CN113913558B - Detection kit and detection method for apple latent spherical viruses - Google Patents

Detection kit and detection method for apple latent spherical viruses Download PDF

Info

Publication number
CN113913558B
CN113913558B CN202111329625.9A CN202111329625A CN113913558B CN 113913558 B CN113913558 B CN 113913558B CN 202111329625 A CN202111329625 A CN 202111329625A CN 113913558 B CN113913558 B CN 113913558B
Authority
CN
China
Prior art keywords
alsv
detection
apple
lamp
virus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111329625.9A
Other languages
Chinese (zh)
Other versions
CN113913558A (en
Inventor
张玉宝
王若愚
谢忠奎
王亚军
金卫杰
何玉惠
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Northwest Institute of Eco Environment and Resources of CAS
Original Assignee
Northwest Institute of Eco Environment and Resources of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Northwest Institute of Eco Environment and Resources of CAS filed Critical Northwest Institute of Eco Environment and Resources of CAS
Priority to CN202111329625.9A priority Critical patent/CN113913558B/en
Publication of CN113913558A publication Critical patent/CN113913558A/en
Application granted granted Critical
Publication of CN113913558B publication Critical patent/CN113913558B/en
Priority to NL2033239A priority patent/NL2033239B1/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1009—Picornaviridae, e.g. hepatitis A virus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6804—Nucleic acid analysis using immunogens
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/54313—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being characterised by its particulate form
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/558—Immunoassay; Biospecific binding assay; Materials therefor using diffusion or migration of antigen or antibody
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/08—RNA viruses
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pathology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Communicable Diseases (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a detection kit and a detection method for an apple latent spherical virus, and relates to the technical field of detection of the apple latent spherical virus. The detection primer composition provided by the invention can specifically detect the ALSV in the target sample, and the 4 primers can identify 6 sequences of the ALSV CP target gene in a targeted manner, so that the specificity is strong and the accuracy is high. The detection card can be used for rapidly detecting the apple latent spherical virus ALSV in a target sample and is suitable for being used in a base layer such as a field. The detection kit and the detection method provided by the invention have the technical advantages of simple operation, high accuracy and good applicability.

Description

Detection kit and detection method for apple latent spherical virus
Technical Field
The invention relates to the technical field of detection of apple latent spherical viruses, and particularly relates to a detection kit and a detection method for apple latent spherical viruses.
Background
Apple Latent Spherical Virus (ALSV) belongs to the family of associated cowpea viruses (Secoviridae), the genus prunus filing virus (Cheravirus), and its host range is very wide, including tobacco, tomato, potato, cucumber, melon, pumpkin, soybean, pea and broad bean, Apple, pear, peach, plum, and the like. In the early stage of Li Mai and soybean infection, the symptoms of the green fading are caused, and other hosts usually show cryptosis and can not cause obvious symptoms of virus infection. In apple, it can be transmitted through seeds and pollen.
The ALSV virions are spherical, approximately 25nm in diameter, and consist of a double-segmented single-stranded RNA genome (RNA1 and RNA2) and three coat proteins (Vp25, Vp20 and Vp 24). RNA1 encodes RNA-dependent RNA polymerase, cysteine polymerase, VPg, and nucleotide triphosphate binding domain (NTP binding domain), and RNA2 encodes motor and coat proteins.
At present, reverse transcription polymerase chain reaction (RT-PCR) and other technologies are mainly used as detection methods for ALSV viruses, but the method has the problems of complex detection procedure, high detection cost, high requirements on instruments, equipment and detection conditions and the like, and can be completed by people with long-term experience accumulation and professional operation skills, so that the application range is greatly limited, and the requirements on rapid detection in planting fields and fields cannot be met. In addition, the seed virus content is low, the RNA extraction difficulty is high, the detection accuracy of RT-PCR and derivative technology depending on nucleic acid extraction is influenced, and a new technology and a new method suitable for rapid and sensitive detection of seed virus diseases are urgently needed to be developed.
In view of this, the invention is particularly proposed.
Disclosure of Invention
The invention aims to provide a detection kit and a detection method for apple latent spherical viruses to solve the problems.
The invention is realized in the following way:
the invention provides a primer composition for detecting latent apple orbiviruses, which comprises a forward outer primer F3 shown in SEQ ID NO.1, a reverse outer primer B3 shown in SEQ ID NO.2, a forward inner primer FIP shown in SEQ ID NO.3 and a reverse inner primer BIP shown in SEQ ID NO. 4.
The sequence is as follows:
F3：5’-CCTGCGAATATTATAAATCTAGCAT-3’；
B3：5’-CTGTACATATTACTGGTAAAACACA-3’；
FIP：
5’-TTGTGCGCTCATCTTGAGGGGAGCAGGTAACAAGCCAAT-3'；
BIP：
5’-CAGTGCCTAAATCAAATGGGTTAAAGCAACTTTCTATAGGCCCTAA-3’。
the primer composition can be used for RT-LAMP reaction, wherein the RT-LAMP reaction recognizes 6 sequences of ALSV CP target genes through 4 specific primers including F3, B3, FIP and BIP, and has the advantages of strong specificity and high accuracy. The primer composition is a group of detection primer combinations with high specificity, good repetition rate and high sensitivity, which are obtained by the inventor through a large amount of amplification screening for a long time.
The reagent prepared by the primer composition can be in a freeze-dried powder shape, and is respectively and independently subpackaged in a storage tube according to the upstream and downstream and the type of the primer.
The invention also provides a detection card for the apple latent spherical virus, which comprises a sample pad, a colloidal gold combination pad, a nitrocellulose membrane and an absorption pad which are sequentially arranged on a lining plate, wherein the colloidal gold combination pad contains a colloidal gold-apple latent spherical virus antibody combination substance, the nitrocellulose membrane is sequentially provided with a detection T line and a quality control C line along the chromatography direction, the detection T line is coated with an ALSV antibody IgG, and the quality control C line is coated with a secondary antibody of an anti-ALSV antibody; detecting the coating amount of the antibody IgG of the ALSV on the T line, wherein 1.0-1.5 mu g of protein is coated on each 2mm line width; the coating amount of the secondary antibody of the anti-ALSV antibody is 1.5-2.0 mu g of protein coated on each 2mm line width.
The coating amount of the apple latent spherical virus antibody on the colloidal gold bonding pad is that each 1mL of colloidal gold contains 15-16 mug of the apple latent spherical virus antibody.
The detection card provided by the inventor can realize the rapid screening of the latent orbivirus of apple ALSV, and is suitable for the field rapid screening under the conditions of fields and the like. The method is convenient to carry, specific equipment or instruments are not needed, whether the target sample is infected by the apple latent spherical virus or not can be judged by naked eyes, and the method has a good application prospect.
In a preferred embodiment of the present invention, the detection card further includes a slot formed by a lower housing and an upper housing, the slot has an installation cavity for placing a lining board, the lining board is fixedly connected to an inner wall of the lower housing, and the upper housing is fixedly connected to the lower housing.
In a preferred embodiment of the present invention, the upper housing is provided with a sample loading window and a reaction observation window at an interval, the sample loading window is spatially located above the sample pad so as to facilitate loading the sample on the sample pad for subsequent capillary chromatography, and the reaction observation window is spatially located above the nitrocellulose membrane so as to facilitate subsequent chromatography.
In one embodiment, the upper housing and the lower housing are clamped by a clamping structure. In other embodiments, the upper housing and the lower housing may be connected by bonding, fixing by a fixing member, or the like.
The invention also provides a GICA-RT-LAMP kit for detecting the apple latent spherical viruses, which comprises a detection card of the apple latent spherical viruses and a primer composition for detecting the apple latent spherical viruses.
In a preferred embodiment of the invention, the kit further comprises RT-LAMP amplification reaction reagent, wherein the RT-LAMP amplification reaction reagent comprises reverse transcriptase, RNase inhibitor, dNTP mixture, reaction buffer solution and MgSO4DNA polymerase and water; preferably, the reverse transcriptase is selected from AMV reverse transcriptase or M-MLV reverse transcriptase and the reaction buffer is selected from ThermoPol reaction buffer.
Through the specific inner primer FIP/BIP and the outer primer F3/B3, six specific regions of a target sequence are targeted, and DNA polymerase with the characteristic of strand displacement is utilized to synthesize a circulating template for amplification reaction. LAM has the advantage of high amplification efficiency, and can obtain 10 in about 1h9-1010And (4) copying. Compared with the conventional PCR nucleic acid detection method, the LAMP technology does not need molecular biology instrument equipment such as a gene amplification instrument and the like, can complete amplification reaction in a constant-temperature water bath, and has the advantages of simple and convenient operation, strong specificity, high sensitivity and the like.
In an alternative embodiment, the kit further comprises phosphate buffer, phosphate wash buffer, fluorescent dye detection solution, negative control, and positive control.
In an alternative embodiment, the negative control is water and the positive control is a standard sample of the coat protein CP gene fragment of the cryptococcal apple virus.
The sequence of the standard product of the angelica ALSV CP gene fragment is as follows:
TTGTATCAACCGTTCCTCCTGAAAATTTTTCAAAGGAGTAATTATCAGTACCTGCGAATATTATAAATCTAGCATTAGTGAGGGCTGAGCAGGTAACAAGCCAATTTACGACCAAATCACCAGAATAGCCCTCAAGATGAGCGCACAAAGACTGAAATCTATTAAATACAGTGCCTAAATCAAATGGGTTAAAATGAAATCTAGCTATAGAGGGTTTAGGGCCTATAGAAAGTTGCTGTGTTTTACCAGTAATATGTACAGGAAAATTGGGAATGCTCAGACAAGCTCCCTGACCTATGTTATAAAAAGTGGTTTTAACATCCACAATAGAAAAATTAAATGTACAAGAGAAGCTCTCAGGCATATTTTCCGTCAAATTAGGTGCGCTAAGAGCTGCCAAATGTACCTTGCCAAGGAGCTTGTTATTATCAAACTTAAGGTGAACCCCTGGCGAAAATAACTCAAAATCAAAAGAAAACTCTTCTTCCTGAGTACTAAAGATAGCACCAGGGAGAACACTGATCTTGCCAAAATCAGTGGTATCAGAGCTCAATTGCATAAGCTCATCATACACAAGTTTCAAAGCRAAACTGCAGAATTTACTAAGCRTAACTTTAGCAGAGACACGAATGGTAGCA。
in an alternative embodiment, the DNA polymerase is selected from Bst DNA polymerase.
The invention also provides a detection method for detecting the apple latent spherical virus by adopting the GICA-RT-LAMP kit, which comprises the following steps:
(1) sampling a solution to be detected onto a sample pad of a detection card of the apple latent spherical virus, observing the color change of a detection T line and a quality control C line, and primarily judging whether the sample to be detected contains the apple latent spherical virus ALSV;
(2) if the sample to be detected cannot be identified to contain the apple latent spherical virus ALSV according to the step (1), carrying out reverse transcription RT-LAMP amplification: taking down the detection T line on the detection card after the immune enrichment reaction in the step (1), and carrying out RT-LAMP amplification by using an RT-LAMP detection primer composition by taking the taken-down detection T line as a template; and judging whether the sample to be detected contains the apple latent spherical virus or not according to the RT-LAMP amplification reaction product twice.
The reaction conditions of RT-LAMP amplification are as follows: amplifying in thermostatic water bath at 56-66 deg.c for 50-100min, denaturing at 80 deg.c for 10min and terminating the reaction. In an actual application scene, RT-LAMP amplification can be realized through a thermostatic water bath, a specific fluorescent quantitative amplification instrument and other equipment are not needed, independent RNA extraction is also not needed, and the operation is simple and easy.
The apple latent spherical virus particles can be rapidly enriched by a colloidal gold immunochromatography GICA technology, and the virus infection condition of a sample to be detected is preliminarily judged according to the color development condition of strips on a reagent card; then RT-LAMP amplification is carried out by utilizing a specific primer of a virus genome sequence, and the purpose of accurately detecting the pathogen is achieved by analyzing an amplification product. The ALSV particles in the immune enrichment sample to be detected on the colloidal gold immunochromatography GICA detection card are used as a template to carry out subsequent RT-LAMP amplification, thereby reducing the occurrence of false positive and being beneficial to improving the detection accuracy.
The GICA-RT-LAMP detection method provided by the invention organically combines a serology method and a nucleic acid detection method, and has the advantages of strong specificity and high sensitivity. The sensitivity of detecting the apple latent spherical virus reaches 0.19pg/mL, is 100 times more sensitive than the common GICA-RT-PCR, is free from nucleic acid RNA extraction in the detection process, does not need professional instruments and equipment, simplifies the operation process, reduces the detection difficulty, improves the detection efficiency, and has wide application prospect.
In a preferred embodiment of the invention, the specific method for primarily judging whether the sample to be detected contains ALSV or not according to the color change of the detection T line and the quality control C line is a visual observation method; the visual observation method comprises the following steps:
if the T line and the quality control C line are detected to have brownish red bands, the sample to be detected contains the apple latent spherical virus ALSV, and reverse transcription RT-LAMP amplification is not needed;
and if the T line is detected to have no color change and only the quality control C line has a brownish red strip, judging that the detected sample is not infected with the apple latent spherical virus ALSV or the content of the infected apple latent spherical virus ALSV is low, and performing reverse transcription RT-LAMP amplification.
In a preferred embodiment of the application of the invention, the specific method for secondarily judging whether the sample to be detected contains the apple latent spherical virus according to the RT-LAMP amplification reaction product is a fluorescent dye macroscopic observation method; the macroscopic observation method of the fluorescent dye comprises the following steps:
adding the fluorescent dye reaction solution to a tube cover of the RT-LAMP amplification reaction tube before reaction, mixing the fluorescent dye detection solution and the LAMP reaction solution after the LAMP amplification reaction is finished, and directly observing the color of the mixed reaction solution by naked eyes.
SYBR Green I can inhibit LAMP reaction, so that SYBR Green I is not suitable for being added before the reaction, and fluorescent dye detection solution and LAMP reaction solution are mixed in a tube cover throwing or centrifuging mode after the reaction is finished, so that the reaction solution is developed.
In an optional embodiment, the fluorescent dye reaction solution is SYBR Green I, if the amplification product generates Green fluorescence, the sample to be detected contains the apple latent spherical virus;
if the color of the amplification product is orange, the sample to be detected does not contain the apple latent spherical virus.
The invention also provides an application of the detection card for the apple latent spherical virus, the primer composition for detecting the apple latent spherical virus or the GICA-RT-LAMP kit for detecting the apple latent spherical virus in the detection of the apple latent spherical virus.
The invention has the following beneficial effects:
the detection primer composition provided by the invention can specifically detect the ALSV in the target sample, and the 4 primers can identify 6 sequences of the ALSV CP target gene in a targeted manner, so that the specificity is strong and the accuracy is high. The detection card can be used for rapidly detecting the apple latent spherical virus ALSV in a target sample and is suitable for being used in a base layer such as a field. The detection kit and the detection method provided by the invention have the technical advantages of simple operation, high accuracy and good applicability.
The operation is simple and is shown in that: the detection kit and the detection method provided by the invention do not need RNA extraction and do not depend on expensive molecular biological instruments such as a gene amplification instrument and the like; the invention organically combines serology and LAMP amplification technology, fully exerts the advantages of the two detection methods, directly takes ALSV virus particles enriched by colloidal gold immunochromatography GICA as detection objects to carry out RT-LAMP amplification, avoids RNA extraction, reduces the detection threshold and difficulty, continuously carries out reaction operation in the same reaction system, does not need to add any reagent in the middle of the reaction, and reduces the pollution risk.
The accuracy is shown in the following steps: ALSV virus particles enriched by colloidal gold immunochromatography GICA are directly used as detection objects and used as templates for RT-LAMP amplification, so that the detection specificity is improved, and false positive is reduced.
The applicability is well embodied as follows: the immunochromatography reaction step does not need any instrument or equipment, the result is observed by naked eyes, the subsequent RT-LAMP reaction can be completed in a constant-temperature water bath, the detection difficulty is reduced, the application range of the technology is expanded, the result is judged by naked eyes through color change after the reaction is finished, the instrument or equipment is not needed, the application value is increased, the immunochromatography reaction method is very suitable for being popularized and applied in the basic level, and the prospect is very wide.
In addition, the invention also provides a new technical platform for detecting the diseases of the angelica and the plants, can be applied to the rapid screening of the latent orbicular virus ALSV of the apples and the accurate monitoring of the ALSV virus, achieves two aims at one stroke, and provides technical support for monitoring the occurrence, diffusion, prevalence and prevention and control of the ALSV virus.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.
FIG. 1 is a schematic plane structure diagram of a colloidal gold immunochromatographic assay card for detecting ALSV virus by GICA-RT-LAMP in accordance with the present invention;
FIG. 2 is a schematic view of the internal structure of a colloidal gold immunochromatographic assay card for detecting ALSV virus by GICA-RT-LAMP in the embodiment of the present invention;
FIG. 3 is a macroscopic view of fluorescent dyes for detecting ALSV virus reaction temperature by GICA-RT-LAMP in the embodiment of the present invention; in the figure: 1: negative control; 2-9 correspond to: 56 ℃; at 58 ℃; 60 ℃; 62 ℃; 64 ℃; at 66 ℃; 68 ℃ and 70 ℃;
FIG. 4 is a macroscopic view of fluorescent dyes for detecting ALSV virus reaction time by GICA-RT-LAMP in the embodiment of the present invention; in the figure: 1: negative control; 2-10 correspond to: 20 min; 30 min; 40 min; 50 min; 60 min; 70 min; 80 min; 90 min; 100 min;
FIG. 5 is a macroscopic view of fluorescent dyes for detecting ALSV virus sensitivity by GICA-RT-LAMP in the example of the present invention; in the figure: 1: negative control; 2-11 correspond to ALSV CP gene standard concentration: 10-1(1.9×104ng/mL)；10-2(1.9×103ng/mL)；10-3(1.9×102ng/mL)；10-4(1.9×101ng/mL)；10-5(1.9×10 0ng/mL)；10-6(1.9×10-1ng/mL)；10-7(1.9×10-2ng/mL)；10-8(1.9×10-3ng/mL)；10-9(1.9×10-4ng/mL)；10-10(1.9×10-5ng/mL)；
FIG. 6 is a diagram showing an electrophoretic analysis of the sensitivity of the GICA-RT-PCR detection of ALSV virus in the example of the present invention; in the figure: m: 2000bp Marker; 1: negative control; 2-11 correspond to ALSV CP gene standard concentration: 10-1(1.9×104ng/mL)；10-2(1.9×103ng/mL)；10-3(1.9×102ng/mL)；10-4(1.9×101ng/mL)；10-5(1.9×100ng/mL)；10-6(1.9×10-1ng/mL)；10-7(1.9×10-2ng/mL)；10-8(1.9×10-3ng/mL)；10-9(1.9×10- 4ng/mL)；10-10(1.9×10-5ng/mL)；
FIG. 7 is a macroscopic view of fluorescent dyes for detecting ALSV virus specificity by GICA-RT-LAMP in the embodiment of the present invention; in the figure: 1: negative control; 2-12 correspond to: healthy angelica tissue; LSV lily susceptible tissue; CMV-Li Lilium susceptible tissue; LMoV lily susceptible tissue; AMV Angelica sinensis infected tissue; JHMV Angelica sinensis susceptible tissue; plamv lily susceptible tissue; LNYV lettuce susceptible tissue; LMV lettuce susceptible tissue; CMV lettuce susceptible tissue; the ALSV angelica tissue is infected with diseases.
Reference numerals: 1-a card slot; 2-a sample application window; 3-reaction observation window; 4-sample pad; 5-colloidal gold bonding pad; 6-nitrocellulose membrane; 7-an absorbent pad; 8-lining board; 9-detecting the T line; 10-quality control C line.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
The features and properties of the present invention are described in further detail below with reference to examples.
Example 1
Referring to fig. 1 and 2, the present embodiment provides a detection card for latent apple virus, which includes a card slot 1. The card slot 1 is composed of a lower casing and an upper casing (reference numerals are not shown in the figure), and the lower casing and the upper casing are arranged to be connected in a buckling manner in the embodiment. An installation cavity for placing the lining plate 8 is reserved between the upper shell and the lower shell. The lining plate 8 is fixedly connected with one end surface of the lower shell.
A sample pad 4, a colloidal gold bonding pad 5, a nitrocellulose membrane 6 and an absorption pad 7 are sequentially arranged on a lining plate 8, the colloidal gold bonding pad 5 contains a colloidal gold-apple latent spherical virus antibody conjugate, the nitrocellulose membrane 6 is sequentially provided with a detection T line 9 and a quality control C line 10 along the chromatography direction, the detection T line 9 is coated with ALSV antibody IgG, and the quality control C line 10 is coated with a secondary antibody of an anti-ALSV antibody; detecting the coating amount of the antibody IgG of the ALSV on the T line 9, wherein 1.0-1.5 mu g of protein is coated on each 2mm line width; the coating amount of the secondary antibody of the anti-ALSV antibody is 1.5-2.0 mu g of protein coated on each 2mm line width, and the secondary antibody of the anti-ALSV antibody in the embodiment is goat anti-rabbit IgG; the coating amount of the apple latent spherical virus antibody on the colloidal gold conjugate pad 5 was 80. mu.g of the apple latent spherical virus antibody per 5mL of the colloidal gold. In this example, the apple latent spherical virus antibody on the colloidal gold conjugate pad 5 is a rabbit anti-ALSV polyclonal antibody.
Go up the interval on the casing and be provided with application of sample window 2 and reaction observation window 3, application of sample window 2 is located the top of sample pad 4 in the space, and reaction observation window 3 is located the top of nitrocellulose membrane 6 in the space.
The preparation method of the detection card comprises the following steps:
1. firstly, polyclonal antibody IgG of the apple latent spherical virus ALSV is prepared.
Expression and purification of ALSV CP coat protein: extracting total RNA from the leaves (collected in the field) of the angelica infected with ALSV to carry out reverse transcription polymerase chain reaction (RT-PCR), and amplifying CP coat protein gene segments of the ALSV; cloning to pET-28a vector by enzyme digestion; transferring the recombinant plasmid into a bacillus coli BL21(DE3) strain, culturing at 37 ℃, carrying out IPTG induced expression, and purifying by nickel column affinity chromatography to obtain ALSV CP coat protein with the size of 64.2 kDa;
preparing a polyclonal antibody: immunizing New Zealand white rabbits with 1mg/mL of the above purified ALSV CP coat protein as an immunogen; in the primary immunization, the protein antigen and Freund's complete adjuvant are mixed uniformly in equal volume, and subcutaneous multipoint injection is carried out; after primary immunization for 21d, 1.0mg/ml of purified protein is mixed with equivalent volume of Freund incomplete adjuvant, and after full emulsification, subcutaneous multi-point injection is used as the first enhanced immunity; subsequently, every 21d interval, boosting was performed by subcutaneous multiple injections. 3 times of boosting immunity is carried out in total, blood is collected from carotid artery 5-7 d after 4 times of boosting immunity, the blood is stood still and centrifuged, and the collected blood serum is added with sodium azide with the mass percentage concentration of 0.02 percent and is preserved at the temperature of minus 20 ℃; the obtained antiserum is dialyzed to phosphate buffer solution with pH7.8 by a saturated ammonium sulfate precipitation method, and then purified by a protein A affinity chromatography method to obtain rabbit anti-ALSV polyclonal antibody IgG.
2. Method for labeling rabbit anti-ALSV polyclonal antibody by colloidal gold
Respectively taking 5mL of colloidal gold with the particle size of 30nm and 80 mu g of rabbit anti-ALSV polyclonal antibody, stirring and vibrating by magnetic force under the condition of pH7.5 to combine the antibodies, adding 10% Bovine Serum Albumin (BSA) and 5% PEG20000 as stabilizers to make the final concentrations respectively be 0.5% and 0.2%, removing the unbound polyclonal antibody, the unstable colloidal gold particles and the de-aggregates by adopting a low-temperature high-speed centrifugation method, and obtaining the colloidal gold-antibody conjugate by deep red precipitation at the bottom of a centrifuge tube.
3. Preparation of colloidal gold conjugate pad
And (3) suspending the colloidal gold-antibody conjugate in 1/10 labeled resuspension solution with the volume of the previous colloidal gold solution, centrifuging, coating the supernatant on a glass cellulose membrane by using a spraying device, and drying at 37 ℃ to prepare the colloidal gold conjugate pad.
4. Coating of immunochromatographic membranes
The detection T line is coated with purified rabbit anti-ALSV polyclonal antibody IgG, the control C line is coated with goat anti-rabbit IgG antibody, each line width is 2mm, the appropriate coating amount of the rabbit anti-ALSV polyclonal antibody is 1.4 mu g of protein, and the appropriate coating amount of the goat anti-rabbit IgG purified antibody is 1.6 mu g of protein.
5. Assembly of colloidal gold immunochromatography GICA detection card
The polyvinyl chloride lining plate body serving as a supporting carrier is fixed in the lower shell of the detection clamping groove, the sample pad, the colloidal gold bonding pad, the nitrocellulose membrane and the water absorption filter paper (namely the absorption pad 7) are sequentially connected to the upper surface of the polyvinyl chloride lining plate in an arranging mode, and then the upper shell of the GICA detection clamping groove is connected with the lower shell through the buckle.
The embodiment also provides a detection method of the detection card, which comprises the following steps:
referring to fig. 1, a small amount of solution to be detected of a sample is sucked, the solution to be detected is dripped on a sample adding window 2 of an upper shell of a GICA detection card slot, the liquid moves forwards under the capillary effect, if the solution to be detected contains ALSV, when the detection sample passes through a colloidal gold binding pad, the ALSV and a gold-labeled polyclonal antibody on the gold-labeled pad form a compound, then the compound is subjected to chromatography electrophoresis in the direction of a detection T line, and when the detection T line is contacted, the compound and the ALSV polyclonal antibody on the detection T line are subjected to antigen-antibody binding reaction and are intercepted, and a visible brownish red strip is formed; the unbound complexes continue to migrate toward the control C line, and when contacting the control C line, the unbound complexes bind to the goat anti-rabbit IgG antibody immobilized on the control C line and are trapped, forming a visible red-brown band. Namely, when red brown strips appear on the detection T line and the quality control C line, the detected sample is judged to be infected with the apple latent spherical virus ALSV.
If the liquid to be detected does not contain ALSV or has low ALSV content, when a detection sample passes through the colloidal gold binding pad, the detection sample cannot be bound with the gold-labeled polyclonal antibody on the gold-labeled pad or the bound complex is very little, when the detection sample contacts the detection T line, no reaction occurs, the gold-labeled polyclonal antibody continuously migrates to the direction of the quality control C line, and when the detection sample contacts the quality control C line, the gold-labeled polyclonal antibody is bound with the goat anti-rabbit IgG antibody fixed on the quality control C line and is retained, so that a visible brownish red strip is formed. That is, when the detection line has no color change and only the quality control C line has a reddish brown band, it is determined that the sample to be detected is not infected with the cryptococcal apple virus ALSV or the content of the cryptococcal apple virus ALSV is low, and subsequent further detection and judgment are required.
Therefore, the detection card provided by the invention can be used for preliminarily and rapidly screening the latent spherical viruses of the apples, meets the requirement of on-site detection in fields and other scenes, can preliminarily judge the virus infection condition of a detected sample within 3-5 minutes, and achieves the purpose of rapidly, simply and efficiently detecting the ALSV.
Example 2
The embodiment provides a GICA-RT-LAMP kit for detecting angelica ALSV. Which comprises the apple latent spherical virus colloidal gold immunochromatography GICA detection card prepared in example 1; RT-LAMP specific primer composition and RT-LAMP amplification reaction reagent.
The RT-LAMP specific primer composition comprises a forward outer primer F3 shown in SEQ ID NO.1, a reverse outer primer B3 shown in SEQ ID NO.2, a forward inner primer FIP shown in SEQ ID NO.3 and a reverse inner primer BIP shown in SEQ ID NO. 4.
The sequence is as follows:
F3：5’-CCTGCGAATATTATAAATCTAGCAT-3’；
B3：5’-CTGTACATATTACTGGTAAAACACA-3’；
FIP：
5’-TTGTGCGCTCATCTTGAGGGGAGCAGGTAACAAGCCAAT-3'；
BIP：
5’-CAGTGCCTAAATCAAATGGGTTAAAGCAACTTTCTATAGGCCCTAA-3’。
the RT-LAMP amplification reaction reagent consists of 10U/. mu.L AMV reverse transcriptase, 40U/. mu.L RNase inhibitor, 10mM dNTP mixture, 10 XThermoPol reaction buffer solution and 100mM MgSO4、8U/μL Bst DNA polymerase and RNA-free H2And (C) O.
In addition, the GICA-RT-LAMP kit also comprises Phosphate Buffer Solution (PBS), phosphate washing buffer solution (PBST), fluorescent dye detection solution, a negative control and a positive control.
Phosphate Buffer (PBS) and phosphate wash buffer (PBST) were 0.02M at pH 7.4;
the fluorescent dye detection solution is 1000 XSYBR Green I;
the negative control is RNA-free H2O；
The positive control is radix Angelicae sinensis ALSV CP gene standard.
The embodiment also provides a preparation method of the ALSV CP gene standard substance. The preparation method comprises the following steps:
1. extraction of total RNA:
grinding 50-100mg of ALSV infected angelica leaves in liquid nitrogen, and extracting total RNA of an affected tissue by using a plant total RNA extraction kit;
2. and (3) designing and synthesizing a primer.
According to a sequence obtained by small RNA sequencing, 1 pair of specific forward (ALSV-F) and reverse primers (ALSV-R) of the ALSV CP gene are designed and synthesized; wherein the primer sequences are as follows:
ALSV-F：5’-TTGTATCAACCGTTCCTCCT-3’
ALSV-R：5’-TGCTACCATTCGTGTCTCTG-3’；
3. preparation of Positive control
1) RT reaction
Performing RT reaction by using the ALSV reverse primer ALSV-R and M-MLV reverse transcriptase to synthesize a first cDNA chain; the 10. mu.L RT reaction system was 2. mu.L total RNA, 10. mu.M ALSV specific reverse primer ALSV-R1. mu.L, RNA-free H2Changing the temperature of O3 mu L for 10min at 70 ℃, and rapidly cooling on ice for 2 min; then adding 2 μ L of 5 XM-MLV buffer, 1 μ L of 10mM dNTPs, 0.34 μ L of 30U/μ L RNase inhibitor, 0.35 μ L of 200U/μ L M-MLV reverse transcriptase and 0.31 μ L of RNA-free; mixing, heating in 42 deg.C water bath for 1h, keeping the temperature at 70 deg.C for 15min, and placing on ice;
2) PCR reaction
Performing PCR amplification of ALSV CP gene under the action of Ex Taq DNA polymerase by using the cDNA first chain as a template;
the PCR reaction system was 12.5. mu.L, and included: 50ng cDNA 0.5. mu.L, 5U/. mu.L Ex Taq DNA polymerase 0.1. mu.L, 10 XPCR buffer 1.25. mu.L, 2.5mM dNTPs 1. mu.L, 10. mu.M forward primer ALSV-F0.25. mu.L, 10. mu.M reverse primer ALSV-R0.25. mu.L, ddH2O is complemented to 12.5 mu L;
the PCR amplification conditions were: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 30s, annealing at 51 ℃ for 45s, extension at 72 ℃ for 45s, cyclic amplification for 35 times, and extension at 72 ℃ for 7 min;
detecting the PCR product by 1.5% agarose gel electrophoresis, recovering a target fragment, connecting the target fragment to a pMD18-T vector by using a cloning vector kit, transforming DH5 alpha competent cells, and carrying out blue-white spot plate screening; randomly selecting 3 white spot colonies, respectively inoculating the white spot colonies on an ampicillin (LB) culture medium, and performing shake culture at 37 ℃ for 12-16 h; extracting plasmids by using a plasmid micro-extraction kit; respectively taking 1 mu L of plasmid, and carrying out PCR amplification under the same condition with the PCR reaction system; sequencing the positive recombinant plasmid obtained by PCR detection; the positive plasmid with completely correct sequence is confirmed by sequencing, namely the positive control, and the lengths of the fragments corresponding to the angelica ALSV CP gene are 638bp respectively; measuring the plasmid concentration of the standard substance by using a NanoDrop ND-1000 nucleic acid/protein analyzer;
3. positive control sequence
Sequencing shows that the positive control completely conforms to the expected result, and the sequence of the recovered control fragment is as follows:
the standard sequence of the angelica ALSV CP gene fragment:
TTGTATCAACCGTTCCTCCTGAAAATTTTTCAAAGGAGTAATTATCAGTACCTGCGAATATTATAAATCTAGCATTAGTGAGGGCTGAGCAGGTAACAAGCCAATTTACGACCAAATCACCAGAATAGCCCTCAAGATGAGCGCACAAAGACTGAAATCTATTAAATACAGTGCCTAAATCAAATGGGTTAAAATGAAATCTAGCTATAGAGGGTTTAGGGCCTATAGAAAGTTGCTGTGTTTTACCAGTAATATGTACAGGAAAATTGGGAATGCTCAGACAAGCTCCCTGACCTATGTTATAAAAAGTGGTTTTAACATCCACAATAGAAAAATTAAATGTACAAGAGAAGCTCTCAGGCATATTTTCCGTCAAATTAGGTGCGCTAAGAGCTGCCAAATGTACCTTGCCAAGGAGCTTGTTATTATCAAACTTAAGGTGAACCCCTGGCGAAAATAACTCAAAATCAAAAGAAAACTCTTCTTCCTGAGTACTAAAGATAGCACCAGGGAGAACACTGATCTTGCCAAAATCAGTGGTATCAGAGCTCAATTGCATAAGCTCATCATACACAAGTTTCAAAGCRAAACTGCAGAATTTACTAAGCRTAACTTTAGCAGAGACACGAATGGTAGCA。
example 3
This example provides a method for detecting ALSV using the GICA-RT-LAMP kit of example 2.
1. Colloidal gold immunochromatography GICA enriched virus particle
1) Putting 100mg of an ALSV-infected Chinese angelica sample or other samples to be detected into a 3mL self-sealing bag filled with phosphate buffer PBS, and lightly grinding the sample by using a grinding rod, wherein the ground tissue fluid is the detection fluid of the samples to be detected;
2) and (3) sucking a small amount of detection liquid of the sample to be detected, dripping the detection liquid at the sample adding window 2 of the ALSV colloidal gold immunochromatography GICA detection card, and observing a color development result in the reaction observation window 3 within 3-5 minutes.
2. First judging the reaction result
When brownish red strips appear on the detection T line 9 and the quality control C line 10 in the ALSV colloidal gold immunochromatography GICA detection card reaction observation window 3, the detected sample is judged to be infected by the apple latent spherical virus ALSV, and subsequent detection is not needed.
When the detection T line 9 in the ALSV colloidal gold immunochromatographic GICA detection card reaction observation window 3 has no color change and a brownish red strip appears on the quality control C line 10, the detected sample is judged to be not infected with the apple latent globular virus ALSV or to be slightly infected with the ALSV, and then the subsequent reverse transcription RT-LAMP detection is required.
3. The RT-LAMP reaction process is as follows:
1) cutting off a detection T line of the ALSV colloidal gold immunochromatographic GICA detection card after the reaction is finished, washing the T line with PBST for three times, carefully scraping the T line area with a disinfection blade, and putting the T line area into a PCR tube;
2) to the above-mentioned PCR tube containing T-line were added 40U/. mu.L RNAse inhibitor 0.15. mu.L, 10U/. mu.L LAMV reverse transcriptase 0.3. mu.L, 10 XThermoPol buffer 1.25. mu.L, 100mM MgSO40.75. mu.L, 1.75. mu.L of 10mM dNTP mix, 1.0. mu.L of LAMP primer set containing 2.5. mu. M B3 and F3, 20.0. mu.M FIP and BIP, respectively, and 8U/. mu.L of Bst DNA polymerase 1.0μL、RNAse free H2O is added to the solution to be 12.5 mu L; with RNA-free H2Taking O as a negative control, and taking the angelica ALSV CP gene standard product as a positive control; after the reaction system is configured, adding 1 mu L of 100 × SYBR Green I fluorescent dye working solution on the inner wall of the PCR tube cap, tightly covering the PCR tube cap, and carrying out RT-LAMP reaction; the reaction conditions of RT-LAMP are that amplification is carried out for 50-100min at 56-66 ℃, then denaturation is carried out for 10min at 80 ℃, and the reaction is stopped.
4. And judging the reaction result for the second time.
After the RT-LAMP reaction is finished, the PCR tube is centrifuged or slightly thrown without opening the cover, so that SYBR Green I fluorescent dye on the inner wall of the PCR tube cover is mixed with LAMP amplification products, the mixture is inverted and mixed up and down, and the color change of the mixed liquid in the PCR tube is observed by naked eyes:
if the color of the mixed solution is changed into Green, the SYBR Green I dye is combined with the double-stranded DNA, a positive reaction is carried out, and the detected sample contains the apple latent spherical virus ALSV;
if the color of the mixture is orange, a negative reaction is indicated, indicating that the sample does not contain the apple latent spherical virus ALSV.
Experimental example 1
The experimental example provides a fluorescent dye macroscopic observation experiment of the GICA-RT-LAMP kit for detecting ALSV in the example 2 under different reaction temperatures and reaction times, and the detection method is shown in the reference example 3.
The amplification results of RT-LAMP amplification at the temperature of 56 deg.C, 58 deg.C, 60 deg.C, 62 deg.C, 64 deg.C, 66 deg.C, 68 deg.C and 70 deg.C for 80min were tested, respectively. FIG. 3, in which: 1: negative control; 2-9 correspond to: 56 deg.C, 58 deg.C, 60 deg.C, 62 deg.C, 64 deg.C, 66 deg.C, 68 deg.C and 70 deg.C. As can be seen from the figure, the amplification primer combination provided by the embodiment of the invention can realize high-efficiency amplification of the target gene at 56-66 ℃.
The amplification results of the RT-LAMP at the amplification temperature of 60 ℃ under the RT-LAMP amplification time of 20min, 30min, 40min, 50min, 60min, 70min, 80min, 90min and 100min are respectively tested. FIG. 4, in which: 1: negative control; 2-10 correspond to: 20min, 30min, 40min, 50min, 60min, 70min, 80min, 90min, 100 min. As can be seen from the figure, the amplification primer combination provided by the embodiment of the invention can realize the high-efficiency amplification of the target gene under the condition of 50-100 min.
Experimental example 2
The experiment example carries out a sensitivity experiment of detecting ALSV by colloidal gold immunochromatography GICA-RT-LAMP.
The Angelica sinensis ALSV CP gene standard substance in example 2 is used as a sample, and the concentration is measured by a NanoDrop ND-1000 nucleic acid/protein analyzer (1.9 is multiplied by 10)5ng/mL), and then RNA-free H2O the above standard was diluted 10-fold and stored at-20 ℃ as a template. Taking 1.0 mu L of each diluted solution with 10 times of ratio as a template, adding the RT-LAMP reaction reagent in the embodiment 2 for RT-LAMP amplification, wherein the reaction program is amplification at 60 ℃ for 80 min;
for comparative detection, each of the dilutions diluted 10-fold was subjected to PCR amplification. The PCR amplification conditions were: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 30s, annealing at 51 ℃ for 45s, extension at 72 ℃ for 45s, cyclic amplification for 35 times, and final extension at 72 ℃ for 7 min;
after the RT-LAMP reaction is finished, the visualization condition is observed by an SYBR Green I fluorescent dye macroscopic observation method, and the result shows that the reaction sensitivity of GICA-RT-LAMP on the angelica ALSV CP gene standard substance is 1.9 multiplied by 10-4ng/mL, i.e., 0.19pg/mL (FIG. 5); after the PCR reaction is finished, 5 mu L of amplification product is sampled, and the agarose gel electrophoresis result shows that the reaction sensitivity of GICA-RT-PCR to the angelica ALSV CP gene standard substance is 1.9 multiplied by 10-2ng/mL, i.e., 19pg/mL (FIG. 6), it can be seen that the sensitivity of colloidal gold immunochromatography GICA-RT-LAMP for ALSV detection is 100 times that of GICA-RT-PCR.
Experimental example 3
Detecting the specificity of ALSV by colloidal gold immunochromatography GICA-RT-LAMP.
Using 10 common viruses infected with lily, angelica and lettuce, namely lily insidiosis virus LSV, lily cucumber mosaic virus CMV-Li, lily mottle virus LMoV, lily plantain mosaic virus PlAMV, angelica alfalfa mosaic virus AMV, angelica Japanese goldfish algae mosaic virus JHMV, lettuce necrosis yellowing virus LNYV, lettuce mosaic virus LMV, lettuce cucumber mosaic virus lettuce CMV-L and angelica apple latent globular virus ALSV (field collection) as samples, respectively and lightly grinding the samples in a self-sealing bag filled with PBS buffer solution by using a grinding rod to prepare a detection solution, and dropwise adding the detection solution into a sample adding window 3 of an ALSV colloidal gold immunochromatography GICA detection card to observe a color development result after 3-5 minutes; then, the GICA-RT-LAMP detection system and the detection method in the above embodiment are used for RT-LAMP amplification, the reaction program is amplification at 60 ℃ for 80min, and color development is carried out after the amplification is finished. Taking healthy angelica leaves as negative control, and repeating the experiment for 3 times;
the color development result of the ALSV colloidal gold immunochromatographic GICA detection card shows that only the detection T line and the quality control C line of the ALSV infected angelica leaf sample have brownish red strips, while the detection T lines of other samples have no color change and the quality control C line has brownish red strips;
the results of SYBR Green I fluorescent dye visual observation show that only the amplification products of the angelica leaves infected with ALSV are Green, and the amplification products of the other susceptible leaves and the amplification products of the healthy angelica leaves are orange (FIG. 7); the GICA-RT-LAMP method established by the invention has high specificity to ALSV virus and has no cross reaction with other common viruses.
Experimental example 4
And (3) detecting field samples by colloidal gold immunochromatography GICA-RT-LAMP.
Taking a field angelica sinensis leaf sample, detecting the virus particles enriched by the card by ALSV colloidal gold immunochromatography GICA, and performing RT-LAMP amplification by using the GICA-RT-LAMP detection system in the embodiment;
if brownish red strips appear on the detection T line and the quality control C line of the GICA detection card, judging that the detected sample is infected with the apple latent spherical virus ALSV;
if the GICA detection card detects that the T line has no color change, a brownish red strip appears on the quality control C line, and meanwhile, the green strip is displayed by a fluorescent dye visual observation method, which indicates that the sample contains the apple latent spherical virus ALSV;
if the GICA detection card detects that the T line has no color change, a brownish red strip appears on the quality control C line, and meanwhile, the orange is displayed by a fluorescent dye visual observation method, which indicates that the sample does not contain the apple latent spherical virus ALSV.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> northwest institute of ecological environmental resources of academy of Chinese sciences
<120> detection kit and detection method for apple latent spherical virus
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 25
<212> DNA
<213> Artificial sequence
<400> 1
cctgcgaata ttataaatct agcat 25
<210> 2
<211> 25
<212> DNA
<213> Artificial sequence
<400> 2
ctgtacatat tactggtaaa acaca 25
<210> 3
<211> 39
<212> DNA
<213> Artificial sequence
<400> 3
ttgtgcgctc atcttgaggg gagcaggtaa caagccaat 39
<210> 4
<211> 46
<212> DNA
<213> Artificial sequence
<400> 4
cagtgcctaa atcaaatggg ttaaagcaac tttctatagg ccctaa 46

Claims (13)

1. A GICA-RT-LAMP kit for detecting an Apple Latent Spherical Virus (ALSV) infecting angelica sinensis is characterized by comprising a detection card of the apple latent spherical virus and a primer composition for detecting the apple latent spherical virus, wherein the primer composition comprises a forward outer primer F3 shown by SEQ ID No.1, a reverse outer primer B3 shown by SEQ ID No.2, a forward inner primer FIP shown by SEQ ID No.3 and a reverse inner primer BIP shown by SEQ ID No.4, the detection card comprises a sample pad, a colloidal gold binding pad, a nitrocellulose membrane and an absorption pad which are sequentially arranged on a lining plate, the colloidal gold binding pad contains a colloidal gold-apple latent spherical virus antibody combination, a detection T line and a quality control C line are sequentially arranged on the nitrocellulose membrane along the chromatographic direction, the detection T line is wrapped by ALSV antibody IgG, the quality control C line is coated with a secondary antibody of an anti-ALSV antibody; the coating amount of the IgG antibody for detecting the ALSV on the T line is 1.0-1.5 mu g of protein coated on each 2mm line width; the coating amount of the secondary antibody of the anti-ALSV antibody is 1.5-2.0 mu g of protein coated on each 2mm line width;
the coating amount of the apple latent spherical virus antibody on the colloidal gold bonding pad is that each 1mL of colloidal gold contains 15-16 mug of apple latent spherical virus antibody.
2. The GICA-RT-LAMP kit for detecting the apple latent orbivirus (ALSV) infecting angelica according to claim 1, wherein the detection card further comprises a card slot consisting of a lower shell and an upper shell, the card slot has an installation cavity for placing the lining plate, the lining plate is fixedly connected with the inner wall of the lower shell, and the upper shell is fixedly connected with the lower shell.
3. The GICA-RT-LAMP kit for detecting the Angelica sinensis-infecting Apple Latent Spherical Virus (ALSV) according to claim 2, wherein the upper case is provided with a sample application window and a reaction observation window at intervals, the sample application window is spatially located above the sample pad, and the reaction observation window is spatially located above the nitrocellulose membrane.
4. The GICA-RT-LAMP kit for detecting the Apple Latent Spherical Virus (ALSV) infecting angelica according to claim 3, wherein the upper shell and the lower shell are clamped by a buckle structure.
5. The GICA-RT-LAMP kit for detecting the Angelica sinensis-infecting apple latent globular virus (ALSV) according to claim 1, further comprising a RT-LAMP amplification reaction reagent comprising reverse transcriptase, RNase inhibitor, dNTP mixture, reaction buffer, MgSO4DNA polymerase and water.
6. The GICA-RT-LAMP kit for detecting Angelica sinensis-infecting apple latent globular virus (ALSV) according to claim 5, wherein the reverse transcriptase is selected from AMV reverse transcriptase or M-MLV reverse transcriptase, and the reaction buffer is selected from ThermoPol reaction buffer.
7. The GICA-RT-LAMP kit for detecting the Angelica sinensis-infecting Apple Latent Spherical Virus (ALSV) according to claim 5, wherein the DNA polymerase is selected from the group consisting ofBstA DNA polymerase.
8. The GICA-RT-LAMP kit for detecting the Apple Latent Spherical Virus (ALSV) infecting angelica according to claim 1, wherein the kit further comprises a phosphate buffer, a phosphate washing buffer, a fluorescent dye detection solution, a negative control and a positive control.
9. The GICA-RT-LAMP kit for detecting the Angelica sinensis-infecting Apple Latent Spherical Virus (ALSV) according to claim 8, wherein the negative control is water, and the positive control is the Angelica sinensis apple latent spherical virus coat proteinCPAnd (4) gene fragment standard.
10. A detection method for detecting angelica sinensis-infecting apple cryptococcal virus (ALSV) using the GICA-RT-LAMP kit for detecting angelica sinensis-infecting apple cryptococcal virus (ALSV) according to any one of claims 1 to 9, comprising:
(1) sampling a solution to be detected onto a sample pad of a detection card of the apple latent spherical virus, observing the color change of a detection T line and a quality control C line, and primarily judging whether the sample to be detected contains the apple latent spherical virus ALSV;
(2) if the sample to be detected cannot be identified to contain the apple latent spherical virus ALSV according to the step (1), carrying out reverse transcription RT-LAMP amplification: taking down the detection T line on the detection card after the immune enrichment reaction in the step (1), and carrying out RT-LAMP amplification by using the RT-LAMP detection primer composition by taking the taken-down detection T line as a template; and judging whether the sample to be detected contains the apple latent spherical virus or not according to the RT-LAMP amplification reaction product twice.
11. The method for detecting the angelica-infested apple latent spherical virus according to claim 10, wherein the specific method for primarily judging whether the sample to be detected contains the ALSV according to the color changes of the detection T line and the quality control C line is a visual observation method; the visual observation method comprises the following steps:
if brownish red strips appear on the T line and the quality control C line, the sample to be detected contains the apple latent spherical virus ALSV, and reverse transcription RT-LAMP amplification is not needed;
and if the T line is detected to have no color change and only the quality control C line has a brownish red strip, judging that the detected sample is not infected with the apple latent spherical virus ALSV or the content of the infected apple latent spherical virus ALSV is low, and performing reverse transcription RT-LAMP amplification.
12. The method for detecting the apple latent spherical viruses infecting angelica according to claim 10, wherein the specific method for secondarily judging whether the sample to be detected contains the apple latent spherical viruses according to the RT-LAMP amplification reaction product is a fluorescent dye macroscopic observation method; the macroscopic observation method of the fluorescent dye comprises the following steps:
adding a fluorescent dye reaction solution to a tube cover of an RT-LAMP amplification reaction tube before reaction, mixing a fluorescent dye detection solution with the LAMP reaction solution after the LAMP amplification reaction is finished, and directly observing the color of the mixed reaction solution by naked eyes:
the fluorescent dye reaction solution is SYBR Green I, if the amplification product has Green fluorescence, the sample to be detected contains the apple latent spherical virus;
if the color of the amplification product is orange, the sample to be detected does not contain the apple latent spherical virus.
13. Use of the GICA-RT-LAMP kit according to any one of claims 1 to 9 for the detection of angelica sinensis-infecting apple latent orbivirus (ALSV) for the detection of angelica sinensis-infecting apple latent orbivirus.
CN202111329625.9A 2021-11-09 2021-11-09 Detection kit and detection method for apple latent spherical viruses Active CN113913558B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202111329625.9A CN113913558B (en) 2021-11-09 2021-11-09 Detection kit and detection method for apple latent spherical viruses
NL2033239A NL2033239B1 (en) 2021-11-09 2022-10-05 Test kit and test method for apple latent spherical virus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111329625.9A CN113913558B (en) 2021-11-09 2021-11-09 Detection kit and detection method for apple latent spherical viruses

Publications (2)

Publication Number Publication Date
CN113913558A CN113913558A (en) 2022-01-11
CN113913558B true CN113913558B (en) 2022-07-19

Family

ID=79245963

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111329625.9A Active CN113913558B (en) 2021-11-09 2021-11-09 Detection kit and detection method for apple latent spherical viruses

Country Status (2)

Country Link
CN (1) CN113913558B (en)
NL (1) NL2033239B1 (en)

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP3977189B2 (en) * 2002-08-01 2007-09-19 独立行政法人科学技術振興機構 Gene transfer method to fruit tree using apple latent virus
CN102634608B (en) * 2012-04-18 2015-04-08 西北农林科技大学 Method for detecting apple viruses by adopting reverse transcription loop-mediated isothermal amplification technology
CN104122390B (en) * 2014-04-14 2015-04-15 中国科学院寒区旱区环境与工程研究所 Reagent card for detecting lily symptomless virus by adopting colloidal gold immunochromatographic assay and preparation method
CN106596935A (en) * 2016-12-26 2017-04-26 山西师范大学 Preparation method for multiplex immunocolloidal gold test strip used for apple latent viruses
CN108754025A (en) * 2018-06-21 2018-11-06 中国科学院寒区旱区环境与工程研究所 A kind of kit and its detection method of the hidden syndrome virus of specific detection lily
CN113564128B (en) * 2021-08-17 2022-05-13 山东农业大学 Colloidal gold immune test strip for detecting tomato brown wrinkled fruit virus and preparation method thereof

Also Published As

Publication number Publication date
CN113913558A (en) 2022-01-11
NL2033239A (en) 2023-06-05
NL2033239B1 (en) 2023-06-26

Similar Documents

Publication Publication Date Title
CN105154576B (en) The quickly primer pair of detection nosema bombycis and its kit and detection method
CN104730238A (en) ELISA detection kit for detecting porcine epidemic diarrhea virus antibody and use method and application of ELISA kit
Salem et al. Polyclonal antibodies against the recombinantly expressed coat protein of the Citrus psorosis virus
CN112111006B (en) Antibody for resisting bovine sarcoidosis virus, detection test paper and kit
CN109053883B (en) Binding protein of NS1 protein
CN108754026A (en) Detect the kit and detection method of lily arabis mosaic virus
CN108796127A (en) A kind of kit and its detection method of specific detection lily mottle virus
CN113913555B (en) Detection card and detection kit for brassica flaviviruses
CN114107561B (en) GICA-RT-LAMP kit and detection card for detecting alfalfa mosaic virus
CN108624713B (en) Method and kit for identifying and detecting porcine pseudorabies vaccine virus and wild virus
CN113913558B (en) Detection kit and detection method for apple latent spherical viruses
CN113862338B (en) Primer composition for detecting Scotryopeltis-mottle virus and GICA-RT-LAMP kit
CN114019159B (en) Detection primer composition and kit for Japanese yam mosaic virus and application of detection primer composition and kit
CN108872580B (en) Colloidal gold test strip for detecting novel goose parvovirus and preparation method thereof
CN113846095B (en) Detection card, detection primer composition and GICA-RT-LAMP kit for plantain mosaic virus
RU2803155C1 (en) Test card and test kit for detection of brassica yellows virus
CN102140516B (en) Primer for detecting CAMV35S genes, relevant kit and detecting method
WO2020156102A1 (en) Ic-rt-lamp reagent kit for detecting lettuce necrotic yellows virus and detection method thereof
CN104651379A (en) Recombinant porcine epidemic diarrhea virus N protein and preparation method thereof
CN113549626A (en) Aptamer Pr-A08 specifically bound with procymidone and application thereof
EP2571985A1 (en) Method for isolating small rna-molecules using hc-pro protein
CN112851803A (en) Monoclonal antibody ZJU10-01 for resisting H10 subtype avian influenza virus hemagglutinin protein and application thereof
CN108754025A (en) A kind of kit and its detection method of the hidden syndrome virus of specific detection lily
CN117867152B (en) Nucleic acid primer group for detecting bacterial wilt, product containing same and application
CN112724249B (en) Monoclonal antibody ZJU9-01 for resisting H9 subtype avian influenza virus hemagglutinin protein and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant