention relates to the field of technology for detecting the Brassica yellow virus, in particular to a test card and test kit for detecting the Brassica yellow virus.

State of the art

Baikal skullcap (Scutellaria baicalensis Georgi) is a perennial plant of the Lamiaceae family and one of the widely used medicines in our country. Baikal skullcap is cold in nature and bitter in taste, belongs to the meridians of the lungs, gall bladder, spleen, large and small intestine; has an effect on eliminating heat and moisture, removing fire and neutralizing, hemostasis and preventing abortion. Scutellaria baicalensis has significant pharmacological effects such as antibacterial, antiviral, anti-inflammatory, antioxidant and cardiovascular effects, it is commonly used in the treatment of damp fever, diarrhea, jaundice, cough due to pulmonary heat and embolism. Wild Scutellaria baicalensis is mainly distributed in most areas north of the Yangtze River in our country, is the authentic medicinal material in Chengde, Hebei Province, and Chengde is known as "Rehe Scutellaria baicalensis".

Due to the constant expansion of the scale and area of artificial plantings, as well as continuous planting, the origin of Scutellaria baicalensis has deteriorated and the quality of seeds has decreased, which has seriously affected the income of farmers and has become a key bottleneck limiting the development of the Chinese herbal medicine industry. and rural revitalization in my country. Currently, research on Scutellaria baicalensis has mainly focused on five fungal diseases, namely powdery mildew (Erysiphe cichorocearum DC) , root rot (Fusarium spp) , late blight (Phoma asparage Sacc) , gray mold (Botrytis cinerea Pers) and cercospora blight (Phyllosticta menthae Bres) , while there are relatively few reports of viral diseases.

Viral disease is also a very serious plant disease that is difficult to control and is known as “plant cancer.” Once a plant is infected with a virus, the species degenerates, resistance weakens and becomes more vulnerable to other pathogens such as fungi and bacteria; in the field, multiple diseases often occur simultaneously, resulting in more severe losses. In 2020, the inventor conducted preliminary research and detection of Scutellaria baicalensis disease planted in Longxi County, Gansu Province, and identified Brassica yellows virus (BrYV) in some samples using small RNA sequencing (sRNA-seq) technology ), this was the first time that BrYV infection was detected in Scutellaria baicalensis. After infection with BrYV and other viruses, the plants became dwarfed and the leaves showed symptoms such as severe yellowing and necrotic spots, resulting in a decrease in yield and quality, which seriously affected the quality of medicinal raw materials.

At present, the detection method of BrYV mainly includes reverse transcription-polymerase chain reaction (RT-PCR), but this method has complex procedures, high cost, high requirements for equipment and detection conditions, and requires the accumulation of many years of experience and personnel with professional operating skills, Therefore, the scope of application is highly limited, and it cannot meet the need for rapid detection of Scutellaria baicalensis landing sites and fields. For Scutellaria baicalensis crops propagated by seeds, seed quality is the key to the development of the industry, but the virus content in the seeds is low and RNA extraction is difficult, so the detection accuracy of RT-PCR method depends on nucleic acid extraction is impaired and false negative results often occur, urgently needed develop new technologies or new methods for rapid and sensitive detection of seed viral diseases.

In view of this, the present invention is proposed.

Brief description of the invention

The purpose of the present invention is to provide a test card and test kit for the detection of Brassica yellowtail virus to solve the above-mentioned technical problems.

BrYV is an important member of the Luteoviridae and poleroviruses , a virus in this genus cannot be transmitted by mechanical inoculation alone, but can be transmitted by aphids in a persistent, non-proliferating manner. BrYV can infect a variety of plants such as rapeseed, cauliflower, cabbage, benthamiana and Arabidopsis, causing severe disease and reduced yields.

BrYV is a positive-sense, single-stranded RNA virus that lacks poly(A) structure at the 3' end of the viral genome and VPg (Virus genome-linked protein, VPg) at the 5' end. Viral particles are spherical in shape and size from 25 to 30 nm. The BrYV genome contains seven open reading frames (ORFs), and the P0 protein, encoded by ORF0, is a suppressor of gene silencing. Coat protein (CP) is encoded by ORF3. ORF1 encodes protease, helicase, and VPg motifs, whereas ORF1 and ORF2 encode P1-P2 fusion proteins involved in viral replication. Protein 3a, encoded by ORF3a, and MP protein, encoded by ORF4, are associated with viral movement. The RTP protein, which is produced by ORF5 readthrough from ORF3, is associated with persistent wandering nonproliferative transmission, virus accumulation, and phloem retention in aphids.

The present invention is implemented as follows:

The present invention relates to a primer composition for the detection of Brassica yellowtail virus, which includes a forward external primer F3 shown in SEQ ID NO.1, a reverse external primer B3 shown in SEQ ID NO.2, a forward internal primer FIP shown in SEQ ID NO. .3, the reverse internal primer BIP shown in SEQ ID NO.4, the forward loop primer LF shown in SEQ ID NO.5, and the reverse loop primer LB shown in SEQ ID NO.6.

The above primers can be used for a DNA loop-mediated isothermal amplification reaction. The inventors have designed specific internal primers FIP/BIP and external primers F3/B3 to target six specific regions of the Brassica yellowtail virus target sequence, the amplification reaction can be carried out using a polymerase, thereby obtaining 10 ⁹ -10 ¹⁰ copies in a relatively short period of time. The amplification reaction can be completed in a constant temperature water bath without the need for molecular biology instruments such as gene amplification instruments, which have the advantages of easy operation, high specificity and high sensitivity.

The present invention also provides a test card for detecting Brassica yellow yellow virus, which includes a sample pad, a colloidal gold binding pad, a nitrocellulose membrane and an absorption pad arranged sequentially on a backing plate, wherein the colloidal gold binding pad contains a conjugate of antibodies to Brassica yellow virus and colloidal gold, the T-line detection and C-quality control line are located on a nitrocellulose membrane sequentially along the chromatographic direction, the T-line detection is coated with an IgG antibody to BrYV, and the C-line quality control is coated with a secondary antibody with antibody to BrYV; the amount of IgG anti-BrYV coating antibody on the T-line detection is 1.5-2.0 μg of protein per 2 mm line width; the amount of BrYV secondary antibody coating is 1.5-2.0 μg of protein per 2 mm of line width.

The amount of anti-Brassica virus antibody applied to the colloidal gold binding pad is 16-18 μg of anti-Brassica virus antibody per 1 ml of colloidal gold.

The antibody applied to the test card can be prepared at home or selected from commercially available antibodies.

The test card can provide rapid detection of Brassica yellowspot virus and can be used for primary screening of Brassica yellowspot virus.

In a preferred embodiment of the present invention, the above test card further includes a card slot consisting of a lower body and an upper body, the card slot has a mounting cavity for receiving a backing plate, and the backing plate is fixedly connected to the inner wall of the lower body, and the upper body fixedly connected to the lower housing.

In a preferred embodiment of the present invention, the upper housing is provided with a sample addition window and a reaction monitoring window at intervals, the sample addition window is spatially located above the sample spacer, and the reaction monitoring window is spatially located above the nitrocellulose membrane. To make it easier to observe the color change of the test card, the reaction observation window can be made transparent. The shape of the sample addition window can be set to an inverted cone to facilitate collection of liquid on the sample pad.

In a preferred embodiment of the present invention, the upper housing and the lower housing are connected by a snap structure with a latch.

The present invention also relates to a GICA-RT-LAMP test kit for detecting Brassica yellowspot virus, which includes the above-mentioned test card for detecting Brassica yellowspot virus and a primer composition for detecting Brassica yellowspot virus.

In a preferred embodiment of the present invention, the above kit further includes RT-LAMP amplification reaction reagents, and the RT-LAMP amplification reaction reagents include reverse transcriptase, RNase inhibitor, dNTP mixture, reaction buffer, MgSO ₄ , DNA polymerase and water; in a preferred embodiment of the present invention, the reverse transcriptase is selected from AMV reverse transcriptase or M-MLV reverse transcriptase, and the reaction buffer is selected from ThermoPol reaction buffer.

In a preferred embodiment of the present invention, the kit further includes a phosphate buffer, a phosphate wash buffer, a fluorescent dye detection solution, a negative control substance, and a positive control substance.

In a preferred embodiment of the present invention, the negative control substance is water, and the positive control substance is a standard substance of the Brassica virus envelope protein CP gene fragment.

The standard sequence of the BrYV CP gene fragment is as follows:

AGTCGTGGGGTAGAGAACAATCAATGGAAGAAGACGACCACGCAGGCAAACAAGGCGCATTCAGCGAAATCAGCCAGTGGTTGTGGTCCAAACCTCTCGGACAACACAACGCCGACCTAGACGACGACGAAGAGGTAACAACCGGACAGGAAGAACTGTTCCTACCAGAGGAGCAGGTTCGAGCGAGACATTTGTTTTCTCAAAAGACAATCTCGCGGGAAGTTCCAGCGGAG CAATCACGTTCGGGCCGAGTCTATCAGACTGCCCGGCATTCTCTAATGGAATGCTCAAGGCCTACCATGAATATAAGATCTCAATGGTCATTCTGGAGTTCGTCTCCGAGGCCTCTTCCCAAAATTCCGGTTCCATCGCTTACGAGCTGGACCCACACTGTAAACTCAATTCACTCTCTTCCCACGATTAA.

The DNA polymerase is a polymerase suitable for isothermal amplification, in a preferred embodiment of the present invention the DNA polymerase is selected from Bst DNA polymerase.

The present invention also relates to a method for detecting Brassica yellowspot virus using the GICA-RT-LAMP Brassica yellowspot virus detection kit, comprising:

(1) Take the test solution onto the sample pad of the Brassica Yellow Blight Virus Detection Test Card, observe the color change of the detection T-line and the Quality Control C-line, and determine for the first time whether the Brassica Yellow Blight Virus BrYV is contained in the test sample;

(2) If it is not possible to determine whether Brassica yellowtail virus BrYV is contained according to step (1), perform RT-LAMP reverse transcription amplification: The T-line detection on the test card after the immunoenrichment reaction in step (1) is removed , and the deleted detection T line is used as a template, and the RT-LAMP detection primer composition is used to perform RT-LAMP amplification; Using the product of the RT-LAMP amplification reaction, determine again whether the brassica virus BrYV is contained in the test sample. The reaction conditions for RT-LAMP amplification were as follows: amplification in a constant temperature water bath at 58–66°C for 60–100 min, followed by denaturation at 80°C for 10 min to terminate the reaction.

In the preferred embodiment of the present invention, the above-mentioned specific method for determining whether a test sample contains BrYV for the first time by the color change of the detection T line and the quality control C line is a naked eye observation method; Naked eye observation method:

If brown-red bands are present on the detection T-line and quality control C-line, this means that the test sample contains brassica virus BrYV, and RT-LAMP reverse transcription amplification is not required;

If there is no color change on the detection T-line, but only a brown-red band appears on the quality control C-line, then it is determined that the test sample is not infected with BrYV, or the BrYV content is low, and RT-LAMP reverse transcription amplification is required .

In a preferred embodiment of the present invention, from the product of the RT-LAMP amplification reaction, secondarily determine whether the brassica virus BrYV is contained in the test sample, the specific method being a naked eye observation method using a fluorescent dye; Naked eye observation method for fluorescent dye:

Take the fluorescent dye reaction solution and add it to the cap of the RT-LAMP amplification reaction tube before the reaction, after completing the LAMP amplification reaction, mix the fluorescent dye detection solution with the LAMP reaction solution, and directly observe the color of the mixed reaction solution with the naked eye.

Since SYBR Green I inhibits the LAMP reaction, it is not recommended to add SYBR Green I before the reaction, after the reaction is complete, the fluorescent dye detection solution is mixed with the LAMP reaction solution by shaking the tube cap or centrifugation to allow the reaction solution to acquire color.

In a preferred embodiment of the present invention, the fluorescent dye reaction solution is SYBR Green I, and if the amplified product shows green fluorescence, it means that the test sample contains brassica virus;

If the color of the amplified product is orange, this means that the tested sample does not contain Brassica yellowtail virus.

The object detected by the above kit is BrYV virus particles, and the virus particles can be quickly enriched by GICA colloidal gold immunochromatography technology, which can preliminarily detect the virus infection of the test sample; and then use specific virus primers. genome sequence to perform RT-LAMP amplification, the goal of accurate detection of pathogens is achieved through the analysis of amplification products.

The GICA-RT-LAMP detection method seamlessly combines serological methods and nucleic acid detection methods, and has the advantages of high specificity and high sensitivity. After testing and verification, its sensitivity reached 0.25 pg/ml, which is 100 times more sensitive than conventional GICA-RT-PCR, the detection process does not require RNA isolation, no professional equipment is required, which simplifies the workflow, reduces the difficulty of detection and improves detection efficiency, and it has broad application prospects.

The invention also provides a test card for detecting Brassica yellowspot virus, a primer composition for detecting Brassica yellowspot virus, or a GICA-RT-LAMP kit for detecting Brassica yellowspot virus.

The present invention has the following positive effects:

The detection primer set proposed in the present invention can detect specific brassica yellowtail virus, and the primer set has the technical advantage of high sensitivity. The test card of the invention has the advantage of rapid detection and can preliminarily determine whether a target sample is infected with Brassica virus. GICA-RT-LAMP test kit, combined with the above two and its detection method, has the technical advantages of convenient operation, high accuracy and good applicability.

The GICA-RT-LAMP detection method does not require the extraction of RNA nucleic acids, which solves the problem of the difficulty of isolating RNA from detection objects such as seeds. At the same time, this method is superior to the cumbersome, time-consuming and labor-intensive methods for detecting BrYV in the prior art, must rely on expensive molecular biology tools such as gene amplification tools, and cannot quickly detect the target virus, this method seamlessly combines serology and LAMP amplification technology, takes full advantage of the advantages of two detection methods, and directly uses BrYV virus particles enriched with GICA colloidal gold immunochromatography as the detection object to carry out RT-LAMP amplification, the detection threshold and complexity are reduced, and reaction operations are carried out continuously in one same reaction system, and there is no need to add reagents in the middle, reducing the risk of contamination.

A total of 6 specific primers F3, B3, FIP, BIP, LF and LB were used to identify 8 BrYV CP target gene sequences, which had the advantages of high specificity and high accuracy.

The implementation of the method allows detection to be completed without the help of a gene amplification device; the results of the immunochromatographic reaction can be observed with the naked eye and combined with the RT-LAMP reaction in a constant temperature water bath. This reduces the difficulty of detection and expands the application scope of the technology, after the reaction is completed, the color change can also be used to evaluate the results with the naked eye, which does not depend on instruments or equipment and increases the application value, it is very suitable for promotion and application at the grassroots level, and the prospects are very wide.

In addition, the present invention also provides a new technical platform for Scutellaria baicalensis and plant disease detection. It can be used not only for rapid screening of BrYV, but also for precise monitoring of BrYV. Provide technical support for monitoring the occurrence, spread, prevalence of BrYV, and for the prevention and control of viral diseases.

Brief description of drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for the embodiments will be briefly presented below, it should be understood that the following drawings show only some embodiments of the present invention and should not be construed as limiting the scope, and those skilled in the art techniques other related drawings can also be obtained from these drawings without any creative effort.

Drawing 1 is a diagram of the plenary structure of a colloidal gold immunochromatographic test card for detecting Brassica virus BrYV in accordance with an embodiment of the present invention;

Drawing 2 is a diagram of the internal structure of a colloidal gold immunochromatographic test card for detecting Brassica virus BrYV according to an embodiment of the present invention;

Figure 3 is a diagram of naked eye observation of fluorescent dye for determining the reaction temperature of BrYV using GICA-RT-LAMP in accordance with an embodiment of the present invention, in the drawing: 1: negative control, 2-9 correspond to: 56°C, 58°C , 60°С, 62°С, 64°С, 66°С, 68°С, 70°С;

Drawing 4 is a diagram of naked eye observation of fluorescent dye for determining the reaction time of BrYV using GICA-RT-LAMP according to an embodiment of the present invention, in the drawing: 1: negative control, 2-10 respectively correspond to: 20 min; 30 min; 40 min; 50 min; 60 min; 70 min; 80 min; 90 min; 100 min;

Figure 5 is a diagram of naked eye observation of fluorescent dye for determining the sensitivity of BrYV using GICA-RT-LAMP in accordance with an embodiment of the present invention, in the drawing: 1: negative control, 2-11 correspond to the standard concentration of BrYV CP gene: 10 ^-1 (2.5×10 ⁴ ng/ml); 10 ^-2 (2.5×10 ³ ng/ml); 10 ^-3 (2.5×10 ² ng/ml); 10 ^-4 (2.5×10 ¹ ng/ml); 10 ^-5 (2.5×10 ⁰ ng/ml); 10 ^-6 (2.5×10 ^-1 ng/ml); 10 ^-7 (2.5×10 ^-2 ng/ml); 10 ^-8 (2.5×10 ^-3 ng/ml); 10 ^-9 (2.5×10 ^-4 ng/ml); 10 ^-10 (2.5×10 ^-5 ng/ml);

Figure 6 is a diagram of an electrophoretic sensitivity assay for the detection of BrYV in accordance with the GICA-RT-PCR embodiment of the present invention; in the drawing: M: 600 bp marker; 1: negative control; 2-11 correspond to the standard concentration of the CP BrYV gene: 10 ^-1 (2.5×10 ⁴ ng/ml); 10 ^-2 (2.5×10 ³ ng/ml); 10 ^-3 (2.5×10 ² ng/ml); 10 ^-4 (2.5×10 ¹ ng/ml); 10 ^-5 (2.5×10 ⁰ ng/ml); 10 ^-6 (2.5×10 ^-1 ng/ml); 10 ^-7 (2.5×10 ^-2 ng/ml); 10 ^-8 (2.5×10 ^-3 ng/ml); 10 ^-9 (2.5×10 ^-4 ng/ml); 10 ^-10 (2.5×10 ^-5 ng/ml);

Figure 7 is a chart of naked eye observation using GICA-RT-LAMP for detecting the specificity of BrYV fluorescent dyes in accordance with an embodiment of the present invention, in the drawing: 1: negative control, 2-13 respectively correspond to: healthy Scutellaria baicalensis tissue, susceptible tissue LSV lilies; susceptible lily tissue CMV-Li; Lily LMoV susceptible tissue; susceptible lily tissue PlAMV; lily ArMV susceptible tissue; susceptible tissue of angelica JHMV; susceptible tissue of Angelica AMV; receptive lettuce tissue LNYV; LMV receptive lettuce tissue; susceptible lettuce tissue CMV; receptive tissue of skullcap Baikal BrYV.

Drawing legends: 1-card slot, 2-sample addition windows, 3-reaction observation window, 4-sample pad, 5-colloidal gold binding pad, 6-nitrocellulose membrane, 7-absorption pad, 8 - backing plate, 9-T detection line; 10-C quality control line.

Embodiment of the invention

To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and fully described below. If specific conditions are not indicated in the examples, it is carried out in accordance with generally accepted conditions or conditions proposed by the manufacturer. Reagents or instruments used without manufacturer's specification are common products that can be purchased in the market.

The features and characteristics of the present invention will be described in detail below in connection with embodiments.

Embodiment 1

Referring to Drawings 1 and 2, this embodiment provides a test card for detecting Brassica yellow fever virus, which includes a card slot 1. The card slot 1 is composed of a lower housing and an upper housing (numbers not shown in the drawing), and in this In an embodiment, the lower housing and the upper housing are arranged in a snap connection. The upper housing and the lower housing have mounting cavities for placing the backing plate 8. The backing plate 8 is fixedly connected to one end of the lower housing.

Sample pad 4, colloidal gold binding pad 5, nitrocellulose membrane 6 and absorption pad 7 are arranged sequentially on the backing plate 8, colloidal gold binding pad 5 contains a conjugate of colloidal gold and anti-brassica virus antibodies, and the T-line detection 9 and quality control C-line 10 are located on the nitrocellulose membrane 6 sequentially along the chromatographic direction, detection T-line 9 is coated with anti-BrYV IgG antibody, and quality control C-line 10 is coated with a secondary antibody with anti-BrYV antibody; the amount of anti-BrYV IgG antibody coating on T detection line 9 is 1.5-2.0 μg of protein per 2 mm line width; the amount of BrYV secondary antibody coating is 1.5-2.0 μg of protein per 2 mm of line width; in this embodiment, is a goat anti-rabbit IgG; The amount of anti-BrYV antibody coating on the colloidal gold binding pad 5 is 90 μg of anti-BrYV antibody per 5 ml of colloidal gold. In this embodiment, the anti-BrYV antibody on colloidal gold binding pad 5 is a rabbit polyclonal anti-BrYV antibody.

The upper housing is provided with a window for adding sample 2 and a window for observing the reaction 3 at intervals, a window for adding sample 2 is located above the sample pad 4 in space, and a window for observing the reaction 3 is spatially located above the nitrocellulose membrane 6.

The method for preparing the above test card is as follows:

1. Preparation of polyclonal IgG antibody to BrYV:

Expression and purification of BrYV CP envelope protein: total RNA was extracted from Scutellaria baicalensis leaves infected with BrYV and subjected to reverse transcription-polymerase chain reaction (RT-PCR) to amplify the BrYV CP gene fragment; cloned into the pET-28a vector by enzymatic digestion; the recombinant plasmid was transformed into Escherichia coli strain BL21 (DE3), cultured at 37°C, induced with IPTG for expression, and purified by nickel affinity column chromatography to obtain the 22.6 kDa BrYV CP envelope protein;

Preparation of polyclonal antibodies: New Zealand white rabbits were immunized with 1 mg/ml of the purified BrYV CP envelope protein described above as an immunogen; during primary immunization, mix the BrYV protein antigen with Freund's complete adjuvant in an equal volume and perform a subcutaneous injection at several points; 21 days after the primary immunization, 1.0 mg/ml purified BrYV protein was mixed with an equal volume of Freund's incomplete adjuvant and, after complete emulsification, injected subcutaneously at several sites as the first booster immunization; thereafter, booster immunization is given every 21 days, and the immunization method is multi-point subcutaneous injection. A total of 3 booster immunizations were carried out: blood from the carotid arteries was collected 5-7 days after the fourth booster immunization, incubated, centrifuged, 0.02% sodium azide was added to the collected serum and stored at -20°C; The serum was precipitated with saturated ammonium sulfate, dialyzed to phosphate buffer pH 7.8, and then purified by protein A affinity chromatography to obtain rabbit polyclonal IgG antibodies to BrYV.

2. The method of colloidal gold labeled rabbit polyclonal antibody to BrYV is as follows:

Take 5 ml of colloidal gold with a particle size of 30 nm and 90 μg of rabbit polyclonal antibody to BrYV respectively and combine them by magnetic stirring under pH 7.6 conditions, add 10% bovine serum albumin (BSA) and 5% PEG 20000 as stabilizers to obtain final concentrations of 0.5% and 0.2%, respectively, use low-temperature high-speed centrifugation to remove unbound polyclonal antibodies, unstabilized colloidal gold particles and deagglomerates, and the dark red precipitate at the bottom of the centrifuge tube is a conjugate of colloidal gold and antibodies.

3. Preparation of a pad for binding with colloidal gold

The colloidal gold-antibody conjugate was suspended in 1/10 volume of pre-labeled colloidal gold solution, centrifuged, and the supernatant was applied to a glass cellulose membrane using spray equipment and dried at 37°C to prepare a colloidal gold binding pad.

4. Coating of immunochromatographic membranes

The detection line T is coated with purified anti-BrYV rabbit polyclonal IgG antibody, and the quality control C-line is coated with goat anti-rabbit IgG antibody, the width of each line is 2mm, the suitable amount of anti-BrYV rabbit polyclonal antibody coating is 1.6 μg protein, and the suitable The coverage amount of purified goat anti-rabbit IgG antibody is 1.6 μg of protein.

5. Assembling the GICA colloidal gold immunochromatography test card

Fix the PVC backing plate body as a support holder in the bottom body of the detection card slot, and connect the sample pad, colloidal gold binding pad, nitrocellulose membrane and water-absorbing filter paper (i.e., absorption pad 7) in series to the top surface PVC backing plate, and then connect the upper housing and lower housing of the GICA detection card slot with a buckle.

This embodiment also provides a detection method for the above test card:

Referring to drawing 1, draw up a small amount of sample test solution and place it on the sample addition windows 2 in the upper body of the GICA detection card slot, by capillary effect the loaded liquid moves forward if the test solution contains BrYV when the sample passes through the pad for binding with colloidal gold, BrYV forms complexes with gold-labeled polyclonal antibodies on the gold pad, and then continues chromatographic electrophoresis towards the detection T-line, upon contact with the detection T-line, an antigen-antibody binding reaction occurs with the BrYV polyclonal antibody on the T-line detection, which is captured to form a visible brown-red streak; the unbound complex continues to migrate towards the QC C-line, when it comes into contact with the QC C-line, it binds to the goat anti-rabbit IgG antibody immobilized on the QC C-line and is intercepted, forming a visible brown-red band . That is, when brown-red bands appear on both the detection T-line and the quality control C-line, the test sample is determined to be infected with BrYV.

If the test sample solution does not contain BrYV or the BrYV content is low, when the test sample passes through the colloidal gold binding pad, it cannot bind to the gold-labeled polyclonal antibody on the gold-labeled pad, or the number of bound complexes is very small when the sample comes into contact with T-line detection, no reaction occurs, and the gold-labeled polyclonal antibody continues to migrate to the C-line QC, when the sample touches the C-line, it binds to the goat anti-rabbit IgG antibody immobilized on the C-line QC , and is intercepted, forming a visible brown-red stripe. That is, when there is no color change on the detection T line, but only a brown-red band appears on the quality control C line, the test sample is determined to be free of BrYV or the BrYV content is low, and further experimental analysis is required.

The above test card can be used for preliminary rapid screening of BrYV, which can correspond to on-site detection in the field and other scenes. In 3 to 5 minutes, the viral infection of the test sample can be preliminarily determined and the goal of fast, simple and effective detection of BrYV can be achieved.

Embodiment 2

This embodiment provides the GICA-RT-LAMP test kit for the detection of Brassica virus BrYV.

The test kit consists of three parts, including: a test card for detecting Brassica yellowtail virus in embodiment 1, a specific RT-LAMP primer composition and a reagent for the RT-LAMP amplification reaction;

In addition, the GICA-RT-LAMP test kit also includes phosphate buffered saline (PBS), phosphate wash buffer (PBST), fluorescent dye detection solution, negative control and positive control.

The RT-LAMP specific primer composition includes forward external primer F3 shown in SEQ ID NO.1, reverse external primer B3 shown in SEQ ID NO.2, forward internal primer FIP shown in SEQ ID NO.3, reverse internal primer BIP shown in SEQ ID NO.4, the forward loop primer LF shown in SEQ ID NO.5, and the reverse loop primer LB shown in SEQ ID NO.6., the sequence of each primer set in the above primer composition is as follows:

F3: 5’-AGGTAACAACCGGACAGGA-3’;

B3: 5’-TCGGAGACGAACTCCAGAA-3’;

FIP:

5'-GGAACTTCCCGCGAGATTGTCTACTGTTCCTACCAGAGGAGC-3';

BIP:

5'-AGCGGAGCAATCACGTTCGGATTCATGGTAGGCCTTGAGC-3'';

LF: 5'-ACAAATGTCTCGCTCGAACCT-3'';

LB: 5'-GCCGAGTCTATCAGACTGCC-3'.

The RT-LAMP amplification reagent consists of 10 U/μL AMV reverse transcriptase, 40 U/μL RNAse inhibitor, 10 mM dNTP mixture, 10× ThermoPol reaction buffer, 100 mM MgSO ₄ , 8 U/μL Bst DNA polymerase and RNA-free H2O;

Phosphate-buffered saline (PBS) and phosphate wash buffer (PBST) had a concentration of 0.02 M, pH 7.4.

The fluorescent dye detection solution is 1000×SYBR Green I;

Negative control – RNA-free H2O;

The angelica CP BrYV gene standard served as a positive control.

This embodiment also provides a method for preparing a BrYV CP gene standard. The specific cooking method is as follows:

1. Extraction of total RNA

50-100 mg of Scutellaria baicalensis leaves infected with BrYV are crushed in liquid nitrogen and total RNA from susceptible tissue is extracted using a plant total RNA isolation kit;

2. Design and synthesis of primers

Based on the sequence obtained by sequencing small RNAs, pairs of specific forward (BrYV-F) and reverse (BrYV-R) primers for the BrYV CP gene were designed and synthesized; the sequences of these primers are as follows:

BrYV-F:5’-AGTCGTGGGTAGGAGAACA-3’

BrYV-R:5’-AATCGTGGAGGAGAGTGAA-3’;

3. Preparation of positive controls

1) RT reaction

Use the above reverse primers BrYV-R BrYV and reverse transcriptase M-MLV to perform an RT reaction to synthesize first-strand cDNA; reaction system 10 µl RT: total RNA 2 µl, 10 µM specific reverse primer BrYV-R BrYV 1 µl, RNA-free H ₂ O 3 µl, denatured at 70°C for 10 min, quickly placed on ice for 2 min, then buffer 5×M-MLV 2 μl, 10 mM dNTPs 1 μl, 30 U/μl RNase inhibitor 0.34 μl, 200 U/μl reverse transcriptase M-MLV 0.35 μl and RNA-free 0.31 μl were added; After mixing, place in a water bath at 42°C for 1 hour, incubate at 70°C for 15 minutes and place on ice for use.

2) PCR reaction

Using the first strand of cDNA obtained in step (1) as a template, PCR amplification of the BrYV CP gene was carried out using Ex Taq DNA polymerase;

The PCR reaction system is 12.5 µl, including: 50 ng cDNA 0.5 µl, 5 U/µl Ex Taq DNA polymerase 0.1 µl, 10× PCR buffer 1.25 µl, 2.5 mM dNTPs 1 µl, 10 µM forward primer BrYV-F 0.25 µl, 10 µM reverse primer BrYV-R 0.25 µl, adding ddH2O to 12.5 µl;

PCR amplification conditions: predenaturation at 94°C for 4 min, denaturation at 94°C for 30 s, annealing at 51°C for 45 s, extension at 72°C for 30 s, 35 amplification cycles, and final extension at 72°C for 7 min;

After detecting the PCR products by 1.5% agarose gel electrophoresis, the target fragments were recovered, use a cloning vector kit to couple the target fragment to the pMD18-T vector, transform DH5α competent cells, and perform blue-white spot screening; randomly select 3 colonies with white spots and inoculate them on ampicillin LB medium and shake the bacteria at 37°C for 12-16 hours; use the mini plasmid extraction kit to extract the plasmid; take 1 μl of plasmids respectively and perform PCR amplification under the same conditions as the above PCR reaction system; sequence positive recombinant plasmids detected by PCR; Sequencing confirmed that the sequence of the positive plasmid was completely correct, i.e., a positive control, and the length of the fragment corresponding to the BrYV CP gene of Scutellaria baicalensis was 424 bp; Plasmid concentrations of standards were determined using a NanoDrop ND-1000 nucleic acid/protein analyzer.

3. Sequence of positive controls

After sequencing, the above positive control substances are exactly as expected, and the sequences of the extracted control substance fragments are as follows:

Standard sequence of the Scutellaria Baikalensis CP BrYV gene fragment:

AGTCGTGGGGTAGAGAACAATCAATGGAAGAAGACGACCACGCAGGCAAACAAGGCGCATTCAGCGAAATCAGCCAGTGGTTGTGGTCCAAACCTCTCGGACAACACAACGCCGACCTAGACGACGACGAAGAGGTAACAACCGGACAGGAAGAACTGTTCCTACCAGAGGAGCAGGTTCGAGCGAGACATTTGTTTTCTCAAAAGACAATCTCGCGGGAAGTTCCAGCGGAG CAATCACGTTCGGGCCGAGTCTATCAGACTGCCCGGCATTCTCTAATGGAATGCTCAAGGCCTACCATGAATATAAGATCTCAATGGTCATTCTGGAGTTCGTCTCCGAGGCCTCTTCCCAAAATTCCGGTTCCATCGCTTACGAGCTGGACCCACACTGTAAACTCAATTCACTCTCTTCCCACGATTAA.

Embodiment 3

This embodiment provides a method for detecting Brassica yellowtail virus BrYV using the GICA-RT-LAMP test kit in Embodiment 2.

1. Enrichment of viral particles by colloidal gold immunochromatography GICA

1) Take 100 mg of BrYV infected Scutellaria baicalensis sample or other test samples to be tested, place them in a 3 ml ziplock bag containing PBS, and grind it gently with a pestle, and the liquid of the crushed tissue is liquid for detecting the test sample;

2) Take a small amount of detection solution from the above test sample, place it on the sample window 2 of the BrYV colloidal gold immunochromatography test card in Embodiment 1, and observe the color development result in the reaction window 3 for 3- 5 minutes.

2. Initial determination of reaction results

When brown-red bands appear on both detection T-line 9 and quality control C-line 10 in reaction observation window 3 of the BrYV colloidal gold immunochromatography test card, it is determined that the test sample is infected with BrYV, no further detection is required ;

When detection T-line 9 in reaction observation window 3 of the BrYV colloidal gold immunochromatography test card has no change in color and a brown-red band appears on quality control C-line 10, the test sample is determined to be free of BrYV or have mild BrYV requires subsequent detection by reverse transcription RT-LAMP.

3. RT-LAMP reaction

1) Cut the detection T-line on the GICA Colloidal Gold Immunochromatography Test Card BrYV after the above reaction, rinse with PBST three times, carefully clean the T-line area with a sterilized blade, and place it into a PCR tube;

2) Add 40 U/μL RNAse inhibitor 0.15 μL, 10 U/μL AMV reverse transcriptase 0.3 μL, 10× ThermoPol buffer 1.25 μL, 100 mM MgSO4 0.75 μL, 10 mM dNTP mixture 1.75 µl into the above PCR tube containing the T line, LAMP primer set containing 2.5 µM F3 and B3, 20.0 µM FIP and BIP and 10.0 µM LF and LB, respectively, 1.0 µl, 8 U/μl DNA polymerase Bst 1.0 μl and RNAse free H ₂ O, supplemented to 12.5 μl; RNA-free H ₂ O was used as a negative control, the Scutellaria baicalensis CP BrYV gene standard was used as a positive control, after setting up the reaction system, 1 μl of 100× working solution of the fluorescent dye SYBR Green I was added to the inner wall of the reaction system, tightly close the tube for PCR and perform RT-LAMP reaction; RT-LAMP reaction conditions: amplification at 58-66°C for 60-100 min followed by denaturation at 80°C for 10 min to stop the reaction.

4. Secondary judgment reaction results

After completing the above RT-LAMP reaction, centrifuge or gently shake the PCR tube without opening the cap to mix the fluorescent dye SYBR Green I on the inner wall of the PCR tube cap with the LAMP amplification product, turn upside down and mix evenly, and observe with the naked eye the Change colors of the mixture in the PCR tube:

If the color of the mixture turns green, this means that SYBR Green I dye is binding to double-stranded DNA, and this is a positive reaction, indicating that the test sample contains Brassica yellow virus BrYV;

If the color of the mixture is orange, it is a negative reaction, indicating that the sample does not contain Brassica yellowtail virus BrYV.

Embodiment 1

This embodiment is a naked eye observation experiment of fluorescent dyes to detect BrYV using the GICA-RT-LAMP test kit in Embodiment 2 at different reaction temperatures and reaction times, the detection method is shown in Embodiment 3.

Check RT-LAMP amplification results for 80 minutes at RT-LAMP amplification temperatures of 56°C, 58°C, 60°C, 62°C, 64°C, 66°C, 68°C, and 70°C. As shown in Figure 3, in Figure: 1: negative control; 2-9 correspond to: 56°C, 58°C, 60°C, 62°C, 64°C, 66°C, 68°C and 70°C. It can be seen from the drawing that the combination of amplification primers provided in the embodiment of the present invention can provide effective amplification of the target gene under conditions of 58-66°C.

Check amplification results at 64°C with RT-LAMP amplification times of 20 min, 30 min, 40 min, 50 min, 60 min, 70 min, 80 min, 90 min, and 100 min, respectively. As shown in Figure 4, in Figure: 1: negative control; 2-10 correspond to: 20 min, 30 min, 40 min, 50 min, 60 min, 70 min, 80 min, 90 min, 100 min respectively. As can be seen from the drawing, the combination of amplification primers presented in the embodiment of the present invention can provide effective amplification of the target gene under conditions of 60-100 minutes.

Embodiment 2

Sensitivity of GICA-RT-LAMP colloidal gold immunochromatography for detection of BrYV.

To analyze the sensitivity of immunochromatography with colloidal gold GICA-RT-LAMP to the detection of BrYV, the Scutellaria baicalensis CP BrYV gene standard was used as a sample in the above version, after determining the concentration (2.5×10 ⁵ ng/ml) using a nucleic acid analyzer/ NanoDrop ND-1000 proteins, the above standards were then diluted 10-fold with RNA-free H ₂ O, and stored at -20°C as a matrix. 1.0 μL of each dilution solution after 10-fold dilution was taken as a template, and the RT-LAMP reaction reagent in the above embodiment was added to carry out RT-LAMP amplification, and the reaction program was 64°C for 80 min;

As a comparative determination, PCR amplification was performed for each dilution solution after the above 10-fold dilution. PCR amplification conditions: predenaturation at 94°C for 4 min, denaturation at 94°C for 30 s, annealing at 51°C for 45 s, extension at 72°C for 30 s, 35 amplification cycles, and final extension at 72°C for 7 min;

After the RT-LAMP reaction, the fluorescent dye SYBR Green I was used to observe the development of color with the naked eye, the results showed that the sensitivity of GICA-RT-LAMP to the Scutellaria baicalensis CP gene standard BrYV was 2.5×10 ^-4 ng. /ml or 0.25 pg/ml (Figure 5); after the PCR reaction, 5 μl of the amplified product was selected, and the results of agarose gel electrophoresis showed that the sensitivity of the GICA-RT-PCR reaction to the Scutellaria baicalensis CP BrYV gene standard was 2.5×10 ^-2 ng/ml, that is, 25 pg/ml (Figure 6), it can be seen that the sensitivity of immunochromatography with colloidal gold GICA-RT-LAMP for detecting BrYV is 100 times higher than that of GICA-RT-PCR.

Embodiment 3

Specificity of GICA-RT-LAMP colloidal gold immunochromatography for detection of BrYV

To analyze the specificity of colloidal gold immunochromatography GICA-RT-LAMP for the detection of BrYV in Scutellaria baicalensis, 11 common viruses were used: those affecting lily, angelica, lettuce and Scutellaria baicalensis: Susceptible leaves (collected in the field) LSV, CMV-Li, LMoV, ArMV , PlAMV, JHMV-DG, AMV, LNYV, LMV, CMV-L and BrYV were used as samples, respectively place them in a ziplock bag containing PBS buffer and grind it gently with a pestle, after grinding it is made into droplets for detection and added to the sample addition window on the GICA BrYV colloidal gold immunochromatography test card 3, and the color development results are observed after 3-5 minutes; then RT-LAMP amplification was carried out using the GICA-RT-LAMP system and method in the above embodiment, the reaction program was 64°C for 80 minutes, and after completion of the amplification, color appeared, and healthy leaves of Scutellaria baicalensis were used as a negative control. The experiment was repeated three times.

The color development results of the test card showed that brown-red stripes appeared on both the detection T-line and the quality control C-line of Scutellaria baicalensis leaf samples infected with BrYV, while the detection T-lines of other samples had no color change , and brownish-red streaks appear on the quality control C-line.

The results of visual observation with the fluorescent dye SYBR Green I showed that only the amplification products of Scutellaria baicalensis leaves infected with BrYV were green, and the amplification products of the remaining susceptible leaves and healthy leaves of Scutellaria baicalensis were orange (Figure 7); this shows that the GICA-RT-LAMP method established in the present invention is highly specific for BrYV and does not cross-react with other common viruses.

Embodiment 4

Field samples were detected using colloidal gold immunochromatography GICA-RT-LAMP.

Take field samples of Scutellaria baicalensis leaves, use the GICA BrYV colloidal gold immunochromatography test card to enrich for viral particles, and then use the GICA-RT-LAMP detection system in embodiment 3 above to perform RT-LAMP amplification.

When brownish-red bands appear on both the detection T-line and the quality control C-line of the GICA test card, the test sample is determined to be infected with Brassica yellowtail virus BrYV.

If the GICA test card shows no color change on the detection T-line, but a brown-red band appears on the QC C-line, and the fluorescent dye shows a green color when observed with the naked eye, it means that the sample contains Brassica virus BrYV ;

If the GICA test card shows no color change on the detection T-line, but a brownish-red band appears on the quality control C-line, and the fluorescent dye shows an orange color when observed with the naked eye, the sample does not contain Brassica yellowtail virus. BrYV.

The above descriptions are only preferred embodiments of the present invention and are not intended to limit the present invention, and the present invention is subject to various modifications and changes to those skilled in the art. Any modification, equivalent replacement, improvement, etc. made in the spirit and principle of the present invention shall be included within the scope of protection of the present invention.

--->

LIST OF SEQUENCES

<110> Northwestern Institute of Ecological Environment and

resources of the Chinese Academy of Sciences

<120> Test card and test kit for yellow fever virus detection

brassicas

<160> 6

<170> Patent version 3.5

<210> 1

<211> 19

<212> DNA

<213> Artificial sequence

<400> 1

aggtaacaac cggacagga 19

<210> 2

<211> 19

<212> DNA

<213> Artificial sequence

<400> 2

tcggagacga actccagaa 19

<210> 3

<211> 42

<212> DNA

<213> Artificial sequence

<400> 3

ggaacttccc gcgagattgt ctactgttcc taccagagga gc 42

<210> 4

<211> 40

<212> DNA

<213> Artificial sequence

<400> 4

agcggagcaa tcacgttcgg attcatggta ggccttgagc 40

<210> 5

<211> 21

<212> DNA

<213> Artificial sequence

<400> 5

acaaatgtct cgctcgaacc t 21

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence

<400> 6

gccgagtcta tcagactgcc 20

<---

Claims (23)

1. A test kit for detecting Brassica yellowing virus (BrYV), characterized in that it contains a test card for detecting Brassica yellowing virus and a primer composition for detecting Brassica yellowing virus, the primer composition includes a direct external primer F3 shown in SEQ ID NO : 1, reverse outer primer B3 shown in SEQ ID NO: 2, forward inner primer FIP shown in SEQ ID NO: 3, reverse inner primer BIP shown in SEQ ID NO: 4, forward loop primer LF shown in SEQ ID NO: 5, and the LB loopback primer shown in SEQ ID NO: 6; wherein the test card includes a sample pad, a colloidal gold binding pad, a nitrocellulose membrane and an absorption pad arranged sequentially on a backing plate, wherein the colloidal gold binding pad contains a conjugate of antibodies to Brassica virus and colloidal gold, T - the detection line and the quality control C-line are located on the nitrocellulose membrane sequentially along the chromatographic direction, the detection T-line is coated with an IgG antibody to BrYV, and the quality control C-line is coated with a secondary antibody with an antibody to BrYV; the amount of IgG anti-BrYV coating antibody on the T-line detection is 1.5-2.0 μg of protein per 2 mm line width; the amount of BrYV secondary antibody coating is 1.5-2.0 μg of protein per 2 mm of line width; The amount of anti-Brassica virus antibody applied to the colloidal gold binding pad is 16-18 μg of anti-Brassica virus antibody per 1 ml of colloidal gold. 2. The test kit according to claim 1, characterized in that the test card further comprises a card slot consisting of a lower housing and an upper housing, the card slot has an installation cavity for accommodating the backing plate, and the backing plate is fixedly connected to the inner wall the lower housing, and the upper housing is fixedly connected to the lower housing. 3. The test kit according to claim 2, characterized in that the upper body is equipped with a window for adding a sample and a window for observing the reaction at intervals, the window for adding a sample is located above the sample pad in space, and the window for observing the reaction is spatially located over a nitrocellulose membrane. 4. The test kit according to claim 3, characterized in that the upper housing and the lower housing are connected by a snap structure with a latch. 5. The test kit according to claim 1, wherein the test kit further includes reagents for the amplification reaction, and the reagents for the amplification reaction include reverse transcriptase, RNase inhibitor, dNTP mixture, reaction buffer, MgSO4, DNA polymerase and water. 6. Test kit according to claim 5, characterized in that the reverse transcriptase is selected from AMV reverse transcriptase or M-MLV reverse transcriptase, and the reaction buffer is selected from ThermoPol reaction buffer. 7. Test kit according to claim 5, characterized in that the DNA polymerase is selected from Bst DNA polymerase. 8. The test kit according to claim 1, wherein the test kit further includes a phosphate buffer, a phosphate wash buffer, a fluorescent dye detection solution, a negative control substance and a positive control substance. 9. The test kit according to claim 8, characterized in that the negative control substance is water, and the positive control substance is the standard substance of the CP gene fragment of the envelope protein of the brassica virus. 10. A method for detecting the Brassica yellow virus, which uses the test kit according to claim 1, characterized in that it includes the following steps, in which: (1) take the test solution onto the sample pad of the Brassica Yellow Blight Virus test card, observe the color change of the detection T line and the Quality Control C line, and determine for the first time whether the Brassica Yellow Blight Virus BrYV is contained in the test sample; (2) if it is not possible to determine whether Brassica yellowtail virus BrYV is contained in accordance with step (1), perform reverse transcription amplification amplification: the T detection line on the test card after the immunoenrichment reaction in step (1) is removed, and the removed T -the detection line is used as a template, and the amplification detection primer composition is used to perform amplification; Using the amplification reaction product, it is determined for the second time whether the brassica yellow yellow virus BrYV is contained in the test sample. 11. The method for detecting the Brassica yellow virus according to claim 10, characterized in that it is determined whether the Brassica yellow virus BrYV is contained in the test sample for the first time by observing with the naked eye the color change of the detection T-line and the quality control C-line; namely: if brown-red bands are present on the detection T-line and the quality control C-line, it is concluded that the test sample contains the brassica virus BrYV, and reverse transcription amplification is not performed; If there is no color change on the T-line of detection, but only on the C-line of quality control a brown-red band appears, then it is determined that the test sample is not infected with BrYV, or the content of BrYV is low, and then reverse transcription amplification is performed. 12. The method for detecting the Brassica yellow virus according to claim 10, characterized in that the product of the amplification reaction is used to determine for the second time whether the Brassica yellow virus BrYV is contained in the test sample, for which the naked eye observation method using a fluorescent dye is used, in which: Take the fluorescent dye reaction solution and add it to the cap of the amplification reaction tube before the reaction, after completing the amplification reaction, mix the fluorescent dye detection solution with the reaction solution, and directly observe the color of the mixed reaction solution with the naked eye. 13. The method for detecting the Brassica yellow virus according to claim 12, characterized in that SYBR Green I is used as a fluorescent dye reaction solution, and if the amplified product shows green fluorescence, it is concluded that the test sample contains Brassica yellowtail virus; If the color of the amplified product is orange, it is concluded that the tested sample does not contain Brassica yellowswing virus. 14. Use of a test kit for detecting Brassica yellows virus according to any one of claims 1 to 9 for detecting Brassica yellows virus.