RU2798988C2 - Bispecific trivalent antibodies binding to claudin 6 or claudin 18.2 and cd3 for the treatment of oncological diseases with claudin expression - Google Patents

Abstract

FIELD: biochemistry.

SUBSTANCE: invention relates to a binding agent that binds to the T-cell specific antigen CD3 and claudin 6 (CLDN6). Also disclosed is a nucleic acid or a mixture of nucleic acids encoding the said agent; a host cell containing the said nucleic acid; a vector or composition of vectors containing the said nucleic acid; a host cell containing the said nucleic acid; and a pharmaceutical composition containing the said agent. The use of the specified binding agent as a drug, and a method for the treatment or prevention of cancer, using the specified agent are disclosed.

EFFECT: invention makes it possible to effectively treat diseases associated claudin 6 expression.

34 cl, 14 ex, 10 tbl, 18 dwg

Description

Claudins are membrane-integrated proteins located in tight junctions between epithelium and endothelium. It is assumed that claudins have four transmembrane segments with two extracellular loops and N- and C-termini located in the cytoplasm. The claudin transmembrane protein family (CLDN) plays a critical role in maintaining epithelial and endothelial tight junctions and may also play a role in maintaining the cytoskeleton and in cell signaling.

CLDN18 exists in two distinct splice variants that have been described in mice and humans (Niimi, Mol. Cell. Biol. 21:7380-90, 2001). Splice variants (Genbank accession number: splice version 1 (CLDN18.1): NP_057453, NM_016369 and splice version 2 (CLDN18.2): NM_001002026, NP_001002026) have a molecular weight of approximately 27.9/27.72 kDa. Splice variants CLDN18.1 and CLDN18.2 differ in the N-terminal portion, which includes the first transmembrane (TM) region and loop 1, while the primary protein sequence of the C-terminus is identical.

No expression of CLDN18.2 is found in normal tissues, with the exception of the stomach, where CLDN18.2 is expressed exclusively on short-lived differentiated gastric epithelial cells. CLDN18.2 is maintained during malignant transformation and thus is frequently presented on the surface of human gastric cancer cells. In addition, this pan-tumor antigen is ectopically upregulated at significant levels in adenocarcinomas of the esophagus, pancreas, and lungs. The CLDN18.2 protein is also localized in lymph node metastases from adenocarcinoma of gastric cancer and in distant metastases, especially in the ovary (the so-called Krukenberg tumors).

CLDN6 is expressed in a number of different human cancer cells, while expression in normal tissues is restricted to the placenta.

The differential expression of claudins such as CLDN18.2 and CLDN6 between cancer and normal cells, their membrane localization, and their absence in the vast majority of normal tissues make these molecules attractive targets for cancer immunotherapy and the use of antibody-based therapeutics to target claudins. in the treatment of cancer promises a high level of therapeutic specificity.

The purpose of the invention was to create new agents and methods for the treatment of cancer.

The solution to the problem underlying the invention is based on the concept of creating a binding agent that includes two binding domains that are specific for a claudin molecule associated with a tumor, ie cancer cells. The binding agent also includes a binding domain that is specific for a T cell specific antigen such as CD3, allowing T cells to bind and assemble the T cells into a complex, thus allowing the targeted cytotoxic effect of the T cells against cancer cells. The formation of this complex can induce signaling in cytotoxic T cells, either alone or in combination with additional cells, resulting in the release of cytotoxic mediators.

We report for the first time that binding agents comprising two binding domains targeting claudin and another binding domain targeting a T cell specific antigen such as CD3 can induce potent T cell mediated lysis and are effective in treating neoplastic diseases. .

The essence of the invention

The invention provides a binding agent comprising at least three binding domains, wherein the first binding domain binds to a T-cell specific antigen, and the second binding domain and the third binding domain bind to claudin. The binding agent of the invention can bind to a T cell (eg, by engaging the CD3 receptor) and a claudin-expressing cancer cell to be targeted.

In one embodiment, the binding agent comprises six antibody variable domains with at least three binding domains, where at least two binding domains bind to claudin and at least one binding domain binds to a T cell specific antigen.

In one embodiment, each of the first, second, and third binding domains comprises an immunoglobulin heavy chain (VH) variable domain and an immunoglobulin light chain (VL) variable domain.

In one embodiment, the first binding domain comprises an immunoglobulin heavy chain (VH) variable domain with specificity for T cell specific antigen (VH(T)) and an immunoglobulin light chain variable domain (VL) with specificity for T cell specific antigen (VL(T )) and a second binding domain and a third binding domain each comprising an immunoglobulin heavy chain (VH) variable domain with specificity for claudin antigen (VH(CLDN)) and an immunoglobulin light chain variable domain (VL) with specificity for claudin antigen (VL (CLDN )).

In one embodiment, said heavy chain variable domain (VH) and the corresponding light chain variable domain (VL) of one or more binding domains are linked via a peptidic linker, in particular a flexible peptidic linker such as a glycine-serine peptidic linker. In one embodiment, the peptide linker comprises the amino acid sequence (G ₄ S) _x where x is 3, 4, 5, or 6.

In one embodiment, said heavy chain variable domain (VH) and corresponding light chain variable domain (VL) of one or more binding domains are in the format of a Fab molecule and/or a scFv molecule.

In one embodiment, the first binding domain is in the Fab molecule format and/or the second binding domain, and the third binding domain is in the scFv molecular format.

In one embodiment, the binding agent of the invention is a dimer consisting of two polypeptide chains, wherein the first polypeptide comprises an scFv linked to an additional VL domain via an immunoglobulin light chain (CL) constant domain and the second polypeptide comprises an scFv linked to an additional VH domain. through immunoglobulin heavy chain constant domain 1 (CH1). The two polypeptide chains are preferably linked to each other by a disulfide bridge. A disulfide bridge is preferably formed between a Cys residue in the CL domain and a Cys residue in the CH1 domain such that the additional VL domain of the first polypeptide associates with the additional VH domain of the second polypeptide in an antigen-binding configuration such that the binding agent comprises three antigen-binding domains in total. According to the invention, the VH and VL domains in scFv fragments are preferably linked by peptide linkers, such as a peptide linker containing the amino acid sequence (G ₄ S) _x where x is 3, 4, 5 or 6, and the Fab chains and scFv are preferably linked by peptide linkers , such as a peptide linker containing the amino acid sequence DVPG ₂ S or SGPG ₃ RS(G ₄ S) ₂ . In one embodiment, the scFv fragments bind to claudin and the Fab fragment binds to a T cell specific antigen.

In one embodiment, the first binding domain consists of a Fab fragment and the second and third binding domains each consist of scFv, where each strand of the Fab fragment is linked to one scFv and the scFv is preferably C-terminally linked to the Fab fragment.

In one embodiment, the binding agent comprises a first and a second polypeptide, wherein said first and second polypeptides comprise a VH domain with specificity for a T cell specific antigen (VH(T)), a VL domain with specificity for a T cell specific antigen (VL(T) ), a first VH domain with specificity for claudin (VH(CLDN)), a second VH domain with specificity for claudin (VH(CLDN)), a first VL domain with specificity for claudin (VL (CLDN)) and a second VL domain with specificity for claudin (VL (CLDN)), where the first polypeptide and the second polypeptide are linked to form a binding agent.

In one embodiment, the binding agent comprises

(a) a first polypeptide comprising a VH domain with specificity for a T cell specific antigen (VH(T)), a VH domain with specificity for claudin (VH(CLDN)) and a VL domain with specificity for claudin (VL(CLDN)); And

(b) a second polypeptide comprising a VL domain with specificity for a T cell specific antigen (VL(T)), a VH domain with specificity for claudin (VH(CLDN)) and a VL domain with specificity for claudin (VL(CLDN)),

where the first polypeptide and the second polypeptide are linked so that they form a binding agent.

In one embodiment, the first polypeptide further comprises an immunoglobulin heavy chain constant domain 1 (CH1) and the second polypeptide further comprises an immunoglobulin light chain constant domain (CL), wherein both domains are capable of binding.

In one embodiment, the first polypeptide and the second polypeptide are covalently linked through a disulfide bridge between the CH1 domain and the CL domain.

In one embodiment of the binding agent of the invention, the first polypeptide and the second polypeptide have a VH domain(s), a VL domain(s), a CH1 domain, and a CL domain from the N-terminus to the C-terminus, in the order

- VH(T) -CH1-VH (CLDN) -VL (CLDN) and VL(T) -CL-VH (CLDN) -VL (CLDN); or

- VH(T) -CH1-VL (CLDN) -VH (CLDN) and VL(T) -CL-VL (CLDN) -VH (CLDN); or

- VH(T) -CH1-VH (CLDN) -VL- (CLDN) and VL(T) -CL-VL (CLDN) -VH- (CLDN); or

- VH(T) -CH1-VL (CLDN) -VH- (CLDN) and VL(T) -CL-VH (CLDN) -VL- (CLDN); or

- VH (CLDN) -CH1-VH(T) -VL(T) and VL (CLDN) -CL-VH (CLDN) -VL (CLDN); or

- VH (CLDN) -CH1-VL(T) -VH(T) and VL (CLDN) -CL-VL (CLDN) -VH (CLDN); or

- VH (CLDN) -CH1-VL(T) -VH(T) and VL (CLDN) -CL-VH (CLDN) -VL (CLDN); or

- VH (CLDN) -CH1-VH(T) -VL(T) and VL (CLDN) -CL-VL (CLDN) -VH (CLDN); or

- VH (CLDN) -CH1-VH (CLDN) -VL (CLDN) and VL (CLDN) -CL-VH(T) -VL(T); or

- VH (CLDN) -CH1-VL (CLDN) -VH (CLDN) and VL (CLDN) -CL-VL(T) -VH(T); or

- VH (CLDN) -CH1-VL (CLDN) -VH (CLDN) and VL (CLDN) -CL-VH(T) -VL(T); or

- VH (CLDN) -CH1-VH (CLDN) -VL (CLDN) and VL (CLDN) -CL-VL(T) -VH(T).

In one embodiment, most of the N-terminal VH domain of one strand is associated with most of the N-terminal VL domain of the other strand to form a binding domain, and each of the VH-VL or VL-VH domains in one strand form a binding domain.

In one embodiment, the VH-VL or VL-VH domains are linked to the CH1 domain or CL domain via a peptide linker, such as a peptide linker containing the amino acid sequence DVPG ₂ S or SGPG ₃ RS(G ₄ S) ₂ .

In one embodiment, the VH and VL domains are linked via a peptide linker to form VH-VL or VL-VH domains, such as a peptide linker containing the amino acid sequence (G ₄ S) _x , where x is 3, 4, 5, or 6.

In the binding agent of the invention, a VH domain with specificity for a T cell antigen (VH(T)) and a VL domain with specificity for a T cell specific antigen (VL(T)) are able to bind to form a binding domain that binds to T -cell specific antigen.

Further, in the binding agent of the invention, a claudin-specific VH domain (VH(CLDN)) and a claudin-specific VL domain (VL(CLDN)) are capable of binding so as to form a binding domain that binds to claudin. According to the invention, the claudin-specific VH domains (VH (CLDN)) and the claudin-specific VL domains (VL (CLDN)) may be the same or different. In case the binding agent of the invention comprises different claudin-specific VH domains (VH (CLDN), VH (CLDN)*) and/or different claudin-specific VL domains (VL (CLDN), VL (CLDN)*) , VH (CLDN) and VL (CLDN) are able to bind to form a first claudin binding domain, and VH (CLDN)* and VL (CLDN)* can bind to form a second claudin binding domain.

In one embodiment, the binding agent of the invention is a bispecific dimeric binding agent.

In one embodiment, the T cell specific antigen is expressed on the surface of the T cell.

In one embodiment, binding of a binding agent to a T cell specific antigen on T cells results in T cell proliferation and/or activation.

In one embodiment, the T cell specific antigen is CD3.

In one embodiment, the first binding domain binds to the CD3 epsilon chain.

In one embodiment, CD3 is expressed on the surface of a T cell. In one embodiment, binding of a binding agent to CD3 on T cells results in proliferation and/or activation of T cells, wherein said T cells preferentially release cytotoxic factors such as perforins and granzymes and initiate cytolysis and apoptosis of cancer cells.

In one embodiment, claudin is expressed on the surface of a cancer cell.

In one embodiment, claudin is selected from the group consisting of claudin 6 and claudin 18.2.

In one embodiment, the binding agent binds to the extracellular domain of claudin.

In one embodiment, the binding agent of the invention binds to native claudin epitopes present on the surface of living cells. In one embodiment, the binding agent binds to the first extracellular loop of claudin.

In one embodiment, binding to a T cell specific antigen and/or binding to claudin is specific binding.

In one embodiment, the binding agent induces T-cell mediated cytotoxicity against claudin-expressing cancer cells.

In one embodiment, the binding agent induces T-cell mediated cytotoxicity against claudin-expressing cancer cells with an EC ₅₀ of <10 nM or <1 nM or <500 pM or <250 pM or <100 pM or <50 pM.

In one embodiment of the invention, claudin is claudin 6 and the cancer cell(s) are or are derived from cancer cells selected from the group consisting of bladder cancer, ovarian cancer, in particular ovarian adenocarcinoma and ovarian teratocarcinoma, lung cancer including small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), in particular squamous cell lung cancer and adenocarcinoma, gastric cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer, in particular basal cell carcinoma and squamous cell carcinoma, malignant melanoma, head and neck cancer, in particular malignant pleomorphic adenoma, sarcoma, in particular synovial sarcoma and carcinosarcoma, bile duct cancer, bladder cancer, in particular transitional cell carcinoma and papillary carcinoma, kidney cancer, in particular renal cell carcinoma, including clear cell renal cell carcinoma and papillary renal cell carcinoma, colon cancer, small intestine cancer, including ileum cancer, in particular small intestine adenocarcinoma and ileal adenocarcinoma, embryonic testicular carcinoma, placental choriocarcinoma, cervical cancer, testicular cancer, in particular testicular seminoma, testicular teratoma and embryonic testicular cancer, uterine cancer, germ cell tumors such as teratocarcinoma or embryonic carcinoma, in particular testicular germinomas, and their metastatic forms.

In one embodiment of the invention, claudin is claudin 18.2 and the cancer cell(s) is from a cancer selected from the group consisting of gastric cancer, esophageal cancer, pancreatic cancer, lung cancer such as non-small cell lung cancer (NSCLC) , breast cancer, ovarian cancer, colon cancer, liver cancer, head and neck cancer, gallbladder cancer and their metastatic forms, Krukenberg tumor, metastases in the abdominal cavity and / or metastases to the lymph nodes.

In one embodiment, the T cell specific antigen is CD3 and VH(T) comprises or consists of the amino acid sequence shown in SEQ ID NO: 5 or a fragment thereof, or an amino acid sequence variant or fragment and/or VL(T) comprises or consists of the amino acid sequence represented by SEQ ID NO: 6, or a fragment thereof, or a variant amino acid sequence or fragment.

In one embodiment of the invention, claudin is claudin 6 and VH (CLDN) includes or consists of the amino acid sequence shown in SEQ ID NO: 8, or a fragment thereof, or an amino acid sequence variant or fragment, and/or VL (CLDN) includes or consists of from the amino acid sequence represented by SEQ ID NO: 10, or a fragment thereof, or a variant amino acid sequence or fragment.

In one embodiment, the T cell specific antigen is CD3, claudin is claudin 6, and

- the first polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO: 14, or a fragment thereof, or an amino acid sequence variant or fragment, and the second polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO. 16 or a fragment thereof, or a variant amino acid sequence or fragment;

- the first polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO: 15, or a fragment thereof, or an amino acid sequence variant or fragment, and the second polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO. 16 or a fragment thereof, or a variant amino acid sequence or fragment;

- the first polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO: 17, or a fragment thereof, or an amino acid sequence variant or fragment, and the second polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO. 19 or a fragment thereof, or a variant amino acid sequence or fragment; or

- the first polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO: 18, or a fragment thereof, or an amino acid sequence variant or fragment, and the second polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO. 19 or a fragment thereof, or a variant amino acid sequence or fragment.

In one embodiment of the invention, claudin is claudin 18.2 and (i) VH (CLDN) comprises or consists of the amino acid sequence represented by SEQ ID NO: 20 or a fragment thereof, or an amino acid sequence variant or fragment and/or VL (CLDN) comprises or consists of the amino acid sequence represented by SEQ ID NO: 22, or a fragment thereof, or an amino acid sequence variant or fragment, or (ii) VH (CLDN) comprises or consists of the amino acid sequence represented by SEQ ID NO: 21, or a fragment thereof, or variant amino acid sequence or fragment and/or VL (CLDN) includes or consists of the amino acid sequence represented by SEQ ID NO: 23, or a fragment thereof, or a variant amino acid sequence or fragment.

In one embodiment, the T cell specific antigen is CD3, claudin is claudin 18.2, and

- the first polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO: 30, or a fragment or variant of the amino acid sequence or fragment thereof, and the second polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO: 32, or a fragment or variant thereof amino acid sequence or fragment;

- the first polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO: 31, or a fragment thereof, or a variant of the amino acid sequence or fragment, and the second polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO: 32, or a fragment or variant thereof amino acid sequence or fragment;

- the first polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO: 33, or a fragment thereof, or an amino acid sequence variant or fragment, and the second polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO. 35 or a fragment thereof, or a variant amino acid sequence or fragment;

- the first polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO: 34, or a fragment thereof, or an amino acid sequence variant or fragment, and the second polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO. 35 or a fragment thereof, or a variant amino acid sequence or fragment;

- the first polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO: 36, or a fragment thereof, or an amino acid sequence variant or fragment, and the second polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO. 37, or a fragment thereof, or a variant amino acid sequence or fragment;

- the first polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO: 38, or a fragment thereof, or an amino acid sequence variant or fragment, and the second polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO. 39 or a fragment thereof, or a variant amino acid sequence or fragment;

- the first polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO: 40, or a fragment or variant of the amino acid sequence or fragment thereof, and the second polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO: 41, or a fragment or variant thereof amino acid sequence or fragment;

- the first polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO: 42, or a fragment or variant of the amino acid sequence or fragment thereof, and the second polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO: 43, or a fragment or variant thereof amino acid sequence or fragment.

In various embodiments, the binding agent of the invention, or one or more polypeptide chains of the binding agent of the invention, may or may not include secretion signals, such as N-terminal secretion signals, in particular immunoglobulin, such as IgG secretion signals, such as the sequence MGWSCIILFLVATATGVHS and/or includes or does not include tags, in particular C-terminal tags such as His tags, in particular the Gly-Gly-Ser-(His) ₆ or (His) ₆ sequence, or the Strep tag.

The invention also provides a nucleic acid encoding a binding agent of the invention.

The invention also relates to a nucleic acid encoding a first polypeptide and/or a second polypeptide as defined herein.

In one embodiment, the nucleic acid of the invention is in the form of a vector or in the form of an RNA.

In one embodiment, the nucleic acid of the invention is a recombinant nucleic acid.

The invention also relates to a host cell containing the nucleic acid of the invention.

The invention also provides a binding agent of the invention, a nucleic acid of the invention, or a host cell of the invention for use as a drug.

The invention also provides a binding agent of the invention, a nucleic acid of the invention, or a host cell of the invention for use in the treatment or prevention of cancer.

The invention also relates to a pharmaceutical composition comprising a binding agent of the invention, a nucleic acid of the invention, or a host cell of the invention.

In one embodiment, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier and/or excipient.

The invention also provides a method for treating a disease comprising administering a binding agent of the invention, a nucleic acid of the invention, a host cell of the invention, or a pharmaceutical composition of the invention to a subject in need thereof. In one embodiment, the disease is a cancer.

The invention also provides a method for treating or preventing cancer, comprising administering a binding agent of the invention, a nucleic acid of the invention, a host cell of the invention, or a pharmaceutical composition of the invention to a subject in need thereof.

The invention also provides for the use of a coupling agent of the invention, a nucleic acid of the invention, a host cell of the invention, or a pharmaceutical composition of the invention for the manufacture of a medicament. In one embodiment, the drug is for the treatment of cancer.

In one embodiment, said cancer cells express claudin to which said binding agent is able to bind.

In one embodiment, said claudin is claudin 6 and said cancer is selected from the group consisting of bladder cancer, ovarian cancer, in particular ovarian adenocarcinoma and ovarian teratocarcinoma, lung cancer, including small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC ), in particular lung squamous cell carcinoma and adenocarcinoma, gastric cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer, in particular basal cell carcinoma and squamous cell carcinoma, malignant melanoma, head and neck cancer, in particular malignant pleomorphic adenoma, sarcoma , in particular synovial sarcoma and carcinosarcoma, bile duct cancer, bladder cancer, in particular transitional cell carcinoma and papillary carcinoma, kidney cancer, in particular renal cell carcinoma, including clear cell renal cell carcinoma and clear cell renal cell carcinoma, cancer colon, small bowel cancer, including ileum cancer, in particular small bowel adenocarcinoma and ileal adenocarcinoma, fetal testicular carcinoma, placental choriocarcinoma, cervical cancer, testicular cancer, in particular testicular seminoma, testicular teratoma and fetal testicular cancer, cancer uterus, germ cell tumors such as teratocarcinoma or embryonic carcinoma, in particular testicular germinomas, and their metastatic forms.

In one embodiment, said claudin is claudin 18.2 and said cancer is selected from the group consisting of gastric cancer, esophageal cancer, pancreatic cancer, lung cancer such as non-small cell lung cancer (NSCLC), breast cancer, ovarian cancer, colon cancer colon, liver cancer, head and neck cancer, gallbladder cancer, and their metastatic forms, Krukenberg tumor, metastases in the abdominal cavity and / or metastases in the lymph nodes.

The invention also relates to a binding agent, nucleic acid or host cell, as described herein, for use in the methods of treatment described herein. In one embodiment, the invention provides a pharmaceutical composition as described herein for use in the methods of treatment described herein.

According to the invention, claudin 18.2 preferably has the amino acid sequence according to SEQ ID NO: 1, and claudin 6 preferably has the amino acid sequence according to SEQ ID NO: 2 or 3.

Other features and advantages of the present invention will be apparent from the following detailed description and claims.

Brief description of the drawings

Fig. 1. Modular diagrams illustrating DNA constructs and the bstb protein targeted to TAA CLDN6.

(A) Design of bstb strands at the DNA level. (B) Schematic model of the bstb molecule.

_CH 1 is derived from IgG1 in bstb_369/367 and from IgG2 in bstb_371/367.

C denotes the constant region; CMV, cytomegalovirus promoter; Fd, hydrolyzable fragment/part of the Fab heavy chain (antigen-binding fragment); H, heavy chain; His, 6xHis-label; L - light chain; L1, linker SGPG ₃ RS(G ₄ S) ₂ ; L2, DVPG ₂ S linker; L3, linker (G ₄ S) ₄ ; SS, disulfide bridge; scFv, single chain variable fragment; Sec, secretion signal; Strp, Strep - label; V, variable domain.

Fig. 2. Purification of labeled and unlabeled bstb proteins from cell culture supernatant.

Expi293F ^TM cells were transiently transfected with the appropriate bstb constructs. The supernatant was collected seven days after transfection and subjected to purification. (A) Chromatograms showing the first step in the purification of labeled bstb by Ni-NTA affinity chromatography (Immobilized Metal Ion Affinity Chromatography - IMAC). mAU (milliabsorption units) on the Y-axis are plotted against volume in ml on the X-axis. Left, IMAC bstb_369/367 peaks, right, IMAC bstb_371/367 peaks. The corresponding right peak includes HMW compounds and the corresponding middle peak includes monomeric compounds. The corresponding left peak shows impurities. 1) indicates fractions combined as the main peak, containing mainly monomeric compounds, 2) fractions combined as HMW compounds. (B) Chromatograms showing the second stage of labeled bstb purification. Pools of major IMAC peaks were subjected to Strep- ^Tactin® affinity chromatography. Plot on the left, peak bstb_369/367, plot on the right, peak bstb_371/367. (C) Separation of HMW compounds and bstb_369/367 monomeric compounds by size exclusion chromatography (SEC). The fractions of the HMW pool and the monomer pool are indicated in square brackets. (D) SE-HPLC analysis of unlabeled bstb_5726/5725 after purification. The mAU (milliabsorption units) values on the y-axis are plotted against time in minutes on the x-axis.

Bstb stands for bispecific TriMAB; HMW, macromolecular compounds; LMW, low molecular weight compounds.

Fig. 3. SDS-PAGE analysis of the CLDN6 x CD3 bstb_369/367 protein.

The supernatant of Expi293F ^TM cells transiently expressing bstb_369/367 was purified using IMAC. HMW compounds were separately eluted from the main peak. The major peak compounds were subsequently subjected to Strep- ^Tactin® affinity chromatography. The eluted pool was further split by SEC to collect the highly monomeric bstb. Cell culture supernatant aliquots, reference and various purification steps were loaded under non-reducing (left) and reducing (right) conditions on a 4–15% Tris-glycine unstained gel. (A) Bands visualized on unstained gel using fluorescence. (B) Western blot analysis using anti-His detection antibody (upper blot) or StrepMAB detection antibody. The arrows on the left indicate the unreduced monomer and HMB, the arrows on the right are the reduced bstb chains. Fd denotes a hydrolysable fragment/part of the Fab heavy chain (antigen-binding fragment); HMW, macromolecular compounds; His, 6xHis - label; IMAC, immobilized metal affinity chromatography; L - light chain; scFv, single chain variable fragment; SEC, size exclusion chromatography; Strp, Strep label.

Fig. 4. In vitro cytotoxicity assay to determine specific lysis mediated by the CLDN6 x CD3 proteins bstb_369/367 and bstb_371/367.

Human PBMC as effector cells and human cells stably transduced with luciferase as target cells were used at a 5:1 effector/target ratio in luciferase-based cytotoxicity assays to determine specific concentration dependent lysis. Cell lines CLDN6 ⁺ PA-1 (ovarian teratocarcinoma) and/or OV-90 (ovarian cancer) served as positive targets and ^CDLN6 cell line MDA-MB-231 (breast cancer) as negative targets. Triplicate means are shown, including standard deviation. The half-maximal lysis values (EC50) are indicated under the corresponding graphs. (A) Specific lysis (standard slope) mediated by bstb_369/367 and bstb_371/367 of CLDN6 ⁺ ovarian carcinoma OV-90 cells after 48 h incubation. (B) Comparison of specific lysis (standard slope) mediated by bstb_369/367 and CDLN6 x CD3-specific bi-(scFv) ₂ reference protein. Cell lines and incubation times are shown on separate graphs. (C) Specific lysis (variable slope) of bstb_369/367 and the effect of 5% BMV on bstb_369/367 activity. Left: incubation with PA-1 for 16 h; right: incubation with OV-90 for 48 hours. The solid lines indicate the lysis curve of monomeric bstb_369/367, the dotted lines are the lysis curve of monomeric bstb_369/367 with the addition of 5% BMW compounds. (D) Specific lysis (standard slope) of OV-90 after 48 h incubation. Left graph: Lysis is mediated by bstb_369/367 and unlabeled bstb_5726/5725 analog as a monomer and includes 5% BMW. Right graph: Lysis mediated by bstb_369/367 as reference and CH1 (IgG2)-bearing variant bstb_5727/5725 as monomer, and includes 5% BMV.

Bstb stands for bispecific TriMAB; bi-(scFv) ₂ , bispecific single chain variable fragment; EC50, half maximum effective concentration; HMW, macromolecular compounds.

Fig. 5. Target-dependent modulation of T cells mediated by CLDN6 x CD3 proteins bstb_369/367 and bstb_371/367

The cancer cell lines CLDN6 ⁺ OV-90 and PA-1 and CLDN6 ^- MDA-MB-231 were used as target cells. Human PBMC served as effector cells in an E:T ratio of 5:1. Anti-CD3 IgG2a OKT3 was used at a concentration of 100 ng/ml as an activation control. Spurious samples were incubated with DPBS to subtract background signals from the analyzed sample values. PBMCs without target cells were used as an additional specificity control. All samples were created in duplicate in a 24-well format. Increasing the concentration of proteins bstb bstb_369/367 or bstb_371/367 (0.005–5000 ng/ml). (A) T cell activation: PBMCs were harvested after 48 h of co-incubation and labeled with anti-CD5-PE-Cy7, anti-CD25-PE, anti-CD69-APC and eFluor506 for analysis of viable T cell activation by flow cytometry. (B) T cell proliferation: Human PBMCs were stained with CFSE prior to analysis. PBMC were harvested after 72 h of co-incubation and labeled with anti-CD5-APC and eFluor506 to exclude non-lymphocytes and dead cells. The decrease in the CFSE signal, indicative of T cell proliferation, was analyzed by flow cytometry.

Bstb denotes bispecific TriMAB; Ctrl, control.

Fig. 6. Binding of various CLDN6 x CD3 bispecific antibodies to the tumor-specific CLDN6 antigen.

(A) Relative binding affinity of the bi-(scFv) ₂ reference, bstb_369/367 and bstb_5726/5725 were examined by flow cytometry on endogenously CLDN6-expressing human PA-1 cells, over a concentration range of 9.77 ng/mL to 10 μg/mL . Primary antibodies were detected with protein-L-FITC (4 μg/ml). Data are presented as mean ± standard deviation (n = 2 repetitions). (B) The effect of high molecular weight (HMW) compounds on bstb_5726/5725 monomer binding was analyzed by flow cytometry with either monomeric bstb_5726/5725 or monomeric bstb_5726/5725 supplemented with ~3% or 5% HMW compounds (concentration range from 9, 77 ng/ml to 10 µg/ml). Primary antibodies were detected with protein-L-FITC (4 μg/ml). Data are presented as mean ± standard deviation (n = 2 repetitions). Bstb stands for bispecific TriMAB; MFI, mean fluorescence intensity.

Fig. 7. Efficacy of the CLDN6 x CD3 protein bstb_369/367 in vivo in a mouse tumor xenograft model.

Male and female immunodeficient NSG mice were used. (A) Schematic of the injection schedule. Mice were inoculated subcutaneously with human ovarian carcinoma OV-90 CLDN6 ⁺ cells as target cells and engrafted intraperitoneally (ip) with human PBMC as effector cells. Treatment started with an average tumor volume of ~35 mm ³ per group and was performed intraperitoneally 3 times a week. Group 1 (G1) received DPBS buffer, group 2 (G2) a low dose of bstb_369/367 of 31 μg/kg, and group 3 (G3) a higher dose of 308 μg/kg. (B) Tumor growth in all mice and groups over time. Processing was applied during the period of time allocated by the boundary. Top, G1 carrier group; lower left, group G2 bstb_369/367 low dose; lower right, group G3 bstb_369/367 with higher dose. Each line represents a single mouse. (C) Kaplan-Meier survival plot for all groups from the day of treatment to the day of euthanasia. The table below shows the average days of survival per group and the significance of survival of G2 and G3 compared to G1 by log-rank test (Cox-Mantel).

Bstb stands for bispecific TriMAB; d, days; G, group; GVHD, graft-versus-host disease; i.p., intraperitoneally; PBMC, peripheral blood mononuclear cells; s.c., subcutaneously.

Fig. 8. Evaluation of the in vivo pharmacokinetics of the CLDN6 x CD3 protein bstb_369/367.

5 mg/kg bstb_369/367 was administered ip to female immunodeficient NSG mice on day 0. An injection of DPBS ("0 h") served as a pre-injection control. Plasma was collected at 0.25 h, 1 h, 2 h, 3 h, 6 h and 8 h after administration. The plasma concentration of Bstb_369/367 was detected by ELISA. Concentration is presented on a logarithmic scale along the y-axis. Each point represents the average value of three mice with a standard deviation.

i.p. means intraperitoneally.

Fig. 9. In vivo dose determination with CLDN6 x CD3-bstb bstb_5726/5725 protein in a mouse tumor xenograft model.

Male and female immunodeficient NSG mice were inoculated subcutaneously with human ovarian carcinoma OV-90 CLDN6 ⁺ cells as target cells and engrafted intraperitoneally (ip) with human PBMC as effector cells. Treatment started with an average tumor volume of ~150 mm ³ per group and was administered intraperitoneally 3 times a week. (A) Schematic of the injection schedule. (B) Plots of tumor growth. The dosing groups (n=6) were as indicated on the individual graphs. The G7 control group (n = 8) received DPBS. Graphs show the growth of all mice and groups over time. The processing period is highlighted by a border. Each row represents a single mouse (mouse ID = BIO - ####).

Bstb stands for bispecific TriMAB; DPBS, Dulbecco's Phosphate Buffered Saline; i.p., intraperitoneally; PBMC, peripheral blood mononuclear cells; s.c., subcutaneously.

Fig. 10. Modular diagrams illustrating DNA constructs and the bstb protein targeted to TAA CLDN18.2.

(A) Design of bstb strands at the DNA level. Anti-CLDN18.2-scFv orients either in the order V _H -V _L (upper diagram) or in the order V _L -V _H (lower diagram). Designs have been developed with (+/-) disulfide bridges (SS) and without them. (B) Theoretical models of exemplary bstb molecules with anti-CLDN18.2 scFv in the order V _H -V _L or V _L -V _H labeled but without disulfide bridges (SS) in scFv fragments (top) and unlabeled, but with SS (below). C _H 1 derived from IgG1 or IgG2.

C denotes the constant region; CMV, cytomegalovirus promoter; Fd, hydrolyzable fragment/part of the Fab heavy chain (antigen-binding fragment); H, heavy chain; His, 6xHis-label; L - light chain; L1, SGPG ₃ RS(G ₄ S) ₂ linker; L2, DVPG ₂ S linker; L3, (G ₄ S) ₄ linker; L4, (G ₄ S) ₅ linker; SS, disulfide bridge; scFv, single chain variable fragment; Sec, secretion signal; Strp, Strep label; V, variable domain.

Fig. 11. In vitro cytotoxicity assay to compare specific lysis mediated by CLDN18.2×CD3-bstb proteins.

Human PBMCs as effector cells and human cells stably transduced with luciferase as target cells were used in a 5:1 effector to target ratio in a luciferase-based cytotoxicity assay. IMAC and Strep- ^Tactin® purified bstb test samples were used without further enrichment of the monomeric particles by SEC. Left graph: Specific and concentration dependent lysis of CLDN18.2 ⁺ _, NUGC-4_hCLDN18.2 gastric cancer cells mediated by bstb_5730/5728, bstb_5731/5729, bstb_5732/5728 and bstb_5733/5729 after 48 h incubation. Right graph: lysis of CDLN18.2 ^- control cell line MDA-MB-231. Triplicate means are shown, including standard deviation.

Bstb stands for bispecific TriMAB.

Fig. 12. SE-HPLC analysis of various CLDN18.2 x CD3-bstb proteins after purification.

Expi293F ^TM cells were transiently transfected with bstb_5745/5747, bstb_5749/5751, bstb_5746/5748 or bstb_5750/5752 constructs. The supernatant was collected seven days after transfection and subjected to purification. (A) SE-HPLC analysis of bstb_5745/5747 (upper graph) and bstb_5749/5751 (lower graph) after cleaning (lower graph). The mAU (milliabsorption units) values on the y-axis are plotted against time in minutes on the x-axis. The monomer content is greatly increased in bstb_5749/5751, which includes additional disulfide bonds in the anti-CLDN18.2 scFv fragments. (B) SE-HPLC analysis of bstb_5746/5748 (top graph) and bstb_5750/5752 (bottom graph) after cleaning (bottom graph). The mAU (milliabsorption units) values on the y-axis are plotted against time in minutes on the x-axis. The monomer content is greatly increased in bstb_5749/5751, which includes additional disulfide bonds in the anti-CLDN18.2 scFv fragments.

Bstb stands for bispecific TriMAB; HMW, macromolecular compounds; LMW, low molecular weight compounds.

Fig. 13. In vitro cytotoxicity assay to compare specific lysis mediated by a high monomeric disulfide bridge containing CLDN18.2×CD3-bstb and bi-(scFv) ₂ proteins.

Human PBMCs were used as effector cells and luciferase-stably transduced CLDN18.2 ⁺ NUGC-4_hCLDN18.2 human gastric cancer cells as target cells in a 5:1 effector-to-target ratio in a luciferase-based cytotoxicity assay. Monomeric test samples bstb, separated by SEC, and their protein analogues (scFv) ₂ used in 10-point 5-fold serial dilutions. (A) Specific and concentration dependent lysis mediated by bstb_5749/5751 and bstb_5750/5752 (left panel) and bi-scFv_5506 and bi-scFv_5538 (right panel) after 48 h incubation. The EC50 values are given in the tables below. The EC50 values of the "reference sample" served for normalization. (B) Divalent bstb fold difference compared to related bi-(scFv) ₂ analogs after normalization to "plate reference". For calculations, the associated EC50 values for bi-(scFv) ₂ were taken equal to 1.

Bi-scFv denotes a bispecific single chain variable fragment; bstb, bispecific TriMAB; EC50, half maximum effective concentration.

Fig. 14. Modular diagrams illustrating RNA constructs encoding CLDN6 x CD3 bstb.

Design of bstb Fd (top) and L-chain (bottom) at the RNA level.

C denotes the constant region; CMV, cytomegalovirus promoter; Fd, hydrolyzable fragment/part of the Fab heavy chain (antigen-binding fragment); H, heavy chain; His, 6xHis-label; L - light chain; L1, linker SGPG ₃ RS(G ₄ S) ₂ ; L2, DVPG ₂ S linker; L3, linker (G ₄ S) ₄ ; SS, disulfide bridge; scFv, single chain variable fragment; Sec, secretion signal; Strp, Strep label; V, variable domain.

Fig. 15. Western blot analysis of IVT mRNA encoding CLDN6 x CD3 bstb_435/434 and bstb_436/434 in producer cells.

The human chronic myeloid leukemia cell line K-562 was transiently transfected by electroporation with equal amounts of Fd and L chain IVT mRNA or with H ₂ O alone (blank control). K-562 supernatants were harvested 48 hours after electroporation and cell lysates were obtained. As a reference, purified protein analogs of bstb_369/367 (A) or bstb_371/367 (B) were loaded as a monomeric preparation and a VMB preparation on gels. Gradient SDS-PAGE and Western blot analysis were performed to detect translated and purified protein products.

Both bstb variants ((A) bstb_435/434, (B) bstb_436/434) were detected in K-562 supernatant and cell lysate with anti-6xHis HRP (Fd part) and anti-Strep-MAB-HRP (L -Part). Anti-β-actin immunoblotting served as a loading control for cell lysates. Samples were loaded as indicated in the attached sample loading tables under non-reducing and reducing conditions. Arrows indicate protein bands of interest. (A) bstb_435/434, (B) bstb_436/434. In (C), both bstb variants were detected under reducing conditions with a mixture of anti-6xHis-HRP and anti-Strep-MAB-HRP to visualize the heterodimeric state of the antibody derivatives.

Bstb stands for bispecific TriMAB; Fd, hydrolyzable fragment/part of the Fab heavy chain (antigen-binding fragment); His, 6xHis-label; HMW, macromolecular compounds; HRP, horseradish peroxidase; L, part of the bstb light chain; scFv, single chain variable fragment; SN, supernatant.

Fig. 16. In vitro cytotoxicity assay to determine specific lysis mediated by CLDN6 x CD3 bstb_435/434 and bstb_436/434.

Human PBMCs as effector cells and human cells stably transduced with luciferase as target cells were used in a 5:1 effector to target ratio in a luciferase-based cytotoxicity assay. SNs from K-562 containing bstb_435/434 or bstb_436/434 encoded RNA were used in 7-point 5-fold serial dilution. Shown is a concentration-specific lysis mediated by bstb_435/434 and bstb_436/434 cells of CLDN6 ⁺ ovarian cancer OV-90 after 48 h of incubation. CDLN6 ^- MDA-MB-231 breast carcinoma cells served as a negative control. The means of three repetitions are shown, including the standard deviation.

Bstb stands for bispecific TriMAB; EC ₅₀ half maximum effective concentration.

Fig. 17. Comparison of in vivo efficacy of CLDN6 x CD3 RNA and protein bstb and bi-(scFv) ₂ in mouse tumor xenograft model.

Male (black symbols) and female (white symbols) immunodeficient NSG mice were used. (A) Scheme of the schedule of injections. Mice were inoculated subcutaneously (sc) with human ovarian carcinoma OV-90 CLDN6 ⁺ cells as target cells and engrafted intraperitoneally (ip) with human PBMC as effector cells. Treatment was initiated at an average tumor volume of ~250 mm ³ per group and administered intravenously (iv) once a week. Group 1 (G1) received a control RNA complex (luciferase RNA in TransIT), G2, bstb RNA complex, and G3, bi-(scFv) ₂ RNA complex. Each injection contained only 3 µg of RNA. G4-6 served as control/reference protein groups: G4 received a carrier buffer (buffer for protein composition), G5 received 100 μg/kg reference bstb and G6 received 200 μg/kg reference bi-(scFv) ₂ . (B) Tumor growth in all mice and groups as a function of time. Treatment was applied intravenously as indicated by the arrows. Treatments per group are indicated in the headings of the graphs. Each line represents a single mouse. (C) Flow cytometric analysis of human T cells that have infiltrated mouse xenograft tumor tissue treated with control RNA (G1), bstb RNA (G2), or bi-(scFv) ₂ RNA (G3). Each symbol represents an individual mouse, and the lines represent the average for each group. Symbols according to (B).

Bi-scFv denotes a bispecific single chain fragment; bstb, bispecific TriMAB; d, days; G, group; GVHD, graft-versus-host disease; i.p., intraperitoneally; i.v., intravenously; PBMC, peripheral blood mononuclear cells; s.c., subcutaneously.

Fig. 18. Amino acid sequences of V _H and V _L according to IMGT nomenclature.

Shown are the amino acid sequences in the standard one-letter code for the V _H and V _L domains that were used in the bstb molecules described herein. A) V _H and V _L sequences of anti-CLDN18.2 and anti-CLDN6, B) V _H and V _L sequences of anti-CD3.

CDR indicates the complementarity-determining region; FR, frame region; IMGT, international information system ImMunoGeneTics; VH, variable heavy chain; VL, variable light chain.

Detailed description of the invention

Although the present invention is described in detail below, it should be understood that this invention is not limited to the specific methodologies, protocols, and reagents described herein, as they may vary. In addition, it should be understood that the terminology used herein is for the purpose of describing specific embodiments only, and is not intended to be limiting, as the scope of the present invention will only be limited by the appended claims. Unless otherwise indicated, all technical and scientific terms used in this document have the same meanings as generally understood by a person skilled in the art.

The elements of the present invention will be described below. These elements are listed in specific embodiments, however, it should be understood that they can be combined in any way and in any number to create additional embodiments. The various described examples and preferred embodiments should not be construed as limiting the present invention to the expressly described embodiments. This description is to be understood as supporting and covering embodiments that combine the expressly described embodiments with any number of disclosed and/or preferred elements. In addition, any permutations and combinations of all the described elements in this application should be considered the disclosed description of the present application, unless the context indicates otherwise.

Preferably, the terms used in this document are defined in accordance with the description of the "Multilingual Glossary of Biotechnology Terms: (IUPAC Guidelines)", HGW Leuenberger, B. Nagel and H. Kölbl, Eds., Helvetica Chimica Acta, CH-4010 Basel, Switzerland, (1995).

The practice of the present invention will use, unless otherwise indicated, the conventional techniques of chemistry, biochemistry, cell biology, immunology, and recombinant DNA as explained in the literature in the art (see, for example, Molecular Cloning: A Laboratory Manual, ^2nd Edition, J. Sambrook et al.eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1989).

Throughout this description and the following claims, unless the context otherwise requires, the word "comprise" and variations such as "comprises" and "comprising" will be understood to include the claimed element, whole or step or group of members, whole or steps , but not the exclusion of any member, integer or step or group of members, integers or steps, although in some embodiments such other element, whole or step or group of members, integers or steps, i.e. the object of the invention is to include the specified member, whole or stage or group of members, integers or stages. Terms in the singular are to be construed to encompass both the singular and the plural, unless otherwise specified in this document or clearly inconsistent with the context. The presentation of ranges of values in this document is simply intended to be used as a shorthand way of referring individually to each individual value within a range. Unless otherwise noted, each individual value is included in the description as if it were individually described in this document. All methods described herein can be performed in any suitable order, unless otherwise indicated herein or otherwise clearly contrary to the context. The use of any and all examples or exemplary language (eg, "such as") provided herein is merely intended to better illustrate the invention and does not constitute a limitation on the scope of the claimed invention. No wording in the specification should be construed as indicating any unclaimed element as being essential in the practice of the invention.

Several documents are cited in the text of this description. Each of the documents cited in this document (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether above or below, are incorporated herein by reference in their entirety. No part of this document should be taken as an admission that the invention cannot claim an earlier date for the present description by virtue of the prior art of the invention.

Claudins are a family of proteins that are the most important components of tight junctions, where they establish a paracellular barrier that controls the flow of molecules in the intercellular space between epithelial cells. Claudins are transmembrane proteins that cross the membrane 4 times, with N- and C-termini located in the cytoplasm. The first extracellular loop, called EC1 or ECL1, has an average of 53 amino acids, and the second extracellular loop, called EC2 or ECL2, has about 24 amino acids. Cell surface proteins of the claudin family, such as CLDN6 and CLDN18.2, are expressed in tumors of various origins and are particularly suitable as target structures in the case of antibody-mediated cancer immunotherapy due to their selective expression (lack of expression in toxicity-relevant normal tissue) and localization in the plasma membrane.

In the context of the present invention, the preferred claudins are CLDN6 and CLDN18.2. CLDN6 and CLDN18.2 have been identified as differentially expressed in tumor tissues, with the only normal tissue expressing CLDN18.2 being the stomach and the only normal tissue expressing CLDN6 being the placenta.

CLDN18.2 is selectively expressed in normal tissues in differentiated epithelial cells of the gastric mucosa. CLDN18.2 is expressed in cancers of various origins such as pancreatic carcinoma, esophageal carcinoma, gastric carcinoma, bronchial carcinoma, breast carcinoma and ENT tumors. CLDN18.2 is a valuable target for the prevention and/or treatment of primary tumors such as gastric cancer, esophageal cancer, pancreatic cancer, lung cancer such as non-small cell lung cancer (NSCLC), ovarian cancer, colon cancer, liver cancer, cancer head and neck, gallbladder cancer and metastases, in particular gastric cancer metastases such as Krukenberg tumors, peritoneal metastases and lymph node metastases.

CLDN6 has been found to be expressed in, for example, ovarian cancer, lung cancer, stomach cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer, melanomas, head neck cancer, sarcomas, bile duct cancer, kidney cell cancer, and cancer. Bladder. CLDN6 is a particularly preferred target for the prevention and/or treatment of ovarian cancer, in particular ovarian adenocarcinoma and ovarian teratocarcinoma, lung cancer, including small cell lung cancer (SCLC), and non-small cell lung cancer (NSCLC), in particular squamous cell lung cancer and adenocarcinoma, gastric cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer, in particular basal cell carcinoma and squamous cell carcinoma, malignant melanoma, head and neck cancer, in particular malignant pleomorphic adenoma, sarcoma, in particular synovial sarcoma and carcinosarcoma, biliary cancer duct, bladder cancer, in particular transitional cell carcinoma and papillary carcinoma, kidney cancer, in particular renal cell carcinoma, including clear cell renal cell carcinoma and clear cell renal cell carcinoma, colon cancer, cancer of the small intestine, including cancer ileum, in particular adenocarcinoma of the small intestine and adenocarcinoma of the ileum, fetal testicular carcinoma, placental choriocarcinoma, cervical cancer, testicular cancer, in particular testicular seminoma, testicular teratoma and fetal testicular cancer, uterine cancer, germ cell tumors such as teratocarcinoma or embryonic carcinoma, in particular testicular germinomas, and their metastatic forms. In one embodiment, the cancer associated with CLDN6 expression is selected from the group consisting of ovarian cancer, lung cancer, metastatic ovarian cancer, and metastatic lung cancer. Preferably, the ovarian cancer is a carcinoma or adenocarcinoma. Preferably, the lung cancer is a carcinoma or adenocarcinoma, and preferably is a bronchiolar cancer such as bronchial carcinoma or bronchiolar adenocarcinoma.

The term "claudin" or "CLDN" includes CLDN18.2 and CLDN6. Preferably the claudin is a human claudin.

The term "claudin 18" or "CLDN18" includes any variants including splice variant 1 of claudin 18 (claudin 18.1 (CLDN18.1)) and splice variant 2 of claudin 18 (claudin 18.2 (CLDN18.2)).

The term "claudin 18.2" or "CLDN18.2" preferably refers to human CLDN18.2 and in particular to a protein comprising, preferably consisting of, the amino acid sequence according to SEQ ID NO: 1 of the sequence listing or a variant of said amino acid sequence. The first extracellular loop of CLDN18.2 preferably includes amino acids 27-81, more preferably amino acids 29-78 of the amino acid sequence shown in SEQ ID NO: 1. The second extracellular loop of CLDN18.2 preferably includes amino acids 140 to 180 or 144 to 167 of the amino acid sequence shown in SEQ ID NO: 1. Said first and second extracellular loops preferably form the extracellular portion of CLDN18.2.

The term "claudin 6" or "CLDN6" preferably refers to human CLDN6 and in particular to a protein comprising, preferably consisting of, the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3 from a sequence listing or a variant of said amino acid sequence. The first extracellular loop of CLDN6 preferably comprises amino acids 28 to 80 or 29 to 81, more preferably amino acids 28 to 76 of the amino acid sequence shown in SEQ ID NO: 2 or the amino acid sequence shown in SEQ ID NO: 3. The second extracellular loop of CLDN6 preferably includes amino acids 138 to 160, preferably amino acids 141 to 159, more preferably amino acids 145 to 157 of the amino acid sequence shown in SEQ ID NO: 2 or the amino acid sequence shown in SEQ ID NO: 3. Said first and second extracellular the loops preferably form the extracellular portion of CLDN6.

The term "variant" according to the invention refers in particular to mutants, splicing variants, conformations, isoforms, allelic variants, species and species homologues, in particular to those found in nature. An allelic variant refers to a change in the normal sequence of a gene, the meaning of which is often unclear. Whole gene sequencing will often identify numerous allelic variants for a given gene. A species homologue is a nucleic acid or amino acid sequence of a species of a different origin derived from a given nucleic acid or amino acid sequence. The term "variant" shall encompass any post-translationally modified variants and conformational variants.

The second target molecule of the binding agents described herein is a T-cell specific antigen. T cell specific antigen is an antigen on the surface of T cells. A preferred embodiment of such a T cell specific antigen is the CD3 complex (differentiation cluster 3).

The CD3 complex refers to an antigen that is expressed on mature human T cells, thymocytes, and a subgroup of natural killer cells as part of a multimolecular T cell receptor (TCR) complex. The T-cell co-receptor is a protein complex and consists of four separate chains. In mammals, the complex includes a CD3γ chain, a CD3δ chain, and two CD3ε chains. These chains bind to a molecule known as the T cell receptor (TCR) and the ζ chain generates an activation signal in T lymphocytes. The TCR molecules, the ζ chain, and CD3 together make up the TCR complex.

Human CD3 epsilon has GenBank accession number NM_000733 and is included in SEQ ID NO: 4. Human CD3 gamma has GenBank accession number NM_000073. Human CD3 delta has GenBank accession number NM_000732. CD3 is responsible for TCR signaling. As described by Lin and Weiss, Journal of Cell Science 114, 243-244 (2001), activation of the TCR complex by binding to specific antigenic epitopes presented by MHC results in phosphorylation of immunoreceptor tyrosine-based activation motifs (ITAMs) by Src family kinases that trigger recruitment of additional kinases, which leads to the activation of T-cells, including the release of Ca ²⁺ . Clustering of CD3 on T cells, for example by immobilized anti-CD3 antibodies, results in T cell activation similar to T cell receptor activation but independent of lineage-typical specificity.

As used herein, the term "CD3" includes human CD3 and refers to an antigen that is expressed on human T cells as part of a multimolecular T cell receptor complex.

With respect to CD3, the binding agent of the invention preferably recognizes the CD3 epsilon chain, in particular it recognizes an epitope that corresponds to the first 27 N-terminal amino acids of the CD3 epsilon or functional fragments of this 27 amino acid region.

According to the invention, the term "claudin-positive cancer" or similar terms means a cancer involving cancer cells expressing claudin, preferably on the surface of said cancer cells.

"Cell surface" is used according to its normal meaning in the art and thus includes the outer surface of a cell that is available for binding by proteins and other molecules.

Claudin is expressed on the surface of cells if it is located on the surface of said cells and is available for binding by claudin-specific antibodies added to the cells.

The term "extracellular part" in the context of the present invention refers to a part of a molecule, such as a protein, that faces the extracellular space of a cell and is preferably accessible from outside said cell, for example, antigen-binding molecules, such as antibodies located outside the cell. Preferably, the term refers to one or more extracellular loops or domains, or a fragment thereof.

The terms "part" or "fragment" are used interchangeably herein and refer to a continuous element. For example, a part of a structure, such as an amino acid sequence or a protein, refers to a contiguous element of said structure. The share, part or fragment of the structure preferably includes one or more functional properties of the specified structure. For example, a proportion, portion, or fragment of an epitope or peptide is preferably immunologically equivalent to the epitope or peptide from which it is derived. The portion or fragment of the protein sequence preferably comprises a sequence of at least 4, in particular at least 6, at least 8, at least 12, at least 15, at least 20, at least at least 30, at least 50, or at least 100 consecutive amino acids of a protein sequence.

According to the invention, CLDN18.2 is not significantly expressed in a cell if the expression level is lower compared to expression in gastric cells or gastric tissue. Preferably, the expression level is less than 10%, preferably less than 5%, 3%, 2%, 1%, 0.5%, 0.1% or 0.05% of the expression in gastric cells or gastric tissues, or even lower. Preferably, CLDN18.2 is not significantly expressed in a cell if the expression level exceeds the expression level in non-cancerous tissue other than the stomach by no more than 2 times, preferably 1.5 times, and preferably does not exceed the expression level in said non-cancerous tissue. Preferably, CLDN18.2 is not substantially expressed in the cell if the expression level is below the detection limit and/or if the expression level is too low to allow binding by CLDN18.2-specific antibodies added to the cells.

According to the invention, CLDN18.2 is expressed in a cell if the expression level exceeds the expression level in non-cancerous tissue other than the stomach, preferably more than 2 times, preferably 10 times, 100 times, 1000 or 10000 times. Preferably, CLDN18.2 is expressed in a cell if the expression level is above the detection limit and/or if the expression level is high enough to allow binding to CLDN18.2-specific antibodies added to the cells. Preferably, CLDN18.2 expressed in a cell is expressed or displayed on the surface of said cell.

According to the invention, CLDN6 is essentially not expressed in a cell if the level of expression is lower compared to expression in cells of the placenta or tissue of the placenta. Preferably, the expression level is less than 10%, preferably less than 5%, 3%, 2%, 1%, 0.5%, 0.1% or 0.05% of expression in placental cells or placental tissue, or even lower. Preferably, CLDN6 is not significantly expressed in a cell if the expression level exceeds the expression level in non-cancerous tissue other than the placenta by no more than 2 times, preferably 1.5 times, and preferably does not exceed the expression level in said non-cancerous tissue. Preferably, CLDN6 is not substantially expressed in the cell if the expression level is below the detection limit and/or if the expression level is too low to allow binding by CLDN6-specific antibodies added to the cell.

According to the invention, CLDN6 is expressed in a cell if the expression level exceeds the expression level in non-cancerous tissue other than the stomach, preferably more than 2 times, preferably 10 times, 100 times, 1000 or 10000 times. Preferably, CLDN6 is expressed in the cell if the expression level is above the detection limit and/or if the expression level is high enough to allow binding by CLDN6-specific antibodies added to the cell. Preferably, CLDN6 expressed in a cell is expressed or displayed on the surface of said cell.

According to the invention, the term "disease" refers to any pathological condition, including cancer, in particular to such forms of cancer as described in this document. Any reference herein to cancer or specific forms of cancer also includes cancer metastases. In a preferred embodiment, the disease to be treated in accordance with the present application includes cells expressing claudin (CLDN), such as CLDN18.2 and/or CLDN6.

"Diseases associated with cells expressing claudin" or similar expressions means in accordance with the invention that claudin is expressed in cells of a diseased tissue or organ. In one embodiment, the expression of the tumor antigen in the cells of the diseased tissue or organ is increased compared to the state in the healthy tissue or organ. Increase refers to an increase of at least 10%, in particular at least 20%, at least 50%, at least 100%, at least 200%, at least at least 500%, at least 1000%, at least 10000% or even more. In one embodiment, expression is found only in diseased tissue, while expression in healthy tissue is repressed. According to the invention, diseases associated with cells expressing claudin include oncological diseases. In addition, according to the invention, oncological diseases are preferably diseases in which cancer cells express claudin.

As used herein, the term "oncological disease" or "cancer" includes a disease characterized by aberrantly regulated cell growth, proliferation, differentiation, adhesion, and/or migration. By "cancer cell" is meant an abnormal cell that proliferates rapidly and uncontrollably and continues to grow after the stimulus that initiated the new growth has ceased. Preferably, the "cancer" is characterized by cells expressing claudin and the cancer cell expresses claudin. The cell expressing claudin is preferably a cancer cell, preferably from the cancer described herein.

The term "cancer" according to the invention includes leukemias, seminomas, melanomas, teratomas, lymphomas, neuroblastomas, gliomas, rectal cancer, endometrial cancer, kidney cancer, adrenal cancer, thyroid cancer, hemoblastosis, skin cancer, brain cancer, cervical cancer , colon cancer, liver cancer, colon cancer, stomach cancer, colon cancer, head and neck cancer, gastrointestinal cancer, cancer of the lymph nodes, esophageal cancer, colon cancer, pancreatic cancer, ear, nose and throat cancer ( ENT), breast cancer, prostate cancer, uterine cancer, ovarian cancer and lung cancer, and their metastases. Examples of this are lung cancer, breast cancer, prostate cancer, colon cancer, renal cell carcinoma, cervical cancer, or metastases of the types of cancers or tumors described above. The term cancer of the invention also includes cancer metastases.

According to the invention, "carcinoma" is a cancer derived from epithelial cells. This group represents the most common types of cancer, including common forms of breast, prostate, lung, and colon cancer.

"Adenocarcinoma" is a cancer that originates in glandular tissue. This tissue is also part of a broader category of tissue known as epithelial tissue. Epithelial tissue includes the skin, glands, and many other tissues that line the cavities and organs of the body. The epithelium is embryologically derived from the ectoderm, endoderm and mesoderm. To be classified as an adenocarcinoma, the cells do not have to be part of a gland if they have secretory properties. This form of carcinoma can occur in some higher mammals, including humans. Well-differentiated adenocarcinomas tend to resemble the glandular tissue from which they originate, while poorly differentiated ones may not. By staining the biopsy cells, the pathologist will determine whether the tumor is an adenocarcinoma or another type of cancer. Adenocarcinomas can occur in many body tissues due to the ubiquitous nature of glands in the body. Although each gland cannot secrete the same substance, if there is exocrine function in the cell, it is considered glandular, so its malignant form is called adenocarcinoma. Malignant adenocarcinomas invade other tissues and often metastasize if given enough time. Adenocarcinoma of the ovary is the most common type of ovarian carcinoma. It includes serous and mucinous adenocarcinoma, clear cell carcinoma, and endometrioid adenocarcinoma.

"Metastasis" refers to the spread of cancer cells from their original site to another part of the body. The formation of metastases is a very complex process and depends on the separation of cancer cells from the primary tumor, invasion of the extracellular matrix, penetration through endothelial basement membranes into the body cavity and vessels, and then, after transport by blood, infiltration into target organs. Finally, the growth of a new tumor at the target site depends on angiogenesis. Tumor metastases often occur even after removal of the primary tumor because tumor cells or components may remain and develop metastatic potential. In one embodiment, the term "metastasis" according to the invention refers to "distant metastasis", which refers to metastasis remote from the primary tumor and the regional lymph node system. In one embodiment, the term "metastasis" in accordance with the invention refers to metastasis to the lymph nodes. One particular form of metastasis that is treatable using the therapy of the invention is metastasis originating from gastric cancer as the primary site. In preferred embodiments, such gastric cancer metastasis is Krukenberg tumors, peritoneal metastasis, and/or lymph node metastasis.

Krukenberg's tumor is an uncommon metastatic ovarian tumor accounting for 1% to 2% of all ovarian tumors. The prognosis of Krukenberg tumor is still very poor and there is no cure for Krukenberg tumors. Krukenberg's tumor is a metastatic ring cell adenocarcinoma of the ovary. The stomach is the main site in most cases of Krukenberg tumors (70%). Colon, appendix, and breast carcinomas (predominantly invasive lobular carcinoma) are the most common primary sites. Rare cases of Krukenberg tumor originating from carcinomas of the gallbladder, biliary tract, pancreas, small intestine, ampulla of Vater, cervix, and bladder/urachus have been reported.

By "treat" is meant administering a compound or composition or combination of compounds or compositions to an object for the purpose of preventing or eliminating a disease, including reducing the size of a tumor or the number of tumors in the object; stop or slow down the disease in the subject; inhibition or slowing down the development of a new disease in the object; reducing the frequency or severity of symptoms and/or relapses in a subject who is currently suffering from or who previously had a disease; and/or renewals, i.e. increasing the lifespan of an object.

In particular, the term "treating a disease" includes curing, shortening, ameliorating, preventing, retarding or slowing the progression or worsening of, or preventing or delaying the onset of a disease or its symptoms.

In the context of the present invention, terms such as "protect", "prevent", "prophylactic", "preventive", or "protective" refer to the prevention or treatment, or both, of the occurrence and/or spread of a disease in a subject, and in particular , to minimize the likelihood that the subject will develop a disease, or to delay the development of a disease. For example, a subject at risk of cancer would be a candidate for cancer prevention therapy.

By "threatened" is meant an entity that is identified as having a higher than normal chance of developing a disease, in particular cancer, compared to the general population. In addition, an object that has or currently has a disease, in particular cancer, is an object that has an increased risk of developing the disease because such an object may continue to develop the disease. Subjects who currently have or have had cancer also have an increased risk of developing cancer metastases.

The term "patient" in accordance with the invention means an object for treatment, in particular a sick object, including humans, non-human primates or other animals, in particular mammals, such as cows, horses, pigs, sheep, goats, dogs, cats or rodents such as mice and rats. In a particularly preferred embodiment, the patient is a human.

"Target cell" means any unwanted cell, such as a cancer cell. In preferred embodiments, the target cell expresses claudin.

The term "antigen" refers to a molecule, such as a protein or peptide, containing an epitope against which the agent is directed and/or to be directed, preferably to induce an immune response. In a preferred embodiment, the antigen is a tumor-associated antigen, such as CLDN18.2 or CLDN6, i.e. an element of cancer cells that can be obtained from the cytoplasm, cell surface and cell nucleus, in particular those antigens that are produced, preferably in large quantities , intracellularly or as surface antigens on cancer cells.

In the context of the present invention, the term "tumor-associated antigen" preferably refers to proteins that under normal conditions are specifically expressed in a limited number of tissues and/or organs or at certain developmental stages and are expressed or aberrantly expressed in one or more tumor or cancer tissues. In the context of the present invention, the tumor-associated antigen preferably binds to the cell surface of the cancer cell and is preferably not or rarely expressed in normal tissues.

The term "epitope" refers to an antigenic determinant in a molecule, i. to the part of the molecule that is recognized by the immune system, for example, that is recognized by an antibody. For example, epitopes are discrete three-dimensional regions on an antigen that are recognized by the immune system. Epitopes usually consist of reactive surface groups of molecules, such as amino acids or sugar side chains, and usually have specific three-dimensional structural characteristics, and specific charge characteristics. Conformational and non-conformational epitopes differ in that binding to the former, but not to the latter, is lost in the presence of denaturing solvents. A protein epitope preferably comprises a continuous or discontinuous portion of said protein and is preferably 5 to 100, preferably 5 to 50, more preferably 8 to 30, most preferably 10 to 25 amino acids in length, e.g. the epitope may preferably be 8, 9 , 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 amino acids in length.

The term "binding agent" as used herein refers to any agent capable of binding to the antigens of interest. In certain embodiments of the invention, the binding agent is an antibody, an antibody fragment, or a construct thereof. The binding agent may also contain synthetic, modified or non-naturally occurring fragments, in particular non-peptide fragments. Such fragments may, for example, bind antigen-binding functions or regions of interest, such as antibodies or antibody fragments. In one embodiment, the binding agent is a synthetic construct containing antigen-binding CDRs or variable regions.

The term "immunoglobulin" refers to proteins of the immunoglobulin superfamily, preferably antigen receptors such as antibodies or the B cell receptor (BCR). Immunoglobulins are characterized by a structural domain, ie an immunoglobulin domain having a characteristic immunoglobulin fold (Ig). The term includes membrane-bound immunoglobulins, and soluble immunoglobulins. Soluble immunoglobulins are commonly referred to as antibodies. Immunoglobulins usually contain several chains, usually two identical heavy chains and two identical light chains, which are linked through disulfide bonds. These chains are primarily composed of immunoglobulin domains such as the V _L domain (light chain variable), the _CL domain (light chain constant), and the _CH domains (heavy chain constant) C _H 1, C _H 2, C _H 3 and C _H 4. There are five types of mammalian immunoglobulin heavy chains, namely α, δ, ε, γ and µ, which give rise to different classes of antibodies, i.e. IgA, IgD, IgE, IgG and IgM. Unlike the heavy chains of soluble immunoglobulins, the heavy chains of membrane or surface immunoglobulins contain a transmembrane domain and a short cytoplasmic domain at their carboxy terminus. Mammals have two types of light chains, namely lambda and kappa. Immunoglobulin chains contain a variable region and a constant region. The constant region is essentially conserved across immunoglobulin isotypes, while the variable region is very different and determines antigen recognition.

The term "antibody" refers to an immunoglobulin containing at least two heavy (H) chains and two light (L) chains connected by disulfide bonds, or an antigen-binding portion thereof. The term "antibody" includes monoclonal antibodies, recombinant antibodies, human antibodies, humanized antibodies, and chimeric antibodies. Each heavy chain consists of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. Each light chain consists of a light chain variable region (abbreviated herein as VL) and a light chain constant region. The term "region" and the term "domain" are used interchangeably in this document. The VH and VL regions can be further subdivided into regions of hypervariability called complementarity determining regions (CDRs) interspersed with regions that are more conserved and called framework regions (FRs). Each VH and VL consists of three CDRs and four FRs, arranged from amino to carboxy in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. Antibody constant regions can mediate immunoglobulin binding to host tissues or factors, including various cells of the immune system (eg, effector cells) and the first component (Clq) of the classical complement system.

As used herein, the term "monoclonal antibody" refers to a preparation of antibody molecules with a single molecular composition. A monoclonal antibody exhibits a single binding specificity and affinity. In one embodiment, the monoclonal antibodies are derived from a hybridoma, which consists of a B cell derived from a non-human animal, such as a mouse, fused to an immortalized cell.

As used herein, the term "recombinant antibody" includes all antibodies that have been made, expressed, generated, or isolated by recombinant means, such as (a) antibodies isolated from an animal (e.g., mouse) that is transgenic or transchromosomal for immunoglobulin genes. , or a hybridoma derived therefrom, (b) antibodies isolated from a host cell transformed to express the antibody, e.g. from a transfectoma, (c) antibodies isolated from a library of recombinant combinatorial antibodies, and (d) antibodies obtained, expressed, created or isolated by any other means that involve splicing immunoglobulin gene sequences with other DNA sequences.

As used herein, the term "human antibody" is intended to include antibodies having variable and constant regions derived from germline human immunoglobulin sequences. Human antibodies may include amino acid residues not encoded by germline human immunoglobulin sequences (eg, mutations introduced by in vitro random or site-specific mutagenesis or in vivo somatic mutation).

The term "humanized antibody" refers to a molecule having an antigen binding site that is essentially derived from an immunoglobulin of a non-human species, in which the remaining structure of the immunoglobulin molecule is based on the structure and/or sequence of a human immunoglobulin. The antigen binding site may either contain complete variable domains fused to constant domains, or only complementarity determining regions (CDRs) grafted into the appropriate framework regions in the variable domains. Antigen binding sites may be wild-type or may be modified with one or more amino acid substitutions, such as modified to more closely resemble human immunoglobulins. Some forms of humanized antibodies retain all CDR sequences (eg, a humanized mouse antibody that includes all six CDRs from a mouse antibody). Other forms have one or more CDRs that vary from the parent antibody.

The term "chimeric antibody" refers to those antibodies where one portion of each of the heavy and light chain amino acid sequences is homologous to corresponding sequences in antibodies derived from the same species or belonging to a particular class, while the remaining chain segment is homologous to corresponding sequences in another species or class. . Typically, the variable region of both the light and heavy chains mimics the variable regions of antibodies derived from one mammalian species, while the constant portions are homologous to antibody sequences derived from another organism. One distinct advantage of such chimeric forms is that the variable region can be conveniently derived from currently known sources using readily available B cells or hybridomas from non-human hosts in combination with constant regions derived from e.g. human cells. Although the variable region has the advantage of ease of preparation and the specificity is not affected by the source, a human constant region is less likely to elicit an immune response in a human when administered with an antibody than a constant region from a non-human source. However, this definition is not limited to this specific example.

Antibodies can be obtained from a variety of species, including, but not limited to, mice, rats, rabbits, guinea pigs, and humans.

The antibodies described herein include IgA antibodies such as IgA1 or IgA2, IgG1, IgG2, IgG3, IgG4, IgE, IgM, and IgD. In various embodiments of the invention, the antibody is an IgG1 antibody, more specifically an IgG1, kappa or IgG1, lambda isotype (i.e., IgG1, κ, λ), an IgG2a antibody (i.e., IgG2a, κ, λ), an IgG2b antibody (i.e., IgG2b, κ, λ), IgG3, antibody (eg IgG 3, κ, λ) or IgG4 antibody (eg IgG4, κ, λ).

As used herein, the term "heterologous antibody" is defined in relation to a transgenic organism that produces such an antibody. This term refers to an antibody having an amino acid sequence or encoded by a nucleotide sequence corresponding to that found in an organism that does not match the transgenic organism and is usually derived from a species other than the transgenic organism.

As used herein, the term "heterohybrid antibody" refers to an antibody having light and heavy chains from different organisms. For example, an antibody having a human heavy chain linked to a mouse light chain is a heterohybrid antibody.

Binding agents such as the antibodies described herein are preferably isolated. The term "isolated", as used herein, is intended to mean a binding agent that is substantially free of other agents having different antigenic specificities (e.g., an isolated antibody that specifically binds to CLDN18.2 is substantially free of antibodies that specifically bind antigens other than CLDN18.2). An isolated binding agent that specifically binds to an epitope, isoform, or variant of human CLDN18.2 may, however, be cross-reactive to other related antigens, eg from other species (eg, species homologues of CLDN18.2). In addition, the isolated binding agent may be substantially free of other cellular materials and/or chemicals.

The terms "antigen-binding portion" of an antibody (or simply "binding portion") or "antigen-binding fragment" of an antibody (or simply "binding fragment") or similar terms refer to one or more antibody fragments that retain the ability to specifically bind to an antigen. It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full length antibody. Examples of binding fragments included in the term "antigen-binding portion" of an antibody include (i) Fab fragments, monovalent fragments consisting of VL, VH, CL, and CH domains; (ii) F(ab')2 fragments, bivalent fragments containing two Fab fragments connected by a disulfide bridge in the hinge region; (iii) Fd fragments consisting of VH and CH domains; (iv) Fv fragments consisting of the VL and VH domains of one antibody arm, (v) dAb fragments (Ward et al., (1989) Nature 341: 544-546) which consist of a VH domain; (vi) dedicated complementarity determination regions (CDRs); and (vii) combinations of two or more dedicated CDRs, which may optionally be joined by a synthetic linker. In addition, although the two fragment regions Fv, VL and VH are encoded by separate genes, they can be combined, using recombinant methods, with a synthetic linker that allows a single protein chain in which the VL and VH pairs form monovalent molecules (known as single-stranded Fv (scFv), see, for example, Bird et al (1988) Science 242: 423-426 and Huston et al (1988) Proc Natl Acad Sci USA 85: 5879-5883). Such single chain antibodies are intended to be included in the term "antigen binding fragment" of an antibody. Another example are immunoglobulin-binding domain fusion proteins comprising (i) a binding domain polypeptide that is fused to an immunoglobulin hinge polypeptide, (ii) an immunoglobulin heavy chain CH2 constant region fused to the hinge, and (iii) a heavy chain CH3 constant region. immunoglobulin fused to the CH2 constant region. The binding domain polypeptide can be a heavy chain variable region or a light chain variable region. Binding domain and immunoglobulin fusion proteins are further described in US 2003/0118592 and US 2003/0133939. These antibody fragments are prepared by conventional methods known to those skilled in the art and the fragments are screened for utility in the same manner as intact antibodies.

A single chain variable fragment (scFv) is a fusion protein of immunoglobulin heavy (VH) and light chain (VL) variable regions linked to a short linker peptide, typically 10-30 amino acids. The linker is usually rich in glycine for flexibility, and serine or threonine for solubility, and can either connect the N-terminus of the VH to the C-terminus of the VL, or vice versa. Bivalent (or bivalent) single chain variable fragments (di-scFv, bi-scFv) can be generated by linking two scFvs. This can be done by making a single peptide chain with two VH and two VL regions, resulting in tandem scFvs. The invention also includes polyspecific molecules containing more than two scFv binding domains. One common flexible binding peptide is (Gly ₄ Ser) _x where x can be 3, 4, 5 or 6. Optionally, the association of VH and VL can be stabilized by one or more intermolecular disulfide bonds.

As used herein, the term "binding domain" or "antigen-binding domain" refers to a site, such as an antibody, that binds to an antigen and includes the antigen-binding portion of the antibody. the binding domain may consist of heavy chain and light chain variable domains (VH and VL), each of which includes four conserved framework regions (FR) and three CDRs. CDRs differ in sequence and determine specificity for a particular antigen. The VH and VL domains together can form a site that specifically binds a particular antigen.

Fab (antigen-binding fragment) antibody fragments are immunoreactive polypeptides containing monovalent antigen-binding domains of an antibody, consisting of a polypeptide consisting of a heavy chain variable region (VH) and a heavy chain constant region 1 (CH1), and a polypeptide consisting of a light chain variable region chain (VL) and the light chain constant region (in which the CL and CH1 regions are linked together, preferably by a disulfide bond between Cys residues). Preferably, in the Fab fragments described herein, the CH1 region and the CL region are of human origin. In one embodiment, the CL region is a kappa-type CL region. In one embodiment, the CH1 region is derived from IgG1 or IgG2.

All antibodies and antibody derivatives, such as antibody fragments, as described herein for the purposes of the invention, are encompassed by the term "antibody". The term "antibody derivatives" refers to any modified form of an antibody, such as a conjugate of an antibody and another agent, or an antibody or antibody fragment. In addition, antibodies and antibody derivatives as described herein are useful in the preparation of binding agents of the invention, such as antibody fragments.

Naturally occurring antibodies tend to be monospecific, meaning they bind to a single antigen. The present invention provides binding agents that bind to a cytotoxic cell, such as a T cell (eg, by engaging the CD3 receptor) and a target cell, such as a cancer cell (by engaging claudin). The binding agents of the present invention bind to at least two different types of antigen and are at least bispecific or multispecific, such as trispecific, tetraspecific, and so on.

The binding agent of the present invention may be at least trivalent. As used herein, the term "valency", "valency", "valencies", or other grammatical variants thereof, refers to the number of antigen binding sites or binding domains in a binding agent. Antigen binding sites that bind to the same antigen may recognize the same epitope or different epitopes. Trivalent bispecific antibodies and tetravalent bispecific antibodies are known in the art. The binding agent of the present invention may also have a valence greater than 4.

The binding agent described herein is preferably an artificial protein (including protein complexes) that can be composed of fragments of at least two different antibodies (said fragments of at least two different antibodies forming, at least two different binding domains) and therefore binding to at least two different types of antigens. The binding agent of the invention is designed to simultaneously bind to an immune cell, such as an immune effector cell, in particular a T cell, such as a cytotoxic cell (for example, by binding to CD3), and a target cell to be killed, such as a cancer cell. (by binding to a tumor antigen (claudin).

Several types of trivalent antibodies have been developed and all types are within the scope of the present invention. TRIPLEBODY or single chain triple antibodies (sctb) consist of three separate regions of scFv connected by linker sequences. In addition, natural in vivo heterodimerization of the heavy chain (CH1 domain) and light chain (CL domain) can be used to form a scaffold to which multiple scFvs can be added. So, for example, a ScFv specific for one antigen can be linked to a CH1 domain that is also linked to a specific ScFv to another antigen, and this chain can interact with another chain containing a ScFv specific to any antigen linked to the CL domain (scFv3-CH1 /CL). Another example of a trivalent construct involves the use of a Fab fragment specific for one epitope, C-terminally linked to two scFvs specific for a different epitope, one per strand (Fab-scFv2). Yet another example of a trivalent (or tetravalent) molecule includes a variety of formats that contain additional binding entities attached to the N- or C-terminus of the antibodies. For example, one format consists of an intact single antigen-specific antibody molecule with a single chain Fab (scFab) linked to the C-terminus of the molecule (IgG-scFab). The Dock-and-Lock (DNL) approach has also been used to generate trivalent antibodies (DNL-F(ab)3) (Chang, C.-H. et al. In: Bispecific Antibodies. Kontermann R.E. (ed.), Springer Heidelberg Dordrecht London New York, pp. 199-216 (2011)). Each of the above antibodies is within the scope of the present invention.

Quadrivalent antibodies have also been constructed and all types are within the scope of the present invention. Examples of tetravalent antibodies include, but are not limited to, scFv2-Fc, F(ab')2-scFv2, scFv2-H/L, and scFv-dhlx-scFv molecules. The bispecific scFv2-Fc constructs have an Fc domain with two scFvs specific for one molecule linked to the N-terminus of the Fc chains and two other scFvs specific to the other molecule linked to the C-terminus of the Fc chain. The F(ab')2-scFv2 bispecific constructs include scFv fragments linked to the C-terminus of the F(ab')2 fragment. The scFv2-H/L constructs have scFvs specific for one molecule associated with heavy chains, while scFvs specific for another molecule are associated with light chains. Finally, the scFv-dhlx-scFv constructs contain one type of scFv associated with a helical dimerization domain followed by another type of scFv. Two chains of this type can dimerize to form a tetravalent antibody.

The binding agent of the invention may be in the form of an antibody molecule or an antibody-like molecule, or a protein scaffold with antibody-like properties, or a cyclic peptide with at least two binding specificities. Thus, the binding agent may contain one or more of the antibodies described herein, or fragments thereof.

In one embodiment, the binding agent of the invention includes a heavy chain (Fd fragment) and a light chain (L) of the Fab fragment, which are capable of heterodimerization and by which additional functions or binding domains can be introduced. Such additional binding domains may be independently selected from the group consisting of binding domains containing two antibody variable regions, such as scFv binding domains, ie. VH-VL or VL-VH, and binding domains containing a single antibody variable region, such as VH binding domains and VHH binding domains.

In one embodiment, the binding agent of the invention is in the format of a Fab-scFv2 construct, ie a Fab fragment provided with two scFv fragments, preferably at the C-terminus of the Fab fragment constant regions. In one embodiment, the binding agent of the invention is a dimer consisting of two polypeptide chains, preferably linked together by a disulfide bridge, wherein the first polypeptide comprises an scFv linked to an additional VL domain via a CL polypeptide chain and the second polypeptide comprises an scFv linked to an additional domain VH through the CH1 polypeptide chain. A disulfide bridge is preferably formed between the Cys residue in CL and the Cys residue in CH1 such that the additional VL of the first polypeptide is associated with the additional VH of the second polypeptide in an antigen-binding configuration such that the binding agent comprises three antigen-binding domains in total. Thus, in one embodiment, the binding agent of the invention comprises a heavy chain (Fd fragment) and a light chain (L) of the Fab fragment, which are capable of heterodimerization and which include scFv binding domains (preferably at the C-terminus in Fd/L). According to the invention, the VH and VL domains in the scFv fragments are preferably connected by peptide linkers and/or Fab chains, and the scFv are preferably connected by peptide linkers. According to the invention, the VH and VL domains in scFv fragments are preferably linked by peptide linkers having the amino acid sequence (G ₄ S) _x where x is 3, 4, 5 or 6. The Fab and scFv chains are preferably linked by a peptide linker having the amino acid sequence DVPG ₂ S or SGPG ₃ RS(G ₄ S) ₂ . In one embodiment, a linker containing the amino acid sequence SGPG ₃ RS(G ₄ S) ₂ connects the scFv binding domain to the Fd fragment, and a linker containing the DVPG ₂ S amino acid sequence connects the scFv binding domain to the L fragment. In one embodiment, the scFv fragments bind to claudin and the Fab fragment binds to a T cell specific antigen.

In one embodiment, the binding agent of the invention comprises a first and a second polypeptide, wherein the first polypeptide and the second polypeptide comprise, from the N-terminus to the C-terminus, the following domains:

VH-CH1-scFv and VL-CL-scFv,

where VH and VL are linked to form a binding domain.

In one embodiment, the binding agent of the invention comprises a first and a second polypeptide, wherein in the first polypeptide and the second polypeptide, the VH domain(s), VL domain(s), CH1 domain, and CL domain are N-terminal to C-terminal in order

- VH(T) -CH1-VH (CLDN) -VL (CLDN) and VL(T) -CL-VH (CLDN) -VL (CLDN); or

- VH(T) -CH1-VL (CLDN) -VH (CLDN) and VL(T) -CL-VL (CLDN) -VH (CLDN); or

- VH(T) -CH1-VH (CLDN) -VL- (CLDN) and VL(T) -CL-VL (CLDN) -VH- (CLDN); or

- VH(T) -CH1-VL (CLDN) -VH- (CLDN) and VL(T) -CL-VH (CLDN) -VL- (CLDN); or

- VH (CLDN) -CH1-VH(T) -VL(T) and VL (CLDN) -CL-VH (CLDN) -VL (CLDN); or

- VH (CLDN) -CH1-VL(T) -VH(T) and VL (CLDN) -CL-VL (CLDN) -VH (CLDN); or

- VH (CLDN) -CH1-VL(T) -VH(T) and VL (CLDN) -CL-VH (CLDN) -VL (CLDN); or

- VH (CLDN) -CH1-VH(T) -VL(T) and VL (CLDN) -CL-VL (CLDN) -VH (CLDN); or

- VH (CLDN) -CH1-VH (CLDN) -VL (CLDN) and VL (CLDN) -CL-VH(T) -VL(T); or

- VH (CLDN) -CH1-VL (CLDN) -VH (CLDN) and VL (CLDN) -CL-VL(T) -VH(T); or

- VH (CLDN) -CH1-VL (CLDN) -VH (CLDN) and VL (CLDN) -CL-VH(T) -VL(T); or

-VH(CLDN)-CH1-VH(CLDN)-VL(CLDN) and VL(CLDN)-CL-VL(T)-VH(T).

The term "linker" refers to any means that serve to connect two different functional units (for example, antigennegative fragments). Types of linkers include, but are not limited to, chemical linkers and polypeptide linkers. The sequences of the polypeptide linkers are not limited. Polypeptide linkers are preferably non-immunogenic and flexible, such as linkers containing serine and glycine sequences. Linkers can be long or short depending on the specific design.

According to the invention, the linker connecting the VH and VL domains to form the VH-VL or VL-VH scFv domains preferably includes a flexible peptide linker such as a glycine-serine peptide linker. In one embodiment, the linker includes the amino acid sequence (GS _x , where x is 3, 4, 5, or 6. In the case of an scFv domain containing VH and VL domains in a VH-VL orientation, the linker preferably includes the amino acid sequence (G ₄ S) ₄ . In the case of an scFv domain containing the VH and VL domains in a VL-VH orientation, the linker preferably includes the amino acid sequence (G ₄ S) ₅ .

According to the invention, the linker connecting the scFv domain and the Fd domain, preferably at the C-terminus of CH1, preferably comprises the amino acid sequence DVPG ₂ S or SGPG ₃ RS(G ₄ S) ₂ , preferably SGPG ₃ RS(G ₄ S) ₂ . According to the invention, the linker connecting the scFv domain and the L domain, preferably at the C-terminus of the CL, preferably comprises the amino acid sequence DVPG ₂ S or SGPG ₃ RS(G ₄ S) ₂ , preferably DVPG ₂ S.

Binding agents of the invention may also contain an amino acid sequence to facilitate secretion of the molecule, such as an N-terminal secretion signal, and/or one or more epitope tags to facilitate binding, purification, or detection of the molecule.

Preferably, the secretion signal is a signal sequence (eg, the amino acid sequence MGWSCIILFLVATATGVHS) that allows sufficient passage through the secretory pathway and/or secretion of the binding agent or its polypeptide chains into the extracellular environment. Preferably, the secretion signal sequence is cleavable and removed from the mature binding agent. The secretion signal sequence is preferably selected based on the cell or organism in which the binding agent is produced.

The amino acid sequence of the epitope tag may be introduced at any position in the amino acid sequence of the binding agent and may take the form of a loop in the structure of the encoded protein, or it may be fused to the N-terminus or C-terminus of the binding agent. Preferably, the epitope tag is linked to a linking agent at the C-terminus. The epitope label may include a cleavage site that allows the label to be removed from the binding agent. Said epitope tag may be any type of epitope tag that functions under native and/or denaturing conditions, preferably a histidine tag, most preferably a six histidine tag.

The binding agent according to the invention may contain, in addition to the first, second and third binding domains, one or more additional binding domains, which serve, for example, to increase selectivity for tumor cells. This can be achieved, for example, by providing binding domains that bind to other antigens expressed on tumor cells.

In the context of the present invention, the resulting binding agents are preferably capable of inducing immune effector functions as described herein. Preferably, said immune effector functions are directed against cells bearing the tumor-associated antigen claudin on their surface.

The term "immune effector functions" in the context of the present invention includes any functions mediated by components of the immune system that result, for example, in inhibition of tumor growth and/or inhibition of tumor development, including inhibition of tumor spread and metastasis. Preferably, the functions of the immune effector lead to the destruction of tumor cells. Such functions include complementary-dependent cytotoxicity (CDC), antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cell-mediated phagocytosis (ADCP), induction of apoptosis in tumor antigen-bearing cells, cytolysis of tumor antigen-bearing cells, and/or inhibition of cell proliferation. carrying the tumor antigen. Binding agents may also act simply by binding to tumor antigens on the surface of the cancer cell. For example, antibodies can block the function of a tumor antigen or induce apoptosis only by binding to a tumor antigen on the surface of a cancer cell.

The binding agents described herein may be conjugated to a therapeutic moiety or agent, such as a cytotoxin, a drug (eg, an immunosuppressant), or a radioisotope. A cytotoxin or cytotoxic agent includes any agent that is detrimental to a cell and in particular kills cells. Examples include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracindione, mitoxantrone, mithramycin, actinomycin D, amanitin, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine , lidocaine, propranolol and puromycin, and their analogues or homologues. Suitable therapeutic agents for forming antibody conjugates include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, fludarabine, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine ( BSNU) and lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and is-Diammindichloroplatinum (II) (DDP) cisplatin), anthracyclines (eg, daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (eg, dactinomycin ( formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC), and antimitotic agents (e.g., vincristine and vinblastine). In a preferred embodiment, the therapeutic agent is a cytotoxic agent or a radiotoxic agent. In another embodiment, the therapeutic agent is an immunosuppressant. In yet another embodiment, the therapeutic agent is the agent is GM-CSF In a preferred embodiment, the therapeutic agent is doxorubicin, cisplatin, bleomycin, sulfate, carmustine, chlorambucil, cyclophosphamide, or ricin A.

Binding agents can be conjugated to a radioisotope, such as iodine-131, yttrium-90, or indium-111, to produce cytotoxic radiopharmaceuticals.

Methods for conjugating such a therapeutic moiety to antibodies are well known, see, for example, Arnon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies For Drug Delivery", in Controlled Drug Delivery ( ^2nd Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal Antibodies '84: Biological And Clinical Applications, Pincheraet al. (eds.), pp. 475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and Thorpe et al., "The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates", Immunol. Rev. 62: 119-58 (1982).

The term "binding" according to the invention preferably refers to specific binding.

According to the present invention, an agent, such as an antibody, is capable of binding to a predefined target if it has a significant affinity for said predefined target and binds to said predefined target in standard assays. "Affinity" or "binding affinity" is often measured by the equilibrium dissociation constant (K _D ). Preferably, the term "significant affinity" refers to binding to a given target with a dissociation constant (K _D ) of 10 ^-5 M or less, 10 ^-6 M or less, 10 ^-7 M or less, 10 ^-8 M or less, 10 ^-9 M or less, 10 ^-10 M or less, 10 ^-11 M or less, or 10 ^-12 M or less.

An agent is (substantially) unable to bind to a target unless it has significant affinity for said target and binds significantly, in particular, does not bind in a detectable manner to said target in standard assays. Preferably, the antibody does not bind to said target if it is present at a concentration of up to 2, preferably 10, more preferably 20, in particular 50 or 100 μg/ml or higher. Preferably, if the agent has no significant affinity for the target, if it binds to said target with a K _D that is at least 10 times, 100 times, 10 ³ times, 10 ⁴ times, 10 ⁵ times, or 10 ⁶ times higher than the K _D for binding to a predetermined target with which the antibody is able to bind. For example, if the K _D for binding of an antibody to a target for which the antibody is able to bind is 10 ^-7 M, the K _D for binding to a target for which the antibody has no significant affinity will be at least 10 ^-6 M, 10 ^-5 M, 10 ^-4 M, 10 ^-3 M, 10 ^-2 M or 10 ^-1 M.

An agent is specific for a given target if it is able to bind to said predetermined target, and at the same time is not able to bind to other targets, i.e. has no significant affinity for other targets and cannot significantly bind to other targets in standard assays. According to the invention, an agent is specific for claudin if it is able to bind to claudin but is (substantially) unable to bind to other targets. Preferably, the agent is specific for claudin if the affinity and binding to such other targets is not significantly greater than the affinity or binding to non-claudin related proteins such as bovine serum albumin (BSA), casein, human serum albumin (HSA)) or non-claudin transmembrane proteins such as MHC molecules or transferrin receptor, or any other polypeptide specified. Preferably, an agent is specific to a predetermined target if it binds to said entity with a K _D that is at least 10 times, 100 times, 10 ³ times, 10 ⁴ times, 10 ⁵ times, or 10 ⁶ -times less than K _D binding to a target for which it is not specific. For example, if the K _D for binding an agent to a target for which it is specific is 10 ^-7 M, the K _D for binding to a target for which it is not specific will be at least 10 ^-6 M, 10 ^{- 5} M, 10 ^-4 M, 10 ^-3 M, 10 ^-2 M or 10 ^-1 M.

The binding of an agent to a target can be determined experimentally using any suitable method; see, for example, Berzofsky et al., "Antibody-Antigen Interactions" In Fundamental Immunology, Paul, WE, Ed., Raven Press New York, NY (1984), Kuby, Janis Immunology, WH Freeman and Company New York, NY (1992) and the methods described herein. Affinities can be easily determined using conventional methods such as equilibrium dialysis; using the BIAcore 2000 instrument, using the general procedures specified by the manufacturer; by radioimmunoassay using a radioactively labeled antigen; or in another manner known to a person skilled in the art. Affinity data can be analyzed, for example, by the method of Scatchard et al., Ann NY Acad. ScL, 51:660 (1949). The measured affinity of a particular antibody-antigen interaction may vary if measured under different conditions, eg salt concentration, pH. Thus, measurements of affinity and other antigen-binding parameters, eg K _D , IC ₅₀ , are preferably made with standardized antibody and antigen solutions and a standardized buffer.

The term "competes" refers to the competition between two antibodies for binding to a target antigen. If two antibodies do not block each other for binding to the target antigen, such antibodies are not competing, and this indicates that these antibodies do not bind to the same part, i.e. epitope of the target antigen. One skilled in the art is well aware of how to test for antibody competition for binding to a target antigen. An example of such a method is the so-called cross-competition assay, which can, for example, be carried out in the form of an ELISA or by flow cytometry.

For example, an ELISA-based assay can be performed by coating the well of an ELISA plate with each of the antibodies; adding a competing antibody and His-tagged extracellular domain of the antigen/target and incubation; determining whether the added antibody inhibits the binding of the His-tagged protein to the coated antibody can be done by adding a biotinylated anti-His antibody followed by the addition of streptavidin-poly-HRP and further developing the reaction with ABTS and measuring absorbance at 405 nm . For example, flow cytometry analysis can be performed by incubating cells expressing the antigen/target with an excess of unlabeled antibody, incubating the cells with a suboptimal concentration of biotin labeled antibody, followed by incubation with fluorescently labeled streptavidin, and analyzing by flow cytometry.

Two antibodies have "the same specificity" if they bind to the same antigen and the same epitope. Does the antibody to be tested recognize the same epitope as the particular antigen-binding antibody, i.e. antibodies that bind to the same epitope can be analyzed based on their competition for the same epitope. Competition between antibodies can be detected using a cross-blocking assay. For example, a competitive ELISA assay can be used as a cross-blocking assay. For example, the target antigen can be loaded into the wells of a microtiter plate, and an antigen-binding antibody and a possible competing test antibody can be added. The amount of antigen-binding antibody bound to an antigen in a well indirectly correlates with the binding capacity of a potential competing test antibody that competes with it for binding to the same epitope. In particular, the greater the affinity of a potential competing test antibody for the same epitope, the lower the amount of antigen-binding antibody bound to the antigen-coated well. The amount of antigen-binding antibody bound to a well can be measured by labeling the antibody with detectable or measurable labeling agents.

An antibody that competes for antigen binding with another antibody, such as an antibody containing heavy and light chain variable regions, as described herein, or an antibody that has specificity for the antigen of another antibody, such as an antibody containing a heavy and light chain variable region, as described herein may be an antibody containing variants of said heavy and/or light chain variable regions as described herein, eg, CDR modifications and/or a certain degree of identity as described herein.

As used herein, the term "isotype" refers to the class of antibodies (eg, IgM or IgG1) that is encoded by heavy chain constant region genes.

As used herein, the term "isotype switching" refers to the phenomenon by which the class or isotype of an antibody changes from one Ig class to one of the other Ig classes.

The term "naturally occurring" as used herein to apply to an object refers to the fact that the object can be found in nature. For example, a polypeptide or polynucleotide sequence present in an organism (including viruses) that can be isolated from a source in nature and that has not been intentionally modified by humans in a laboratory is naturally occurring.

As used herein, the term "rearranged" refers to a heavy chain or light chain immunoglobulin locus configuration where the V segment is located immediately adjacent to the D-J or J segment in a conformation encoding a substantially complete VH or VL domain, respectively. The rearranged immunoglobulin (antibody) gene locus can be identified by comparison with germline DNA; the rearranged locus will have at least one recombined heptamer/nonamer homology element.

The term "unrearranged" or "germline configuration", as used herein in relation to a V segment, refers to a configuration in which the V segment is not recombined to be directly adjacent to the D or J segment.

In one embodiment, the binding agent of the invention has the ability to bind to CLDN18.2, i.e. the ability to bind to an epitope present in CLDN18.2, preferably an epitope located within the extracellular domains of CLDN18.2, in particular the first extracellular loop, preferably amino acid positions 29-78 in CLDN18.2. In specific embodiments, an agent with the ability to bind to CLDN18.2 binds to an epitope on CLDN18.2 that is not present on CLDN18.1.

An agent having the ability to bind to CLDN18.2 preferentially binds to CLDN18.2 but not to CLDN18.1. Preferably, the CLDN18.2 binding agent is specific for CLDN18.2. Preferably, the CLDN18.2 binding agent binds to CLDN18.2 expressed on the cell surface. In preferred embodiments, the CLDN18.2 binding agent binds to native CLDN18.2 epitopes present on the surface of living cells.

In a preferred embodiment, the CLDN18.2 binding domain of the binding agent of the invention comprises a heavy chain variable region (VH) comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 20, 21, 24, or a fragment thereof, or a variant amino acid sequence or fragment.

In a preferred embodiment, the binding domain binding to CLDN18.2 of the binding agent of the invention comprises a light chain variable region (VL) comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 22, 23, 25, or a fragment or variant thereof. amino acid sequence or fragment.

In some preferred embodiments, the CLDN18.2 binding domain of the binding agent of the invention comprises a combination of a heavy chain variable region (VH) and a light chain variable region (VL) selected from the following possibilities:

(i) VH includes the amino acid sequence shown by SEQ ID NO: 20 or a fragment or variant of the amino acid sequence or fragment thereof, and VL includes the amino acid sequence shown by SEQ ID NO: 22 or a fragment or variant of the amino acid sequence or fragment thereof,

(ii) VH includes the amino acid sequence represented by SEQ ID NO: 20, or a fragment or variant of the amino acid sequence or fragment thereof, and VL includes the amino acid sequence represented by SEQ ID NO: 23, or a fragment or variant of the amino acid sequence or fragment thereof,

(iii) VH includes the amino acid sequence shown by SEQ ID NO: 21 or a fragment or variant of the amino acid sequence or fragment thereof, and VL includes the amino acid sequence shown by SEQ ID NO: 22 or a fragment or variant of the amino acid sequence or fragment thereof,

(iv) VH includes the amino acid sequence shown by SEQ ID NO: 21 or a fragment or variant of the amino acid sequence or fragment thereof, and VL includes the amino acid sequence shown by SEQ ID NO: 23 or a fragment or variant of the amino acid sequence or fragment thereof,

(v) VH includes the amino acid sequence represented by SEQ ID NO: 24, or a fragment or variant of the amino acid sequence or fragment thereof, and VL includes the amino acid sequence represented by SEQ ID NO: 25, or a fragment or variant of the amino acid sequence or fragment.

In a particularly preferred embodiment, the CLDN18.2 binding domain of the binding agent of the invention comprises the following combination of a heavy chain variable region (VH) and a light chain variable region (VL):

VH includes the amino acid sequence represented by SEQ ID NO: 20, or a fragment thereof, or a variant of the amino acid sequence or fragment, and VL includes the amino acid sequence represented by SEQ ID NO: 22, or a fragment or variant of the amino acid sequence or fragment.

In a particularly preferred embodiment, the CLDN18.2 binding domain of the binding agent of the invention comprises the following combination of a heavy chain variable region (VH) and a light chain variable region (VL):

VH includes the amino acid sequence shown by SEQ ID NO: 21 or a fragment or variant of the amino acid sequence or fragment thereof, and VL includes the amino acid sequence shown by SEQ ID NO: 23 or a fragment or variant of the amino acid sequence or fragment.

The term "fragment" refers in particular to one or more of the complementarity determining regions (CDRs), preferably at least the CDR3 variable region of the heavy chain variable region (VH) and/or the light chain variable region (VL). In one embodiment, said one or more complementarity determining regions (CDRs) are selected from a set of complementarity determining regions CDR1, CDR2, and CDR3. In a particularly preferred embodiment, the term "fragment" refers to the complementarity-determining regions of the heavy chain variable region (VH) and/or light chain variable region (VL) CDR1, CDR2 and CDR3.

In one embodiment, a binding domain containing one or more CDRs, a set of CDRs, or a combination of sets of CDRs, as described herein, includes said CDRs along with their intermediate framework regions. Preferably, this portion will also include at least about 50% of one or both of the first and fourth framework regions, with 50% being the C-terminal 50% of the first framework region and the N-terminal 50% of the fourth framework region. The construction of binding agents derived from recombinant DNA techniques may result in the introduction of N- or C-terminal residues into the variable regions encoded by linkers that are introduced to facilitate cloning or other processing steps, including the introduction of linkers to connect the variable regions of the invention to additional protein sequences. , including immunoglobulin heavy chains, other variable domains, or protein labels.

In one embodiment, a binding domain containing one or more CDRs, a set of CDRs, or a combination of sets of CDRs, as described herein, includes said CDRs in a human antibody framework.

In a preferred embodiment, the CLDN18.2 binding domain of the binding agent of the invention comprises the following combination of heavy chain variable region (VH) and light chain variable region (VL):

The VH includes a heavy chain complementarity determining region 3 (HCDR3) containing the sequence shown in SEQ ID NO: 58, and

VL includes light chain complementarity determining region 3 (LCDR3) containing the sequence shown in SEQ ID NO: 64.

In one embodiment, VH further includes HCDR1 containing the sequence shown in SEQ ID NO: 56 and/or HCDR2 containing the sequence shown in SEQ ID NO: 57 and/or VL further includes LCDR1 containing the sequence shown in SEQ ID NO: 62, and/or an LCDR2 containing the sequence shown in SEQ ID NO: 63.

In a preferred embodiment, the CLDN18.2 binding domain of the binding agent of the invention comprises the following combination of heavy chain variable region (VH) and light chain variable region (VL):

VH includes HCDR1 containing the sequence shown in SEQ ID NO: 56, HCDR2 containing the sequence shown in SEQ ID NO: 57, and HCDR3 containing the sequence shown in SEQ ID NO: 58, and VL includes LCDR1 containing the sequence shown in SEQ ID NO: 62, LCDR2 containing the sequence shown in SEQ ID NO: 63, and LCDR3 containing the sequence shown in SEQ ID NO: 64.

In a preferred embodiment, the CLDN18.2 binding domain of the binding agent of the invention comprises the following combination of heavy chain variable region (VH) and light chain variable region (VL):

The VH includes a heavy chain complementarity determining region 3 (HCDR3) containing the sequence shown in SEQ ID NO: 61, and

VL includes light chain complementarity determining region 3 (LCDR3) containing the sequence shown in SEQ ID NO: 65.

In one embodiment, VH further includes HCDR1 containing the sequence shown in SEQ ID NO: 59 and/or HCDR2 containing the sequence shown in SEQ ID NO: 60 and/or VL further includes LCDR1 containing the sequence shown in SEQ ID NO: 62, and/or an LCDR2 containing the sequence shown in SEQ ID NO: 63.

In a preferred embodiment, the CLDN18.2 binding domain of the binding agent of the invention comprises the following combination of heavy chain variable region (VH) and light chain variable region (VL):

VH includes HCDR1 containing the sequence shown in SEQ ID NO: 59, HCDR2 containing the sequence shown in SEQ ID NO: 60, and HCDR3 containing the sequence shown in SEQ ID NO: 61, and VL includes LCDR1 containing the sequence shown in SEQ ID NO: 62, LCDR2 containing the sequence shown in SEQ ID NO: 63 and LCDR3 containing the sequence shown in SEQ ID NO: 65.

In one embodiment, said heavy and light chain variable regions comprise said complementarity-determining regions inserted into framework regions. In one embodiment, each variable region includes three complementarity determining regions (CDR1, 2 and 3) and four framework regions (FR1, 2, 3 and 4). In one embodiment, said complementarity-determining regions and said framework regions are located from the amino terminus to the carboxy terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

In other embodiments, the CLDN18.2 binding domain of the binding agent of the invention comprises the heavy and light chain variable regions of an antibody that (i) competes for binding of CLDN18.2 to an antibody comprising heavy and light chain variable regions as described. above, and/or (ii) has specificity for CLDN18.2 of an antibody containing heavy and light chain variable regions as described above.

In one embodiment, the heavy chain variable region (VH) and the light chain variable region (VL) of the CLDN18.2 binding domain of the binding agent of the invention are in the format of an scFv molecule. In this embodiment, the binding domain that binds to CLDN18.2 of the binding agent of the invention comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, or a fragment or amino acid sequence variant or fragment thereof.

It should be understood that the binding domains that bind to the CLDN18.2 binding agent of the invention may be identical or substantially identical or different and thus may bind to identical or substantially identical epitopes or different epitopes. Thus, both CLDN18.2 binding domains of a binding agent of the invention may correspond or substantially correspond to one of the CLDN18.2 binding domains of a binding agent of the invention described herein, or they may be independently selected from binding domains that bind to CLDN18.2 of the binding agent of the invention described herein.

In one embodiment, the binding agent of the invention has the ability to bind to CLDN6, i.e. the ability to bind to an epitope present in CLDN6, preferably an epitope located within the extracellular domains of CLDN6, in particular the first extracellular loop, preferably amino acid positions 28-76 or 29-81 in CLDN6 or a second extracellular loop, preferably amino acid positions 141-159 in CLDN6. In specific embodiments, an agent with the ability to bind to CLDN6 binds to an epitope on CLDN6 that is not present on CLDN9. Preferably, the CLDN6 binding agent binds to an epitope on CLDN6 that is not present on CLDN4 and/or CLDN3. Most preferably, the CLDN6 binding agent binds to an epitope on CLDN6 that is not present on a non-CLDN6 claudin protein.

An agent having the ability to bind to CLDN6 preferably binds to CLDN6 but not to CLDN9 and preferably does not bind to CLDN4 and/or CLDN3. Preferably, the CLDN6 binding agent is specific for CLDN6. Preferably, an agent with the ability to bind to CLDN6 binds to CLDN6 expressed on the cell surface. In specific preferred embodiments, the CLDN6 binding agent binds to native CLDN6 epitopes present on the surface of living cells.

In a preferred embodiment, the CLDN6 binding of the binding agent of the invention comprises a heavy chain variable region (VH) comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 7, 8, 11, or a fragment or variant amino acid sequence or fragment thereof.

In a preferred embodiment, the binding domain to CLDN6 of the binding agent of the invention comprises a light chain variable region (VL) comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 9, 10, 12, or a fragment or variant amino acid sequence or fragment thereof.

In some preferred embodiments, binding of a binding domain to CLDN6 of a binding agent of the invention comprises a combination of a heavy chain variable region (VH) and a light chain variable region (VL) selected from the following possibilities:

(i) VH includes the amino acid sequence shown by SEQ ID NO: 7 or a fragment or variant of the amino acid sequence or fragment thereof, and VL includes the amino acid sequence shown by SEQ ID NO: 9 or a fragment or variant of the amino acid sequence or fragment thereof,

(ii) VH includes the amino acid sequence shown by SEQ ID NO: 7 or a fragment or variant of the amino acid sequence or fragment thereof, and VL includes the amino acid sequence shown by SEQ ID NO: 10 or a fragment or variant of the amino acid sequence or fragment thereof,

(iii) VH includes the amino acid sequence represented by SEQ ID NO: 8 or a fragment or variant of the amino acid sequence or fragment thereof, and VL includes the amino acid sequence represented by SEQ ID NO: 9 or a fragment or variant of the amino acid sequence or fragment thereof,

(iv) VH includes the amino acid sequence represented by SEQ ID NO: 8 or a fragment or variant of the amino acid sequence or fragment thereof, and VL includes the amino acid sequence represented by SEQ ID NO: 10 or a fragment or variant of the amino acid sequence or fragment thereof,

(v) VH includes the amino acid sequence shown by SEQ ID NO: 11 or a fragment or variant of the amino acid sequence or fragment thereof, and VL includes the amino acid sequence shown by SEQ ID NO: 12 or a fragment or variant of the amino acid sequence or fragment thereof,

(vi) VH includes the amino acid sequence shown by SEQ ID NO: 7 or a fragment or variant of the amino acid sequence or fragment thereof, and VL includes the amino acid sequence shown by SEQ ID NO: 12 or a fragment or variant of the amino acid sequence or fragment thereof,

(vii) VH includes the amino acid sequence represented by SEQ ID NO: 8, or a fragment or variant of the amino acid sequence or fragment thereof, and VL includes the amino acid sequence represented by SEQ ID NO: 12, or a fragment or variant of the amino acid sequence or fragment.

In a particularly preferred embodiment, the binding domain to CLDN6 of the binding agent of the invention comprises the following combination of a heavy chain variable region (VH) and a light chain variable region (VL):

VH includes the amino acid sequence shown by SEQ ID NO: 8 or a fragment or variant of the amino acid sequence or fragment thereof, and VL includes the amino acid sequence shown by SEQ ID NO: 10 or a fragment or variant of the amino acid sequence or fragment.

In a particularly preferred embodiment, the binding domain to CLDN6 of the binding agent of the invention comprises the following combination of a heavy chain variable region (VH) and a light chain variable region (VL):

VH includes the amino acid sequence shown by SEQ ID NO: 7 or a fragment or variant of the amino acid sequence or fragment thereof, and VL includes the amino acid sequence shown by SEQ ID NO: 12 or a fragment or variant of the amino acid sequence or fragment.

The term "fragment" refers in particular to one or more of the complementarity determining regions (CDRs), preferably at least the CDR3 variable region of the heavy chain variable region (VH) and/or the light chain variable region (VL). In one embodiment, said one or more complementarity determining regions (CDRs) are selected from a set of complementarity determining regions CDR1, CDR2, and CDR3. In a particularly preferred embodiment, the term "fragment" refers to the complementarity-determining regions of the heavy chain variable region (VH) and/or light chain variable region (VL) CDR1, CDR2 and CDR3.

In one embodiment, a binding domain containing one or more CDRs, a set of CDRs, or a combination of sets of CDRs, as described herein, includes said CDRs along with their intermediate framework regions. Preferably, this portion will also include at least about 50% of one or both of the first and fourth framework regions, with 50% being C-terminal, 50% first framework and 50% N-terminal fourth framework. The construction of binding agents derived from recombinant DNA techniques may result in the introduction of N- or C-terminus residues into the variable regions encoded by linkers introduced to facilitate cloning or other processing steps, including the introduction of linkers to join the variable regions of the invention for additional protein sequences, including immunoglobulin heavy chains, other variable domains, or protein labels.

In one embodiment, a binding domain containing one or more CDRs, a set of CDRs, or a combination of sets of CDRs, as described herein, includes said CDRs in a human antibody framework.

In a preferred embodiment, binding of the binding domain to CLDN6 of the binding agent of the invention comprises the following combination of heavy chain variable region (VH) and light chain variable region (VL):

The VH includes a heavy chain complementarity determining region 3 (HCDR3) containing the sequence Ala Arg Asp Xaa1 Gly Xaa2 Val Xaa3 Asp Tyr, where Xaa1 is any amino acid, preferably an aromatic amino acid, more preferably Phe or Tyr, most preferably Tyr, Xaa2 is any amino acid, preferably an aromatic amino acid, more preferably Phe or Tyr, most preferably Tyr, and Xaa3 is any amino acid, preferably Leu or Phe, more preferably Leu. In one embodiment, HCDR3 includes the sequence shown in SEQ ID NO: 46 or 47, and

VL includes light chain complementarity determining region 3 (LCDR3) containing the sequence Gln Gln Arg Xaa1 Xaa2 Xaa3 Pro Pro Trp Thr, where Xaa1 is any amino acid, preferably Ser or Asn, most preferably Ser, Xaa2 is any amino acid, preferably Tyr , Ser, Ile, Asn or Thr, more preferably Ile, Asn or Thr, most preferably Ile or Asn, and Xaa3 is any amino acid, preferably Ser or Tyr, more preferably Tyr. In one embodiment, LCDR3 includes the sequence shown in SEQ ID NO: 52 or 53.

In one embodiment, VH further comprises HCDR1 containing the sequence shown in SEQ ID NO: 44 and/or HCDR2 containing the sequence shown in SEQ ID NO: 48, where Xaa is any amino acid, preferably Thr, Ser or Ile, most preferably Thr, such as the sequence shown in SEQ ID NO: 45, and/or VL further comprises an LCDR1 comprising the sequence shown in SEQ ID NO: 54, where Xaa is any amino acid, preferably Ser or Asn, most preferably Ser, such as the sequence set forth in SEQ ID NO: 50 and/or an LCDR2 containing the sequence set forth in SEQ ID NO: 51.

In a preferred embodiment, binding of a binding domain to CLDN6 of a binding agent of the invention comprises the following combination of a heavy chain variable region (VH) and a light chain variable region (VL):

VH includes HCDR1 containing the sequence shown in SEQ ID NO: 44, HCDR2 containing the sequence shown in SEQ ID NO: 45, and HCDR3 containing the sequence shown in SEQ ID NO: 46, and VL includes LCDR1 containing the sequence shown in SEQ ID NO: 50, LCDR2 containing the sequence shown in SEQ ID NO: 51 and LCDR3 containing the sequence shown in SEQ ID NO: 52.

In a preferred embodiment, binding of the binding domain to CLDN6 of the binding agent of the invention comprises the following combination of heavy chain variable region (VH) and light chain variable region (VL):

VH includes HCDR1 containing the sequence shown in SEQ ID NO: 44, HCDR2 containing the sequence shown in SEQ ID NO: 45, and HCDR3 containing the sequence shown in SEQ ID NO: 47, and VL includes LCDR1 containing the sequence shown in SEQ ID NO: 47 in SEQ ID NO: 50, LCDR2 containing the sequence shown in SEQ ID NO: 51 and LCDR3 containing the sequence shown in SEQ ID NO: 53.

In a preferred embodiment, binding of the binding domain to CLDN6 of the binding agent of the invention comprises the following combination of heavy chain variable region (VH) and light chain variable region (VL):

VH includes HCDR1 containing the sequence shown in SEQ ID NO: 44, HCDR2 containing the sequence shown in SEQ ID NO: 45, and HCDR3 containing the sequence shown in SEQ ID NO: 46, and VL includes LCDR1 containing the sequence shown in SEQ ID NO: 50, LCDR2 containing the sequence shown in SEQ ID NO: 51 and LCDR3 containing the sequence shown in SEQ ID NO: 53.

In one embodiment, said heavy and light chain variable regions comprise said complementarity-determining regions included in framework regions. In one embodiment, each variable region includes three complementarity determining regions (CDR1, 2 and 3) and four framework regions (FR1, 2, 3 and 4). In one embodiment, said complementarity-determining regions and said framework regions are located from the amino terminus to the carboxy terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

In other embodiments, the binding domain to CLDN6 of a binding agent of the invention comprises the heavy and light chain variable regions of an antibody that (i) competes for CLDN6 binding with an antibody comprising heavy and light chain variable regions as described above, and/or (ii) has specificity for CLDN6 of an antibody containing heavy and light chain variable regions as described above.

In one embodiment, the heavy chain variable region (VH) and the light chain variable region (VL) of the CLDN6 binding domain of the binding agent of the invention are in the scFv molecular format. In this embodiment, the binding domain that binds to CLDN6 of the binding agent of the invention comprises the amino acid sequence shown in SEQ ID NO: 13, or a fragment thereof, or a variant amino acid sequence or fragment.

It should be understood that the binding domains that bind to CLDN6 of a binding agent of the invention may be identical or substantially identical or different and thus may bind to identical or substantially identical epitopes or different epitopes. Thus, both CLDN6 binding domains of a binding agent of the invention may correspond or substantially correspond to one of the CLDN6 binding domains of a binding agent of the invention described herein, or they may be independently selected from the binding domains that bind with CLDN6 of the coupling agent of the invention described herein.

Anti-CD3 antibodies that are useful in providing binding agents of the invention include, but are not limited to, UCHT1-HS (humanized mAb), UCHT1-MM (mouse mAb), CLB-T3, TR66, 145-2C11.

UCHT1 is an anti-CD3 IgG1 monoclonal antibody that detects CD3 in human and primate samples. CLB-T3 is a mouse monoclonal anti-CD3 antibody that is directed against the CD3 antigen and reacts with 80-90% of human peripheral T lymphocytes and medullary thymocytes. TR66 is a mouse IgG1 anti-CD3 monoclonal antibody that recognizes the human CD3 epsilon chain. 145-2C11 is a gray hamster anti-mouse CD3 monoclonal antibody.

Preferably, the VH and VL regions of the CD3 binding domain are derived from antibody/antibody and antibody-like molecules that are capable of specifically recognizing human CD3 in the context of other TCR subunits present in activated primary human T cells expressing the TCR in its native configuration. VH and VL regions derived from antibodies specific for the CD3-epsilon chain are most preferred, and said (parent) antibodies should be able to specifically bind epitopes reflecting native or near-native structure, or a conformational human CD3 epitope presented in the context of the complex. TCR. In a preferred embodiment, the VH and VL regions of the CD3 binding domain are derived from a CD3-specific antibody selected from the group consisting of UCHT1-HS, UCHT1-MM, CLB-T3 and TR66, preferably TR66.

In a preferred embodiment, the CD3 binding domain of the binding agent of the invention comprises a heavy chain variable region (VH) comprising the amino acid sequence shown in SEQ ID NO: 5, or a fragment thereof, or a variant amino acid sequence or fragment.

In a preferred embodiment, the CD3 binding domain of the binding agent of the invention comprises a light chain variable region (VL) comprising the amino acid sequence shown in SEQ ID NO: 6, or a fragment thereof, or a variant amino acid sequence or fragment.

In a preferred embodiment, binding of a binding domain to CD3 of a binding agent of the invention comprises the following combination of a heavy chain variable region (VH) and a light chain variable region (VL):

VH includes the amino acid sequence represented by SEQ ID NO: 5, or a fragment thereof, or a variant of the amino acid sequence or fragment, and VL includes the amino acid sequence represented by SEQ ID NO: 6, or a fragment thereof, or an amino acid sequence variant or fragment.

The term "fragment" refers in particular to one or more of the complementarity determining regions (CDRs), preferably at least the CDR3 variable region of the heavy chain variable region (VH) and/or the light chain variable region (VL). In one embodiment, said one or more complementarity determining regions (CDRs) are selected from a set of complementarity determining regions CDR1, CDR2, and CDR3. In a particularly preferred embodiment, the term "fragment" refers to the complementarity determining regions CDR1, CDR2 and CDR3 of the heavy chain variable region (VH) and/or the light chain variable region (VL).

In one embodiment, a binding domain containing one or more CDRs, a set of CDRs, or a combination of sets of CDRs, as described herein, includes said CDRs along with their intermediate framework regions. Preferably, this portion will also include at least about 50% of one or both of the first and fourth framework regions, with 50% being the C-terminal 50% of the first framework region and the N-terminal 50% of the fourth framework region. The construction of binding agents derived from recombinant DNA techniques may result in the introduction of N- or C-terminal residues into the variable regions encoded by linkers introduced to facilitate cloning or other processing steps, including the introduction of linkers to connect the variable regions of the invention to additional protein sequences, including immunoglobulin heavy chains, other variable domains, or protein labels.

In one embodiment, a binding domain containing one or more CDRs, a set of CDRs, or a combination of sets of CDRs, as described herein, includes said CDRs in a human antibody framework.

It should be understood that the binding agents described herein can be delivered to a patient by administering a nucleic acid, such as an RNA encoding an antibody, and/or by administering a host cell containing a nucleic acid, such as an RNA encoding an antibody. If the binding agent includes more than one polypeptide chain, different polypeptide chains may be encoded in the same nucleic acid or in different nucleic acids. Thus, the nucleic acid to be administered may be a mixture of different nucleic acid molecules. The nucleic acid encoding the binding agent, when introduced into the patient's body, may be present in the nude or in a suitable delivery vehicle, such as liposomes or nanoparticles or viral particles, or in the host cell. The provided nucleic acid can produce the agent for long periods of time in a stable manner, reducing the instability, at least in part, seen with therapeutic antibodies. Nucleic acids to be delivered to a patient may be produced by recombinant means. If the nucleic acid is administered to a patient without being present in a host cell, it is preferably taken up by the patient's cells to express the binding agent encoded by the nucleic acid. If the nucleic acid is administered to a patient in a host cell, it is preferably expressed by the host cell within the patient to produce a binding agent encoded by the nucleic acid.

The term "recombinant" in the context of the present invention means "obtained by genetic engineering". Preferably, a "recombinant entity", such as a recombinant nucleic acid in the context of the present invention, does not occur in nature.

As used herein, the term "naturally occurring" refers to the fact that an object can be found in nature. For example, a peptide or nucleic acid that is present in the body (including viruses) can be isolated from a natural source, has not been intentionally altered by humans in a laboratory, and is naturally occurring.

As used herein, the term "nucleic acid" is intended to include DNA and RNA such as genomic DNA, cDNA, mRNA, recombinantly produced and chemically synthesized molecules. The nucleic acid may be single-stranded or double-stranded. RNA includes in vitro transcribed RNA (IVT RNA) or synthetic RNA.

Nucleic acids may be included in the vector. As used herein, the term "vector" includes any vectors known to those skilled in the art, including plasmid vectors, cosmid vectors, phage vectors such as lambda phage, viral vectors such as adenovirus or baculovirus vectors, or artificial chromosome vectors, such as bacterial artificial chromosomes (BAC), yeast artificial chromosomes (YAC) or P1 artificial chromosomes (PAC). These vectors include both expression and cloning vectors. Expression vectors include plasmids and viral vectors and typically contain the coding sequence of interest and the corresponding DNA sequences necessary for expression of the operably linked coding sequence in a particular host organism (e.g., bacteria, yeast, plant, insect, or mammal) or in vitro expression systems. . Cloning vectors are typically used to process and amplify a particular DNA fragment of interest and may not have the functional sequences required to express the DNA fragments of interest.

In the context of the present invention, the term "RNA" refers to a molecule that includes ribonucleotide residues and preferably consists entirely or essentially of ribonucleotide residues. "Ribonucleotide" refers to a nucleotide with a hydroxyl group at the 2'-position of the β-D-ribofuranosyl group. The term includes double-stranded RNA, single-stranded RNA, isolated RNA such as partially purified RNA, substantially purified RNA, synthetic RNA, recombinantly produced RNA, and modified RNA that differs from natural RNA by the addition, deletion, substitution and/or replacement of one or more nucleotides. Such changes may include the addition of non-nucleotide material, for example, to the end(s) of the RNA or inward, for example, in one or more nucleotides of the RNA. Nucleotides in RNA molecules may also contain non-standard nucleotides such as non-natural nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs may be referred to as natural RNA analogs or analogs.

According to the present invention, the term "RNA" includes and preferably refers to "mRNA", which means "messenger RNA" and refers to a "transcript" that can be obtained using DNA as a template and which encodes a peptide or protein. An mRNA typically includes a 5' untranslated region (5'UTR), a protein or peptide coding region, and a 3' untranslated region (3'UTR). mRNA has a limited half-life in cells and in vitro. Preferably, mRNA is obtained by in vitro transcription using a DNA template. In one embodiment of the invention, RNA is obtained by in vitro transcription or chemical synthesis. The methodology for in vitro transcription is known to those skilled in the art. For example, there are many commercially available in vitro transcription kits.

In one embodiment of the present invention, the RNA is a self-replicating RNA, such as a single-stranded self-replicating RNA. In one embodiment, the self-replicating RNA is a positive polar single stranded RNA. In one embodiment, the self-replicating RNA is viral RNA or RNA derived from viral RNA. In one embodiment, the self-replicating RNA is alpha viral genomic RNA or is derived from alpha viral genomic RNA. In one embodiment, the self-replicating RNA is a vector that expresses a viral gene. In one embodiment, the virus is a Semliki forest virus. In one embodiment, the self-replicating RNA comprises one or more transgenes, at least one of said transgenes, encoding the binding agent described herein. In one embodiment, if the RNA is or is derived from viral RNA, the transgenes may partially or completely replace viral sequences, such as viral sequences encoding structural proteins. In one embodiment, the self-replicating RNA is an in vitro transcribed RNA.

The genome of alpha viruses is a positive-polar single-stranded RNA (ssRNA (+)) that encodes two open reading frames (ORFs) for large polyproteins. ORF at the 5' end of the genome encodes non-structural proteins nSP1 to nSP4 (nsP1-4), which are translated and processed into RNA-dependent RNA polymerase (replicase); The ORF at the 3' end encodes the structural proteins of the capsid and glycoproteins. Both ORFs are separated by the so-called subgenomic promoter (SGP), which drives the transcription of the structural ORF. When used as gene vectors, the structural proteins behind the SGP are usually replaced by transgenes. To package such vectors into viral particles, structural proteins are usually expressed in trans cells with accessory constructs. Alphaviruses replicate in the cytoplasm of infected cells exclusively at the RNA level. Upon infection with the ssRNA(+) gene, it acts as mRNA for translation of the nsP1234 polypeptide precursor, which is spontaneously processed into nsP123 and nsP4 fragments during the early stages of the virus life cycle. The nsP123 and nsP4 fragments form a (-) strand replicase complex that transcribes the (-) stranded RNA from the genomic RNA template. In later stages, the nsP1234 polyprotein is completely cleaved into individual proteins that assemble into a (+) stranded replicase complex that synthesizes new (+) stranded genomes and subgenomic transcripts that encode structural proteins or transgenes. The subgenomic RNA and the new genomic RNA are capped and polyadenylated and thus recognized as mRNA upon infection of the target cells. Only new genomic RNA includes a packaging signal that ensures exclusive packaging of genomic RNA into nascent virions. The attractiveness of alpha viral replicons for vectorology is based on the positive orientation of the capped and polyadenylated RNA genome. Translatable replicon RNA can be readily synthesized in vitro, whereby capping can be achieved with cap analogs added to the in vitro transcription reaction, and poly-A tails can be encoded as poly-T tracks on plasmid templates. In vitro transcribed (IVT) replicons are transfected by conventional transfection techniques and even small amounts of the original IVT RNA multiply rapidly. Within hours of transfer, transgenes that are downstream of the SGP are transcribed at very high copy numbers, approximately 40,000 to 200,000 subgenomic RNA copies per cell, so it is not surprising that recombinant proteins are highly expressed. Depending on the specific target, IVT replicons can be transfected directly into target cells or packaged into alpha viral particles using helper vectors that provide structural genes in trans. Transfer to the skin or muscles results in high and sustained local expression accompanied by strong induction of humoral and cellular immune responses.

In order to increase the expression and/or stability of the RNA used according to the present invention, it can be modified, preferably without changing the sequence of the expressed peptide or protein.

The term "modification" in the context of RNA, as used in accordance with the present invention, includes any modification of the RNA, which is not naturally present in the specified RNA.

In one embodiment of the invention, the RNA used according to the invention does not have uncapped 5'-triphosphates. Removal of such uncapped 5'-triphosphates can be achieved by treating the RNA with phosphatase.

The RNA of the invention may have modified natural or synthetic ribonucleotides to increase its stability and/or reduce its cytotoxicity and/or immunogenicity. For example, in one embodiment, in the RNA used according to the invention, 5-methylcytidine is substituted partially or completely, preferably completely, for cytidine. Alternatively or additionally, in one embodiment, in the RNA used according to the invention, pseudouridine is substituted partially or completely, preferably completely, by uridine.

In one embodiment, the term "modification" refers to providing the RNA with a 5'-cap structure or an analog of the 5'-cap structure. The term "5' cap" refers to the cap structure found at the 5' end of an mRNA molecule and usually consists of a guanosine nucleotide linked to the mRNA via an unusual 5'-5' triphosphate bond. In one embodiment, this guanosine is 7-methylated. The term "traditional 5'-cap" refers to a natural 5'-cap RNA, preferably a cap based on 7-methylguanosine (m7G). In the context of the present invention, the term "5'-cap" includes a 5'-cap analog that resembles the structure of an RNA cap and is modified to have the ability to stabilize RNA when attached to it, preferably in vivo and/or in a cell.

Providing an RNA with a 5'-cap or 5'-cap analog can be achieved by in vitro transcription of the template DNA in the presence of said 5'-cap or 5'-cap analog, where said 5'-cap is cotranscriptionally incorporated into the generated RNA strand, or the RNA can be generated, for example, by in vitro transcription, and the 5'-cap can be attached to the RNA post-transcriptionally using capping enzymes, for example, vaccinia virus capping enzymes.

The RNA may include additional modifications. For example, further modification of the RNA used in the present invention may be an extension or truncation of the naturally occurring poly(A) tail, or alteration of the 5' or 3' untranslated regions (UTRs), such as introducing a UTR that is not associated with a coding region. said RNA, e.g. insertion of one or more, preferably two copies of the 3'-UTR derived from a globin gene such as alpha-2-globin, alpha-1-globin, beta-globin, preferably beta-globin, more preferably beta- human globin.

Therefore, in order to increase the stability and/or expression of the RNA used according to the present invention, it can be modified so that it is present in combination with a poly-A sequence, preferably having a length of 10 to 500, more preferably 30 to 300, even more preferably 65 to 200 and especially 100 to 150 adenosine residues. In a particularly preferred embodiment, the poly-A sequence is approximately 120 adenosine residues in length. In addition, the incorporation of two or more 3' untranslated regions (UTRs) into the 3' untranslated region of an RNA molecule can result in increased efficiency of translation. In one specific embodiment, the 3'-UTR is derived from the human β-globin gene.

Preferably, the RNA, if delivered, ie. is transfected into a cell, in particular the cell present in vivo has expressed the protein or peptide it encodes.

The term "transfection" refers to the introduction of nucleic acids, specifically RNA, into a cell. For the purposes of the present invention, the term "transfection" also includes the introduction of a nucleic acid into a cell, or the absorption of a nucleic acid into such a cell, in which the cell may be present in an object, such as a patient. Thus, according to the present invention, the nucleic acid transfection cell described herein may be present in vitro or in vivo, for example, the cell may form part of an organ, tissue and/or body of a patient. According to the invention, transfection may be transient or stable. For some applications of transfection, it is sufficient that the transfected genetic material is only transiently expressed. Since the nucleic acid introduced into the transfection process usually does not integrate into the nuclear genome, the foreign nucleic acid will be diluted through mitosis or degraded. Cells that allow episomal amplification of nucleic acids significantly reduce the degree of dilution. If it is desired that the transfected nucleic acid actually remain in the cell's genome and in its daughter cells, then stable transfection must take place. The RNA can be transfected into cells to transiently express the encoded protein.

The term "stability" of RNA refers to the "half-life" of RNA. "Half-life" refers to the period of time required to eliminate half of the activity, number or number of molecules. In the context of the present invention, the half-life of an RNA is indicative of the stability of said RNA. The half-life of RNA can influence the "length of expression" of the RNA. An RNA having a long half-life can be expected to be expressed over a long period of time.

In the context of the present invention, the term "transcription" refers to the process in which the genetic code in a DNA sequence is transcribed into RNA. Subsequently, RNA can be translated into protein. According to the present invention, the term "transcription" includes "in vitro transcription", where the term "in vitro transcription" refers to a method in which RNA, specifically mRNA, is synthesized in vitro in a cell-free system, preferably using suitable cell extracts. Preferably, cloning vectors are used to generate transcripts. These cloning vectors are commonly referred to as transcription vectors and are encompassed by the term "vector" according to the present invention.

The term "translation" according to the invention refers to the process in the ribosomes of a cell by which a messenger RNA chain directs the assembly of an amino acid sequence to produce a peptide or protein.

The term "expression" is used according to the invention in its most general sense and includes the production of RNA and/or peptides or proteins, for example, by transcription and/or translation. With regard to RNA, the term "expression" or "translation" refers in particular to the formation of peptides or proteins. It also includes partial expression of nucleic acids. Moreover, expression can be transient or stable. According to the invention, the term expression also includes "aberrant expression" or "abnormal expression".

"Aberrant expression" or "abnormal expression" means according to the invention that the expression is changed, preferably increased, compared to the reference, for example, when the subject does not have a disease associated with aberrant or abnormal expression of a certain protein, for example, a tumor antigen. An increase in expression refers to an increase of at least 10%, specifically at least 20%, at least 50%, or at least 100% or more. In one embodiment, expression is found only in diseased tissue, while expression in healthy tissue is repressed.

The term "specifically expressed" means that the protein is essentially expressed only in a particular tissue or organ. For example, a tumor antigen specifically expressed in the gastric mucosa means that said protein is predominantly expressed in the gastric mucosa and is not expressed in other tissues or is not expressed to a significant extent in other tissues or organs. Thus, a protein that is exclusively expressed in gastric mucosal cells and to a much lesser extent in any other tissue, such as the testis, will be specifically expressed in gastric mucosal cells. In some embodiments, the tumor antigen may also be specifically expressed under normal conditions in more than one tissue or organ type, such as 2 or 3 tissue or organ types, but preferably no more than 3 different tissue or organ types. In this case, the tumor antigen is then specifically expressed in these organs. For example, if a tumor antigen is expressed under normal conditions, preferably approximately equally in the lungs and stomach, then said tumor antigen is specifically expressed in the lungs and stomach.

According to the invention, the term "coding RNA" means that the RNA, if present in an appropriate environment, preferably within a cell, can be expressed to produce the protein or peptide it encodes.

Some aspects of the invention are based on the adoptive transfer of host cells that are transfected in vitro with a nucleic acid, such as an RNA encoding an antibody described herein, and transferred to recipients, such as patients, preferably after ex vivo production, ranging from low represented progenitors to clinically significant numbers of cells. The host cells used for the treatment according to the invention may be autologous, allogeneic, or syngeneic to the treated recipient.

The term "autologous" is used to describe everything that comes from the same entity. For example, "autologous transplantation" refers to transplantation of tissue or organs derived from the same subject. Such procedures are beneficial because they overcome the immunological barrier that would otherwise lead to rejection.

The term "allogeneic" is used to describe anything that comes from different individuals of the same species. Two or more individuals are said to be allogeneic to each other when the genes at one or more loci are not identical.

The term "syngeneic" is used to describe everything that comes from individuals or tissues that have identical genotypes, i.e. identical twins or animals of the same inbred strain or their tissues.

The term "heterologous" is used to describe something that is made up of several different elements. As an example, the transfer of bone marrow from one person to another person is a heterologous transplant. A heterologous gene is a gene derived from a source other than the subject.

The term "peptide" according to the invention includes oligo- and polypeptides and refers to substances containing two or more, preferably 3 or more, preferably 4 or more, preferably 6 or more, preferably 8 or more, preferably 9 or more, preferably 10 or more , preferably 13 or more, preferably another 16, preferably 21 or more and preferably up to 8, 10, 20, 30, 40 or 50, in particular 100 amino acids covalently linked by peptide bonds. The term "protein" refers to large peptides, preferably peptides with more than 100 amino acid residues, but in general the terms "peptides" and "proteins" are synonymous and are used interchangeably herein.

Guidance given herein with respect to specific amino acid sequences, such as those provided in a sequence listing, should be construed to also refer to variants of said specific sequences, resulting in sequences that are functionally equivalent to said specific sequences, such as amino acid sequences, having properties identical or similar to those of specific amino acid sequences. One of the important properties is the retention of target binding or effector functions. Preferably, a sequence that is a variant of a particular sequence when it replaces a particular sequence in an antibody retains the binding of said antibody to its target and preferably the function of said antibody as described herein, e.g., CDC-mediated lysis or ADCC-mediated lysis. Further preferably, a sequence that is a variant with respect to a particular sequence when it replaces a particular sequence in a binding agent retains the binding of said binding agent to claudin and/or CD3 and preferably functions as said binding agent as described herein, for example, cytotoxic lysis mediated by T cells.

For example, the sequences shown in the sequence listing may be altered so as to remove one or more, preferably all, free cysteine residues, in particular by replacing cysteine residues with amino acids other than cysteine, preferably serine, alanine, threonine, glycine, tyrosine, tryptophan, leucine or methionine.

Those skilled in the art will appreciate that, in particular, CDR sequences, hypervariable and variable regions can be modified without losing the ability to bind claudin and/or CD3. For example, the CDR regions will either be identical or highly homologous to the regions specified herein. By "highly homologous" is meant that 1 to 5 substitutions, preferably 1 to 4, such as 1 to 3 or 1 or 2 substitutions can be made in the CDR. In addition, hypervariable and variable regions can be modified so that they show significant homology to the antibody regions specifically disclosed herein. In one embodiment, the variable region sequences deviate only in framework sequences from the variable region sequences specifically disclosed herein.

For purposes of the present invention, amino acid sequence "variants" include amino acid insertion variants, amino acid addition variants, amino acid deletion variants, and/or amino acid substitution variants. Amino acid deletion variants that include deletion at the N-terminus and/or C-terminus of the protein are also referred to as N-terminal and/or C-terminal truncated variants.

Amino acid insertion variants include insertions of one or two or more amino acids in a particular amino acid sequence. In the case of amino acid sequence variants having an insert, one or more amino acid residues are introduced at a specific site in the amino acid sequence, although random insertion with appropriate screening of the resulting product is also possible.

Options for adding amino acids include amino and/or carboxy-terminal fusions of one or more amino acids, such as 1, 2, 3, 5, 10, 20, 30, 50 or more amino acids.

Amino acid deletion variants are characterized by the removal of one or more amino acids from a sequence, such as the removal of 1, 2, 3, 5, 10, 20, 30, 50 or more amino acids. Deletions can be in any position of the protein.

Amino acid variants are characterized by at least one residue in the deleted sequence and another residue inserted in its place. Preference is given to modifications that are at amino acid sequence positions that are not conservative between homologous proteins or peptides and/or amino acid substitutions for others having similar properties. Preferably, amino acid substitutions in protein variants are conservative amino acid substitutions, that is, substitutions of equally charged or uncharged amino acids. A conservative amino acid substitution includes a substitution with one from a family of amino acids that are related in their side chains. Natural amino acids are usually divided into four families: acidic (aspartate, glutamate), basic (lysine, arginine, histidine), non-polar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan) and uncharged polar (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine) amino acids. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids.

Preferably, the degree of similarity, preferably identity, between a given amino acid sequence and an amino acid sequence that is a variant of said specified amino acid sequence will be at least about 60%, 65%, 70%, 80%, 81%, 82%, 83 %, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. The degree of similarity or identity is preferably given for an amino acid region that is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the entire length of the reference amino acid sequence. For example, if the reference amino acid sequence is 200 amino acids, the degree of similarity or identity is preferably given for at least about 20, at least about 40, at least about 60, at least about 80, at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, or about 200 amino acids, preferably continuous amino acids. In preferred embodiments, the degree of similarity or identity is given for the entire length of the reference amino acid sequence. Alignment to determine sequence similarity, preferably sequence identity, can be done using known tools, preferably using the best sequence alignment, e.g. using Align, using standard settings, preferably EMBOSS: needle, Matrix: Blosum62, gap penalty 10, 0, elongation penalty 0.5.

"Sequence similarity" indicates the percentage of amino acids that are either identical or represent conservative amino acid substitutions. "Sequence identity" between two amino acid sequences indicates the percentage of amino acids that are identical between sequences.

The term "percent identity" is intended to mean the percentage of amino acid residues that are identical between the two sequences to be compared, obtained after the best alignment, this percentage being purely statistical, and the differences between the two sequences being distributed randomly and along the entire length. Sequence comparisons between two amino acid sequences are typically performed by comparing those sequences after they are optimally aligned, said comparison being made using a segment or "comparison window" to identify and compare local areas of sequence similarity. The optimal sequence alignment for comparison can also be obtained manually using the local homology algorithm of Smith and Waterman, 1981, Ads App. Math. 2, 482, using the local homology algorithm of Neddleman and Wunsch, 1970, J. Mol. Biol. 48, 443 using the similarity search method Pearson and Lipman, 1988, Proc. Natl Acad. sci. USA 85, 2444 or by computer programs that use these algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA in the Wisconsin Genetics software package, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin).

Percent identity is calculated by determining the number of identical positions between two compared sequences, dividing this number by the number of compared positions and multiplying the result by 100 to give the percentage identity between the two sequences.

Binding agents of the invention can be produced either intracellularly (eg, in the cytosol, periplasm, or inclusion bodies) and then isolated from host cells and optionally further purified; or they can be obtained extracellularly (eg, in the medium in which the host cells are cultured) and then isolated from the culture medium and possibly further purified. Methods and reagents used for recombinant production of polypeptides, such as specific suitable expression vectors, transformation or transfection methods, selection markers, methods for inducing protein expression, culture conditions, and the like, are known in the art. Likewise, methods for isolating and purifying a protein are well known to those skilled in the art.

The term "cell" or "host cell" preferably refers to an intact cell, that is, a cell with an intact membrane that does not release its normal intracellular components such as enzymes, organelles, or genetic material. The intact cell is preferably a viable cell, ie a living cell capable of performing its normal metabolic functions. Preferably, said term refers according to the invention to any cell that can be transfected with an exogenous nucleic acid. Preferably, a cell transfected with an exogenous nucleic acid and transferred to a recipient can express the nucleic acid in the recipient. The term "cell" includes bacterial cells; other useful cells are yeast cells, fungal cells or mammalian cells. Suitable bacterial cells include those from Gram-negative bacterial strains such as Escherichia coli, Proteus and Pseudomonas strains and Gram-positive bacterial strains such as Bacillus, Streptomyces, Staphylococcus and Lactococcus strains. Suitable fungal cells include cells from Trichoderma, Neurospora and Aspergillus species. Suitable yeast cells include cells from Saccharomyces species (eg Saccharomyces cerevisiae), Schizosaccharomyces (eg Schizo saccharomyces pombe), Pichia (eg Pichia pastoris and Pichia methanolicd) and Hansenula. Suitable mammalian cells include, for example, CHO cells, BHK cells, HeLa cells, COS cells, 293 HEK, and the like. However, amphibian cells, insect cells, plant cells, and any other cells used in the art for expressing heterologous proteins can also be used. Mammalian cells are particularly preferred for adoptive transfer, such as those of humans, mice, hamsters, pigs, goats, and primates. Cells can be obtained from a wide variety of tissue types and include primary cells and cell lines such as cells of the immune system, in particular antigen presenting cells such as dendritic cells and T cells, stem cells such as hematopoietic stem cells and mesenchymal stem cells. cells and other types of cells. An antigen presenting cell is a cell that presents an antigen in the context of a major histocompatibility complex on its surface. T cells can recognize this complex using their T cell receptor (TCR).

"Reduce", "reduce", or "inhibit", as used herein, means an overall reduction or the ability to cause an overall reduction, preferably 5% or more, 10% or more, 20% or more, more preferably 50% % or more, and most preferably 75% or more, of a level, such as an expression level or a cell proliferation level.

Terms such as "increase" or "increase" preferably refer to an increase or increase of about 10%, preferably at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, even more preferably at least 80%, and most preferably at least 100%, at least 200%, at least by 500%, at least 1000%, at least 10000% or even more.

Antibody-dependent cell-mediated cytotoxicity

ADCC describes the ability of effector cells to kill cells as described herein, in particular lymphocytes, which preferably requires that the target cell be labeled with an antibody.

ADCC preferably occurs when antibodies bind to antigens on tumor cells and antibody Fc domains interact with Fc receptors (FcRs) on the surface of immune effector cells. Several families of Fc receptors have been identified, and specific cell populations characteristically express certain Fc receptors. ADCC can be seen as a mechanism to directly induce a variable degree of immediate tumor destruction, leading to antigen presentation and induction of tumor-induced T cell responses. Preferably, in vivo induction of ADCC will result in tumor-induced T cell responses and host antibody responses.

Complement dependent cytotoxicity

CDC is another way of killing cells that can be controlled by antibodies. IgM is the most efficient complement activation isotype. IgG1 and IgG3 are also very effective in driving CDC through the classical complement pathway. Preferably, in this cascade, the formation of antigen-antibody complexes results in the exposure of multiple C1q binding sites in close proximity to the CH2 domains of participating antibody molecules, such as IgG molecules (C1q is one of the three subcomponents of C1 complement). Preferably, these exposed C1q binding sites convert a previously low affinity C1q-IgG interaction into a high avidity interaction that triggers a cascade of events involving a number of other complement proteins and results in proteolytic release of C3a and C5a effector cell chemotactic/activating agents. Preferably, the complement cascade ends with the formation of a membrane attack complex, which creates pores in the cell membrane to facilitate the free passage of water and solutes into and out of the cell.

The antibodies described herein, for example, to provide the VL and VH regions, can be generated by a variety of methods, including conventional monoclonal antibody methodology, such as the standard somatic cell hybridization technique of Kohler and Milstein, Nature 256: 495 (1975). While somatic cell hybridization procedures are preferred, other methods for producing monoclonal antibodies can in principle be used, such as viral or oncogenic transformation of B-lymphocytes, or phage display techniques using antibody gene libraries.

The preferred animal system for producing hybridomas that secrete monoclonal antibodies is the murine system. The production of hybridoma in mice is a very well established procedure. Immunization protocols and methods for isolating immunized splenocytes for fusion are known in the art. Fusion partners (eg, murine myeloma cells) and fusion procedures are also known.

Other preferred animal systems for producing hybridomas that secrete monoclonal antibodies are the rat and rabbit system (e.g., as described in Spieker-Polet et al., Proc. Natl. Acad. Sci. U.S.A. 92:9348 (1995), see also Rossi et al., Am J Clin Pathol 124: 295 (2005)).

In yet another preferred embodiment, human monoclonal antibodies can be generated using transgenic or transchromosomal mice carrying portions of the human immune system, rather than using a mouse system. These transgenic and transchromosomal mice include the mice known as HuMAb mice and KM mice, respectively, and are collectively referred to herein as "transgenic mice". The production of human antibodies in such transgenic mice can be carried out as detailed for CD20 in WO 2004 035607.

Another strategy for obtaining monoclonal antibodies is to directly isolate genes encoding antibodies from lymphocytes that produce antibodies of a certain specificity, for example, see Babcock et al., 1996; A new strategy for obtaining monoclonal antibodies from single isolated lymphocytes producing antibodies of certain specificities. For details on the development of recombinant antibodies, see also Welschof and Kraus, Recombinant antibodes for cancer therapy ISBN-0-89603-918-8 and Benny K.C. Lo Antibody Engineering ISBN 1-58829-092-1.

To generate antibodies, mice can be immunized with carrier-conjugated peptides derived from an antigen sequence, i.e., a sequence to be targeted by antibodies of an enriched preparation of recombinantly expressed antigen or fragments thereof and/or cells expressing the antigen as described. Alternatively, mice can be immunized with DNA encoding the antigen or fragments thereof. In the event that immunization with a purified or enriched antigen preparation does not produce antibodies, mice can also be immunized with antigen-expressing cells, such as a cell line, to stimulate immune responses.

The immune response can be monitored during the course of immunization with plasma and serum samples obtained from the tail vein or by retroorbital phlebotomy. Mice with sufficient immunoglobulin titer can be used for fusion. Mice can be stimulated ip or iv with antigen expressing cells 3 days prior to sacrifice and spleen removal to increase the percentage of hybridomas secreting specific antibodies.

To obtain monoclonal antibody-producing hybridomas, splenocytes and lymph node cells can be isolated from immunized mice and fused to an appropriate immortalized cell line, such as a mouse myeloma cell line. The resulting hybridomas can then be screened to obtain antigen-specific antibodies. Individual wells can then be screened by ELISA for antibody-secreting hybridomas. Immunofluorescence analysis and FACS using cells expressing the antigen can identify antibodies with specificity for the antigen. Antibody-secreting hybridomas can be replicated, screened again and, if still positive for monoclonal antibodies, can be subcloned by limiting dilution. The stable subclones can then be cultured in vitro to generate antibodies in tissue culture media for characterization.

Antibodies can be generated in a host cell transfectome using, for example, a combination of recombinant DNA techniques and gene transfection techniques that are well known in the art (Morrison, S. (1985) Science 229: 1202).

For example, in one embodiment, the gene(s) of interest, such as antibody genes, can be ligated into an expression vector, such as a eukaryotic expression plasmid, such as used by the GS gene expression system disclosed in WO 87/04462, WO 89/01036 and EP 338 841 or other expression systems well known in the art. The purified plasmid with cloned antibody genes can be introduced into eukaryotic host cells such as CHO cells, NS/0 cells, HEK293T cells or HEK293 cells, or alternatively other eukaryotic cells such as cells derived from plants, fungi or yeasts. The method used to introduce these genes may be a method described in the art, such as electroporation, the use of lipofectin, lipofectamine, or others. Once these antibody genes are introduced into host cells, cells expressing the antibody can be identified and selected. These cells are transfectomes which can then be amplified for their level of expression and worked up to produce antibodies. Recombinant antibodies can be isolated and purified from these culture supernatants and/or cells.

Alternatively, the cloned antibody genes can be expressed in other expression systems, including prokaryotic cells such as microorganisms such as E. coli. In addition, antibodies can be produced in non-human transgenic animals such as sheep and rabbit milk or chicken eggs or transgenic plants; See, for example, Verma, R., et al. (1998) J. Immunol. Meth. 216:165-181; Pollock, et al. (1999) J. Immunol. Meth. 231:147-157; and Fischer, R., et al. (1999) Biol. Chem. 380: 825-839.

Chimerization

Unlabeled mouse antibodies are highly immunogenic to humans with repeated use, resulting in a reduced therapeutic effect. The main immunogenicity is mediated by heavy chain constant regions. The immunogenicity of mouse antibodies in humans can be reduced or completely eliminated if the corresponding antibodies are chimerized or humanized. Chimeric antibodies are antibodies whose different parts are derived from different animal species, such as those having a variable region derived from a mouse antibody and human immunoglobulin constant regions. Antibody chimerization is achieved by combining the heavy and light chain variable regions of a mouse antibody with a human heavy and light chain constant region (e.g., as described by Kraus et al., in Methods in Molecular Biology series, Recombinant antibodies for cancer therapy ISBN-0-89603-918 -8). In a preferred embodiment, the chimeric antibodies are generated by fusing a human kappa light chain constant region with a mouse light chain variable region. In a further preferred embodiment, chimeric antibodies can be generated by fusing a human lambda light chain constant region with a mouse light chain variable region. Preferred heavy chain constant regions for making chimeric antibodies are IgG1, IgG3 and IgG4. Other preferred heavy chain constant regions for making chimeric antibodies are IgG2, IgA, IgD and IgM.

humanization

Antibodies interact with target antigens primarily through amino acid residues that are located in the six complementarity-determining regions of the heavy and light chains (CDRs). For this reason, the amino acid sequences within the CDR are more diverse between individual antibodies than those outside the CDR. Because CDR sequences are responsible for most antibody-antigen interactions, it is possible to express recombinant antibodies that mimic the properties of specific naturally occurring antibodies by constructing expression vectors that include CDR sequences from a specific naturally occurring antibody grafted onto framework sequences from another antibody with other properties (see, for example, Riechmann, L. et al. (1998) Nature 332: 323-327; Jones, P. et al. (1986) Nature 321: 522-525; and Queen, C. et al. (1989) Proc. Natl. Acad. Sci. U. S. A. 86: 10029-10033). Such framework sequences can be obtained from public DNA databases that include germline antibody gene sequences. These germline sequences will differ from the mature antibody gene sequences because they will not include the fully assembled variable genes that are generated by V(D)J fusion during B cell maturation. Genetic germline sequences will also differ from high affinity secondary repertoire antibody sequences when individually evenly distributed across the variable region.

The ability of antibodies and other binding agents to bind an antigen can be determined using standard binding assays (eg, ELISA, Western blot, immunofluorescence, and flow cytometric analysis).

For antibody purification, selected producer cell lines can be grown in 2 liter spinner flasks to purify recombinant antibodies. Alternatively, antibodies can be produced in bioreactors based on dialysis. Supernatants can be filtered and, if necessary, concentrated before affinity chromatography with Sepharose with L-protein. Eluted IgG can be checked by gel electrophoresis and high performance liquid chromatography to ensure purity. The buffer solution can be replaced with PBS and the concentration can be determined by OD280 using the appropriate absorbance. Recombinant antibodies can be aliquoted and stored at -65 to -85°C.

Flow cytometry can be used to demonstrate the binding of monoclonal antibodies to living cells expressing the antigen. Cell lines expressing naturally or transfected antigen and negative controls lacking antigen expression (grown under standard growth conditions) can be mixed with various concentrations of monoclonal antibodies in hybridoma supernatants or in PBS containing 1% FBS and incubated at 4°C. C within 30 minutes. After washing, a fluorescently labeled detection reagent (such as a fluorescently conjugated anti-IgG antibody, anti-Fab antibody, or protein-L) can bind to the antigen-bound monoclonal antibody under the same conditions as the conditions for staining the primary antibody. Samples can be analyzed by flow cytometry using a FACS instrument using the properties of light and side scatter with the transmission of single live cells. To distinguish antigen-specific monoclonal antibodies from non-specific binders in a single measurement, a co-transfection method can be used. Cells transiently transfected with plasmids encoding an antigen and a fluorescent marker can be stained as described above. Transfected cells can be detected in a different fluorescence channel than cells stained with antibodies. Because most transfected cells express both transgenes, antigen-specific monoclonal antibodies bind preferentially to cells expressing the fluorescence marker, while non-specific antibodies bind in comparable proportions to non-transfected cells. An alternative analysis using fluorescence microscopy can be used in addition to or instead of flow cytometry analysis. Cells can be stained exactly as described above and examined by fluorescence microscopy.

To demonstrate the binding of monoclonal antibodies to living cells expressing the antigen, immunofluorescent microscopic analysis can be used. For example, cell lines expressing either spontaneously or after transfection the antigen and negative controls lacking antigen expression are grown on chamber slides under standard growth conditions in DMEM/F12 medium supplemented with 10% fetal calf serum (FCS), 2 mM L -glutamine, 100 IU/ml penicillin and 100 mcg/ml streptomycin. The cells can then be fixed with methanol or paraformaldehyde or left untreated. The cells can then react with monoclonal antibodies against the antigen for 30 minutes at 25°C. After washing, cells can react with Alexa555-labeled anti-mouse IgG antibody (Molecular Probes) under the same conditions. The cells can then be examined using fluorescence microscopy.

Cell extracts from cells expressing the antigen and corresponding negative controls can be prepared and subjected to sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis. After electrophoresis, the separated antigens are transferred to nitrocellulose membranes, blocked, and examined for the monoclonal antibodies to be tested. IgG binding can be detected using anti-mouse protein IgG peroxidase and developed with an ECL substrate.

Antibodies can be further tested for reactivity with the antigen by immunohistochemistry well known to the skilled artisan, for example using paraformaldehyde- or acetone-fixed cryosections, or paraformaldehyde-fixed and paraffin-embedded tissue sections from non-tumor tissue or tumor tissue samples obtained from patients. during a routine surgical procedure, or from mice bearing xenotransformed tumors inoculated with cell lines expressing the antigen spontaneously or after transfection. For immunostaining, antibodies reactive to the antigen can then be incubated with goat anti-mouse antibodies or goat anti-rabbit antibodies conjugated with horseradish peroxidase (DAKO) according to the supplier's instructions.

Preclinical studies

The binding agents described herein can also be tested in an in vivo model (eg, immunocompromised mice bearing tumor xenografts inoculated with claudin-expressing cell lines) to determine their effectiveness in controlling the growth of claudin-expressing tumor cells.

In vivo studies following xenotransplantation of claudin-expressing tumor cells into immunocompromised mice or other animals can be performed using the binding agents described herein. Binding agents can be administered to mice without tumors followed by injection of tumor cells to measure the effects of the binding agents in preventing tumor formation or tumor-related symptoms. Binding agents can be administered to mice with tumors to determine the therapeutic efficacy of the respective binders in reducing tumor growth, metastasis, or tumor-related symptoms. The use of binding agents can be combined with the use of other substances as cystostatic drugs, growth factor inhibitors, cell cycle blockers, angiogenesis inhibitors or antibodies to determine the synergistic efficacy and potential toxicity of the combinations. For analysis of toxic side effects mediated by binding agents, animals can be inoculated with binding agents or control reagents and closely examined for symptoms possibly associated with claudine binding agent therapy.

Mapping of epitopes recognized by binding agents can be performed as detailed in "Epitope Mapping Protocols (Methods in Molecular Biology)" by Glenn E. Morris ISBN-089603-375-9 and "Epitope Mapping: A Practical Approach" Practical Approach Series, 248 by ISBN-089603-375-9 and in "Epitope Mapping: A Practical Approach" Practical Approach Series, 248 by Olwyn M. R. Westwood, Frank C. Hay.

The compounds and agents described herein may be administered in the form of any suitable pharmaceutical composition.

Pharmaceutical compositions of the invention are preferably sterile and contain an effective amount of the binding agents described herein, and optionally additional agents, as described herein, to create the desired reaction of the desired effect.

Pharmaceutical compositions are usually provided in a single dosage form and can be prepared in a known manner. The pharmaceutical composition may, for example, be in the form of a solution or suspension.

The pharmaceutical composition may contain salts, buffers, preservatives, carriers, diluents and/or excipients, each of which is preferably pharmaceutically acceptable. The term "pharmaceutically acceptable" refers to the non-toxicity of a material that does not interact with the action of the active ingredient of the pharmaceutical composition.

Salts that are not pharmaceutically acceptable can be used to prepare pharmaceutically acceptable salts and are included in the invention. Pharmaceutically acceptable salts of this type include, but are not limited to, those derived from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic acids, and the like. Pharmaceutically acceptable salts may also be prepared as alkali metal salts or alkaline earth metal salts such as sodium salts, potassium salts or calcium salts.

Suitable buffer substances for use in the pharmaceutical composition include acetic acid in the salt, citric acid in the salt, boric acid in the salt, and phosphoric acid in the salt.

Suitable preservatives for use in the pharmaceutical composition include benzalkonium chloride, chlorobutanol, paraben and thimerosal.

The injectable formulation may include a pharmaceutically acceptable excipient such as Ringer's lactate.

The term "carrier" refers to an organic or inorganic component of a natural or synthetic nature, in which the active component is combined to facilitate, enhance or use. According to the invention, the term "carrier" also includes one or more compatible solid or liquid fillers, diluents, or encapsulating agents that are suitable for administration to a patient.

Possible parenteral carrier substances are, for example, sterile water, Ringer's solution, Ringer's lactate, sterile sodium chloride solution, polyalkylene glycols, hydrogenated naphthalenes and in particular biocompatible lactide polymers, lactide-glycolide copolymers or polyoxyethylene/polyoxypropylene copolymers.

As used herein, the term "excipient" is intended to refer to all substances that may be present in a pharmaceutical composition that are not active ingredients, such as, for example, carriers, binders, lubricants, thickeners, surfactants, preservatives, emulsifiers. , buffers, flavors or colors.

The agents and compositions described herein may be administered by any conventional route, such as parenteral administration, including injection or infusion. Administration is preferably parenteral, eg intravenous, intraarterial, subcutaneous, intradermal or intramuscular.

Compositions suitable for parenteral administration generally contain a sterile aqueous or non-aqueous preparation of the active compound, which is preferably isotonic with the recipient's blood. Examples of compatible vehicles and solvents are Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fatty oils are usually used as a solution or suspension medium.

The agents and compositions described herein are administered in effective amounts. "Effective amount" refers to the amount that achieves the desired response of the desired effect alone or together with additional doses. In the case of treating a specific disease or a specific condition, the desired response preferably refers to inhibition of the course of the disease. This includes slowing down the progress of the disease, and in particular stopping or reversing the progress of the disease. The desired response in the treatment of a disease or condition may also be to delay the onset or prevent the onset of the disease or condition.

The effective amount of an agent or composition described herein will depend on the condition being treated, the severity of the disease, individual patient parameters including age, physiology, size and weight, duration of treatment, type of concomitant therapy (if any), specific route of administration and similar factors. Accordingly, the doses administered by the agents described herein may depend on various such parameters. In the event that the response of the patient is insufficient when using the initial dose, higher doses (or effective higher doses achieved by another, more localized route of administration) can be used.

The agents and compositions described herein may be administered to patients, for example in vivo, to treat or prevent various disorders such as those described herein. Preferred patients include those suffering from disorders that can be corrected or alleviated by the administration of the agents and compositions described herein. This includes disorders involving cells characterized by an altered claudin expression pattern, such as CLDN18.2 and/or CLDN6.

For example, in one embodiment, the agents described herein can be used to treat a patient with a cancer, such as the cancer described herein, which is characterized by the presence of claudin-expressing cancer cells.

Pharmaceutical compositions and methods of treatment described in accordance with the invention can also be used for immunization or vaccination to prevent the disease described herein.

The pharmaceutical composition of the invention may be administered together with additional immune enhancing agents, such as one or more adjuvants, and may contain one or more immune enhancing agents to further enhance its effectiveness, preferably to achieve a synergistic immunostimulatory effect. The term "adjuvant" refers to compounds that prolong or enhance or accelerate the immune response. In this regard, different mechanisms are possible depending on the different types of adjuvants. For example, compounds that mediate DC maturation, such as lipopolysaccharides or CD40 ligand, form a first class of suitable adjuvants. Generally, any agent that affects the immune system in a "danger signal" manner (LPS, GP96, dsRNA, etc.) or cytokines such as GM-CSF can be used as an adjuvant that allows for intensification and/or enhance the immune response in a controlled manner. Also optionally, CpG oligodeoxynucleotides can be used in this context, although their side effects, which occur under certain circumstances, should be considered, as explained above. Particularly preferred adjuvants are cytokines such as monokines, lymphokines, interleukins or chemokines, for example IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, INFα, INF-γ, GM-CSF, LT-α or growth factors such as hGH. Other known adjuvants are aluminum hydroxide, Freund's adjuvant or an oil such as Montanide®, most preferably Montanide® ISA51. Lipopeptides such as Pam3Cys are also suitable for use as adjuvants in the pharmaceutical composition of the present invention.

The agents and compositions provided herein may be used alone or in combination with conventional therapeutic regimens such as surgery, radiation, chemotherapy, and/or bone marrow transplantation (autologous, isogenic, allogeneic, or unrelated).

Cancer treatment is an area where combination strategies are particularly desirable, as often the combined action of two, three, four, or even more anticancer drugs/therapies creates synergistic effects that are significantly stronger than those of a monotherapeutic approach. Thus, in another embodiment of the present invention, cancer treatment using immunization or vaccination based mechanisms, such as the methods and pharmaceutical compositions of the present invention, can be effectively combined with various other drugs and/or methods that target similar or other specific mechanisms. These include, for example, combinations with conventional anticancer therapies, multiple epitope strategies, complementary immunotherapy, and treatment approaches targeting angiogenesis or apoptosis (for a review, see, for example, Andersen et al. 2008: Cancer treatment: the combination of vaccination with other therapies Cancer Immunology Immunotherapy, 57(11): 1735-1743). Sequential administration of different agents may inhibit the growth of cancer cells at different checkpoints, while other agents may, for example, inhibit neoangiogenesis, cancer cell survival or metastasis, potentially turning cancer into a chronic disease. The following list provides some non-limiting examples of anticancer drugs and treatments that can be used in conjunction with the present invention:

1. Chemotherapy

Chemotherapy is the standard treatment for several types of cancer. The most common chemotherapy agents work by killing cells that are rapidly dividing, which is one of the main properties of cancer cells. Thus, combination with conventional chemotherapeutic drugs, such as, for example, alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, and other antitumor agents that affect cell division or DNA synthesis, can significantly improve the therapeutic effects of the present invention by purifying suppressor cells, resetting the immune system, making tumor cells susceptible to immune-mediated killing, or further activating immune system cells. Synergistic antitumor effects of vaccination-based chemotherapy and immunotherapy have been demonstrated in several studies (see e.g. Quoix et al. 2011: Therapeutic vaccination with TG4010 and first-line chemotherapy in advanced non-small-cell lung cancer: a controlled phase 2B trial Lancet Oncol 12 (12): 1125-33, see also Liseth et al 2010: Combination of intensive chemotherapy and anticancer vaccines in the treatment of human malignancies: the hematological experience J Biomed Biotechnol 2010: 6920979; see also Hirooka et al., 2009: A combination therapy of gemcitabine with immunotherapy for patients with inoperable locally advanced pancreatic cancer. Pancreas 38(3): e69-74). There are hundreds of chemotherapy drugs that are mostly suitable for combination therapy. Some (non-limiting) examples of chemotherapy drugs that can be combined with the present invention are carboplatin (paraplatin), cisplatin (platinol, platinol-AQ), cyclophosphamide (cytoxan, neosar), docetaxel (taxotere), doxorubicin (adriamycin), erlotinib ( Tarceva), etoposide (VePesid), fluorouracil (5-FU), gemcitabine (Gemzar), imatinib mesylate (Gleevec), irinotecan (Camptosar), methotrexate (Folex, mexat, amethopterin), paclitaxraxol (tax) (Nexavar), sunitinib ( Sutent), topotecan (Hycamtin), vincristine (Oncovin, Vincasar PFS), and vinblastine (Velban).

2. Surgery

Cancer surgery - surgery to remove a tumor - remains the mainstay of cancer treatment. Surgery may be combined with other cancer treatments in order to remove any remaining tumor cells. The combination of surgical approaches followed by immunotherapy is a promising approach that has been demonstrated countless times.

3. Irradiation

Radiation therapy remains an important component of cancer treatment, with approximately 50% of all cancer patients receiving radiation therapy during their illness. The main goal of radiation therapy is to deprive cancer cells of their potential to multiply (cell divide). The types of radiation used to treat cancer are photon radiation (X-rays and gamma rays) and particle radiation (beams of electrons, protons and neutrons). There are two ways to deliver radiation to the location of the cancer. External beam radiation is delivered from outside the body by directing high-energy beams (photons, protons, or particle radiation) at the location of the tumor. Internal radiation or brachytherapy is delivered from inside the body by radioactive sources sealed in catheters or implanted radiation sources directly into the tumor area. Radiotherapy modalities that are useful in conjunction with the present invention include, for example, fractionation (radiotherapy delivered in a fractionated mode, e.g., daily fractions of 1.5 to 3 Gy given over several weeks), 3D conformal radiotherapy ( 3DCRT; delivery of radiation to the macroscopic volume of the tumor), intensity-modulated radiation therapy (IMRT; computer-controlled modulation of the intensity of several radiation beams), image-guided radiation therapy (IGRT; a method that includes imaging before radiation therapy, which allows correction), and stereotactic radiation body therapy (SRBT, provides very high individual doses of radiation on only a few treatment fractions). For a review of radiotherapy, see Baskar et al., 2012: Cancer and radiation therapy: current advances and future directions. Int. J Med Sci. 9(3): 193–199.

4. Antibodies

Antibodies (preferably monoclonal antibodies) achieve their therapeutic effect against cancer cells through various mechanisms. They can have a direct effect on apoptosis or programmed cell death. They can block components of signal transduction pathways such as, for example, growth factor receptors, effectively delaying tumor cell proliferation. In cells that express monoclonal antibodies, they can induce the formation of anti-idiotypic antibodies. Indirect effects include the recruitment of cells with cytotoxicity, such as monocytes and macrophages. This type of antibody-mediated cell killing is called antibody-dependent cell-mediated cytotoxicity (ADCC). The antibodies also bind complement, resulting in a direct cellular toxicity known as complement-dependent cytotoxicity (CDC). Combining surgical techniques with immunotherapeutic drugs or methods is a successful approach, as demonstrated, for example, in Gadri et al. 2009: Synergistic effect of dendritic cell vaccination and anti-CD20 antibody treatment in the therapy of murine lymphoma. J Immunother. 32(4): 333-40. The following list provides some non-limiting examples of antitumor antibodies and potential target antibodies (in parentheses) that can be used in combination with the present invention: abagovomab (CA-125), abciximab (CD41), adecatumumab (EpCAM), afutuzumab (CD20), alacizumab pigol (VEGFR2), altumomab pentetate (CEA), amatuximab (MORAb-009), anatumomab mafenatox (TAG-72), apolizumab (HLA-DR), arcitumomab (CEA), bavituximab (phosphatidylserine), bektumomab (CD22), belimumab (BAFF), bevacizumab (VEGF-A), bivatuzumab mertansine (CD44 v6), blinatumomab (CD19), brentuximab vedotin (CD30 TNFRSF8), cantuzumab mertansine (mucin CanAg), cantuzumab ravtansin (MUC1), capromab pendetide (prostate carcinoma cells) ), (CNTO888), catumaxomab (EpCAM, CD3), cetuximab (EGFR), citutuzumab richox (EpCAM), cixutumumab (IGF-1 receptor), claudiximab (Claudin), clivatuzumab tetraxetane (MUC1), conatumumab (TRAIL-R2), dacetuzumab (CD40), dalotuzumab (insulin-like growth factor I receptor), denosumab (RANKL), detumomab (B cell), drozitumab (DR5), ecromeximab (ganglioside GD3), edrecolomab (EpCAM), elotuzumab (SLAMF7), enavatuzumab ( PDL192), ensituximab (NPC-1C), epratuzumab (CD22), ertumaxomab (HER2/neu, CD3), etaracizumab (αvβ3 integrin), farletuzumab (folate receptor 1), FBTA05 (CD20), ficlatuzumab (SCH 900105), figitumumab ( IGF-1 receptor), flanvotumab (glycoprotein 75), fresolimumab (TGF-β), galiximab (CD80), ganitumab (IGF-I), gemtuzumab ozogamicin (CD33), gevokizumab (IL-1β), girentuximab (carbonic anhydrase 9 (CA -IX)), glembatumumab vedotin (GPNMB), ibritumumab tiuxetan (CD20), ikrucumab (VEGFR-1), igovoma (CA-125), indatuximab ravtansin (SDC1), intetumumab (CD51), inotuzumab ozogamicin (CD22), ipilimumab ( CD152), iratumumab (CD30), labetuzumab (CEA), lexatumumab (TRAIL-R2), libivirumab (hepatitis B surface antigen), lintuzumab (CD33), lorvotuzumab mertansine (CD56), lucatumumab (CD40), lumiximab (CD23), mapatumumab (TRAIL-R1), matuzumab (EGFR), mepolizumab (IL-5), milatuzumab (CD74), mitumomab (GD3 ganglioside), mogamulizumab (CCR4), moxetumomab pasudotox (CD22), nacolomab tafenatox (C242 antigen), naptumomab estafenatox ( 5T4) narnatumab (RON), necitumumab (EGFR), nimotuzumab (EGFR), nivolumab (IgG4), ofatumumab (CD20), olaratumab (PDGF-Rα), onartuzumab (human scatter factor receptor kinase), oportusumab monatox (EpCAM), oregovomab (CA-125), oxelumab (OX-40), panitumumab (EGFR), patritumab (HER3), pemtumomab (MUC1), pertuzumab (HER2/neu), pintumumab (adenocarcinoma antigen), pritumumab (vimenin), racotumomab (N- glyconeuraminic acid), radretumab (B-fibronectin extradomain), rafivirumab (rabies virus glycoprotein), ramucirumab (VEGFR2), rilotumumab (HGF), rituximab (CD20), robatumumab (IGF-1 receptor), samalizumab (CD200), sibrotuzumab (FAP ), siltuximab (IL-6), tabalumab (BAFF), takatuzumab tetraxetane (alpha-fetoprotein), taplitumomab paptox (CD19), tenatumomab (tenascin C), teprotumumab (CD221), ticilimumab (CTLA-4), tigatuzumab (TRAIL- R2), TNX-650 (IL-13), tositumomab (CD20), trastuzumab (HER2/neu), TRBS07 (GD2), tremelimumab (CTLA-4), tucotuzumab celloleukin (EpCAM), ublituximab (MS4A1), urelumab (4 -1BB), volocikimab (α5β1 integrin), votumumab (CTAA16.88 tumor antigen), zalutumumab (EGFR), zanolimumab (CD4).

5. Cytokines, chemokines, costimulatory molecules, fusion proteins

The combined use of the antigen-encoding pharmaceutical compositions of the present invention with cytokines, chemokines, costimulatory molecules and/or fusion proteins thereof to induce beneficial immune modulating or tumor inhibiting effects is another embodiment of the present invention. Various chemokines with C, CC, CXC and CX3C structures can be used to increase the infiltration of immune cells into the tumor and to facilitate the movement of antigen presenting cells to tumor draining lymph nodes. Some of the most promising chemokines are, for example, CCR7 and its ligands CCL19 and CCL21, and CCL2, CCL3, CCL5 and CCL16. Other examples are CXCR4, CXCR7 and CXCL12. In addition, costimulatory or regulatory molecules such as, for example, B7 ligands (B7.1 and B7.2) are useful. Other cytokines can also be used, such as, for example, interleukins, especially (for example, IL-1 to IL17), interferons (for example, IFNalpha1 to IFNalpha8, IFNalpha10, IFNalpha13, IFNalpha14, IFNalpha16, IFNalpha17, IFNalpha21, IFNbeta1, IFNW, IFNE1 and IFNK), hematopoietic factors, TGF (e.g., TGF-α, TGF-β, and other members of the TGF family), finally, members of the tumor necrosis factor receptor family and their ligands, and other stimulatory molecules, containing, without limitation, 4- 1BB, 4-1BB-L, CD137, CD137L, CTLA-4GITR, GITRL, Fas, Fas-L, TNFR1, TRAIL-R1, TRAIL-R2, p75NGF-R, DR6, LT.beta.R, RANK, EDAR1, XEDAR, Fn114, Troy/Trade, TAJ, TNFRII, HVEM, CD27, CD30, CD40, 4-1BB, OX40, GITR, GITRL, TACI, BAFF-R, BCMA, RELT and CD95 (Fas/APO-1), glucocorticoid -induced TNFR-related protein, apoptosis-mediating protein related to the TNF receptor (TRAMP) and death receptor-6 (DR6). CD40/CD40L and OX40/OX40L are particularly important targets for combination immunotherapy due to their direct effects on T cell survival and proliferation. For a review, see Lechner et al. 2011: Chemokines, costimulatory molecules and fusion proteins for the immunotherapy of solid tumors. Immunotherapy 3(11), 1317-1340.

6. Bacterial treatments

Researchers use anaerobic bacteria such as Clostridium novyi to destroy the interior of tumors that are low in oxygen. The bacteria must then die on contact with the oxygenated sides of the tumor, meaning they will be harmless to the rest of the body. Another strategy is to use anaerobic bacteria that have been transformed with an enzyme capable of converting a non-toxic prodrug into a toxic drug. When bacteria multiply in necrotic and hypoxic areas of the tumor, the enzyme is expressed exclusively in the tumor. Thus, a systemically administered prodrug is metabolized to a toxic drug only in the tumor. Efficacy has been demonstrated with the non-pathogenic anaerobes Clostridium sporogenes.

7. Kinase inhibitors

Another large group of potential targets for complementary cancer therapy includes kinase inhibitors, because the growth and survival of cancer cells are closely related to the deregulation of kinase activity. A wide range of inhibitors are used to restore normal kinase activity and hence reduce tumor growth. The group of target kinases includes receptor tyrosine kinases, e.g. BCR-ABL, B-Raf, EGFR, HER-2/ErbB2, IGF-IR, PDGFR-α, PDGFR-β, c-Kit, Flt-4, Flt3, FGFR1, FGFR3 , FGFR4, CSF1R, c-Met, RON, c-Ret, ALK, cytoplasmic tyrosine kinases, e.g. c-SRC, c-YES, Abl, JAK-2, serine/threonine kinases, e.g. ATM, Aurora A & B, CDKs, mTOR, PKCi, PLKs, b-Raf, S6K, STK11/LKB1 and lipid kinases eg PI3K, SK1. Small molecule kinase inhibitors include, for example, PHA-739358, nilotinib, dasatinib and PD166326, NSC 743411, lapatinib (GW-572016), canertinib (CI-1033), semaxinib (SU5416), vatalanib (PTK787/ZK222584), Sutent (SU112 48 ), Sorafenib (BAY 43-9006), and leflunomide (SU101). For more information see, for example, Zhang et al., 2009: Targeting cancer with small molecule kinase inhibitors. Nature Reviews Cancer 9, 28-39.

8. Toll-like receptors

Members of the Toll-like receptor (TLR) family are an important link between innate and adaptive immunity, and the action of many adjuvants depends on TLR activation. A large number of known cancer vaccines include TLR ligands to enhance vaccine response. Apart from TLR2, TLR3, TLR4, mainly TLR7 and TLR8 have been investigated for cancer therapy in passive immunotherapy approaches. The closely related TLR7 and TLR8 contribute to antitumor responses by acting on immune cells, tumor cells, and the tumor microenvironment, and can be activated by nucleoside analog structures. All TLRs have been used as stand-alone immunotherapeutics or as adjuvants in cancer vaccines and can be combined synergistically with the compositions and methods of the present invention. For more information, see Van Duin et al., 2005: Triggering TLR signaling in vaccination. Trends in Immunology, 27(1):49-55.

9. Angiogenesis inhibitors

In addition to therapies that target immunomodulatory receptors affected by tumor-mediated immune suppression and care mechanisms, there are treatments that target the tumor environment. Angiogenesis inhibitors prevent the extensive growth of blood vessels (angiogenesis) that tumors need to survive. For example, angiogenesis, stimulated by tumor cells to meet their growing demand for nutrients and oxygen, can be blocked by targeting different molecules. Non-limiting examples of angiogenesis-mediating or angiogenesis-inhibiting molecules that can be combined with the present invention are soluble VEGF (VEGF isoforms of VEGF121 and VEGF165, VEGFR1 receptors, VEGFR2, and neurophililin-1 and neurophililin-2 co-receptors) 1 and NRP-1, angiopoietin 2, TSP-1 and TSP-2, angiostatin and related molecules, endostatin, vasostatin, calreticulin, platelet factor-4, TIMP and CDAI, Meth-1 and Meth-2, IFN-α, -β and -γ, CXCL10, IL-4, -12 and -18, prothrombin ("kringle" domain 2), antithrombin III fragment, prolactin, VEGI, SPARC, osteopontin, maspin, canstatin, proliferin-related protein, restin and drugs such as, for example , bevacizumab, itraconazole, carboxyamidotriazole, TNP-470, CM101, IFN-α, platelet factor-4, suramin, SU5416, thrombospondin, VEGFR antagonists, angiostatic steroids + heparin, cartilage angiogenesis inhibitory factor, matrix metalloproteinase inhibitors, 2-methoxyest radiol, tecogalan , tetrathiomoibdate, talisomide, thrombospondin, prolactin Vβ3 inhibitors, linomide, tasquinimod, see e.g. Schoenfeld and Dranoff 2011: Anti-angiogenesis immunotherapy. Hum Vaccines. (9):976-81.

10. Small molecule drugs for targeted therapy

Small molecule drugs for targeted therapy, as a rule, are inhibitors of the enzymatic domains of mutant, overexpressed or other critically important proteins in the cancer cell. Notable and non-limiting examples are the tyrosine kinase inhibitors imatinib (Gleevec/Glivec) and gefitinib (Iressa). The use of small molecules, such as sunitinib malate and/or sorafenib thoralate, targeting certain kinases in combination with cancer vaccines is also described in prior patent application US2009004213.

11. Viral vaccines

There are a number of virus-based vaccines available or under development that can be used in a combination therapeutic approach with the formulations of the present invention. One of the advantages of using such viral vectors is their inherent ability to initiate immune responses, with the inflammatory responses resulting from viral infection creating the danger signal required for immune activation. The ideal viral vector should be safe and not elicit an immune response against the vector to enhance specific antitumor responses. Recombinant viruses such as vaccinia viruses, herpes simplex viruses, adenoviruses, adeno-associated viruses, retroviruses, and avian pox viruses have been used in animal tumor models, and human clinical trials have been initiated based on their encouraging results. Particularly important virus-based vaccines are virus-like particles (VLPs), small particles that contain certain proteins from the outer envelope of the virus. Virus-like particles do not contain any genetic material from a virus and cannot cause infection, but they can be engineered to present tumor antigens on their envelope. VLPs can be derived from various viruses, such as, for example, hepatitis B virus, or other families of viruses, including Parvoviridae (eg, adeno-associated virus), Retroviridae (eg, HIV), and Flaviviridae (eg, hepatitis C virus). For an overview analysis, see Sorensen and Thompsen 2007: Virus-based immunotherapy of cancer: what do we know and where are we going? APMIS 115 (11): 1177-93; virus-like particles against cancer are discussed in Buonaguro et al. 2011: Developments in virus-like particle-based vaccines for infectious diseases and cancer. Expert Rev Vaccines 10(11):1569-83; and in Guillen et al. 2010: Virus-like particles as vaccine antigens and adjuvants: application to chronic disease, cancer immunotherapy and infectious disease preventive strategies. Procedia in Vaccinology 2(2), 128–133.

12. Multi-epitope strategies

The use of multiepitopes shows promising results for vaccination. Rapid sequencing technologies combined with smart algorithm systems allow the exploitation of tumor mutant and can provide multiple epitopes for individualized vaccines that can be combined with the present invention. For more information, see 2007: Vaccination of metastatic colorectal cancer patients with matured dendritic cells loaded with multiple major histocompatibility complex class I peptides. J Immunother 30: 762–772; furthermore Castle et al. 2012: Exploiting the mutanome for tumor vaccination. Cancer Res 72(5):1081-91.

13. Adoptive T cell transfer

For example, the combination of tumor antigen vaccination and T cell transfer is described in: Rapoport et al. 2011: Combination immunotherapy using adoptive T-cell transfer and tumor antigen vaccination on the basis of hTERT and survivin after ASCT for myeloma. Blood 117(3):788-97.

14. Targeted peptide therapies

Peptides can bind to cell surface receptors or damaged extracellular matrix surrounding the tumor. Radionuclides that are attached to these peptides (eg RGD) will eventually kill cancer cells if the nuclide decays in close proximity to the cell. Of particular interest are oligo- or multimers of these binding motifs, as this can lead to increased tumor specificity and avidity. For non-limiting examples, see Yamada 2011: Peptide-based cancer vaccine therapy for prostate cancer, bladder cancer, and malignant glioma. Nihon Rinsho 69(9): 1657-61.

15. Other treatments

There are many other cancer treatments that can be combined with the compositions and methods of the present invention to create synergistic effects. Non-limiting examples are therapies targeting apoptosis, hyperthermia, hormonal therapy, telomerase therapy, insulin potentiated therapy, gene therapy, and photodynamic therapy.

The present invention is further illustrated by the following examples, which should not be construed as limiting the scope of the invention.

EXAMPLES

Example 1 Preparation, Purification and Analysis of Bispecific Antibody Derivatives Targeting CLDN6 and CD3 (CLDN6 x CD3).

A. Origin of sequences, design of bstb constructs and cloning into expression vectors

Bispecific TriMAB chimeric constructs (bstb) were designed as antigen binding fragments (Fab) provided with two single chain variable fragments (scFv) at the C-terminus of the constant regions. The Fab-binding domain is specific to the CD3 component of the human T-cell receptor. The anti-CD3 heavy chain variable region (V _H ) and corresponding light chain variable region domains (V _L ) are derived from mouse IgG TR66 (Lanzavecchia und Scheidegger 1987). The cysteine at position 114 (according to IMGT nomenclature) was replaced by serine. The heavy chain constant region (C _H 1 ) and the light chain constant region (C _L ) are of human origin. For our constructs, we chose a kappa-type light chain constant region. The two scFv binding portions are specific for human tumor antigen (TAA) associated CLDN6. The corresponding V _H and V _L regions were obtained from chimeric IgG1 IMAB206-SUBW (Ganymed Pharmaceuticals AG, Mainz, Germany). In FIG. 18 shows the amino acid sequences of the V _H and V _L domains that were used in the invention.

Two bstb molecules were generated differing in their C _H 1 region. Bstb_369/367 includes the C _H 1 region derived from human IgG1, while bstb_371/367 includes the C _H 1 region from human IgG2. It was rational to compare heterodimer formation due to the formation of different C _H 1 and _CL disulfide bonds of different subclasses (Röthlisberger et al. 2005). Since the sequence for kappa-type _CL is conserved in IgG1 and IgG2, the same _CL construct was used to generate two constructs. The following molecules have been generated at the protein level to form bstb molecules:

Bstb_369/367:

N - V _H ^αCD3 –C _H 1(IgG1)–V _H ^αCLDN6 –V _L ^αCLDN6 –6xHis-tag - C (Fd bstb_369/367) N - V _L ^αCD3 –C _L –V _H ^αCLDN6 –V _L ^αCLDN6 –Strep-mark - C (Lbstb_369/367)

Bstb_371/367:

N - V _H ^αCD3 –C _H 1(IgG2)–V _H ^αCLDN6 –V _L ^αCLDN6 –6xHis-tag - C (Fd bstb_371/367) N - V _L ^αCD3 –C _L –V _H ^αCLDN6 –V _L ^αCLDN6 –Strep-mark - C (Lbstb_371/367)

C = C-terminus, CH = heavy chain constant region, C _L = light chain constant region, Fd = hydrolyzable fragment (Fab _heavy chain part), L = Fab light chain part, N = N-terminus, V _H = variable heavy chain domain, V _L = light chain variable domain.

Table 1 summarizes information on the bstb constructs specific for TAA CLDN6 that have been obtained in the course of the invention. Fragments of the bstb construct were generated by gene synthesis at GeneArt AG (GeneArt/Thermo Fisher Scientific, Regensburg, Germany) using the V _H and V _L sequences of the corresponding IgG antibodies and conserved human _CH and _CL sequences as GeneArt Strings. CHO codon optimization was implemented using the GeneArt GeneOptimizer® software. Information on specificity, sequence origin from monoclonal antibodies (mAB), parameter for optimizing codon usage, and additional sequence characteristics are shown in Table 1. Sequences encoding the variable domains of target cell binding fragments were originally obtained from Ganymed Pharmaceuticals AG.

Construction of the cloning and DNA expression vector was performed using the Seamless PLUS cloning and assembly kit (GeneArt/Thermo Fisher Scientific) known to those skilled in the art. The human IgG secretion signal sequence encoding MGWSCIILFLVATATGVHS was introduced 5' upstream of the Fd- and L-bstb V region sequences to secrete the protein into the culture medium. A sequence encoding a flexible amino acid peptide linker (GS) of 20 amino acids (AK) ((GGGGS) ₄ ) was inserted to combine the V _H and V _L domains for the anti-TAA scFv composition. One cysteine substitution was introduced into each of the V _H and V _L domains to form the scFv-stabilizing disulfide bridge. One scFv domain sequence was fused to the Fd portion (C-terminus of C _H 1) using the sequence encoding linker 18 AA (SGPGGGRS(GGGGS) ₂ ), and the other scFv was fused to the L-part (C-terminus of C _L ) using the sequence encoding the linker with six AA (DVPGGS). Different linker lengths made it possible to distinguish the Fd- and L-parts by size. A 6xHis tag sequence was added to the 3' end of the Fd-scFv fragment and a Strep tag to the 3' end of the L-scFv fragment to facilitate purification of pure heterodimeric first generation bstb. Table 2 shows the complete DNA sequences encoding the bstb protein. Table 3 shows the DNA sequence encoding bi-(scFv) _2, which was used as a reference.

The bstb antibody constructs were cloned into a standard mammalian pCEP4 expression vector (Invitrogen/Thermo Fisher Scientific, Darmstadt, Germany) digested with Nae I and Pml I, resulting in a linear blunt-ended plasmid. The C-terminal 6xHis tag and Strep tag served to purify proteins by affinity chromatography and for detection purposes. Labelless constructs were also obtained. All constructs were validated by an external sequencing service. The design and protein schemes are shown in Fig. 1.

Table 1. Summary of features of CLDN6 x CD3-bstb antibodies

internal name Specificity Origin of scFv
region V _H -V _L Origin of the Fab V _H -V _L region Codon usage _CH 1 Label DS bridge in scFv fragment Bstb_369/367
(SEQ ID NO: 14/16) HS IMAB206-SUBW TR66(C114S) CG IgG1 His/Strp + Bstb_371/367
(SEQ ID NO: 15/16) HS IMAB206-SUBW TR66(C114S) CG IgG2 His/Strp + Bstb_5726/5725
(SEQ ID NO: 17/19) HS IMAB206-SUBW TR66(C114S) CG IgG1 - + Bstb_5727/5725
(SEQ ID NO: 18/19) HS IMAB206-SUBW TR66(C114S) CG IgG2 - +

Bstb stands for bispecific TriMAB; C, cysteine; CH1, constant heavy region 1; CG, Cricetulus griseus; IMAB, ideal monoclonal antibody; His, 6xHis-label; HS, Homo sapiens; IgG, immunoglobulin G; S, serine; Strp, Strep label; W, tryptophan.

Table 2. DNA sequences encoding CLDN6 x CD3-bstb

Internal name of the plasmid Relevant bstb snippet DNA coding sequence #367 Lbstb_369/367,
Lbstb_371/367 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCTCAGATCGTGCTGACCCAGTCTCCCGCCATCATGTCTGCTAGCCCTGGCGAAAAGTGACAATGACCTGCCGGGCCTCCTCCTCCGTGTCCTACATGAACTGGTATCAGCAGAAGTCCGGCACCTCCCCCAAGCGGTGGATCTACGACACCTCCAAGGTGGCCTCTGGCGTG CCCTACAGATTCTCCGGCTCTGGCTCTGGCACCTCCTACAGCCTGACCATCTCCAGCATGGAAGCCGAGGATGCCGCCACCTACTACTGCCAGCAGTGGTCCTCCAACCCCCTGACCTTTGGCTGGCACCAAGCTGGAACTGAAGCGGACCGTGGCCGCTCCTTCCGTGTTCATCTTCCCTCCCTCCGACGAGCAGCTGAAGTCCGGCACCGCCTCCGTGGTGTGCCTGCTGAACAACTTC TACCCTCGGGAGGCCAAGGTGCAGTGGAAGGTGGACAACGCCCTGCAGTCCGGCAACTCCCAGGAAAAGCGTCACCGAGCAGGACTCCAAGGACAGCACCTACTCCCTGTCCTCCACCCTGACCCTGTCCAAGGCCGACTACGAGAAGCACAAGGTGTACGCCTGCGAGGTGACCCCACCAGGGCCTGTCCAGCCCTGTGACCAAGTCCTTCAACCGGGGCGAGTGTGAC GTGCCTGGTGGTAGCGAAGTGCAGCTGCAGCAGCGGCCCTGAGCTGGTGAAACCCGGCGCTAGCATGAAGATCAGCTGCAAGGCCAGCGGCTACAGCTTCACCGGCTACACCATGAACTGGTGAAACAGAGCCACGGCAAGTGCCTGGAATGGATCGGCCTGATCAACCCCTACAACGGCGGCACCATCTACAACCAGAAGTTCAAGGGCAAGGCCACACTGACC GTGGACAAGAGCAGCAGCACCGCCTACATGGAACTGCTGAGCCTGACCAGCGAGGACAGCGCCGTGTACTACTGCGCCAGAGACTACGGCTTCGTGCTGGACTACTGGGGCCAGGGCACCACCCTGACAGTGTCTAGCGGAGGCGGAGGATCTGGTGGTGGCGGATCTGGGCGGTGGAAGTGGCGGAGGTGGTAGCCAGATCGTGTGCTGACCAGTCCCCC TCCATCATGTCCGTGTCTCCCGGCGAGAAAGTGACAATTACCTGCTCCGCCTCCTCCCGTGTCCTACATGCACTGGTTCCAGCAGAAGCCCGGCACCTCCCCCAAGCTGTGGATCTACTCCACCTCCAACCTGGCCTCCGGCGTGCCCGCCAGATTCTCCGGAAGAGGCTCCGGCACCAGCTACTCCCTGACCATCTCCAGAGTGGCCGCCGAGGACGCCGCCACCTACTACTGCCAGC AGCGGTCCAACTACCCCCCCTGGACCTTTGGCTGCGGCACCAAGCTGGAAATCAAGTCTGCCTGGAGCCACCCACAGTTCGAGAAGTGA #369 Fdbstb_369/367 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCCCAGGTGCAGCTGCAGCAGTCTGGCGCTGAGCTGGCTAGACCTGGCCCTCCGTGAAGATGTCCTGCAAGACCTCCGGCTACACCTTCACCCGGTACACCATGCACTGGGTCAAGCAGAGGCCTGGACAGGGCCTGGAATGGATCGGCTACATCAACCCCTCCCGGGG CTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACAACCGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCTCCCTGACCTCCGAGGACTCCGCCGTGTACTGCGCCCGGTACTACGACGACCACTACTCCCTGGACTACTGGGGCCAGGGCACCACACTGACAGTGTCTAGCGCCTCCACCAAGGGCCTTCCGTGTTCCCTCTGGCCCTTCCTC CAAGTCCACCTCCGGCGGCACCGCCGCTCTGGGCTGCCTGGTGAAGGACTACTTCCCTGAGCCTGTGACCGTGAGCTGGAACTCTGGCGCCCTGACCAGCGGCGTGCACACCTTCCCTGCCGTGCTGCAGTCCTCCGGCCTGTACTCCCTGTCCTCCGTGTGTGACCGTGCCTTCCTCCTCCCTGGCACCCAGACCTACATCTGCAACGTGAACCACAAGCCTTCCAACACCA AGGTGGACAAGCGGGTGGAGCCTAAGTCCTGCTCCGGCCCTGGGGGCGGACGCAGCGGCGGAGGCGGATCCGGCGGAGGAGGCCTCTGAAGTGCAGCTGCAGCAGCGGCCCTGAGCTGGTGAAACCCGGCGCTAGCATGAAGATCAGCTGCAAGGCCAGCGGCTACAGCTTCACCGGCTACACCATGAACTGGTGAAACAGAGCCACGGCAAGTGCCTG GAATGGATCGGCCTGATCAACCCCTACAACGGCGGCACCATCTACAACCAGAAGTTCAAGGGCAAGGCCACACTGACCGTGGACAAGAGCAGCAGCACCGCCTACATGGAACTGCTGAGCCTGACCAGCGAGGACAGCGCCGTGTGTACTGCGCCAAGAGACTACGGCTTCGTGCTGGACTACTGGGCCAGGGCACCACCCTGACAAGTGTCTAGCGGAGGCGGAGGA TCTGGTGGTGGCGGATCTGGCGGCGTGGAAGTGGCGGAGTGGTAGCCAGATCGTGCTGACCCAGTCCCCCTCCATGTCCGTGTCTCCCGGCGAGAAAGTGACAATTACCTGCTCCGCCTCCTCCTCCGTGTCCTACATGCACTGGTTCCAGCAGAAGCCCGGCACCTCCCCCAAGCTGTGGATCTACTCCACCTCCAACCTGGCCCTCCGGCGTGCCCGCCAGAT TCTCCGGAAGAGGCTCCGGCACCAGCTACTCCCTGACCATCTCCAGAGTGGCCGCCGAGGACGCCGCCACCTACTACTGCCAGCAGCGGTCCAACTACCCCCCCTGGACCTTTGGCTGCGGCACCAAGCTGGAAATCAAGGGCGGCTCCCACCACCACCATCACCACTGA #371 Fdbstb_371/367 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCCCAGGTGCAGCTGCAGCAGTCTGGCGCTGAGCTGGCTAGACCTGGCCCTCCGTGAAGATGTCCTGCAAGACCTCCGGCTACACCTTCACCCGGTACACCATGCACTGGGTCAAGCAGAGGCCTGGACAGGGCCTGGAATGGATCGGCTACATCAACCCCTCCCGGGG CTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACAACCGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCTCCCTGACCTCCGAGGACTCCGCCGTGTACTGCGCCCGGTACTACGACGACCACTACTCCCTGGACTACTGGGGCCAGGGCACCACACTGACAGTGTCTAGCGCCTCCACCAAGGCCCTTCCGTGTTCCCTCTGGCCCTTGCTC CAAGTCCACCTCCGAAGGCACCGCCGCTCTGGGCTGCCTGGTGAAGGACTACTTCCCTGAGCCTGTGACCGTGAGCTGGAACTCTGGCGCCCTGACCAGCGGCGTGCACACCTTCCCTGCCGTGCTGCAGTCCTCCGGCCTGTACTCCCTGTCCTCCGTGTGTGACCGTGCCTTCCTCCAACTTCGGCACCCAGACCTACACCTGCAACGTGGACCACAAGCCTTCCAACACCAAG GTGGACAAGACCGTGGAGCCTAAGTCCGCCTCCGGCCCTGGGGGCGGACGCAGCGGCGGAGGCGGATCCGGCGGAGGAGGCCTCTGAAGTGCAGCTGCAGCAGAGCGGCCCTGAGCTGGTGAAACCCGGCGCCTAGCATGAAGATCAGCTGCAAGGCCAGCGGCTACAGCTTCACCGGCTACACCATGAACTGGTGAAACAGAGCCACGGCAAGTGCCTGGAAT GGATCGGCCTGATCAACCCCTACAACGGCGGCACCATCTACAACCAGAAGTTCAAGGGCAAGGCCACACTGACCGTGGACAAGAGCAGCAGCACCGCCTACATGGAACTGCTGAGCCTGACCAGCGAGGACAGCGCCGTGTACTGCGCCAGAGACTACGGCTTCGTGCTGGACTACTGGGGCCAGGGCACCACCCTGACAAGTGTCTAGCGGAGGCGGAGGATCTG GTGGTGGCGGATCTGGCGGCGGTGGAAGTGGCGGAGGTGGTAGCCAGATCGTGTGCTGACCAGTCCCCCTCCATCATGTCCGTGTCTCCCGGCGAGAAAGTGACAATTACCTGCTCCGCCTCCTCCTCCGTGTCCTACATGCACTGGTTCCAGCAGAAGCCCGGCACCTCCCCCAAGCTGTGGATCTACTCCACCTCCAACCTGGCCTCCGGCGTGCCCGCCAGATTCTC CGGAAGAGGCTCCGGCACCAGCTACTCCCTGACCATCTCCAGAGTGGCCGCCGAGGACGCCGCCACCTACTACTGCCAGCAGCGGTCCAACTACCCCCCCTGGACCTTTGGCTGCGGCACCAAGCTGGAAATCAAGGGCGGCTCCCACCACCACCATCACCACTGA #5725 Lbstb_5726/5725,
Lbstb_5727/5725 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCTCAGATCGTGCTGACCCAGTCTCCCGCCATCATGTCTGCTAGCCCTGGCGAAAAGTGACAATGACCTGCCGGGCCTCCTCCTCCGTGTCCTACATGAACTGGTATCAGCAGAAGTCCGGCACCTCCCCCAAGCGGTGGATCTACGACACCTCCAAGGTGGCCTCTGGCGTG CCCTACAGATTCTCCGGCTCTGGCTCTGGCACCTCCTACAGCCTGACCATCTCCAGCATGGAAGCCGAGGATGCCGCCACCTACTACTGCCAGCAGTGGTCCTCCAACCCCCTGACCTTTGGCTGGCACCAAGCTGGAACTGAAGCGGACCGTGGCCGCTCCTTCCGTGTTCATCTTCCCTCCCTCCGACGAGCAGCTGAAGTCCGGCACCGCCTCCGTGGTGTGCCTGCTGAACAACTTC TACCCTCGGGAGGCCAAGGTGCAGTGGAAGGTGGACAACGCCCTGCAGTCCGGCAACTCCCAGGAAAAGCGTCACCGAGCAGGACTCCAAGGACAGCACCTACTCCCTGTCCTCCACCCTGACCCTGTCCAAGGCCGACTACGAGAAGCACAAGGTGTACGCCTGCGAGGTGACCCCACCAGGGCCTGTCCAGCCCTGTGACCAAGTCCTTCAACCGGGGCGAGTGTGAC GTGCCTGGTGGTAGCGAAGTGCAGCTGCAGCAGCGGCCCTGAGCTGGTGAAACCCGGCGCTAGCATGAAGATCAGCTGCAAGGCCAGCGGCTACAGCTTCACCGGCTACACCATGAACTGGTGAAACAGAGCCACGGCAAGTGCCTGGAATGGATCGGCCTGATCAACCCCTACAACGGCGGCACCATCTACAACCAGAAGTTCAAGGGCAAGGCCACACTGACC GTGGACAAGAGCAGCAGCACCGCCTACATGGAACTGCTGAGCCTGACCAGCGAGGACAGCGCCGTGTACTACTGCGCCAGAGACTACGGCTTCGTGCTGGACTACTGGGGCCAGGGCACCACCCTGACAGTGTCTAGCGGAGGCGGAGGATCTGGTGGTGGCGGATCTGGGCGGTGGAAGTGGCGGAGGTGGTAGCCAGATCGTGTGCTGACCAGTCCCCC TCCATCATGTCCGTGTCTCCCGGCGAGAAAGTGACAATTACCTGCTCCGCCTCCTCCCGTGTCCTACATGCACTGGTTCCAGCAGAAGCCCGGCACCTCCCCCAAGCTGTGGATCTACTCCACCTCCAACCTGGCCTCCGGCGTGCCCGCCAGATTCTCCGGAAGAGGCTCCGGCACCAGCTACTCCCTGACCATCTCCAGAGTGGCCGCCGAGGACGCCGCCACCTACTACTGCCAGC AGCGGTCCAACTACCCCCCCTGGACCTTTGGCTGCGGCACCAAGCTGGAAATCAAGTGA #5726 Fdbstb_5726/5725 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCCCAGGTGCAGCTGCAGCAGTCTGGCGCTGAGCTGGCTAGACCTGGCCCTCCGTGAAGATGTCCTGCAAGACCTCCGGCTACACCTTCACCCGGTACACCATGCACTGGGTCAAGCAGAGGCCTGGACAGGGCCTGGAATGGATCGGCTACATCAACCCCTCCCGGGG CTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACAACCGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCTCCCTGACCTCCGAGGACTCCGCCGTGTACTGCGCCCGGTACTACGACGACCACTACTCCCTGGACTACTGGGGCCAGGGCACCACACTGACAGTGTCTAGCGCCTCCACCAAGGGCCTTCCGTGTTCCCTCTGGCCCTTCCTC CAAGTCCACCTCCGGCGGCACCGCCGCTCTGGGCTGCCTGGTGAAGGACTACTTCCCTGAGCCTGTGACCGTGAGCTGGAACTCTGGCGCCCTGACCAGCGGCGTGCACACCTTCCCTGCCGTGCTGCAGTCCTCCGGCCTGTACTCCCTGTCCTCCGTGTGTGACCGTGCCTTCCTCCTCCCTGGCACCCAGACCTACATCTGCAACGTGAACCACAAGCCTTCCAACACCA AGGTGGACAAGCGGGTGGAGCCTAAGTCCTGCTCCGGCCCTGGGGGCGGACGCAGCGGCGGAGGCGGATCCGGCGGAGGAGGCCTCTGAAGTGCAGCTGCAGCAGCGGCCCTGAGCTGGTGAAACCCGGCGCTAGCATGAAGATCAGCTGCAAGGCCAGCGGCTACAGCTTCACCGGCTACACCATGAACTGGTGAAACAGAGCCACGGCAAGTGCCTG GAATGGATCGGCCTGATCAACCCCTACAACGGCGGCACCATCTACAACCAGAAGTTCAAGGGCAAGGCCACACTGACCGTGGACAAGAGCAGCAGCACCGCCTACATGGAACTGCTGAGCCTGACCAGCGAGGACAGCGCCGTGTGTACTGCGCCAAGAGACTACGGCTTCGTGCTGGACTACTGGGCCAGGGCACCACCCTGACAAGTGTCTAGCGGAGGCGGAGGA TCTGGTGGTGGCGGATCTGGCGGCGTGGAAGTGGCGGAGTGGTAGCCAGATCGTGCTGACCCAGTCCCCCTCCATGTCCGTGTCTCCCGGCGAGAAAGTGACAATTACCTGCTCCGCCTCCTCCTCCGTGTCCTACATGCACTGGTTCCAGCAGAAGCCCGGCACCTCCCCCAAGCTGTGGATCTACTCCACCTCCAACCTGGCCCTCCGGCGTGCCCGCCAGAT TCTCCGGAAGAGGCTCCGGCACCAGCTACTCCCTGACCATCTCCAGAGTGGCCGCCGAGGACGCCGCCACCTACTACTGCCAGCAGCGGTCCAACTACCCCCCCTGGACCTTTGGCTGCGGCACCAAGCTGGAAATCAAGTGA #5727 Fdbstb_5727/5725 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCCCAGGTGCAGCTGCAGCAGTCTGGCGCTGAGCTGGCTAGACCTGGCCCTCCGTGAAGATGTCCTGCAAGACCTCCGGCTACACCTTCACCCGGTACACCATGCACTGGGTCAAGCAGAGGCCTGGACAGGGCCTGGAATGGATCGGCTACATCAACCCCTCCCGGGG CTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACAACCGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCTCCCTGACCTCCGAGGACTCCGCCGTGTACTGCGCCCGGTACTACGACGACCACTACTCCCTGGACTACTGGGGCCAGGGCACCACACTGACAGTGTCTAGCGCCTCCACCAAGGCCCTTCCGTGTTCCCTCTGGCCCTTGCTC CAAGTCCACCTCCGAAGGCACCGCCGCTCTGGGCTGCCTGGTGAAGGACTACTTCCCTGAGCCTGTGACCGTGAGCTGGAACTCTGGCGCCCTGACCAGCGGCGTGCACACCTTCCCTGCCGTGCTGCAGTCCTCCGGCCTGTACTCCCTGTCCTCCGTGTGTGACCGTGCCTTCCTCCAACTTCGGCACCCAGACCTACACCTGCAACGTGGACCACAAGCCTTCCAACACCAAG GTGGACAAGACCGTGGAGCCTAAGTCCGCCTCCGGCCCTGGGGGCGGACGCAGCGGCGGAGGCGGATCCGGCGGAGGAGGCCTCTGAAGTGCAGCTGCAGCAGAGCGGCCCTGAGCTGGTGAAACCCGGCGCCTAGCATGAAGATCAGCTGCAAGGCCAGCGGCTACAGCTTCACCGGCTACACCATGAACTGGTGAAACAGAGCCACGGCAAGTGCCTGGAAT GGATCGGCCTGATCAACCCCTACAACGGCGGCACCATCTACAACCAGAAGTTCAAGGGCAAGGCCACACTGACCGTGGACAAGAGCAGCAGCACCGCCTACATGGAACTGCTGAGCCTGACCAGCGAGGACAGCGCCGTGTACTGCGCCAGAGACTACGGCTTCGTGCTGGACTACTGGGGCCAGGGCACCACCCTGACAAGTGTCTAGCGGAGGCGGAGGATCTG GTGGTGGCGGATCTGGCGGCGGTGGAAGTGGCGGAGGTGGTAGCCAGATCGTGTGCTGACCAGTCCCCCTCCATCATGTCCGTGTCTCCCGGCGAGAAAGTGACAATTACCTGCTCCGCCTCCTCCTCCGTGTCCTACATGCACTGGTTCCAGCAGAAGCCCGGCACCTCCCCCAAGCTGTGGATCTACTCCACCTCCAACCTGGCCTCCGGCGTGCCCGCCAGATTCTC CGGAAGAGGCTCCGGCACCAGCTACTCCCTGACCATCTCCAGAGTGGCCGCCGAGGACGCCGCCACCTACTACTGCCAGCAGCGGTCCAACTACCCCCCCTGGACCTTTGGCTGCGGCACCAAGCTGGAAATCAAGTGA

Table 3. DNA sequences encoding CLDN6 x CD3-bi- (scFv) ₂

Internal plasmid name Corresponding
bi-(scFv) ₂ DNA coding sequence #123 bi-scFv "reference" ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCCACCGCCACCGGCGTGCACAGCGACATCAAGCTGCAGCAGAGCGGAGCCGAGCTGGCCAGACCTGGGGCAGCGTGAAGATGAGCTGCAAGACCAGCGGCTACACCTTCACCCGGTACACCATGCACTGGGTGAAACAGCGGCCTGGACAGGGCCTGGAATGGATCGGCTACATCAACCCCAGCCGGGG CTACACCAACTACACCAGAAGTTCAAGGACAAGGCCACCCTGACCACCGACAAGAGCAGCAGCACCGCCTACATGCAGCTGAGCAGCCCTGACCAGCGAGGACAGCGCCGTGTACTGCGCCCGGTACTACGACGACCACTACAGCCTGGACTACTGGGCCAGGGCACCACCCTGACAGTGTCTAGCGTGGAAGGAGGAAGCGGAGGATCTGGCGGCTCTGGGGGAAGCG GTGGCGTGGACGACATCCAGCTGACCCAAGCCCCGCCATCATGTCTGCCAGCCCTGGCGAGAAAGTGACCATGACCTGCCGGGCAGCAGCAGCGTGTCCTACATGAACTGGTATCAGCAGAAGTCCGGCACCAGCCCCAAGCGGTGGATCTACGACACCAGCAAGGTGGCAAGCGGCGTGCCCTACAGATTCAGCGGCAGCGGCTCCGGCACCTCCTACTCCCTGACCATCA GCAGCATGGAAGCCGAGGACGCCGCCACCTACTACTGCCAGCAGTGGTCCAGCAACCCCCTGACCTTCGGAGCCGGCACCAAGCTGGAACTGAAGTCTGGCGGGGAGGATCCGAGGTGCAGCTGCAGCAGTCCGGCCCTGAGCTGGTGAAACCCGGCGCCTAGCATGAAGATCTCTTGCAAGGCCTCCGGCTACAGCTTTACCGGCTACACAATGAATTGGGTGAAGCAGA GCCACGGCAAGAATCTGGAATGGATTGGCCTGATCAACCCTTACAACGGCGGCACAATCTATAATCAGAAGTTTAAAGGGAAGGCCACACTGACAGTGGACAAGTCCAGCTCCACAGCCTACATGGAACTGCTGAGCCTGACCTCCGAGGACTCTGCCGTGTATTACTGTGCCAGAGACTACGGCTTCGTGCTGGATTATTGGGGACAGGGAACAACACTGACCGTGTCCT CCGGGGGAGGGGGATCAGGTGGGGGAGGTAGTGGGGGTGGCGGCTCTGATATCGTGCTGACCCAGTCCCCTAGCATGAGCGTGTCCCAGGCGAAAAAGTGACAATCACTTGCAGCGCCAGCTCCTCCGTGTCTTATATGCATTGGTTCCAGCAGAAGCCTGGCACATCCCCCAAACTGTTAATCTACAGCACCTCCAACCTGGCTTCCGGCGTGCCCG CCAGATTTTCTGGCAGAGGCAGCGGCACCAGCTACAGCCTGACAATCAGCCGGGTGGCCGCCGAAGATGCCGCCACATATTATTGTCAGCAGCGGAGCAACTACCCCCCCTGGACATTCGGGGGAGGAACAAAGCTGGAAATCAAGCACCACCACCACCACCACTGA

b. Transient transfection and production

For transient production of CLDN6-specific bstb proteins, the ^Expi293TM expression system (Thermo Fisher Scientific, Darmstadt, Germany) - a derivative of the human embryonic kidney cell line HEK293 - was used according to the manufacturer's guidelines. For this, Expi293F ^TM cells were pre-cultured to a density of 2.0×10 ⁶ per ml of medium for the expression of Expi293 ^TM in suspension flasks for cell culture for two days. On the day of transfection, 2.5×10 ⁶ Expi293 ^TM cells per ml of fresh Expi293 ^TM expression medium were transferred into sterile glass Erlenmeyer flasks with a capacity of 5 times the volume. In the pCEP4 plasmids, the Fd and L fragments were mixed in a 1:1 ratio in Opti-MEM (Gibco/Thermo Fisher Scientific). Per ml of cell suspension, 1 μg of DNA mixture was pre-diluted in 50 μl of Opti-MEM and 2.7 μl of ExpiFectamine ^TM 293 reagent per ml of cell suspension in 50 μl of Opti-MEM in separate tubes and incubated for 5 minutes at room temperature. The pre-diluted DNA mixture was then added to the pre-diluted ExpiFectamine ^™ 293 reagent, mixed and incubated for 20 minutes at room temperature before being added to the cell suspension. The cell culture flask was agitated at 125 rpm in 8% CO ₂ , 37° C. in a humidified Multitron Cell shaker (Infors HT, Bottmingen, Switzerland) for 16-18 hours. Then, 3.9 µl of Enhancer 1 and 39 µl of Enhancer 2 were added per ml of cell suspension, and the cell culture flasks were further incubated. The protein-containing supernatant was collected seven days after transfection. Supernatants were filtered with 0.22 µm Nalgene Rapid Flow 90 mm filter blocks, low protein binding (Thermo Fisher Scientific). The secreted protein content was assessed by BLItz quantitation using protein L biosensors (Pall/ForteBio, Dreieich, Germany) according to the manufacturer's protocol. The supernatant was stored at 2–8°С until purification.

c. Purification of labeled proteins bstb_369/367 and bstb_371/367

Cell culture supernatant of transiently transfected ^Expi293TM cells containing the bstb_369/367 or bstb_371/367 protein (described in Example 1b) was subjected to immobilized metal affinity chromatography (IMAC) using standard procedures (Coligan et al. 2001b). Briefly, cell culture supernatant supplemented with 10 mM imidazole was loaded onto a 1 ml HisTrap HP column connected to an ÄKTA pure 25 FPLC system (both from GE Healthcare Life Sciences, Freiburg, Germany) and equilibrated with wash buffer (20 mM NaH ₂ PO _{4 ).} , 500 mM NaCl, 10 mM imidazole, pH 7.5). The sample was loaded at a rate of 1 ml/min. The elution buffer differed from the wash buffer in a concentration of 500 mM imidazole. After washing with ten column volumes (CV), the protein was eluted using a linear gradient of 0-100% elution buffer. The eluate was collected in 1 ml fractions at a rate of 1 ml/min. High molecular weight (HMW) and monomeric compounds (major peak) were collected (FIG. 2A). The eluted bstb protein was pooled and immediately dialyzed using a Slide-A-Lyzer G2 10K MWCO dialysis cassette (Pierce/Thermo Fisher Scientific, Rockford, IL, USA) against DPBS Strep- ^Tactin® binding buffer (Dulbecco's phosphate-buffered saline, Gibco /Thermo Fisher Scientific), containing 137 mm NaCl, 2.7 mm KCl, 10 mm Na ₂ HPO ₄ , 2 mm KH ₂ PO _4, pH 7.4. The dialyzed bstb protein from the main IMAC peak was further purified by Strep- ^Tactin® affinity chromatography (GE Healthcare Life Sciences). All subsequent Strep- ^Tactin® purification steps were performed at a flow rate of 1 ml/min.

The Strep- ^Tactin® column was equilibrated with binding buffer prior to addition of the bstb protein. Elution of the bstb protein was performed with a 0–100% linear gradient with 2.5 mM dethiobiotin (SigmaAldrich, Taufkirchen, Germany) containing binding buffer, after a washing step with five CVs of binding buffer (Fig. 2B). The eluted bstb protein in 1 ml fractions was pooled and sub-injected into a HiLoad 16/600 Superdex 200 pg size exclusion chromatography (SEC) column (GE Healthcare Life Sciences) followed by isocratic elution with one CV DPBS. Eluted HMW and monomeric bstb compounds were collected in 1 ml fractions (FIG. 2C) and pooled.

The Bstb concentration was determined by measuring at 280 nm on a NanoDrop 2000c taking into account the extinction coefficient and the theoretical molecular weight determined using the ProtParam tool (http://web.expasy.org/protparam/). The purified protein was divided into aliquots and stored at 2–8°C.

d. Purification of unlabeled proteins bstb_5726/5725 and bstb_5727/5725

Cell culture supernatant of transiently transfected Expi293 ^TM cells containing bstb_5726/5725 and bstb_5727/5725 protein (described in Example 1b) - both unlabeled - was filtered using Supracap ^TM 50 deep filtration capsules (Pall corporation, Crailsheim, Germany) and then run protein purification process. The purified bstb protein was analyzed by high performance liquid chromatography, short SE-HPLC (FIG. 2D).

SE-HPLC was performed using a Dionex Ultimate 3000 (Thermo Scientific) using a TSKgel G3000SWxl size-exclusion column (300 x 7.8 mm, Tosoh Bioscience, Griesheim, Germany). Injected up to 100 µl. The column was washed with SE-HPLC buffer (0.3 M Na ₂ HPO ₄ , pH 7.2) and bstb protein was isolated by isocratic elution.

Both bstb_5726/5725 and bstb_5727/5725 (data not shown) can be effectively purified by the designed process and the monomer content will increase to >93% after the purification process (FIG. 2D). To further enrich the monomer fraction to ~100%, the samples dialyzed against PBS were finally subjected to preparative SEC using a HiLoad 26/600 Superdex 200 pg column (GE Healthcare Life Sciences).

With this, the unmarked bstb cleanup strategy can be shown.

e. Analysis of labeled proteins bstb_369/367 and bstb_371/367

The quality and purity of labeled bstb proteins were checked by polyacrylamide gel electrophoresis using 4–15% Criterion™ TGX Stain-Free™ gel (Bio-Rad Laboratories, Dreieich, Germany), followed by a stain-free gel (Fig. 3A) and western blot analysis (FIG. 3B) according to standard procedures well known to those skilled in the art. The antibodies used for Western blot analysis were anti-6xHis tag® (HRP) (1:10,000, Abcam, Cambridge, MA, USA) and Strep MAB-Classic, HRP conjugate (1:10,000, IBA GmbH, Göttingen, Germany). Gel and western blot membranes were fixed using Bio-Rad's Chemidoc MP Imaging System. bstb protein signals were detected at 50–55 kDa under reducing conditions (DTT addition) and at ~100 kDa under non-reducing conditions compared to an internal molecular weight standard (Fig. 3). The heterodimeric composition of bstb becomes apparent under reducing conditions when separating the Fd- and L-fragment in a colorless gel.

The state of aggregation of the purified proteins was determined by analytical SE-HPLC as a function of time. SE-HPLC was performed using an Agilent 1260 Infinity system (Agilent Technologies, Waldbronn, Germany) using a TSKgel G3000SWXL (300 x 7.8 mm, Tosoh Bioscience) size exclusion column. Injected up to 100 µl. The column was washed with SE-HPLC buffer (0.3 M Na ₂ HPO ₄ , pH 7.2) and bstb protein was isolated by isocratic elution. As shown in Table 4, the purified bstb_369/367 protein was tested for more than six months by analytical SE-HPLC and showed high stability at 2-8°C in DPBS without any signs of aggregation or degradation.

Table 4. Stability of bstb_369/367 according to SE-HPLC

Storage time at
2–8°C in DPBS [days] WWII
[%] Monomer
[%] NMM
[%] 0 0.59 99.41 0 7 0.54 99.46 0 thirty 0.76 99.24 0 56 0.74 99.26 0 203 0.66 99.34 0

In this case, the high stability of the bstb molecule can be demonstrated. More recent purifications even yielded 100% monomeric bstb_369/367 protein.

Example 2 Determination of the specific lysis activity of bstb_369/367 and bstb_371/367 in in vitro cytotoxicity assays.

To determine the specific effects of lysis, we used the in vitro luciferase cytotoxicity assay. Human ovarian cancer cell lines OV-90 (ATCC CRL-11732), stably expressing luciferase and endogenously expressing CLDN6, and teratocarcinoma cell line PA-1 (ATCC CRL-1572) were used as target cell lines. The CLDN6-negative human breast cancer cell line MDA-MB-231 (ATCC HTB-26), also stably expressing luciferase, served as a specificity control (non-target).

Human peripheral blood mononuclear cells (PBMC) isolated from the blood of healthy donors (University Medical Center JGU Mainz, Blood Transfusion Centre, Mainz, Germany) were selected as effector cells according to standard procedures (Coligan et al. 2001a).

A. Definition of _EC50

To determine the half maximum effective concentration (EC50) of high monomeric bstb_369/367, a protein titration series was tested in an in vitro luciferase cytotoxicity assay.

In the example described, effector (E) and target (T) cells were mixed in an E:T ratio of 5:1 and plated in white 96-well cell culture plates (Nunclon® Delta Surface, Thermo Scientific, Braunschweig, Germany) with a finite number of cells. per well 1×10 ⁴ target cells and 5×10 ⁴ effector cells. Cells were incubated with a 10-point, 10-fold series of serial dilutions of bstb_369/367 or bstb_371/367 protein in the concentration range from 4.85 to 48.50 nM. Wells serving as L _min and L _max values (see below) were supplemented with DPBS instead of bstb protein.

Microplates for cell cultures were incubated for 48 h at 37°C, 5% CO ₂ . For analysis, 50 µl of an aqueous solution containing 1 mg/ml luciferin (BD Monolight, BD Biosciences, Heidelberg, Germany) and 50 mM HEPES was added to each well and the plates were then incubated for 30 min in the dark at 37°C. The luminescence resulting from the oxidation of luciferin by viable cells expressing luciferase was measured using an Infinite M200 Tecan microplate reader (Tecan, Mennedorf, Switzerland). The percentage of specific lysis of target cells was calculated using the following formula:

% specific lysis = [1 - (luminescence _{test sample} - L _max )/(L _min - L _max )] x 100, where "L" denotes lysis. L _min refers to luminescence at minimal lysis in the absence of bstb, and L _max refers to luminescence at maximum lysis (equal to the amount of spontaneous luminescence) in the absence of bstb, achieved by adding Triton X-100 (2% final concentration).

The EC50 value was calculated using a sigmoidal dose-response algorithm (logarithm (agonist) vs. response (three parameters)) integrated into PRISM 6 software (GraphPad Software, San Diego, CA, USA).

The determined EC50 value for bstb_369/367 was 39.71 pM, and three times lower than the EC50 value for bstb_371/367 with 117.00 pM (Fig. 4A) for CLDN6 positive OV-90 cells. No lysis was observed with the CLDN6 negative control cell line MDA-MB-231. The outcome of this assay is highly dependent on human PBMC activity, which varies with the immune status of the donor, as has also been reported by others (see, for example, Lutterbuese et al. 2010). Thus, using eight different PBMC donors, we determined the range of EC50 values for the bstb_369/367 protein, which is from 0.98 to 39.71 pM (data not shown).

b. Comparison of bstb_369/367 and CLDN6 x CD3 bi- (scFv) ₂

Bivalent CLDN6-binding bstb_369/367 was compared with highly monomeric (99.5%) CDLN6 x CD3 bi-(scFv) ₂ homemade _, (BioNTech AG, Stadler et al. 2015) in order to investigate the beneficial avidity effects of the bivalent anticancer agent , which directly affects the efficiency of lysis.

For this purpose, bstb and bi-(scFv) ₂ were used at equimolar concentrations, and lysis effects were tested on PA-1, OV-90 and MDA-MB-231 in a cytotoxicity assay (FIG. 4B) essentially as described in Example 2a. PA-1 cells were co-incubated for only 24 hours because this cell line is more susceptible to effector cell killing than OV-90. Proteins were diluted in 9-point, 5-fold (PA-1) or 8-point, 10-fold (OV-90, MDA-MB-231) serial dilution series. Strikingly, bstb_369/367 mediated 58% kill of PA-1 cells with only 0.24 pM, the lowest concentration used for PA-1, while the bi-(scFv) ₂ reference showed a lysis curve starting at 0% kill . In the case of OV-90, the higher potency of bstb_369/367 compared to bi-(scFv) ₂ becomes apparent with a 55-fold lower EC50 of bstb. Both molecules do not affect the effects of target lysis.

Therefore, the bivalent binding of CLDN6 to the bstb molecule greatly increases the killing potential of target cells compared to the monovalent CLDN6 binding molecule bi-(scFv) ₂ .

c. Study of the influence of macromolecular compounds bstb_369/367 on lysis activity.

HMW compounds, such as dimers or multimers, may exhibit different activity compared to monomeric compounds due to their multivalence to the respective antigens. Even though the molecules have been shown to be stable in their monomeric state, the effect of HMW compounds on activity has been tested for future safety aspects.

For this, HMW compounds were collected during the purification procedure, enriched with SEC and added to the monomeric preparation up to a certain amount of 5%. Subsequently, 99.3% monomer and 94.3% monomer supplemented with 5% HMB were compared in a cytotoxicity assay as described in Example 2a, but at 15-point 20-fold serial dilutions. PA-1 and OV-90 served as target cells. Co-incubation with bstb_369/367 was performed for 16 hours with the rather sensitive PA-1 cell line and for 48 hours with the more resistant OV-90 cell line. EC50 values were calculated using a sigmoidal dose-response algorithm (logarithm (agonist) versus response - variable slope (four parameters)) integrated into PRISM 6 software (GraphPad Software) as shown in FIG. 4C. The calculated EC50 for the 5% HMW sample bstb_369/367 was 1.5 times higher for PA-1 and 2.3 times lower for OV-90. Therefore, a slight decrease in activity was observed with PA-1 and a slight increase in activity with OV-90. In general, the effect of 5% HMB compounds on activity is low and may depend on the target cell line and/or incubation time. With respect to the stability of the bstb protein and the low impact of a rather high percentage of HMB compounds, the bstb molecule is suitable for therapeutic product development.

d. Comparison of bstb_369/367 with unlabeled variants of bstb_5726/5725 and bstb_5727/5725

Unlabeled bstb variants were evaluated in a cytotoxicity assay and compared with bstb_369/367. In addition, the effect of HMW compounds on activity was tested. The assay scheme was the same as described in Example 2c, but the test elements were applied in 10-point 5-fold serial dilutions only on OV-90 as CLDN6 ⁺ target cells.

Bstb_369/367 and its unlabeled counterpart bstb_5726/5725 (99.9% monomeric) showed equal lysis efficiency with an EC ₅₀ value of ~9.3 pM. (FIG. 4D, left graph). 5% WW resulted in a 1.4-fold reduction in EC50. The EC50 C _H 1 (IgG2)-bearing variant bstb_5727/5725 (100% monomer) was ~1.6-fold higher than the reference bstb_369/367, confirming the slightly lower activity of this variant, which was also shown for the unlabeled variant in Example 2a. In the case of bstb_5727/5725, 5% HMW had little effect on efficiency (FIG. 4D, right graph). The EC ₅₀ with HMW addition was only 1.1 times lower than with the monomer in this exemplary study.

In conclusion, it should be noted that labeled and unlabeled C _H 1 (IgG1)-containing bstb are identical in their functionality and exhibit slightly higher activity compared to C _H 1 (IgG2)-containing bstb. The effect of HMW compounds is low for both options.

Example 3 T cell modulation mediated by bstb_369/367 and bstb_371/367

T cell modulation, namely T cell activation and proliferation, mediated by bstb_369/367 and bstb_371/367 was investigated in a similar scheme as described in Example 2 with the same target cell lines. Briefly, CLDN6 ⁺ OV-90 and PA-1 target cells and CLDN6 ^- control MDA-MB-231 cells were seeded with human PBMC in 0.5 ml of complete medium in 24-well plates at a ratio of E:T 5:1. To further confirm the target dependence, PBMCs without target cells were co-incubated with bstb proteins. Proteins Bstb bstb_369/367 and bstb_371/367 were added in the concentration range of 0.005–5000 ng/ml in a 4-point 100-fold series of serial dilutions. As a positive control, 100 ng/ml of human anti-CD3 IgG2a clone OKT3 (BioXCell, West Lebanon, New Hampshire, USA), target-independent mouse IgG, activating T cells was used. As a negative control, we added DPBS, bstb buffer.

A. T cell activation

Effector and target cells were co-incubated with bstb for 48 hours. PBMCs were harvested, transferred to round bottom 96 wells (Fisher Scientific, Schwerte, Germany), centrifuged and washed. Cells were stained with fluorescently labeled antibodies against human protein, anti-CD5-PE-Cy7 (Abcam), CD69-APC, CD25-PE (BD Biosciences) and living/non-living cell dye eFluor506 (eBioscience, Frankfurt am Main, Germany ). Samples were measured using BD FACSCantoII and registered 10,000 CD5 ⁺ viable singlet lymphocytes. Data were analyzed using FlowJo V10 software (Tree Star, San Carlos, CA, USA) and Microsoft Excel 2010 (Microsoft Deutschland GmbH, Unterschleissheim, Germany). The background signals of the negative control samples were subtracted.

As shown in FIG. 5A, both bstb mediate strong CLDN6-dependent T cell activation. After 48 h, the cells were in the intermediate stage of activation, which was determined by a high percentage of double positivity for the early activation marker CD69 and the late activation marker CD25 and the absence of CD25-only positive T cells. Moreover, the data show that the lower the concentration of bstb, the earlier the activation state occurred. Only at the high concentration of 5000 ng/mL did bstb proteins result in measurable target-independent T cell activation that was below 5.5%. Bstb_369/367 shows a slight but slightly higher activity than bstb_371/367 in mediating target-dependent T cell activation (see also Table 5).

Table 5. T cell activation bstb_369/367 and bstb_371/367

Cellular
line PA-1-SC12 OV-90-SC12 MDA-MB-231 without cells-
targets Expression
CLDN6 + + - - Tested
element Bstb 369/367 Bstb 371/367 Bstb 369/367 Bstb 371/367 Bstb 369/367 Bstb 371/367 Bstb 369/367 Bstb 371/367 Conc. [ng/ml] 0.5 5000 0.5 5000 0.5 5000 0.5 5000 0.5 5000 0.5 5000 0.5 5000 0.5 5000 General
activation [%] 67.1 70.6 60.4 70.9 17.4 83.1 2.8 80.1 0.0 4.2 0.5 3.8 1.4 4.4 0.6 5.4 CD69 ⁺ /CD25 [%] 33.6 25.0 43.6 27.2 16.2 15.7 2.8 18.8 0.0 3.6 0.4 3.5 1.1 3.4 0.6 3.9 CD69 ⁺ /CD25 ⁺ [%] 33.5 45.6 16.9 43.7 1.2 67.4 0.0 61.2 0.0 0.3 0.0 0.3 0.2 0.2 0.0 0.2 CD697CD25* [%] 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.2 0.3 0.1 0.0 0.0 0.8 0.0 1.3

b. T cell proliferation

PBMCs were labeled with the CellTrace™ CFSE Cell Proliferation Kit (Thermo Fisher Scientific, Darmstadt, Germany) according to the manufacturer's protocol prior to assaying. Effector and target cells were co-incubated with bstb for 72 hours. PBMC were collected as described above in example 3a. Cells were stained with anti-CD5-APC antibodies labeled with human fluorescent antibodies (BD Biosciences) and live/dead cell dye eFluor506 (eBioscience). Samples were measured using BD FACSCantoII and registered 10,000 CD5 ⁺ viable singlet lymphocytes. The data was analyzed using FlowJo V10 software from Tree Star and Microsoft Excel 2010.

As shown in FIG. 5B, both bstbs mediate strong CLDN6-dependent T cell proliferation, as determined by the fading of CFSE positivity indicative of cell division. A clear difference in the efficiency of the two bstb molecules in terms of stronger proliferation was not determined in the presence of PA-1. As also seen for T cell activation in the presence of OV-90, bstb_369/367 mediate stronger effects than bstb_371/367. No non-specific or target-independent T cell proliferation was detected.

Thus, both bstb molecules provide strong modulation of T cells in strict target dependence.

Example 4 Binding bstb_369/367 and bstb_5726/5725 to CLDN6

The relative binding affinity of the bi-(scFv) ₂ reference protein, bstb_369/367, and its unlabeled analogue bstb_5726/5725 was determined by flow cytometry analysis. PA-1 cells endogenously expressing CLDN6 were harvested with 0.05% trypsin/EDTA, washed with PBS and resuspended in FACS buffer (PBS containing 2% FCS and 0.1% sodium azide) at a concentration of 2×10 ⁶ cells/ml . 100 µl of the cell suspension was incubated with concentration series of various relevant antibodies diluted in FACS buffer (11-point 2-fold dilution series 9.77–10,000 ng/ml) and incubated for 45 min at 4°C. Cells were then washed three times with FACS buffer and incubated for 45 min at 4°C with protein L (Pierce/Thermo Scientific) conjugated to Squarix FITC (Squarix Biotechnology, Marl, Germany) at a concentration of 4 µg/mL. The cells were then washed twice and resuspended in 100 μl of FACS buffer. Binding was analyzed by flow cytometry using BD FACSArray (BD Biosciences). The EC50 value for half-maximal binding was determined using GraphPad Prism 6 One Site - Specific Binding.

The bi-(scFv) _{2 protein,} which has a monovalent CLDN6 binding site, exhibited a low relative binding affinity (EC50: ˜8.3 μg/mL corresponding to ˜150 nM). In comparison, bstb_369/367 and bstb_5726/5725 showed half maximum binding at a concentration of ~1.9 µg/mL corresponding to ~19 nM, thus the relative binding affinity was about 8 times higher compared to the bi-(scFv) reference protein. ) ₂ (Fig. 6A). This indicates that binding to the target CLDN6 can be significantly improved by using divalent binding sites, thus increasing binding affinity by realizing avidity effects. It should be noted that the labeled and unlabeled bstb binding curves are congruent.

We also analyzed the effect of HMW compounds on the binding properties of bstb_5726/5725 monomers in flow cytometry using L-FITC protein at 4 µg/mL or PE-conjugated mouse anti-human IgG (Fab region) (antikoerper-online, Aachen, Germany ) at a concentration of 6 µg/ml as secondary detection reagents. EC ₅₀ at half maximum binding did not differ between 100% monomer, 97% monomer/3% HMW, and 95% monomer/5% HMW (ranged from 28 nM to 31-34 nM depending on secondary detection reagent). In FIG. 6B shows only detection by L-FITC protein. These data are consistent with data from cytotoxicity assays (see Example 2c) which clearly demonstrate that 5% HMB does not have a corresponding effect on the activity of the bstb_369/367 molecule, thus favoring this format for product development.

Example 5 Efficacy in a Mouse Xenograft Model

To study the therapeutic potential of the bstb_369/367 protein in vivo, an immunodeficient mouse line NOD.Cg-Prkd ^scid IL2rg ^tm1Wjl /SzJ or short NSG (Jackson laboratory, Bar Harbor, Maine, USA) was chosen. All mice were used in accordance with the recommendations of the Committee on the maintenance of laboratory animals of the University. Johannes Gutenberg, Mainz, Germany.

A. Treatment of progressive CLDN6-expressing tumors in mice with bstb_369/367 protein

The exemplary study used male and female NSG mice aged eight weeks and weighing 21-36 g. CLDN6 positive OV-90 cells served as tumor cells and PBMC as effector cells.

5×10 ⁶ tumor cells were inoculated subcutaneously (subcutaneously) and 1×10 ⁷ PBMC were injected intraperitoneally (intraperitoneally) eight days thereafter. Only mice inoculated with PBMC inoculated - which was analyzed in peripheral blood five days after PBMC injection - were divided into groups by tumor volume and sex (both sexes in all groups). Treatment was started at an average tumor volume of ~30 mm ³ per group. Mice were treated three times a week (Monday to Wednesday) with vehicle (DPBS), 31 μg/kg bstb (low dose) or 308 μg/kg bstb (high dose) by intraperitoneal injection. The "G1 - Vehicle" group included four mice (n = 4), "G2 - bstb_369/367 (low dose)", eight mice (n = 8) and "G3 - bstb_369/367 (high dose)", nine mice ( n = 9). The treatment groups are shown in Table 6. The administration was carried out intraperitoneally for five (G1), six (G2) or four (G3) consecutive weeks, depending on the indication of tumor volume (Fig. 7A). Twice a week, tumor dimensions were measured with a digital calibrated caliper and tumor volume was calculated by the formula: tumor volume [mm ³ ] = length [mm] × (width [mm]) 2/2. Mice were sacrificed by cervical dislocation when tumor volume reached 1500 mm ³ or in case of severe morbidity (mainly graft-versus-host (GVHD) symptoms).

In FIG. 7B shows tumor growth inhibition in all mice from the bstb, G2 and G3 treated groups. Antitumor efficacy was measured as tumor growth inhibition/elimination and survival compared to G1 vehicle control. Treatment with test element bstb_369/367 resulted in tumor resection in both dosing groups, in contrast to the control group. All nine mice in the higher bstb_369/367 (G3) dose group were tumor free after seven injections. All eight mice in the lower bstb_369/367 (G2) dose group were tumor free after 15 injections. In mice without tumors, tumor recurrence was observed before the onset of GVHD symptoms. There were no cases of tumor recurrence during this period of time.

For the Kaplan-Meier survival plot (FIG. 7C), day 0 was considered to start treatment. Survival was significantly prolonged for both bstb_369/367 treated groups compared to the G1 control group, as determined by the Kaplan-Meier survival statistic combined with the logarithmic Cox-Mantel rank test for pairwise comparison. Comparison of G2 with G1 resulted in p-value p<0.0001 and comparison of G3 with G1 resulted in p=0.0043. Median survival was 31 days in the G1 control group versus 52 and 42 days in the G2 and G3 treatment groups, respectively. Thus, bstb_369/367 has demonstrated high efficacy in terms of tumor elimination and, in addition, is beneficial in terms of survival in this GVHD-limited mouse model.

Table 6. Treatment groups

Treatment
group (G) Number of mice
n tumor cells effector cells bstb
Protein Dose of Bstb protein
[µg/kg] G1 4 OV-90 RVMS - 0 G2 8 OV-90 RVMS 369/367 31 G3 9 OV-90 RVMS 369/367 308

b. Determination of the effect of therapy on body weight

The body weight of each mouse was examined twice a week using a laboratory balance. No mice, no group showed significant weight loss during treatment (data not shown).

c. Isolation of splenocytes

After euthanasia, mice were dissected spleens to detect engraftment of human cells by flow cytometry. Splenocyte isolation was performed immediately after opening the spleen by rubbing the spleen through a 70 µm cell sieve placed in a 50 ml reaction tube with a sterile 3–5 ml syringe plunger and rewashing the RT DPBS cell sieve. The isolated splenocytes were centrifuged, the DPBS was decanted and the splenocyte pellets were resuspended in 1 ml heat-inactivated fetal bovine serum supplemented with 10% DMSO. Samples were immediately frozen at -65 to -85° C. and stored until splenocyte samples from all mice were ready.

d. Engraftment assay of human T-lymphocytes in mouse spleen

A complete set of splenocyte samples were thawed at one time, all cells were washed twice with warm DPBS, and 1 x 10 ⁶ splenocytes per sample were incubated with fluorescent dye-conjugated antibodies (BD Biosciences) for 20 minutes at 4°C in the dark to detect human engraftment. cells by anti-hCD45-APC staining and the percentage of human T cells by anti-hCD3-FITC staining. Flow cytometric analysis was performed using FACSCanto II (BD Biosciences). Engraftment of human T cells can be confirmed by a percentage of 50–95% hCD45/hCD3 double positive singlet splenocytes (data not shown).

Example 6 Evaluation of Pharmacokinetic Behavior in Immunodeficient Mice

To determine the approximate half-life and clearance of the bstb_369/367 protein in mice, we used female NSG mice aged 9–49 weeks. 5 mg/kg of high monomeric (100%) bstb_369/367 in DPBS was administered intraperitoneally per mouse. The group sizes were three mice, each of which corresponded to one point in time of blood sampling. As a base value (“time after injection” = 0 h), one group was administered only the carrier buffer (DPBS). Further time points for blood sampling were set to 15 minutes, 1 hour, 2 hours, 3 hours, 6 hours and 8 hours. Blood was collected directly into Li-Heparin tubes (Microvette 300 LH, Sarstedt, Nümbrecht, Germany) and plasma was separated by centrifugation as known to those skilled in the art. Plasma was collected, immediately frozen in liquid nitrogen and stored at -65 to -85°C until use.

ELISA was performed to quantify bstb_369/367 in plasma. To do this, an aliquot of plasma from each group was thawed at room temperature and diluted in PBS/0.2% BSA. Diluted bstb_369/367-containing plasma and bstb_369/367 protein as standard range (0.39 ng/mL to 3.41 μg/mL) were added to MaxiSorp™ plates (Thermo Scientific) coated with goat anti-IgG F(ab ') ₂ people (Abd Serotec, Oxford, UK) and blocked with 3% milk. After a washing step, mouse IgG specific for the anti-CLDN6 binding site bstb_369/367 (Ganymed Pharmaceuticals AG) at a concentration of 3.5 μg/ml was incubated, followed by a washing step and incubation with goat anti-mouse IgG (Fc) conjugated with alkaline phosphatase (Dianova, Hamburg, Germany) at a dilution of 1:500. Finally, 4-nitrophenyl phosphate disodium salt 6-hydrate, short PNPP (PanReac AppliChem, Darmstadt, Germany) was added as an alkaline phosphatase substrate and the reaction was quenched with 3 M potassium hydroxide after 30 min. ELISA was measured with an M200 Pro microplate reader (Tecan) at 405/492 nm. Based on the bstb_369/367 standard curve, the measured absorbance values were converted to concentration values.

As shown in FIG. 8, the maximum plasma concentration of bstb_369/367 of 34 μg/ml was reached 1 hour after intraperitoneal injection. At the end point of the assay, 8 hours after the intraperitoneal injection, the bstb_369/367 protein was still detectable in serum (8 ng/ml).

In view of the binding to the target tumor and T cells in patients, which provides a long circulation, injection cycles of bstb molecules from one to two times a week are possible.

Example 7 In vivo dose finding study bstb_5726/5725 unlabeled

The xenograft model was set up as described in Example 5 according to the graph illustrated in FIG. 9A. Briefly, 44 NSG males and females aged 10–36 weeks were implanted with OV-90 (sc) and human PBMCs (ip). Mice were randomized into seven groups with six treatment groups of six mice and one PBS control group of eight mice. To determine the optimal dose of bstb_5726/5725, concentrations above and below the effective doses of bstb_369/367 used in example 5 (~300 and 30 µg/kg) were chosen, exactly 1000 µg/kg, 300 µg/kg, 100 µg/kg, 30 mcg/kg, 10 mcg/kg and 3 mcg/kg. On the day of treatment, the mean tumor volume in the randomized groups was ~150 mm ³ . The treatment was applied intraperitoneally three times a week, starting on day 28 after tumor cell inoculation. A total of 11 injections per group were made. Tumors were measured twice a week with a digital caliper.

As shown in FIG. 9B, the rate of tumor shrinkage correlates with dose. It seems that the volume of the tumor ~400 mm ³ at the beginning of treatment has a critical size, which is eliminated only at doses bstb>30 μg/kg. Interestingly, even 3 μg/kg resulted in a decrease in tumor growth and size over time, suggesting an accumulation of the effect of bstb in the tumor mass.

In this case, 100 µg/kg was found to be a highly effective and safe dose. In the maximum dose group of 1000mcg/kg, we observed adverse effects such as yellow discoloration of the skin and weight loss.

Example 8 Preparation, Purification and Analysis of Bispecific Antibody Derivatives Targeting CLDN18.2 and CD3.

A. Sequence origin, design of bstb constructs, and cloning into expression vectors

Bispecific TriMAB chimeric constructs (bstb) were designed as antigen binding fragments (Fab) provided with two single chain variable fragments (scFv) at the C-terminus of the constant regions. The Fab-binding domain is specific to the CD3 component of the human T-cell receptor. The heavy chain variable region (V _H ) of anti-CD3 and the corresponding light chain variable region domains (V _L ) were derived from IgG TR66 (Lanzavecchia und Scheidegger 1987). The cysteine at position 114 has been replaced by a serine. The heavy chain constant region (C _H 1 ) and the light chain constant region (C _L ) are of human origin. We chose a constant light kappa region for our designs. The two ScFv-binding fragments are specific for the human tumour-associated antigen (TAA), CLDN18.2. The respective V _H and V _L regions are derived from chimeric IgG1 IMAB362 (Ganymed Pharmaceuticals AG, Mainz, Germany) (eg Woll et al. 2014) which is currently in clinical trials such as NCT01630083 and NCT01671774. The orientation of the V _H and V _L regions and the choice of linkers in the scFv fragments correlate with the bi-(scFv) ₂ molecules 5506 and 5538 described in patent application PCT/EP2013/003399. In FIG. 18 shows the amino acid sequences of the V _H and V _L domains that were used in the course of the invention.

The four bstb molecules produced in the first generation differed in their C _H 1 region and part of the scFv IMAB362. Bstb_5730/5728 and bstb_5731/5729 contain a C _H 1 region derived from human IgG1, bstb_5732/5728 and bstb_5733/5729 a C _H 1 region derived from human IgG2. In addition, bstb_5730/5728 and bstb_5732/5728 carry the IMAB362 scFv fragment in the V _H -V _L orientation, while bstb_5731/5729 and bstb_5733/5728 carry the IMAB362 scFv fragment in the V _L -V _H orientation. protein level to obtain bstb molecules:

Bstb_5730/5728:

N - V _H ^αCD3 –C _H 1(IgG1)–V _H ^αCLDN18.2 –V _L ^αCLDN18.2 –6xHis-tag - C (Fd bstb_5730/5728) N - V _L ^αCD3 –C _L –V _H ^αCLDN18.2 –V _L ^αCLDN18.2 –Strep-tag - C (Lbstb_5730/5728)

Bstb_5732/5728:

N - V _H ^αCD3 –C _H 1(IgG2)–V _H ^αCLDN18.2 –V _L ^αCLDN18.2 –6xHis-tag - C (Fd bstb_5732/5728) N - V _L ^αCD3 –C _L –V _H ^αCLDN18.2 –V _L ^αCLDN18.2 –Strep-tag - C (Lbstb_5732/5728)

Bstb_5731/5729:

N - V _H ^αCD3 –C _H 1(IgG1)–V _L ^αCLDN18.2 –V _H ^αCLDN18.2 –6xHis-tag - C (Fd bstb_5731/5729) N - V _L ^αCD3 –C _L –V _L ^αCLDN18.2 –V _H ^αCLDN18.2 –Strep-tag - C (Lbstb_5731/5729)

Bstb_5733/5729:

N - V _H ^αCD3 –C _H 1(IgG2)–V _L ^αCLDN18.2 –V _H ^αCLDN18.2 –6xHis-tag - C (Fd bstb_5733/5729) N - V _L ^αCD3 –C _L –V _L ^αCLDN18.2 –V _H ^αCLDN18.2 –Strep-tag - C (Lbstb_5733/5729)

C = C-terminus, _CH = heavy chain constant region, C _L = light chain constant region, Fd = hydrolyzable fragment (Fab heavy chain part), L = Fab light chain part, N = N-terminus, V _H = variable heavy chain domain, V _L = light chain variable domain.

Table 7 summarizes information about the bstb constructs specific for TAA CLDN18.2 that were generated during the course of the invention. Information is provided on specificity, sequence origin from monoclonal antibodies (mAB), codon usage, and additional sequence characteristics. The sequences encoding the variable domains of the target cell binding fragments were originally obtained from Ganymed Pharmaceuticals AG.

DNA cloning and construction of the pCEP4 expression vector was performed using GeneArt (GeneArt/Thermo Fisher Scientific). The human IgG secretion signal sequence encoding MGWSCIILFLVATATGVHS was introduced 5' upstream of the Fd- and L-bstb V region sequences to secrete the protein into the culture medium. The sequence encoding the flexible amino acid glycine-serine (GS) peptide of 20 amino acids (AK) ((GGGGS) ₄ ) was inserted to attach the V _H and V _L domains for the anti-TAA scFv composition in the V _H -V _L orientation, in while a flexible 25-AA peptide linker (GGGGS) ₅ was inserted for the anti-TAA scFv formulation in the V _L -V _H orientation. One scFv domain sequence was fused to the Fd portion (C-terminus of C _H 1) using a sequence encoding an 18-AA linker (SGPGGGRS(GGGGS) ₂ ), and the other scFv was fused to the L-part (C-terminus of C _L ) using a sequence encoding a six-AA linker (DVPGGS). Different linker lengths made it possible to distinguish the Fd and L parts by size. A 6xHis tag sequence was added to the 3' end of the Fd-scFv fragment and a Strep tag to the 3' end of the L-scFv fragment to facilitate purification of pure first generation heterodimeric bstb. Table 8 lists the complete DNA sequences encoding the bstb protein. Table 9 lists the DNA sequences encoding the parent bi-(scFv) ₂ and reference bi-(scFv) ₂ proteins used for in vitro studies.

The C-terminal 6xHis tag and Strep tag served for protein affinity purification and detection analysis. All constructs were validated by an external sequencing service. The design diagrams are illustrated in Fig. 10A. Second-generation bstb were constructed without tags, and disulfide bridges were introduced into the scFv fragments.

Table 7. Summary of characteristics of CLDN18.2 x CD3-bstb antibodies

internal name Specificity Origin of scFv
region V _H -V _L CLDN18.2-scFv orientation V _H /V _L Reference CDLN18.2-scFv
bi-(scFv) ₂ Origin of the Fab V _H -V _L region Use of codons _CH 1 Label ds-bridge-tick in scFv fragment Bstb_5730/5728 (SEQ ID NO: 30/32) HS IMAB362 V _H -V _L 5506
(SEQ ID NO: 76) TR66(C114S) CG IgG1 His/Strp - Bstb_5732/5728
(SEQ ID NO: 31/32) HS IMAB362 V _H -V _L 5506
(SEQ ID NO: 76) TR66(C114S) CG IgG2 His/Strp - Bstb_5731/5729
(SEQ ID NO: 33/35) HS IMAB362 _VL - _VH 5538
(SEQ ID NO: 77) TR66(C114S) CG IgG1 His/Strp - Bstb_5733/5729
(SEQ ID NO: 34/35) HS IMAB362 _VL - _VH 5538
(SEQ ID NO: 77) TR66(C114S) CG IgG2 His/Strp - Bstb_5745/5747
(SEQ ID NO: 36/37) HS IMAB362 V _H -V _L 5506
(SEQ ID NO: 76) TR66(C114S) CG IgG1 - - Bstb_5746/5748
(SEQ ID NO: 38/39) HS IMAB362 _VL - _VH 5538
(SEQ ID NO: 77) TR66(C114S) CG IgG1 - - Bstb_5749/5751
(SEQ ID NO: 40/41) HS IMAB362 V _H -V _L 5506
(SEQ ID NO: 76) TR66(C114S) CG IgG1 - + Bstb_5750/5752
(SEQ ID NO: 42/43) HS IMAB362 _VL - _VH 5538
(SEQ ID NO: 77) TR66(C114S) CG IgG1 - +

_CH 1 denotes constant heavy region 1; CG, Cricetulus griseus; ds, disulfide; IMAB, ideal monoclonal antibody; His, 6xHis-label; HS, Homo sapiens; IgG, immunoglobulin G; Strp, Strep label.

Table 8. DNA sequences encoding CLDN18.2 x CD3-bstb

Internal name of the plasmid Relevant bstb snippet DNA coding sequence #5728 Lbstb_5730/5728,
Lbstb_5732/5728 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCTCAGATCGTGCTGACCCAGTCTCCCGCCATCATGTCTGCTAGCCCTGGCGAAAAGTGACAATGACCTGCCGGGCCTCCTCCTCCGTGTCCTACATGAACTGGTATCAGCAGAAGTCCGGCACCTCCCCCAAGCGGTGGATCTACGACACCTCCAAGGTGGCCTCTGGCGTG CCCTACAGATTCTCCGGCTCTGGCTCTGGCACCTCCTACAGCCTGACCATCTCCAGCATGGAAGCCGAGGATGCCGCCACCTACTACTGCCAGCAGTGGTCCTCCAACCCCCTGACCTTTGGCTGGCACCAAGCTGGAACTGAAGCGGACCGTGGCCGCTCCTTCCGTGTTCATCTTCCCTCCCTCCGACGAGCAGCTGAAGTCCGGCACCGCCTCCGTGGTGTGCCTGCTGAACAACTTC TACCCTCGGGAGGCCAAGGTGCAGTGGAAGGTGGACAACGCCCTGCAGTCCGGCAACTCCCAGGAAAAGCGTCACCGAGCAGGACTCCAAGGACAGCACCTACTCCCTGTCCTCCACCCTGACCCTGTCCAAGGCCGACTACGAGAAGCACAAGGTGTACGCCTGCGAGGTGACCCCACCAGGGCCTGTCCAGCCCTGTGACCAAGTCCTTCAACCGGGGCGAGTGTGAC GTGCCTGGTGGTAGCCAGGTGCAGCTGCAGCAGCCTGGCGCTGAACTGGTCCGACCTGGCGCCCGTGTGAAGCTGTCCTGCAAGGCCTCCGGCTACACCTTCACCAGCTACTGGATCAACTGGGTCAAGCAGCGGCCTGGCCAGGGCCTGGAATGGATCGGCAACATCTACCCCTCCGACTCCTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGA CCGTGGACAAGTCCTCCTCACCGCCTACATGCAGCTGTCCAGCCCCACCTCCGAGGACTCCGCCGTGTACTGCACCCGGTCCTGGCGGGGCAACTCCTTCGACTATTGGGGCCAGGGCACCACCCTGACAGTGTCCTCTGGAGGCGGAGGATCTGGTGGTGGCGGATCTGGCGGCGGTGGAAGTGGCGGAGTGGTAGCGACATCGTGATGACCCAG TCCCCCTCCAGCCTGACCGTGACCGCTGGCGAGAAAGTGACCATGAGCTGCAAGTCCTCCAGTCCCTGCTGAACTCCGGCAACCAGAAGAACTACCTGACCTGGTATCAGCAGAAGCCCGGCCAGCCCCCCAAGCTGCTGATCTACTGGGCCTCCACCCGCGAGTCTGGCGTGCCCGATAGATTCACCGGCTCCGGCAGCGGCACCGACTTTACCCTGACCATCTCCAGCGTGCAGGCCG AGGACCTGGCCGTGTATTACTGTCAGAACGACTACTCCTACCCCTTCACCTTCGGCTCTGGCACCAAGCTGGAAATCAAGTCTGCCTGGAGCCACCCACAGTTCGAGAAGTGA #5729 Lbstb_5731/5729,
Lbstb_5733/5729 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCTCAGATCGTGCTGACCCAGTCTCCCGCCATCATGTCTGCTAGCCCTGGCGAAAAGTGACAATGACCTGCCGGGCCTCCTCCTCCGTGTCCTACATGAACTGGTATCAGCAGAAGTCCGGCACCTCCCCCAAGCGGTGGATCTACGACACCTCCAAGGTGGCCTCTGGCGTG CCCTACAGATTCTCCGGCTCTGGCTCTGGCACCTCCTACAGCCTGACCATCTCCAGCATGGAAGCCGAGGATGCCGCCACCTACTACTGCCAGCAGTGGTCCTCCAACCCCCTGACCTTTGGCTGGCACCAAGCTGGAACTGAAGCGGACCGTGGCCGCTCCTTCCGTGTTCATCTTCCCTCCCTCCGACGAGCAGCTGAAGTCCGGCACCGCCTCCGTGGTGTGCCTGCTGAACAACTTC TACCCTCGGGAGGCCAAGGTGCAGTGGAAGGTGGACAACGCCCTGCAGTCCGGCAACTCCCAGGAAAAGCGTCACCGAGCAGGACTCCAAGGACAGCACCTACTCCCTGTCCTCCACCCTGACCCTGTCCAAGGCCGACTACGAGAAGCACAAGGTGTACGCCTGCGAGGTGACCCCACCAGGGCCTGTCCAGCCCTGTGACCAAGTCCTTCAACCGGGGCGAGTGTGAC GTGCCTGGTGGTAGCGACATCGTGATGACCCAGTCCCCCTCCAGCCTGACCGTGACCGCTGGCGAGAAAGTGACCATGAGCTGCAAGTCCTCCAGTCCCTGCTGAACTCCGGCAACCAGAAGAACTACCTGACCTGGTATCAGCAGAAGCCCGGCCAGCCCCCCAAGCTGCTGATCTACTGGGCCTCCACCCGCGAGTCTGGCGTGCCCGATAGATTCACCGGCTCCGGCAGCGGC ACCGACTTTACCCTGACCATCTCCAGCGTGCAGGCCGAGGACCTGGCCGTGTATTACTGTCAGAACGACTACTCCTACCCCTTCACCTTCGGCTCTGGCACCAAGCTGGAAATCAAGGGAGGCGGTGGTTCAGGCGGCGGAGGCAGCGGTGGAGTGGTAGTGGCGGTGGCGGTTCAGGGGAGGTGGCTCGCAGGTGCAGCTGCAGCAGCCTGGCGCTGA ACTGGTCCGACCTGGCCGCCTCCGTGAAGCTGTCCTGCAAGGCCTCCGGCTACACCTTCACCAGCTACTGGATCAACTGGGTCAAGCAGCGGCCTGGCCAGGGCCTGGAATGGATCGGCAACATCTACCCCTCCGACTCCTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACCGTGGACAAGTCCTCCTCCACCGCTACATGCAGCTGTCCAGCCCCA CCTCCGAGGACTCCGCCGTGTACTGCACCCGGTCCTGGCGGGGCAACTCCTTCGACTATTGGGGCCAGGGCACCACCCTGACAGTGTCCTCTTCTGCCTGGAGCCACCCACAGTTCGAGAAGTGA #5730 Fdbstb_5730/5728 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCCCAGGTGCAGCTGCAGCAGTCTGGCGCTGAGCTGGCTAGACCTGGCCCTCCGTGAAGATGTCCTGCAAGACCTCCGGCTACACCTTCACCCGGTACACCATGCACTGGGTCAAGCAGAGGCCTGGACAGGGCCTGGAATGGATCGGCTACATCAACCCCTCCCGGGG CTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACAACCGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCTCCCTGACCTCCGAGGACTCCGCCGTGTACTGCGCCCGGTACTACGACGACCACTACTCCCTGGACTACTGGGGCCAGGGCACCACACTGACAGTGTCTAGCGCCTCCACCAAGGGCCTTCCGTGTTCCCTCTGGCCCTTCCTC CAAGTCCACCTCCGGCGGCACCGCCGCTCTGGGCTGCCTGGTGAAGGACTACTTCCCTGAGCCTGTGACCGTGAGCTGGAACTCTGGCGCCCTGACCAGCGGCGTGCACACCTTCCCTGCCGTGCTGCAGTCCTCCGGCCTGTACTCCCTGTCCTCCGTGTGTGACCGTGCCTTCCTCCTCCCTGGCACCCAGACCTACATCTGCAACGTGAACCACAAGCCTTCCAACACCA AGGTGGACAAGCGGGTGGAGCCTAAGTCCTGCTCCGGCCCTGGGGGCGGACGCAGCGGCGGAGGCGGATCCGGCGGAGGAGGCTCTCAGGTGCAGCTGCAGCAGCCTGGCGCTGAACTGGTCCGACCTGGCCCTCCGTGAAGCTGTCCTGCAAGGCCTCCGGCTACACCTTCACCAGCTACTGGATCAACTGGGTCAAGCAGCGGCCTGGCCAGGGC CTGGAATGGATCGGCAACATCTACCCCTCCGACTCCTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACCGTGGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCAGCCCCACCTCCGAGGACTCCGCCGTGTACTGCACCCGGTCCTGGCGGGGCAACTCCTTCGACTATTGGGGCCAGGGCACCACCCTGACAGTGTCCTCTGGAGGCG GAGGATCTGGTGGTGGCGGATCTGGCGGCGTGGAAGTGGCGGAGTGGTAGCGACATCGTGATGACCCAGTCCCCCTCCAGCCTGACCGTGACCGCTGGCGAGAAAGTGACCATGAGCTGCAAGTCCTCCCAGTCCCTGCTGAACTCCGGCAACCAGAAGAACTACCTGACCTGGTATCAGCAGAAGCCCGGCCAGCCCCCCAAGCTGCTGATCTACTGGGCCTCCACCC GCGAGTCTGGCGTGCCCGATAGATTCACCGGCTCCGGCAGCGGCACCGACTTTACCCTGACCATCTCCAGCGTGCAGGCCGAGGACCTGGCCGTGTATTACTGTCAGAACGACTACTCCTACCCCTTCACCTTCGGCTCTGGCACCAAGCTGGAAATCAAGGGCGGCTCCCACCACCACCATCACCACTGA #5731 Fdbstb_5731/5729 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCCCAGGTGCAGCTGCAGCAGTCTGGCGCTGAGCTGGCTAGACCTGGCCCTCCGTGAAGATGTCCTGCAAGACCTCCGGCTACACCTTCACCCGGTACACCATGCACTGGGTCAAGCAGAGGCCTGGACAGGGCCTGGAATGGATCGGCTACATCAACCCCTCCCGGGG CTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACAACCGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCTCCCTGACCTCCGAGGACTCCGCCGTGTACTGCGCCCGGTACTACGACGACCACTACTCCCTGGACTACTGGGGCCAGGGCACCACACTGACAGTGTCTAGCGCCTCCACCAAGGGCCTTCCGTGTTCCCTCTGGCCCTTCCTC CAAGTCCACCTCCGGCGGCACCGCCGCTCTGGGCTGCCTGGTGAAGGACTACTTCCCTGAGCCTGTGACCGTGAGCTGGAACTCTGGCGCCCTGACCAGCGGCGTGCACACCTTCCCTGCCGTGCTGCAGTCCTCCGGCCTGTACTCCCTGTCCTCCGTGTGTGACCGTGCCTTCCTCCTCCCTGGCACCCAGACCTACATCTGCAACGTGAACCACAAGCCTTCCAACACCA AGGTGGACAAGCGGGTGGAGCCTAAGTCCTGCTCCGGCCCTGGGGGCGGACGCAGCGGCGGAGGCGGATCCGGCGGAGGAGGCCTCTGACATCGTGATGACCCAGTCCCCCTCCAGCCTGACCGTGACCGCTGGCGAGAAAGTGACCATGAGCTGCAAGTCCTCCCAGTCCCTGCTGAACTCCGGCAACCAGAAGAACTACCTGACCTGGTATCAGCAGAAGCCCGGC CAGCCCCCCAAGCTGCTGATCTACTGGGCCTCCACGCGAGTCTGGCGTGCCCGATAGATTCACCGGCTCCGGCAGCGGCACCGACTTTACCCTGACCATCTCCAGCGTGCAGGCCGAGGACCTGGCCGTGTATTACTGTCAGAACGACTACTCCTACCCCTTCACCTTCGGCTCTGGCACCAAGCTGGAAATCAAGGGAGGCGGTGGTTCAGGCGGCGGAGGCAGCGGTGGA GGTGGTAGTGGCGGTGGCGGTTCAGGGGGAGGTGGCTCGCAGGTGCAGCTGCAGCAGCCTGGCGCTGAACTGGTCCGACCTGGCCCTCCGTGAAGCTGTCCTGCAAGGCTCCGGCTACACCTTCACCAGCTACTGGATCAACTGGGTCAAGCAGCGGCCTGGCCAGGGCCTGGAATGGATCGGCAACATCTACCCCTCCGACTCCTACACCAACT ACAACCAGAAGTTCAAGGACAAGGCCACCCTGACCGTGGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCAGCCCCACCTCCGAGGACTCCGCCGTGTACTACTGCACCCGGTCCTGGCGGGGCAACTCCTTCGACTATTGGGGCCAGGGCACCACCCTGACAGTGTCCTCTTCTCACCACCACCATCACCACTGA #5732 Fd bstb_5732/5728 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCCCAGGTGCAGCTGCAGCAGTCTGGCGCTGAGCTGGCTAGACCTGGCCCTCCGTGAAGATGTCCTGCAAGACCTCCGGCTACACCTTCACCCGGTACACCATGCACTGGGTCAAGCAGAGGCCTGGACAGGGCCTGGAATGGATCGGCTACATCAACCCCTCCCGGGG CTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACAACCGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCTCCCTGACCTCCGAGGACTCCGCCGTGTACTGCGCCCGGTACTACGACGACCACTACTCCCTGGACTACTGGGGCCAGGGCACCACACTGACAGTGTCTAGCGCCTCCACCAAGGCCCTTCCGTGTTCCCTCTGGCCCTTGCTC CAAGTCCACCTCCGAAGGCACCGCCGCTCTGGGCTGCCTGGTGAAGGACTACTTCCCTGAGCCTGTGACCGTGAGCTGGAACTCTGGCGCCCTGACCAGCGGCGTGCACACCTTCCCTGCCGTGCTGCAGTCCTCCGGCCTGTACTCCCTGTCCTCCGTGTGTGACCGTGCCTTCCTCCAACTTCGGCACCCAGACCTACACCTGCAACGTGGACCACAAGCCTTCCAACACCAAG GTGGACAAGACCGTGGAGCCTAAGTCCGCCTCCGGCCCTGGGGGCGGACGCAGCGGCGGAGGCGGATCCGGCGGAGGAGGCTCTCAGGTGCAGCTGCAGCAGCCTGGCGCTGAACTGGTCCGACCTGGCGCCTCCGTGAAGCTGTCCTGCAAGGCCTCCGGCTACACCTTCACCAGCTACTGGATCAACTGGTCAAGCAGCGGCCTGGCCAGGGCCTG GAATGGATCGGCAACATCTACCCCTCCGACTCCTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACCGTGGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCAGCCCCACCTCCGAGGACTCCGCCGTGTACTACTGCACCCGGTCCTGGCGGGGCAACTCCTTCGACTATTGGGGCCAGGGCACCACCCTGACAGTGTCCTCTGGAGGCGGAG GATCTGGTGGTGGCGGATCTGGCGGCGTGGAAGTGGCGGAGTGGTAGCGACATCGTGATGACCCAGTCCCCCTCCAGCCTGACCGTGACCGCTGGCGAGAAAGTGACCATGAGCTGCAAGTCCTCCCAGTCCCTGCTGAACTCCGGCAACCAGAAGAACTACCTGACCTGGTATCAGCAGAAGCCCGGCCAGCCCCCCAAGCTGCTGATCTACTGGGCCTCCACCCGCGA GTCTGGCGTGCCCGATAGATTCACCGGCTCCGGCAGCGGCACCGACTTTACCCTGACCATCTCCAGCGTGTCAGGCCGAGGACCTGGCCGTGTATTACTGTCAGAACGACTACTCCTACCCCTTCACCTTCGGCTCTGGCACCAAGCTGGAAATCAAGGGCGGCTCCCACCACCACCATCACCACTGA #5733 Fdbstb_5733/5729 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCCCAGGTGCAGCTGCAGCAGTCTGGCGCTGAGCTGGCTAGACCTGGCCCTCCGTGAAGATGTCCTGCAAGACCTCCGGCTACACCTTCACCCGGTACACCATGCACTGGGTCAAGCAGAGGCCTGGACAGGGCCTGGAATGGATCGGCTACATCAACCCCTCCCGGGG CTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACAACCGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCTCCCTGACCTCCGAGGACTCCGCCGTGTACTGCGCCCGGTACTACGACGACCACTACTCCCTGGACTACTGGGGCCAGGGCACCACACTGACAGTGTCTAGCGCCTCCACCAAGGCCCTTCCGTGTTCCCTCTGGCCCTTGCTC CAAGTCCACCTCCGAAGGCACCGCCGCTCTGGGCTGCCTGGTGAAGGACTACTTCCCTGAGCCTGTGACCGTGAGCTGGAACTCTGGCGCCCTGACCAGCGGCGTGCACACCTTCCCTGCCGTGCTGCAGTCCTCCGGCCTGTACTCCCTGTCCTCCGTGTGTGACCGTGCCTTCCTCCAACTTCGGCACCCAGACCTACACCTGCAACGTGGACCACAAGCCTTCCAACACCAAG GTGGACAAGACCGTGGAGCCTAAGTCCGCCTCCGGCCCTGGGGGCGGACGCAGCGGCGGAGGCGGATCCGGCGGAGGAGGCCTCTGACATCGTGATGACCCAGTCCCCCTCCAGCCTGACCGTGACCGCTGGCGAGAAAGTGACCATGAGCTGCAAGTCCTCCCAGTCCCTGCTGAACTCCGGCAACCAGAAGAACTACCTGACCTGGTATCAGCAGAAGCCCGGCCAGC CCCCCAAGCTGCTGATCTACTGGGCCTCCACCCGCGAGTCTGGCGTGCCCGATAGATTCACCGGCTCCGGCAGCGGCACCGACTTTACCCTGACCATCTCCAGCGTGCAGGCCGAGGACCTGGCCGTGTATTACTGTCAGAACGACTCCTACCCCTTCACCTTCGGCTCTGGCACCAAGCTGGAAATCAAGGGAGGCGGTGGTTCAGGCGGCGGAGGCAGCGGTGGAGG TGGTAGTGGCGGTGGCGGTTCAGGGGGAGGTGGCTCGCAGGTGCAGCTGCAGCAGCCTGGCGCTGAACTGGTCCGACCTGGCGCCCTCCGTGAAGCTGTCCTGCAAGGCCTCCGGCTACACCTTCACCAGCTACTGGATCAACTGGGTCAAGCAGCGGCCTGGCCAGGGCCTGGAATGGATCGGCAACATCTACCCCTCCGACTCCTACACCAACTACACA ACCAGAAGTTCAAGGACAAGGCCACCCTGACCGTGGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCAGCCCCACCTCCGAGGACTCCGCCGTGTACTACTGCACCCGGTCCTGGCGGGCAACTCCTTCGACTATTGGGGCCAGGGCACCACCCTGACAGTGTCCTCTTCTCACCACCACCATCACCACTGA #5745 Fdbstb_5745/5747 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCCCAGGTGCAGCTGCAGCAGTCTGGCGCTGAGCTGGCTAGACCTGGCCCTCCGTGAAGATGTCCTGCAAGACCTCCGGCTACACCTTCACCCGGTACACCATGCACTGGGTCAAGCAGAGGCCTGGACAGGGCCTGGAATGGATCGGCTACATCAACCCCTCCCGGGG CTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACAACCGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCTCCCTGACCTCCGAGGACTCCGCCGTGTACTGCGCCCGGTACTACGACGACCACTACTCCCTGGACTACTGGGGCCAGGGCACCACACTGACAGTGTCTAGCGCCTCCACCAAGGGCCTTCCGTGTTCCCTCTGGCCCTTCCTC CAAGTCCACCTCCGGCGGCACCGCCGCTCTGGGCTGCCTGGTGAAGGACTACTTCCCTGAGCCTGTGACCGTGAGCTGGAACTCTGGCGCCCTGACCAGCGGCGTGCACACCTTCCCTGCCGTGCTGCAGTCCTCCGGCCTGTACTCCCTGTCCTCCGTGTGTGACCGTGCCTTCCTCCTCCCTGGCACCCAGACCTACATCTGCAACGTGAACCACAAGCCTTCCAACACCA AGGTGGACAAGCGGGTGGAGCCTAAGTCCTGCTCCGGCCCTGGGGGCGGACGCAGCGGCGGAGGCGGATCCGGCGGAGGAGGCTCTCAGGTGCAGCTGCAGCAGCCTGGCGCTGAACTGGTCCGACCTGGCCCTCCGTGAAGCTGTCCTGCAAGGCCTCCGGCTACACCTTCACCAGCTACTGGATCAACTGGGTCAAGCAGCGGCCTGGCCAGGGC CTGGAATGGATCGGCAACATCTACCCCTCCGACTCCTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACCGTGGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCAGCCCCACCTCCGAGGACTCCGCCGTGTACTGCACCCGGTCCTGGCGGGGCAACTCCTTCGACTATTGGGGCCAGGGCACCACCCTGACAGTGTCCTCTGGAGGCG GAGGATCTGGTGGTGGCGGATCTGGCGGCGTGGAAGTGGCGGAGTGGTAGCGACATCGTGATGACCCAGTCCCCCTCCAGCCTGACCGTGACCGCTGGCGAGAAAGTGACCATGAGCTGCAAGTCCTCCCAGTCCCTGCTGAACTCCGGCAACCAGAAGAACTACCTGACCTGGTATCAGCAGAAGCCCGGCCAGCCCCCCAAGCTGCTGATCTACTGGGCCTCCACCC GCGAGTCTGGCGTGCCCGATAGATTCACCGGCTCCGGCAGCGGCACCGACTTTACCCTGACCATCTCCAGCGTGCAGGCCGAGGACCTGGCCGTGTATTACTGTCAGAACGACTACTCCTACCCCTTCACCTTCGGCTCTGGCACCAAGCTGGAAATCAAGTGA #5746 Fdbstb_5746/5748 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCCCAGGTGCAGCTGCAGCAGTCTGGCGCTGAGCTGGCTAGACCTGGCCCTCCGTGAAGATGTCCTGCAAGACCTCCGGCTACACCTTCACCCGGTACACCATGCACTGGGTCAAGCAGAGGCCTGGACAGGGCCTGGAATGGATCGGCTACATCAACCCCTCCCGGGG CTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACAACCGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCTCCCTGACCTCCGAGGACTCCGCCGTGTACTGCGCCCGGTACTACGACGACCACTACTCCCTGGACTACTGGGGCCAGGGCACCACACTGACAGTGTCTAGCGCCTCCACCAAGGGCCTTCCGTGTTCCCTCTGGCCCTTCCTC CAAGTCCACCTCCGGCGGCACCGCCGCTCTGGGCTGCCTGGTGAAGGACTACTTCCCTGAGCCTGTGACCGTGAGCTGGAACTCTGGCGCCCTGACCAGCGGCGTGCACACCTTCCCTGCCGTGCTGCAGTCCTCCGGCCTGTACTCCCTGTCCTCCGTGTGTGACCGTGCCTTCCTCCTCCCTGGCACCCAGACCTACATCTGCAACGTGAACCACAAGCCTTCCAACACCA AGGTGGACAAGCGGGTGGAGCCTAAGTCCTGCTCCGGCCCTGGGGGCGGACGCAGCGGCGGAGGCGGATCCGGCGGAGGAGGCCTCTGACATCGTGATGACCCAGTCCCCCTCCAGCCTGACCGTGACCGCTGGCGAGAAAGTGACCATGAGCTGCAAGTCCTCCCAGTCCCTGCTGAACTCCGGCAACCAGAAGAACTACCTGACCTGGTATCAGCAGAAGCCCGGC CAGCCCCCCAAGCTGCTGATCTACTGGGCCTCCACGCGAGTCTGGCGTGCCCGATAGATTCACCGGCTCCGGCAGCGGCACCGACTTTACCCTGACCATCTCCAGCGTGCAGGCCGAGGACCTGGCCGTGTATTACTGTCAGAACGACTACTCCTACCCCTTCACCTTCGGCTCTGGCACCAAGCTGGAAATCAAGGGAGGCGGTGGTTCAGGCGGCGGAGGCAGCGGTGGA GGTGGTAGTGGCGGTGGCGGTTCAGGGGGAGGTGGCTCGCAGGTGCAGCTGCAGCAGCCTGGCGCTGAACTGGTCCGACCTGGCCCTCCGTGAAGCTGTCCTGCAAGGCTCCGGCTACACCTTCACCAGCTACTGGATCAACTGGGTCAAGCAGCGGCCTGGCCAGGGCCTGGAATGGATCGGCAACATCTACCCCTCCGACTCCTACACCAACT ACAACCAGAAGTTCAAGGACAAGGCCACCCTGACCGTGGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCAGCCCCACCTCCGAGGACTCCGCCGTGTACTACTGCACCCGGTCCTGGCGGGGCAACTCCTTCGACTATTGGGGCCAGGGCACCACCCTGACAGTGTCCTCTTGA #5747 Lbstb_5745/5747 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCTCAGATCGTGCTGACCCAGTCTCCCGCCATCATGTCTGCTAGCCCTGGCGAAAAGTGACAATGACCTGCCGGGCCTCCTCCTCCGTGTCCTACATGAACTGGTATCAGCAGAAGTCCGGCACCTCCCCCAAGCGGTGGATCTACGACACCTCCAAGGTGGCCTCTGGCGTG CCCTACAGATTCTCCGGCTCTGGCTCTGGCACCTCCTACAGCCTGACCATCTCCAGCATGGAAGCCGAGGATGCCGCCACCTACTACTGCCAGCAGTGGTCCTCCAACCCCCTGACCTTTGGCTGGCACCAAGCTGGAACTGAAGCGGACCGTGGCCGCTCCTTCCGTGTTCATCTTCCCTCCCTCCGACGAGCAGCTGAAGTCCGGCACCGCCTCCGTGGTGTGCCTGCTGAACAACTTC TACCCTCGGGAGGCCAAGGTGCAGTGGAAGGTGGACAACGCCCTGCAGTCCGGCAACTCCCAGGAAAAGCGTCACCGAGCAGGACTCCAAGGACAGCACCTACTCCCTGTCCTCCACCCTGACCCTGTCCAAGGCCGACTACGAGAAGCACAAGGTGTACGCCTGCGAGGTGACCCCACCAGGGCCTGTCCAGCCCTGTGACCAAGTCCTTCAACCGGGGCGAGTGTGAC GTGCCTGGTGGTAGCCAGGTGCAGCTGCAGCAGCCTGGCGCTGAACTGGTCCGACCTGGCGCCCGTGTGAAGCTGTCCTGCAAGGCCTCCGGCTACACCTTCACCAGCTACTGGATCAACTGGGTCAAGCAGCGGCCTGGCCAGGGCCTGGAATGGATCGGCAACATCTACCCCTCCGACTCCTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGA CCGTGGACAAGTCCTCCTCACCGCCTACATGCAGCTGTCCAGCCCCACCTCCGAGGACTCCGCCGTGTACTGCACCCGGTCCTGGCGGGGCAACTCCTTCGACTATTGGGGCCAGGGCACCACCCTGACAGTGTCCTCTGGAGGCGGAGGATCTGGTGGTGGCGGATCTGGCGGCGGTGGAAGTGGCGGAGTGGTAGCGACATCGTGATGACCCAG TCCCCCTCCAGCCTGACCGTGACCGCTGGCGAGAAAGTGACCATGAGCTGCAAGTCCTCCAGTCCCTGCTGAACTCCGGCAACCAGAAGAACTACCTGACCTGGTATCAGCAGAAGCCCGGCCAGCCCCCCAAGCTGCTGATCTACTGGGCCTCCACCCGCGAGTCTGGCGTGCCCGATAGATTCACCGGCTCCGGCAGCGGCACCGACTTTACCCTGACCATCTCCAGCGTGCAGGCCG AGGACCTGGCCGTGTATTACTGTCAGAACGACTACTCCTACCCCTTCACCTTCGGCTCTGGCACCAAGCTGGAAATCAAGTGA #5748 Lbstb_5746/5748 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCTCAGATCGTGCTGACCCAGTCTCCCGCCATCATGTCTGCTAGCCCTGGCGAAAAGTGACAATGACCTGCCGGGCCTCCTCCTCCGTGTCCTACATGAACTGGTATCAGCAGAAGTCCGGCACCTCCCCCAAGCGGTGGATCTACGACACCTCCAAGGTGGCCTCTGGCGTG CCCTACAGATTCTCCGGCTCTGGCTCTGGCACCTCCTACAGCCTGACCATCTCCAGCATGGAAGCCGAGGATGCCGCCACCTACTACTGCCAGCAGTGGTCCTCCAACCCCCTGACCTTTGGCTGGCACCAAGCTGGAACTGAAGCGGACCGTGGCCGCTCCTTCCGTGTTCATCTTCCCTCCCTCCGACGAGCAGCTGAAGTCCGGCACCGCCTCCGTGGTGTGCCTGCTGAACAACTTC TACCCTCGGGAGGCCAAGGTGCAGTGGAAGGTGGACAACGCCCTGCAGTCCGGCAACTCCCAGGAAAAGCGTCACCGAGCAGGACTCCAAGGACAGCACCTACTCCCTGTCCTCCACCCTGACCCTGTCCAAGGCCGACTACGAGAAGCACAAGGTGTACGCCTGCGAGGTGACCCCACCAGGGCCTGTCCAGCCCTGTGACCAAGTCCTTCAACCGGGGCGAGTGTGAC GTGCCTGGTGGTAGCGACATCGTGATGACCCAGTCCCCCTCCAGCCTGACCGTGACCGCTGGCGAGAAAGTGACCATGAGCTGCAAGTCCTCCAGTCCCTGCTGAACTCCGGCAACCAGAAGAACTACCTGACCTGGTATCAGCAGAAGCCCGGCCAGCCCCCCAAGCTGCTGATCTACTGGGCCTCCACCCGCGAGTCTGGCGTGCCCGATAGATTCACCGGCTCCGGCAGCGGC ACCGACTTTACCCTGACCATCTCCAGCGTGCAGGCCGAGGACCTGGCCGTGTATTACTGTCAGAACGACTACTCCTACCCCTTCACCTTCGGCTCTGGCACCAAGCTGGAAATCAAGGGAGGCGGTGGTTCAGGCGGCGGAGGCAGCGGTGGAGTGGTAGTGGCGGTGGCGGTTCAGGGGAGGTGGCTCGCAGGTGCAGCTGCAGCAGCCTGGCGCTGA ACTGGTCCGACCTGGCCGCCTCCGTGAAGCTGTCCTGCAAGGCCTCCGGCTACACCTTCACCAGCTACTGGATCAACTGGGTCAAGCAGCGGCCTGGCCAGGGCCTGGAATGGATCGGCAACATCTACCCCTCCGACTCCTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACCGTGGACAAGTCCTCCTCCACCGCTACATGCAGCTGTCCAGCCCCA CCTCCGAGGACTCCGCCGTGTACTACTGCACCCGGTCCTGGCGGGGCAACTCCTTCGACTATTGGGGCCAGGGCACCACCCTGACAGTGTCCTCTTGA #5749 Fdbstb_5749/5751 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCCCAGGTGCAGCTGCAGCAGTCTGGCGCTGAGCTGGCTAGACCTGGCCCTCCGTGAAGATGTCCTGCAAGACCTCCGGCTACACCTTCACCCGGTACACCATGCACTGGGTCAAGCAGAGGCCTGGACAGGGCCTGGAATGGATCGGCTACATCAACCCCTCCCGGGG CTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACAACCGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCTCCCTGACCTCCGAGGACTCCGCCGTGTACTGCGCCCGGTACTACGACGACCACTACTCCCTGGACTACTGGGGCCAGGGCACCACACTGACAGTGTCTAGCGCCTCCACCAAGGGCCTTCCGTGTTCCCTCTGGCCCTTCCTC CAAGTCCACCTCCGGCGGCACCGCCGCTCTGGGCTGCCTGGTGAAGGACTACTTCCCTGAGCCTGTGACCGTGAGCTGGAACTCTGGCGCCCTGACCAGCGGCGTGCACACCTTCCCTGCCGTGCTGCAGTCCTCCGGCCTGTACTCCCTGTCCTCCGTGTGTGACCGTGCCTTCCTCCTCCCTGGCACCCAGACCTACATCTGCAACGTGAACCACAAGCCTTCCAACACCA AGGTGGACAAGCGGGTGGAGCCTAAGTCCTGCTCCGGCCCTGGGGGCGGACGCAGCGGCGGAGGCGGATCCGGCGGAGGAGGCTCTCAGGTGCAGCTGCAGCAGCCTGGCGCTGAACTGGTCCGACCTGGCCCTCCGTGAAGCTGTCCTGCAAGGCCTCCGGCTACACCTTCACCAGCTACTGGATCAACTGGGTCAAGCAGCGGCCTGGCCAGTGCC TGGAATGGATCGGCAACATCTACCCCTCCGACTCCTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACCGTGGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCAGCCCCACCTCCGAGGACTCCGCCGTGTACTGCACCCGGTCCTGGCGGGCAACTCCTTCGACTATTGGGGCCAGGGCACCACCCTGACAGTGTCCTCTGGAGGCGGA GGATCTGGTGGTGGCGGATCTGGCGGCGTGGAAGTGGCGGAGTGGTAGCGACATCGTGATGACCCAGTCCCCCTCCAGCCTGACCGTGACCGCTGGCGAGAAAGTGACCATGAGCTGCAAGTCCTCCCAGTCCCTGCTGAACTCCGGCAACCAGAAGAACTACCTGACCTGGTATCAGCAGAAGCCCGGCCAGCCCCCCAAGCTGCTGATCTACTGGGCCTCCACCCGCGC GAGTCTGGCGTGCCCGATAGATTCACCGGCTCCGGCAGCGGCACCGACTTTACCCTGACCATCTCCAGCGTGTGCAGGCCGAGGACCTGGCCGTGTATTACTGTCAGAACGACTACTCCTACCCCTTCACCTTCGGCTGCGGCACCAAGCTGGAAATCAAGTGA #5750 Fd bstb_5750/5752 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCCCAGGTGCAGCTGCAGCAGTCTGGCGCTGAGCTGGCTAGACCTGGCCCTCCGTGAAGATGTCCTGCAAGACCTCCGGCTACACCTTCACCCGGTACACCATGCACTGGGTCAAGCAGAGGCCTGGACAGGGCCTGGAATGGATCGGCTACATCAACCCCTCCCGGGG CTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACAACCGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCTCCCTGACCTCCGAGGACTCCGCCGTGTACTGCGCCCGGTACTACGACGACCACTACTCCCTGGACTACTGGGGCCAGGGCACCACACTGACAGTGTCTAGCGCCTCCACCAAGGGCCTTCCGTGTTCCCTCTGGCCCTTCCTC CAAGTCCACCTCCGGCGGCACCGCCGCTCTGGGCTGCCTGGTGAAGGACTACTTCCCTGAGCCTGTGACCGTGAGCTGGAACTCTGGCGCCCTGACCAGCGGCGTGCACACCTTCCCTGCCGTGCTGCAGTCCTCCGGCCTGTACTCCCTGTCCTCCGTGTGTGACCGTGCCTTCCTCCTCCCTGGCACCCAGACCTACATCTGCAACGTGAACCACAAGCCTTCCAACACCA AGGTGGACAAGCGGGTGGAGCCTAAGTCCTGCTCCGGCCCTGGGGGCGGACGCAGCGGCGGAGGCGGATCCGGCGGAGGAGGCCTCTGACATCGTGATGACCCAGTCCCCCTCCAGCCTGACCGTGACCGCTGGCGAGAAAGTGACCATGAGCTGCAAGTCCTCCCAGTCCCTGCTGAACTCCGGCAACCAGAAGAACTACCTGACCTGGTATCAGCAGAAGCCCGGC CAGCCCCCCAAGCTGCTGATCTACTGGGCCTCCACGCGAGTCTGGCGTGCCCGATAGATTCACCGGCTCCGGCAGCGGCACCGACTTTACCCTGACCATCTCCAGCGTGCAGGCCGAGGACCTGGCCGTGTATTACTGTCAGAACGACTACTCCTACCCCTTCACCTTCGGCTGCGGCACCAAGCTGGAAATCAAGGGAGGCGGTGGTTCAGGCGGCGGAGGCAGCGGTGGA GGTGGTAGTGGCGGTGGCGGTTCAGGGGGAGGTGGCTCGCAGGTGCAGCTGCAGCAGCCTGGCGCTGAACTGGTCCGACCTGGCCCTCCGTGAAGCTGTCCTGCAAGGCTCCGGCTACACCTTCACCAGCTACTGGATCAACTGGGTCAAGCAGCGGCCTGGCCAGTGCCTGGAATGGATCGGCAACATCTACCCCTCCGACTCCTACACCAACTAC AACCAGAAGTTCAAGGACAAGGCCACCCTGACCGTGGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCAGCCCCACCTCCGAGGACTCCGCCGTGTACTACTGCACCCGGTCCTGGCGGGGCAACTCCTTCGACTATTGGGGCCAGGGCACCACCCTGACAGTGTCCTCTGA #5751 Lbstb_5749/5751 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCTCAGATCGTGCTGACCCAGTCTCCCGCCATCATGTCTGCTAGCCCTGGCGAAAAGTGACAATGACCTGCCGGGCCTCCTCCTCCGTGTCCTACATGAACTGGTATCAGCAGAAGTCCGGCACCTCCCCCAAGCGGTGGATCTACGACACCTCCAAGGTGGCCTCTGGCGTG CCCTACAGATTCTCCGGCTCTGGCTCTGGCACCTCCTACAGCCTGACCATCTCCAGCATGGAAGCCGAGGATGCCGCCACCTACTACTGCCAGCAGTGGTCCTCCAACCCCCTGACCTTTGGCTGGCACCAAGCTGGAACTGAAGCGGACCGTGGCCGCTCCTTCCGTGTTCATCTTCCCTCCCTCCGACGAGCAGCTGAAGTCCGGCACCGCCTCCGTGGTGTGCCTGCTGAACAACTTC TACCCTCGGGAGGCCAAGGTGCAGTGGAAGGTGGACAACGCCCTGCAGTCCGGCAACTCCCAGGAAAAGCGTCACCGAGCAGGACTCCAAGGACAGCACCTACTCCCTGTCCTCCACCCTGACCCTGTCCAAGGCCGACTACGAGAAGCACAAGGTGTACGCCTGCGAGGTGACCCCACCAGGGCCTGTCCAGCCCTGTGACCAAGTCCTTCAACCGGGGCGAGTGTGAC GTGCCTGGTGGTAGCCAGGTGCAGCTGCAGCAGCCTGGCGCTGAACTGGTCCGACCTGGCGCCCGTGTGAAGCTGTCCTGCAAGGCCTCCGGCTACACCTTCACCAGCTACTGGATCAACTGGGTCAAGCAGCGGCCTGGCCAGTGCCTGGAATGGATCGGCAACATCTACCCCTCCGACTCCTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACC GTGGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCAGCCCCACCTCCGAGGACTCCGCCGTGTACTGCACCCGGTCCTGGCGGGGCAACTCCTTCGACTATTGGGGCCAGGGCACCACCCTGACAGTGTCCTCTGGAGGCGGAGGATCTGGTGGTGGCGGATCTGGCGGCGGTGGAAGTGGCGGAGTGGTAGCGACATCGTGATGACCCAGTC CCCCTCCAGCCTGACCGTGACCGCTGGCGAGAAAGTGACCATGAGCTGCAAGTCCTCCAGTCCCTGCTGAACTCCGGCAACCAGAAGAACTACCTGACCTGGTATCAGCAGAAGCCCGGCCAGCCCCCCAAGCTGCTGATCTACTGGGCCTCCACCCGCGAGTCTGGCGTGCCCGATAGATTCACCGGCTCCGGCAGCGGCACCGACTTTACCCTGACCATCTCCAGCGTGCAGGCCGAG GACCTGGCCGTGTATTACTGTCAGAACGACTACTCCTACCCCTTCACCTTCGGCTGCGGCACCAAGCTGGAAATCAAGTGA #5752 Lbstb_5750/5752 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCTCAGATCGTGCTGACCCAGTCTCCCGCCATCATGTCTGCTAGCCCTGGCGAAAAGTGACAATGACCTGCCGGGCCTCCTCCTCCGTGTCCTACATGAACTGGTATCAGCAGAAGTCCGGCACCTCCCCCAAGCGGTGGATCTACGACACCTCCAAGGTGGCCTCTGGCGTG CCCTACAGATTCTCCGGCTCTGGCTCTGGCACCTCCTACAGCCTGACCATCTCCAGCATGGAAGCCGAGGATGCCGCCACCTACTACTGCCAGCAGTGGTCCTCCAACCCCCTGACCTTTGGCTGGCACCAAGCTGGAACTGAAGCGGACCGTGGCCGCTCCTTCCGTGTTCATCTTCCCTCCCTCCGACGAGCAGCTGAAGTCCGGCACCGCCTCCGTGGTGTGCCTGCTGAACAACTTC TACCCTCGGGAGGCCAAGGTGCAGTGGAAGGTGGACAACGCCCTGCAGTCCGGCAACTCCCAGGAAAAGCGTCACCGAGCAGGACTCCAAGGACAGCACCTACTCCCTGTCCTCCACCCTGACCCTGTCCAAGGCCGACTACGAGAAGCACAAGGTGTACGCCTGCGAGGTGACCCCACCAGGGCCTGTCCAGCCCTGTGACCAAGTCCTTCAACCGGGGCGAGTGTGAC GTGCCTGGTGGTAGCGACATCGTGATGACCCAGTCCCCCTCCAGCCTGACCGTGACCGCTGGCGAGAAAGTGACCATGAGCTGCAAGTCCTCCAGTCCCTGCTGAACTCCGGCAACCAGAAGAACTACCTGACCTGGTATCAGCAGAAGCCCGGCCAGCCCCCCAAGCTGCTGATCTACTGGGCCTCCACCCGCGAGTCTGGCGTGCCCGATAGATTCACCGGCTCCGGCAGCGGC ACCGACTTTACCCTGACCATCTCCAGCGTGCAGGCCGAGGACCTGGCCGTGTATTACTGTCAGAACGACTACTCCTACCCCTTCACCTTCGGCTGCGGCACCAAGCTGGAAATCAAGGGAGGCGGTGGTTCAGGCGGCGGAGGCAGCGGTGGAGTGGTAGTGGCGGTGGCGGTTCAGGGGAGGTGGCTCGCAGGTGCAGCTGCAGCAGCCTGGCGCTGA ACTGGTCCGACCTGGCGCCTCCGTGAAGCTGTCCTGCAAGGCCTCCGGCTACACCTTCACCAGCTACTGGATCAACTGGGTCAAGCAGCGGCCTGGCAGTGCCTGGAATGGATCGGCAACATCTACCCCTCCGACTCCTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACCGTGGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCAGCCCCACC TCCGAGGACTCCGCCGTGTACTACTGCACCCGGTCCTGGCGGGGCAACTCCTTCGACTATTGGGGCCAGGGCACCACCCTGACAAGTGTCCTCTTGA

Table 9. DNA sequences encoding CLDN18.2 x CD3-bi-(scFv) ₂

internal name
plasmids Relevant
bi-(scFv) ₂ DNA coding sequence #5506 bi-scFv_5506 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCTCAGGTGCAGCTGCAGCAGCCTGGCGCTGAACTGGTCCGACCTGGCGCCCTCCGTGAAGCTGTCCTGCAAGGCCTCCGGCTACACCTTCACCAGCTACTGGATCAACTGGTCAAGCAGCGGCCTGCCAGGGCCTGGAATGGATCGGCAACATACCCCTCCGACT CCTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACCGTGGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCAGCCCCACCTCCGAGGACTCCGCCGTGTACTGCACCCGGTCCTGGCGGGCAACTCCTTCGACTATTGGGGCCAGGGCACCACCCTGACAAGTGTCCTCTGGAGGCGGAGGATCTGGTGGTGGCGGATCTGGCGGCG GTGGAAGTGGCGGAGTGTGTAGCGACATCGTGATGACCCAGTCCCCCTCCAGCCTGACCGTGACCGCTGGCGAGAAAGTGACCATGAGCTGCAAGTCCTCCCAGTCCCTGCTGAACTCCGGCAACCAGAAGAACTACCTGACCTGGTATCAGCAGAAGCCCGGCCAGCCCCCCAAGCTGCTGATCTACTGGCCTCCACCCGCGAGTCTGGCGTGCCCGATAGATTCACCGGCTC CGGCAGCGGCACCGACTTTACCCTGACCATCTCCAGCGTGCAGGCCGAGGACCTGGCCGTGTATTACTGTCAGAACGACTACTCCTACCCCTTCACCTTCGGCTCTGGCACCAAGCTGGAAATCAAGTCTGGCGGAGGCGGATCCCAGGTGCAGCTGCAGCAGTCTGGCCGCTGAGCTGGCTAGACCTGGCGCTCCGTGTGAAGATGTCCTGCAAGACCTCCGGCTACACCTTCACCCGGTA CACCATGCACTGGGTCAAGCAGAGGCCTGGAATGGATCGGCTACATCAACCCCTCCCGGGGCTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACAACCGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCTCCCTGACCTCCGAGGACTCCGCCGTGTACTACTGCGCCCGGTACTACGACGACCACTACTCCCTGGACTACTGG GGCCAGGGCACCACACTGACAGTGTCTAGCGGTGGTGGAGGAAGCGGAGGGGTGGTAGCGGTGGTGGAGGCTCTGGCGGGGGAGGGAGTCAGATCGTGCTGACCCAGTCTCCCGCCATGTCTGCTAGCCCTGGCGAGAAAGTGCAAATGACCTGCCGGGCCTCCTCCTCCGTGTCCTACATGAACTGGTATCAGCAGAAGTCCGGCACCTCC CCCAAGCGGTGGATTACGACACCTCCAAGGTGGCCTCTGGCGTGCCCTACAGATTCTCCGGCTCTGGCTCTGGCACCCTCCTACAGCCTGACCATCTCCAGCATGGAAGCCGAGGATGCCGCCACCTACTACTGCCAGCAGTGGTCCTCCAACCCCCTGACCTTTGGCGCTGGCACCAAGCTGGAACTGAAGGGCGGCTCTCACCACCACCATCACCACTGA #5538 bi-scFv_5538 ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCACTCTGACATCGTGATGACCCAGTCCCCCTCCAGCCTGACCGTGACCGCTGGCGAGAAAGTGACCATGAGCTGCAAGTCCTCCCAGTCCCTGCTGAACTCCGGCAACCAGAAGAACTACCTGACCTGGTATCAGCAGAAGCCCGGCCAGCCCCCCAAGCTGCTGATCTACTGGGCCTCCACCCGCGAGTCTGGCGTGCCCGATAGATTCACCGGCTCCGGCAGCGGCACCGACTTTACCCTGACCATCTCCAGCGTGCAGGCCGAGGACCTGGCCGTGTATTACTGTCAGAACGACTACTCCTACCCCTTCACCTTCGGCTCTGGCACCAAGCTGGAAATCAAGGGAGGCGGTGGTTCAGGCGGCGGAGGCAGCGGTGGAGGTGGTAGTGGCGGTGGCGGTTCAGGGGGAGGTGGCTCGCAGGTGCAGCTGCAGCAGCCTGGCGCTGAACTGGTCCGACCTGGCGCCTCCGTGAAGCTGTCCTGCAAGGCCTCCGGCTACACCTTCACCAGCTACTGGATCAACTGGGTCAAGCAGCGGCCTGGCCAGGGCCTGGAATGGATCGGCAACATCTACCCCTCCGACTCCTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACCGTGGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCAGCCCCACCTCCGAGGACTCCGCCGTGTACTACTGCACCCGGTCCTGGCGGGGCAACTCCTTCGACTATTGGGGCCAGGGCACCACCCTGACAGTGTCCTCTTCTGGCGGAGGCGGATCCCAGGTGCAGCTGCAGCAGTCTGGCGCTGAGCTGGCTAGACCTGGCGCCTCCGTGAAGATGTCCTGCAAGACCTCCGGCTACACCTTCACCCGGTACACCATGCACTGGGTCAAGCAGAGGCCTGGACAGGGCCTGGAATGGATCGGCTACATCAACCCCTCCCGGGGCTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACAACCGACAAGTCCTCCTCCACCGCCTACATGCAGCTGTCCTCCCTGACCTCCGAGGACTCCGCCGTGTACTACTGCGCCCGGTACTACGACGACCACTACTCCCTGGACTACTGGGGCCAGGGCACCACACTGACAGTGTCTAGCGGAGGCGGAGGATCTGGTGGTGGCGGATCTGGCGGCGGTGGAAGTGGCGGAGGTGGTAGCCAGATCGTGCTGACCCAGTCTCCCGCCATCATGTCTGCTAGCCCTGGCGAGAAAGTGACAATGACCTGCCGGGCCTCCTCCTCCGTGTCCTACATGAACTGGTATCAGCAGAAGTCCGGCACCTCCCCCAAGCGGTGGATCTACGACACCTCCAAGGTGGCCTCTGGCGTGCCCTACAGATTCTCCGGCTCTGGCTCTGGCACCTCCTACAGCCTGACCATCTCCAGCATGGAAGCCGAGGATGCCGCCACCTACTACTGCCAGCAGTGGTCCTCCAACCCCCTGACCTTTGGCGCTGGCACCAAGCTGGAACTGAAGGGCGGCTCTCACCACCACCATCACCACTGA #5376 bi-scFv "plate reference" ATGGGATGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCCACCGGCGTGCAACAGCCAGGTGCAGCTGCAGCAGCCTGGAGCTGAACTGGTGCGGCCTGGAGCCAGCGTGAAGCTGTCCTGCAAGGCCAGCGGCTACACCTTCACCAGCTACTGGATCAACTGGGTGAAGCAGCGGCCTGGACAGGGCCTGGAATGGATCGGCAACATCTACCCAGCGAC AGCTACACCAACTACAACCAGAAGTTCAAGGACAAGGCCACCCTGACCGTGGACAAGAGCAGCAGCACCGCCTACATGCAGCTGTCCAGCCCCACCTCCGAGGACAGCGCCGTGTACTGCACCAGAAGCTGGCGGGCAACAGCTTCGACTACTGGGCCAGGGCACCACACTGACAGTCAGCAGCGGAGGAGGGGATCTGGCGGGGGAGGAAGCGGAGG GGGGGGAAGCGACATCGTGATGACCCAGAGCCCCAGCAGCCTGACCGTGACAGCCGGGGAAAAGGTGACCATGAGCTGCAAGAGCAGCCAGAGCCTGCTGAACAGCGGCAACCAGAAGAACTACCTGACCTGGTATCAGCAGAAGCCCGGCCAGCCCCCCAAGCTGCTGATCTACTGGGCAGCACCCGGGAGAGCGGCGTGCCCGACCGGTTTACCGGCTCCGGCTCCG GCACCGACTTCACCCTGACCATCAGCAGCGTGCAGGCCGAGGACCTGGCCGTGTATTACTGTCAGAACGACTACAGCTACCCCTTCACCTTCGGCAGCGGCACCAAGCTGGAAATCAAGAGCGGAGGGGGAGGATCCGATATCAAGCTGCAGCAGCGGAGCTGAACTGGCTAGGCCAGGCCGCCTCCGTGAAGATGAGCTGTAAGACCTCCGGCTATACCTTTACCCGGTAC ACCATGCACTGGGTGAAACAGAGGCCCGGACAGGGGCTGGAATGGATTGGCTATATCAACCCCTCCCGGGGCTACACAAATTACAATCAGAAATTCAAAGATAAAGCCACACTGACAACCGACAAGTCCAGCTCCACAGCCTATATGCAGCTGTCCTCCCTGACCAGCGAGGACTCTGCCGTGTACTATTGCGCCCGGTACTACGACGACCACTACAGCCTGGATTATTGGGG GCAGGGGACAACACTGACAGTCTCCAGCGTGGAGGGCGGCAGCGGAGGATCTGGCGGGAGCGGCGGCTCTGGGGGCGTCGACGACATCCAGCTGACCCAGTCCCCCCATCATGAGCGCCAGCCCTGGCGAGAAGGTGACAATGACCTGCCGGGCCAAGCAGCAGCGTGTGTACATGAATTGGTATCAGCAGAAAAGCGGCACCAGCCCCAAGCGGTGGATCTAC GACACCAGCAAGGTGGCCTCCGGCGTGCCCTACAGATTCTCCGGCTCCGGCTCTGGCACCAGCTACAGCCTGACAATTTCTAGCATGGAAGCCGAGGACGCCGCCACCTACTACTGCCAGCAGTGGAGCAGCAACCCCCCTGACCTTTGGCGCCGGAACAAAGCTGGAACTGAAGTGA

Example 9 Comparison of specific lysis activity of four CLDN18.2 x CD3-bstb in in vitro cytotoxicity assays.

Proteins bstb_5730/5728, bstb_5731/5729, bstb_5732/5728 and bstb_5733/5729 (all including labels but without disulfide bridges in scFv fragments) were prepared and purified as described in Example 1b and c. Prior to separation of high monomeric compounds by SEC, protein functionality (50-77% monomeric compounds) was examined in an in vitro luciferase cytotoxicity assay, essentially as described in Example 2a. Deviations are described below.

In this example, the human gastric cancer cell line NUGC-4_hCLDN18.2 stably expressing luciferase and CLDN18.2 was used as the target cell line. The CLDN18.2-negative human breast carcinoma cell line MDA-MB-231 served as a specificity control. PBMC effector cells and target cells were incubated with a 10-point, 10-fold series of serial dilutions of bstb proteins over a concentration range of 47.44 to 47.44 nM.

As shown in FIG. 11, all four CLDN18.2 x CD3-bstb molecules (FIG. 10B) resulted in efficient lysis of NUGC-4_hCLDN18.2 cells after 48 hours of co-incubation in the exemplary assay. A maximum of 93% of target cells were lysed. No lysis was observed with the CLDN18.2 negative control cell line MDA-MB-231. With respect to pre-SEC monomer content and performance in cytotoxicity assays, two bstb variants bstb_5730/5728 and bstb_5731/5729 carrying a C _H 1 IgG1 fragment were selected for further studies unlabeled and with or without disulfide bridges in the scFv fragments.

Example 10 Comparison of the physicochemical properties of unlabeled purified CLDN18.2 x CD3-bstb.

Cell culture supernatants of transiently transfected Expi293 ^TM cells containing bstb_5745/5747, bstb_5746/5748, bstb_5749/5751, or bstb_5750/5752 proteins were filtered using Supracap ^TM 50 deep filtration capsules (Pall Corporation, Port Washington, NY, USA). ) and then subjected to protein purification.

To analyze the aggregation status of various purified CLDN18.2 x CD3-bstb proteins, we performed size exclusion high performance liquid chromatography (SE-HPLC) using a Dionex Ultimate 3000 (Thermo Scientific) with a TSKgel G3000SWxl (300 × 7.8) mm size exclusion column, Tosoh bioscience). The column was washed with SE-HPLC buffer (0.3 M Na ₂ HPO ₄ , pH 7.2) and bstb protein was isolated by isocratic elution. While bstb_5745/5747 and bstb_5746/5748 showed relatively low amounts of monomeric proteins (~60% and ~40%, respectively), bstb_5749/5751 and bstb_5750/5752 were highly monomeric after purification (~96% and ~89%, respectively )) (FIGS. 12 A and B). In addition, short-term storage of bstb_5745/5747 and bstb_5746/5748 at room temperature resulted in the formation of visible aggregates.

Bstb_5745/5747 and bstb_5749/5751, and bstb_5746/5748 and bstb_5750/5752 each differ in only two amino acids of the corresponding anti-CLDN18.2 scFv fragment, which allows the formation of a disulfide bridge in the anti-CLDN18.2 scFv fragments from bstb_5749/5751 and bstb_5 750/ 5752. This introduction of an additional disulfide bridge into the anti-CLDN18.2 fragments of scFv promotes the formation of a monomeric protein, thus improving the physicochemical properties of the corresponding bstb.

All bstb variants after initial purification were dialyzed in PBS and finally subjected to preparative SEC using a HiLoad 26/600 Superdex 200 pg column (GE Healthcare Life Sciences) to enrich the monomer fraction to ~100% for further activity and binding characterization.

Example 11 Direct comparison of the activity of CLDN18.2 x CD3 bstb and bi-(scFv) ₂ proteins

Monomeric proteins bstb_5749/5751 and bstb_5750/5752 (all including disulfide bridges in scFv fragments) and their corresponding bi-(scFv) ₂ analogs bi-scFv_5506 and bi-scFv_5538 (without disulfide bridges) were investigated in an in vitro cytotoxicity assay with luciferase also as described in Example 9. In addition to that previously described, a 10-point 5-fold series of serial dilutions was used over a concentration range of 24.64 fM to 48.11 nM. In addition, a reference was included on each plate for normalization. The Bstb and bi-(scFv) ₂ proteins were used at equimolar concentrations.

Bstb_5750/5752 shows a 1.8-fold lower EC50 (40.63 pM) than bstb_5749/5751 (70.94 pM) (Fig. 13A, left panel), thus indicating a slightly higher activity of the first bstb. Both bstb proteins resulted in effective lysis of ~95% of target cells at the highest concentration. Lysis with the CLDN18.2-negative control cell line MDA-MB-231 was not observed (data not shown). Interestingly, the corresponding bi-(scFv) ₂ analogues of bi-scFv_5506 and bi-scFv_5538 (FIG. 13A, right panel) present a significant difference in EC50 values of 9.99 pM and 777.20 pM, respectively. Subsequently, the EC50 values were normalized to the plate reference (bi-scFv_5376), and the fold difference calculated with the EC50 of bi-(scFv) ₂ was taken as 1. Surprisingly, the EC50 of bstb_5749/5751 is 6 times higher compared to bi-scFv_5506 , indicating a loss of activity ~80% of the first (Fig. 13B, left graph). On the other hand, the EC50 of bstb_5750/5752 is 23 times lower compared to bi-scFv_5538, implying a >2000% increase in activity when using the bstb format (FIG. 13B, right panel).

Taken together, switching from monovalent to bivalent, depending on the binding domains used and their orientation, can improve the activity of the bispecific antibody, as demonstrated by the dramatic increase in activity of bstb_5750/5752 compared to bi-scFv_5538. In addition, protein characteristics in the bstb format may be superior to the bi-(scFv) ₂ format in terms of stability.

Example 12 Derivation of bispecific antibodies based on IVT mRNA targeting CLDN6 and CD3.

A. Cloning of vectors with bstb IVT-mRNA template and synthesis of IVT-mRNA

To generate CLDN6 x CD3 bispecific chimeric TriMAB (bstb) as an in vitro transcribed messenger RNA (IVT mRNA), we subcloned the DNA sequences bstb_369/367 and bstb_371/367 (described in Example 1) into a vector with IVT mRNA template pST1- TEV-MCS-FI (BioNTech AG, Mainz, Germany) using standard techniques. The TEV leader sequence has been described elsewhere (Zeenko und Gallie 2005; Weingarten-Gabbay et al. 2016; Gallie et al. 1995) and the FI sequence is described in the patent application 3'UTR Sequences for RNA Stabilization (PCT/EP2015 /073180). The following constructs were obtained to obtain bstb molecules:

Bstb_435/434:

pST1–5'TEV–Sec–V _H ^αCD3 –C _H 1(IgG1)–V _H ^αCLDN6 –V _L ^αCLDN6 –6xHis-tag–FI–A30linkerA70 (Fd) pST1–5'TEV–Sec–V _L ^αCD3 –C _L –V _H ^αCLDN6 –V _L ^αCLDN6 –Strep-tag–FI–A30linkerA70 (L)

Bstb_436/434:

pST1–5'TEV–Sec–V _H ^αCD3 –C _H 1(IgG2)–V _H ^αCLDN6 –V _L ^αCLDN6 –6xHis-tag–FI–A30linkerA70 (Fd) pST1–5'TEV–Sec-V _L ^αCD3 –C _L –V _H ^αCLDN6 –V _L ^αCLDN6 –Strep-tag–FI–A30linkerA70 (L)

A = adenine, Fd = hydrolysable fragment (Fab heavy chain part), FI = 3'UTR sequence, L = Fab light chain part, Sec = secretion signal, 5'TEV = 5'UTR from tobacco etch virus.

Table 10 summarizes information on the CLDN6 TAA-specific bstb constructs that have been generated in the course of the invention. Specificity information, sequence origin from monoclonal antibodies (Mab), codon usage, additional sequence functions are listed. The sequences encoding the variable domains of the target cell binding fragments were originally obtained from Ganymed Pharmaceuticals AG.

Table 10. Summary of characteristics of antibodies to CLDN6 x CD3-bstb

internal name Specificity Origin of scFv
region V _H -V _L Origin of the Fab V _H -V _L region Codon usage _CH 1 label Bstb_435/434
(SEQ ID NO: 79/78) HS IMAB206-SUBW TR66(C114S) CG IgG1 His/Strp Bstb_436/434
(SEQ ID NO: 80/78) HS IMAB206-SUBW TR66(C114S) CG IgG2 His/Strp

Bstb denotes bispecific TriMABs; C, cysteine; C _H 1, heavy chain constant region 1; CG, Cricetulus griseus; IMAB, ideal monoclonal antibody; His, 6xHis-label; HS, Homo sapiens; IgG, immunoglobulin G; S, serine; Strp, Strep label; W, tryptophan.

b. Synthesis of IVT-mRNA

To create templates for in vitro transcription, plasmid DNAs were linearized downstream of the region encoding the poly(A) tail using a class II restriction endonuclease, thus obtaining a template for RNA transcription without additional nucleotides after the poly(A) tail (Holtkamp et al. 2006 ). Linearized template DNAs were purified, quantified spectrophotometrically and then subjected to in vitro transcription using T7 RNA polymerase essentially as described previously (Grudzien-Nogalska et al. 2013) in the presence of 7.5 mM each of ATP, CTP, UTP , 1.5 mM GTP and 6 mM beta-S-ARCA (D2) cap analog (Kuhn et al. 2010). RNA was purified using magnetic particles (Berensmeier 2006). Non-immunogenic RNA was used for in vivo studies. To this end, N1-methylpseuduridine-5'-triphosphate (TriLink Biotechnologies, San Diego, CA, USA) was included instead of UTP and double-stranded RNA was removed. RNA was enzymatically capped using the ScriptCap m7G Capping System and 2'-methyltransferase (CellScript, Madison, Wisconsin, USA). RNA concentration and quality were assessed by spectrophotometry and analysis on a 2100 Bioanalyzer (Agilent, Santa Clara, CA, USA). A sketch of the two IVT mRNAs required to form a complete bstb molecule is shown in FIG. 14.

Example 13 Determination of the specific lysis activity of bstb_435/434 and bstb_436/434 in in vitro cytotoxicity assays

A. Electroporation of producer cells

To obtain bstb protein from IVT-mRNA, 4×10 ⁶ K-562 cells (ATCC CCL-243, LGC Standards GmbH, Wesel, Germany) per ml growing in log phase were subjected to electroporation with H ₂ O (negative control) or with 25 μg/ml IVT-mRNA per bstb strand in 0.4 mm cuvettes using a GenePulser MXCell (Bio-Rad Laboratories Dreieich, Germany) with the following settings: 200 V, 2 pulses, 8 ms. The cells were then seeded in complete culture medium at a density of 5×10 ⁵ /ml in 6-well tissue culture plates. After 48 hours of incubation, the supernatant was collected by centrifugation and sterile filtered using 0.2 μm Minisart NML syringe filters (Sartorius, Göttingen, Germany).

b. Quantification of bstb in the supernatant of producer cells by ELISA

Electroporated K-562 supernatants were subjected to a proprietary ELISA for quantitation. Briefly, MaxiSorp™ 96-well plates (Thermo Scientific, Braunschweig, Germany) were coated with 4.5 μg/ml goat anti-human IgG F(ab') ₂ (Abd Serotec, Puchheim, Germany) in DPBS for 1 hour at 37 °C, washed three times (wash buffer: PBS/0.05% Tween-20) and blocked at 2-8°C with 3% milk powder in DPBS overnight. After a washing step, a serial dilution of bstb_369/367 and bstb_371/367 proteins as reference and a serial dilution of K-562 supernatants containing bstb_435/434 and bstb_436/434 (diluent: 0.2% BSA) were added to the coated plate 3 times repeat. After 2 hours at room temperature, the plate was washed three times. To detect bstb associated with anti-F(ab') ₂ , 3.5 μg/ml mouse anti-IMAB206 (Ganymed Pharmaceuticals AG, Mainz, Germany) was added, incubated for 1 hour at room temperature and the plate was washed again three times . AP-conjugated goat anti-mouse IgG-Fc (Jackson ImmunoResearch, Newmarket, UK) at a 1:500 dilution was incubated for 1 hour at room temperature. For imaging, the plate was incubated with homemade pNPP substrate solution for 30 minutes at room temperature in the dark and finally the reaction was terminated with 3 M KOH. The assay was performed in a Tecan M200 microplate reader (Tecan, Mennedorf, Switzerland) at 405/492 nm. Data was analyzed using GraphPad Prism 6 software and Microsoft Excel 2010 (data not shown).

The concentration of 253 ng/ml bstb_435/434 and 427 ng/ml bstb_436/434 can be determined in the K-562 supernatant. Accordingly, both bstb were translated and secreted, but in different amounts. The amount of protein obtained is highly dependent on electroporation and varies from time to time. During various experiments, 1.0-1.7 times bstb_436/434 was produced compared to bstb_435/434.

c. Western blot analysis of producer cell lysate and supernatant

The supernatant and cell lysate of K-562 cells (Example 13a) were used to analyze the translation and secretion of bstb proteins. Cell lysates were prepared by incubating 1x10 ⁶ washed cells in 200 μl of 4x Lamley's buffer (Bio-Rad Laboratories) containing 20 units of benzonase (Merck Millipore, Darmstadt, Germany). The samples were then heated to 95°C for 10 min with (reducing conditions) or without (non-reducing conditions) 1M dithiothreitol (DTT, final concentration 0.1M). Supernatants were also treated with Laemmli's buffer. Prepared cell lysates and supernatants and corresponding purified bstb proteins were separated by polyacrylamide gel electrophoresis using 4-15% Criterion™ TGX Stain-Free™ gel (Bio-Rad Laboratories) followed by Western blot analysis (Fig. 15) according to standard procedures known to the person skilled in the art. Anti-6xHis tag antibodies conjugated with horseradish peroxidase (HRP) (1:10,000, Abcam, Cambridge, MA, USA), Strep MAB-Classic (1:10000, IBA GmbH, Göttingen, Germany) were used for Western blotting. ) and against beta actin (1:25,000, Abcam). Western blot membranes were recorded using Bio-Rad's Chemidoc MP Imaging System. Signals from bstb proteins were detected at 50–55 kDa under reducing conditions and at ~100 kDa under nonreducing conditions compared to an internal molecular weight standard. Bstb_435/436 (FIG. 15A) and bstb_436/434 (FIG. 15B) were mainly found in the supernatant, but also in the cell lysate, indicating incomplete secretion at the time of collection. The heterodimeric composition of bstb proteins becomes apparent under reducing conditions and detection with a mixture of anti-6xHis-tag HRP and Strep MAB-Classic HRP (Fig. 15C): Fd- and L-fragment differ by ~2 kDa in size (~51 kDa and ~49 kDa respectively). By quantifying protein bands corresponding to HMB and monomeric bstb found under non-reducing conditions, we determined 3% HMW and 88% bstb_435/434 monomeric compounds and 1.4% HMB and 92% bstb_436/434 monomeric compounds. Only a few smaller bands were found (total ~8% and ~6%, respectively), indicating slight degradation during cell culture.

Thus, both bstb can be efficiently translated from IVT mRNA and secreted into the cell culture supernatant. Bstb_436/434 shows a somewhat more favorable protein structure for HMB compounds and degradation products, but the percentage of HMW compounds is low for both bstb molecules.

d. Luciferase cytotoxicity assay and EC50 determination

The cytotoxicity assay was in principle carried out as described in Example 2a. Bstb proteins were used as a reference. K-562 supernatant of the sample from Example 1, 3 was diluted in K-562 mock supernatant (electroporation without IVT-mRNA). The L _min and L _max of the K-562 supernatant samples were supplemented with the mock-transfected K-562 supernatant.

20 µl of bstb in the supernatant was applied in a 7-point 5-fold series of serial dilutions from 33.1 fM to 516.5 pM for OV-90 and MDA-MB-231 cancer cells (stably transduced with luciferase), which were plated with PBMC as effector cells (E:T 5:1). After 48 hours of co-incubation, a luciferase solution was added for measurement and data was read from the plate.

As shown in FIG. 16, both bstb provide effective lysis of CLDN6 ⁺ OV-90, but not CLDN6 ^- MDA-MB-231. Maximum lysis approx. 77–80% was achieved at 516.5 pM bstb_436/434 and bstb_435/434, respectively. EC ₅₀ values show a 1.3 times higher activity in the case of bstb_435/434. EC ₅₀ values for RNA-translated bstb were 4-fold and 7.5-fold lower compared to the corresponding protein elements bstb_369/367 and bstb_371/367, respectively. This effect may be due to higher activity of the protein due to the absence of any further manipulation of the protein, due to the influence of HMW compounds, due to deviations in quantification, or a combination of both.

Thus, the RNA approach is feasible, highly efficient, and time-saving in terms of oversights in protein expression, purification, stability, and analysis.

Example 14 Performance of IVT-RNA Encoding Bispecific Antibodies Compared to Reference Proteins in a Mouse Xenograft Model.

To study the therapeutic potential of IVT-mRNA encoding bispecific antibodies bstb and bi-(scFv) _2, compared with reference proteins in vivo, the immunodeficient NOD mouse line was again selected. Cg-Prkd ^scid IL2rg ^tm1Wjl /SzJ or short NSG (Jackson laboratory , Bar Harbor, Maine, USA). All mice were used in accordance with the recommendations of the Committee for the Welfare of Laboratory Animals of the Johannes Gutenberg University, Mainz, Germany.

A. Treatment of progressive CLDN6-expressing tumors in mice with bstb and bi-(scFv) ₂ -coding IVT-RNA, compared with protein

The exemplary study used male and female NSG mice aged 6–25 weeks and weighing 18–38 g. CLDN6-positive OV-90 cells served as tumor cells and PBMC as effector cells.

5×10⁶ tumor cells were inoculated subcutaneously (s.c.) and 1×10⁷ PBMCs were administered intraperitoneally (i.p.) 19 days later. PBMC-inoculated mice - which were analyzed in peripheral blood six days after PBMC injection - were divided into groups according to tumor volume and sex (both sexes in all groups). Treatment was started eight days after PBMC injection at a fairly late tumor stage, with a mean tumor volume of ~250 mm³ per group. Mice were treated once a week with intravenous (i.v.) injections (injection schedule, Fig. 17A) into the retroorbital venous plexus. Groups "G1 - RNA-control", "G2 - bstb RNA" and "G3 - bi-scFv RNA" received 3 μg of IVT-mRNA in complex with TransIT®-mRNA Transfection Kit (Mirus Bio, Madison, Wisconsin, USA) in volume of 200 µl per mouse. Luciferase IVT-mRNA, bstb-coding RNAs representing CDLN6 x CD3 bstb Fd and LCT-strands of IVT-mRNA 435 and 434 (mixed 1:1) were used as controls, and bi- (scFv)₂-coding RNAs representing CDLN6 x CD3 bi-(scFv)₂ IVT-RNA 123r. All IVT-RNAs were synthesized according to example 1 2b in vivo. "G4 vehicle control" included six mice treated with DPBS and six mice treated with 10 mM NaOAc buffer pH 5.5 (bstb and bi-(scFv) preparation buffers).₂, respectively). "G5 protein - bstb" and "G6 protein - biscFF" were treated with protein analogs of IVT-mRNA elements. The Bstb protein was bstb_369/367 (dose 100 µg/kg, 5 µl/g bw) and bi-(scFv)₂ bi-scFv_123 protein (dose 200 µg/kg, 5 µl/g body weight). The treatment groups are shown in Table 11. Administration was carried out for four consecutive weeks. Twice a week, tumor dimensions were measured using a digital calibrated caliper and tumor volume was calculated using the formula: tumor volume [mm³] = Length [mm] × (width [mm]) 2/2. Mice were killed by displacement of the cervical vertebrae when the tumor volume reached 1500 mm³or in case of severe morbidity (mainly graft-versus-host (GVHD) symptoms).

Fig. 17B illustrates the effects of treatment on tumor growth. Antitumor efficacy was measured as tumor growth inhibition/reduction and survival compared to G1 RNA control group or G4 vehicle control. Treatment with test element bstb_435/434 (G2) resulted in tumor reduction in 8/9 mice and with test element bi-scFv_123r (G3) in 9/9 mice, in contrast to the G1 control group in which 0/10 mice had reduced tumor growth . Treatment with protein analogs (G5, G6) was similar for bstb, but less effective for bi-(scFv) ₂ . It is important to note that the proteins were administered according to an RNA injection schedule (once a week, i.v., meaning retro-orbital) for direct comparison, and not the established three times a week protein treatment schedule, ip Higher RNA efficacy likely , is caused by longer translation and secretion of the protein for several days, while the injected protein is rapidly removed. In vivo blood protein concentrations after RNA administration are unknown. Three mice G1-G3 were killed previously for the study of tumor infiltrating lymphocytes (TIL) by flow cytometry. For this, a suspension of individual tumor cells was stained with fluorescently labeled antibodies against human CD45 and CD3 (BD Biosciences, Heidelberg, Germany) and singlet cells of general tumors analyzed using a BD FACS CantoII flow cytometer. In the RNA control group, <3% of infiltrated human T cells were detected, while >7% and >12% of human T cells were detected in the bstb- and bi-(scFv) ₂ -RNA group, respectively (Fig. 17C) . These data show targeted infiltration of human T cells recruited by bispecific RNA-encoded antibodies.

b. Determination of the effect of therapy on body weight

The body weight of each mouse was examined once a week using a laboratory balance. No treatment-related weight loss was observed (data not shown).

Bibliography

Berensmeier, Sonja (2006): Magnetic particles for the separation and purification of nucleic acids. In: Applied microbiology and biotechnology 73(3), S. 495–504. DOI: 10.1007/s00253-006-0675-0.

Coligan, John E.; Bierer, Barbara E.; Margulies, David H.; Shevach, Ethan M.; Strober, Warren (2001a): Current Protocols in Immunology. Hoboken, NJ, USA: John Wiley & Sons, Inc.

Coligan, John E.; Dunn, Ben M.; Speicher, David W.; Wingfield, Paul T. (2001b): Current Protocols in Protein Science. Hoboken, NJ, USA: John Wiley & Sons, Inc.

Gallie, D. R.; Tanguay, R. L.; Leathers, V. (1995): The tobacco etch viral 5' leader and poly(A) tail are functionally synergistic regulators of translation. In: Gene 165(2), S. 233–238. DOI: 10.1016/0378-1119(95)00521-7.

Grudzien-Nogalska, Ewa; Kowalska, Joanna; Su, Wei; Kuhn, Andreas N.; Slepenkov, Sergey V.; Darzynkiewicz, Edward et al. (2013): Synthetic mRNAs with superior translation and stability properties. In: Methods in molecular biology (Clifton, N.J.) 969, S. 55–72. DOI: 10.1007/978-1-62703-260-5_4.

Holtkamp, S.; Kreiter, S.; Selmi, A.; Simon, P.; Koslowski, M.; Huber, C. et al. (2006): Modification of antigen-encoding RNA increases stability, translational efficacy, and T-cell stimulatory capacity of dendritic cells. In: Blood 108(13), S. 4009–4017. DOI: 10.1182/blood-2006-04-015024.

Kuhn, A. N.; Diken, M.; Kreiter, S.; Selmi, A.; Kowalska, J.; Jemielity, J. et al. (2010): Phosphorothioate cap analogs increase stability and translational efficiency of RNA vaccines in immature dendritic cells and induce superior immune responses in vivo. In: Gene Ther 17(8), S. 961–971. DOI: 10.1038/gt.2010.52.

Lanzavecchia, A.; Scheidegger, D. (1987): The use of hybrid hybridomas to target human cytotoxic T lymphocytes. In: EUR. J. Immunol. 17(1), S. 105–111. DOI: 10.1002/eji.1830170118.

Lutterbuese, Ralph; Raum, Tobias; Kischel, Roman; Hoffman, Patrick; Mangold, Susanne; Rattel, Benno et al. (2010): T cell-engaging BiTE antibodies specific for EGFR potently eliminate KRAS- and BRAF-mutated colorectal cancer cells. In: Proceedings of the National Academy of Sciences of the United States of America 107 (28), S. 12605–12610. DOI: 10.1073/pnas.1000976107.

Rothlisberger, Daniela; Honegger, Annemarie; Plückthun, Andreas (2005): Domain interactions in the Fab fragment: a comparative evaluation of the single-chain Fv and Fab format engineered with variable domains of different stability. In: Journal of molecular biology 347(4), S. 773–789. DOI: 10.1016/j.jmb.2005.01.053.

Stadler, Christiane R.; Bähr-Mahmud, Hayat; Plum, Laura M.; Schmoldt, Kathryn; Kolsch, Anne C.; Tureci, Ozlem; Sahin, Ugur (2015): Characterization of the first-in-class T-cell-engaging bispecific single-chain antibody for targeted immunotherapy of solid tumors expressing the oncofetal protein claudin 6. In: OncoImmunology 5 (3), S. e1091555. DOI: 10.1080/2162402X.2015.1091555.

Weingarten-Gabbay, Shira; Elias-Kirma, Shani; Nir, Ronit; Gritsenko, Alexey A.; Stern-Ginossar, Noam; Yakhini, Zohar et al. (2016): Comparative genetics. Systematic discovery of cap-independent translation sequences in human and viral genomes. In: Science (New York, N.Y.) 351 (6270). DOI: 10.1126/science.aad4939.

Woll, Stefan; Schlitter, Anna Melissa; Dhaene, Karl; Roller, Marc; Esposito, Irene; Sahin, Ugur; Tureci, Ozlem (2014): Claudin 18.2 is a target for IMAB362 antibody in pancreatic neoplasms. In: International journal of cancer 134 (3), S. 731–739. DOI: 10.1002/ijc.28400.

Zeenko, Vladimir; Gallie, Daniel R. (2005): Cap-independent translation of tobacco etch virus is conferred by an RNA pseudoknot in the 5'-leader. In: The Journal of biological chemistry 280 (29), S. 26813–26824. DOI: 10.1074/jbc.M503576200.

--->

SEQUENCE LIST

<110> BioNTech AG et al.

<120> AGENTS FOR TREATMENT OF CLAUDIN EXPRESSING CANCER DISEASES

<130> 674-180 PCT2

<150> PCT/EP2016/072688

<151> 2016-09-23

<160> 101

<170>PatentIn version 3.5

<210> 1

<211> 261

<212> PRT

<213> Homo sapiens

<400> 1

Met Ala Val Thr Ala Cys Gln Gly Leu Gly Phe Val Val Ser Leu Ile

1 5 10 15

Gly Ile Ala Gly Ile Ile Ala Ala Thr Cys Met Asp Gln Trp Ser Thr

20 25 30

Gln Asp Leu Tyr Asn Asn Pro Val Thr Ala Val Phe Asn Tyr Gln Gly

35 40 45

Leu Trp Arg Ser Cys Val Arg Glu Ser Ser Gly Phe Thr Glu Cys Arg

50 55 60

Gly Tyr Phe Thr Leu Leu Gly Leu Pro Ala Met Leu Gln Ala Val Arg

65 70 75 80

Ala Leu Met Ile Val Gly Ile Val Leu Gly Ala Ile Gly Leu Leu Val

85 90 95

Ser Ile Phe Ala Leu Lys Cys Ile Arg Ile Gly Ser Met Glu Asp Ser

100 105 110

Ala Lys Ala Asn Met Thr Leu Thr Ser Gly Ile Met Phe Ile Val Ser

115 120 125

Gly Leu Cys Ala Ile Ala Gly Val Ser Val Phe Ala Asn Met Leu Val

130 135 140

Thr Asn Phe Trp Met Ser Thr Ala Asn Met Tyr Thr Gly Met Gly Gly

145 150 155 160

Met Val Gln Thr Val Gln Thr Arg Tyr Thr Phe Gly Ala Ala Leu Phe

165 170 175

Val Gly Trp Val Ala Gly Gly Leu Thr Leu Ile Gly Gly Val Met Met

180 185 190

Cys Ile Ala Cys Arg Gly Leu Ala Pro Glu Glu Thr Asn Tyr Lys Ala

195 200 205

Val Ser Tyr His Ala Ser Gly His Ser Val Ala Tyr Lys Pro Gly Gly

210 215 220

Phe Lys Ala Ser Thr Gly Phe Gly Ser Asn Thr Lys Asn Lys Lys Ile

225 230 235 240

Tyr Asp Gly Gly Ala Arg Thr Glu Asp Glu Val Gln Ser Tyr Pro Ser

245 250 255

Lys His Asp Tyr Val

260

<210> 2

<211> 220

<212> PRT

<213> Homo sapiens

<400> 2

Met Ala Ser Ala Gly Met Gln Ile Leu Gly Val Val Leu Thr Leu Leu

1 5 10 15

Gly Trp Val Asn Gly Leu Val Ser Cys Ala Leu Pro Met Trp Lys Val

20 25 30

Thr Ala Phe Ile Gly Asn Ser Ile Val Val Ala Gln Val Val Trp Glu

35 40 45

Gly Leu Trp Met Ser Cys Val Val Gln Ser Thr Gly Gln Met Gln Cys

50 55 60

Lys Val Tyr Asp Ser Leu Leu Ala Leu Pro Gln Asp Leu Gln Ala Ala

65 70 75 80

Arg Ala Leu Cys Val Ile Ala Leu Leu Val Ala Leu Phe Gly Leu Leu

85 90 95

Val Tyr Leu Ala Gly Ala Lys Cys Thr Thr Cys Val Glu Glu Lys Asp

100 105 110

Ser Lys Ala Arg Leu Val Leu Thr Ser Gly Ile Val Phe Val Ile Ser

115 120 125

Gly Val Leu Thr Leu Ile Pro Val Cys Trp Thr Ala His Ala Ile Ile

130 135 140

Arg Asp Phe Tyr Asn Pro Leu Val Ala Glu Ala Gln Lys Arg Glu Leu

145 150 155 160

Gly Ala Ser Leu Tyr Leu Gly Trp Ala Ala Ser Gly Leu Leu Leu Leu

165 170 175

Gly Gly Gly Leu Leu Cys Cys Thr Cys Pro Ser Gly Gly Ser Gln Gly

180 185 190

Pro Ser His Tyr Met Ala Arg Tyr Ser Thr Ser Ala Pro Ala Ile Ser

195 200 205

Arg Gly Pro Ser Glu Tyr Pro Thr Lys Asn Tyr Val

210 215 220

<210> 3

<211> 220

<212> PRT

<213> Homo sapiens

<400> 3

Met Ala Ser Ala Gly Met Gln Ile Leu Gly Val Val Leu Thr Leu Leu

1 5 10 15

Gly Trp Val Asn Gly Leu Val Ser Cys Ala Leu Pro Met Trp Lys Val

20 25 30

Thr Ala Phe Ile Gly Asn Ser Ile Val Val Ala Gln Val Val Trp Glu

35 40 45

Gly Leu Trp Met Ser Cys Val Val Gln Ser Thr Gly Gln Met Gln Cys

50 55 60

Lys Val Tyr Asp Ser Leu Leu Ala Leu Pro Gln Asp Leu Gln Ala Ala

65 70 75 80

Arg Ala Leu Cys Val Ile Ala Leu Leu Val Ala Leu Phe Gly Leu Leu

85 90 95

Val Tyr Leu Ala Gly Ala Lys Cys Thr Thr Cys Val Glu Glu Lys Asp

100 105 110

Ser Lys Ala Arg Leu Val Leu Thr Ser Gly Ile Val Phe Val Ile Ser

115 120 125

Gly Val Leu Thr Leu Ile Pro Val Cys Trp Thr Ala His Ala Val Ile

130 135 140

Arg Asp Phe Tyr Asn Pro Leu Val Ala Glu Ala Gln Lys Arg Glu Leu

145 150 155 160

Gly Ala Ser Leu Tyr Leu Gly Trp Ala Ala Ser Gly Leu Leu Leu Leu

165 170 175

Gly Gly Gly Leu Leu Cys Cys Thr Cys Pro Ser Gly Gly Ser Gln Gly

180 185 190

Pro Ser His Tyr Met Ala Arg Tyr Ser Thr Ser Ala Pro Ala Ile Ser

195 200 205

Arg Gly Pro Ser Glu Tyr Pro Thr Lys Asn Tyr Val

210 215 220

<210> 4

<211> 207

<212> PRT

<213> Homo sapiens

<400> 4

Met Gln Ser Gly Thr His Trp Arg Val Leu Gly Leu Cys Leu Leu Ser

1 5 10 15

Val Gly Val Trp Gly Gln Asp Gly Asn Glu Glu Met Gly Gly Ile Thr

20 25 30

Gln Thr Pro Tyr Lys Val Ser Ile Ser Gly Thr Thr Val Ile Leu Thr

35 40 45

Cys Pro Gln Tyr Pro Gly Ser Glu Ile Leu Trp Gln His Asn Asp Lys

50 55 60

Asn Ile Gly Gly Asp Glu Asp Asp Lys Asn Ile Gly Ser Asp Glu Asp

65 70 75 80

His Leu Ser Leu Lys Glu Phe Ser Glu Leu Glu Gln Ser Gly Tyr Tyr

85 90 95

Val Cys Tyr Pro Arg Gly Ser Lys Pro Glu Asp Ala Asn Phe Tyr Leu

100 105 110

Tyr Leu Arg Ala Arg Val Cys Glu Asn Cys Met Glu Met Asp Val Met

115 120 125

Ser Val Ala Thr Ile Val Ile Val Asp Ile Cys Ile Thr Gly Gly Leu

130 135 140

Leu Leu Leu Val Tyr Tyr Trp Ser Lys Asn Arg Lys Ala Lys Ala Lys

145 150 155 160

Pro Val Thr Arg Gly Ala Gly Ala Gly Gly Arg Gln Arg Gly Gln Asn

165 170 175

Lys Glu Arg Pro Pro Pro Val Pro Asn Pro Asp Tyr Glu Pro Ile Arg

180 185 190

Lys Gly Gln Arg Asp Leu Tyr Ser Gly Leu Asn Gln Arg Arg Ile

195 200 205

<210> 5

<211> 119

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 5

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr

20 25 30

Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Thr Leu Thr Val Ser Ser

115

<210> 6

<211> 106

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 6

Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly

1 5 10 15

Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met

20 25 30

Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr

35 40 45

Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly Ser

50 55 60

Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu

65 70 75 80

Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu Thr

85 90 95

Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys

100 105

<210> 7

<211> 117

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 7

Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr

20 25 30

Thr Met Asn Trp Val Lys Gln Ser His Gly Lys Asn Leu Glu Trp Ile

35 40 45

Gly Leu Ile Asn Pro Tyr Asn Gly Gly Thr Ile Tyr Asn Gln Lys Phe

50 55 60

Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Asp Tyr Gly Phe Val Leu Asp Tyr Trp Gly Gln Gly Thr Thr

100 105 110

Leu Thr Val Ser Ser

115

<210> 8

<211> 117

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 8

Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr

20 25 30

Thr Met Asn Trp Val Lys Gln Ser His Gly Lys Cys Leu Glu Trp Ile

35 40 45

Gly Leu Ile Asn Pro Tyr Asn Gly Gly Thr Ile Tyr Asn Gln Lys Phe

50 55 60

Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Asp Tyr Gly Phe Val Leu Asp Tyr Trp Gly Gln Gly Thr Thr

100 105 110

Leu Thr Val Ser Ser

115

<210> 9

<211> 107

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 9

Gln Ile Val Leu Thr Gln Ser Pro Ser Ile Met Ser Val Ser Pro Gly

1 5 10 15

Glu Lys Val Thr Ile Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met

20 25 30

His Trp Phe Gln Gln Lys Pro Gly Thr Ser Pro Lys Leu Cys Ile Tyr

35 40 45

Ser Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Arg

50 55 60

Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Val Ala Ala Glu

65 70 75 80

Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Arg Ser Asn Tyr Pro Pro Trp

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105

<210> 10

<211> 107

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 10

Gln Ile Val Leu Thr Gln Ser Pro Ser Ile Met Ser Val Ser Pro Gly

1 5 10 15

Glu Lys Val Thr Ile Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met

20 25 30

His Trp Phe Gln Gln Lys Pro Gly Thr Ser Pro Lys Leu Trp Ile Tyr

35 40 45

Ser Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Arg

50 55 60

Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Val Ala Ala Glu

65 70 75 80

Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Arg Ser Asn Tyr Pro Pro Trp

85 90 95

Thr Phe Gly Cys Gly Thr Lys Leu Glu Ile Lys

100 105

<210> 11

<211> 117

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 11

Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr

20 25 30

Thr Met Asn Trp Val Lys Gln Ser His Gly Lys Asn Leu Glu Trp Ile

35 40 45

Gly Leu Ile Asn Pro Tyr Asn Gly Gly Thr Ser Tyr Asn Gln Lys Phe

50 55 60

Lys Gly Lys Ala Thr Leu Thr Ile Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Asp Tyr Gly Tyr Val Leu Asp Tyr Trp Gly Gln Gly Thr Thr

100 105 110

Leu Thr Val Ser Ser

115

<210> 12

<211> 107

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 12

Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly

1 5 10 15

Glu Lys Val Thr Ile Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Leu

20 25 30

His Trp Phe Gln Gln Lys Pro Gly Thr Ser Pro Lys Leu Trp Val Tyr

35 40 45

Ser Thr Ser Asn Leu Pro Ser Gly Val Pro Ala Arg Phe Gly Gly Ser

50 55 60

Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Met Glu Ala Glu

65 70 75 80

Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Arg Ser Ile Tyr Pro Pro Trp

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105

<210> 13

<211> 244

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 13

Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr

20 25 30

Thr Met Asn Trp Val Lys Gln Ser His Gly Lys Cys Leu Glu Trp Ile

35 40 45

Gly Leu Ile Asn Pro Tyr Asn Gly Gly Thr Ile Tyr Asn Gln Lys Phe

50 55 60

Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Asp Tyr Gly Phe Val Leu Asp Tyr Trp Gly Gln Gly Thr Thr

100 105 110

Leu Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Ile Val Leu Thr Gln Ser

130 135 140

Pro Ser Ile Met Ser Val Ser Pro Gly Glu Lys Val Thr Ile Thr Cys

145 150 155 160

Ser Ala Ser Ser Ser Val Ser Tyr Met His Trp Phe Gln Gln Lys Pro

165 170 175

Gly Thr Ser Pro Lys Leu Trp Ile Tyr Ser Thr Ser Asn Leu Ala Ser

180 185 190

Gly Val Pro Ala Arg Phe Ser Gly Arg Gly Ser Gly Thr Ser Tyr Ser

195 200 205

Leu Thr Ile Ser Arg Val Ala Ala Glu Asp Ala Ala Thr Tyr Tyr Cys

210 215 220

Gln Gln Arg Ser Asn Tyr Pro Pro Trp Thr Phe Gly Cys Gly Thr Lys

225 230 235 240

Leu Glu Ile Lys

<210> 14

<211> 493

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 14

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr

20 25 30

Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Thr Leu Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe

115 120 125

Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu

130 135 140

Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp

145 150 155 160

Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu

165 170 175

Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser

180 185 190

Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro

195 200 205

Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Ser Gly

210 215 220

Pro Gly Gly Gly Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

225 230 235 240

Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

245 250 255

Ser Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr

260 265 270

Thr Met Asn Trp Val Lys Gln Ser His Gly Lys Cys Leu Glu Trp Ile

275 280 285

Gly Leu Ile Asn Pro Tyr Asn Gly Gly Thr Ile Tyr Asn Gln Lys Phe

290 295 300

Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

305 310 315 320

Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

325 330 335

Ala Arg Asp Tyr Gly Phe Val Leu Asp Tyr Trp Gly Gln Gly Thr Thr

340 345 350

Leu Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

355 360 365

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Ile Val Leu Thr Gln Ser

370 375 380

Pro Ser Ile Met Ser Val Ser Pro Gly Glu Lys Val Thr Ile Thr Cys

385 390 395 400

Ser Ala Ser Ser Ser Val Ser Tyr Met His Trp Phe Gln Gln Lys Pro

405 410 415

Gly Thr Ser Pro Lys Leu Trp Ile Tyr Ser Thr Ser Asn Leu Ala Ser

420 425 430

Gly Val Pro Ala Arg Phe Ser Gly Arg Gly Ser Gly Thr Ser Tyr Ser

435 440 445

Leu Thr Ile Ser Arg Val Ala Ala Glu Asp Ala Ala Thr Tyr Tyr Cys

450 455 460

Gln Gln Arg Ser Asn Tyr Pro Pro Trp Thr Phe Gly Cys Gly Thr Lys

465 470 475 480

Leu Glu Ile Lys Gly Gly Ser His His His His His His

485 490

<210> 15

<211> 493

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 15

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr

20 25 30

Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Thr Leu Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe

115 120 125

Pro Leu Ala Pro Cys Ser Lys Ser Thr Ser Glu Gly Thr Ala Ala Leu

130 135 140

Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp

145 150 155 160

Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu

165 170 175

Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser

180 185 190

Ser Asn Phe Gly Thr Gln Thr Tyr Thr Cys Asn Val Asp His Lys Pro

195 200 205

Ser Asn Thr Lys Val Asp Lys Thr Val Glu Pro Lys Ser Ala Ser Gly

210 215 220

Pro Gly Gly Gly Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

225 230 235 240

Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

245 250 255

Ser Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr

260 265 270

Thr Met Asn Trp Val Lys Gln Ser His Gly Lys Cys Leu Glu Trp Ile

275 280 285

Gly Leu Ile Asn Pro Tyr Asn Gly Gly Thr Ile Tyr Asn Gln Lys Phe

290 295 300

Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

305 310 315 320

Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

325 330 335

Ala Arg Asp Tyr Gly Phe Val Leu Asp Tyr Trp Gly Gln Gly Thr Thr

340 345 350

Leu Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

355 360 365

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Ile Val Leu Thr Gln Ser

370 375 380

Pro Ser Ile Met Ser Val Ser Pro Gly Glu Lys Val Thr Ile Thr Cys

385 390 395 400

Ser Ala Ser Ser Ser Val Ser Tyr Met His Trp Phe Gln Gln Lys Pro

405 410 415

Gly Thr Ser Pro Lys Leu Trp Ile Tyr Ser Thr Ser Asn Leu Ala Ser

420 425 430

Gly Val Pro Ala Arg Phe Ser Gly Arg Gly Ser Gly Thr Ser Tyr Ser

435 440 445

Leu Thr Ile Ser Arg Val Ala Ala Glu Asp Ala Ala Thr Tyr Tyr Cys

450 455 460

Gln Gln Arg Ser Asn Tyr Pro Pro Trp Thr Phe Gly Cys Gly Thr Lys

465 470 475 480

Leu Glu Ile Lys Gly Gly Ser His His His His His His

485 490

<210> 16

<211> 473

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 16

Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly

1 5 10 15

Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met

20 25 30

Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr

35 40 45

Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly Ser

50 55 60

Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu

65 70 75 80

Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu Thr

85 90 95

Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg Thr Val Ala Ala Pro

100 105 110

Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr

115 120 125

Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys

130 135 140

Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu

145 150 155 160

Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser

165 170 175

Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala

180 185 190

Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe

195 200 205

Asn Arg Gly Glu Cys Asp Val Pro Gly Gly Ser Glu Val Gln Leu Gln

210 215 220

Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala Ser Met Lys Ile Ser

225 230 235 240

Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr Thr Met Asn Trp Val

245 250 255

Lys Gln Ser His Gly Lys Cys Leu Glu Trp Ile Gly Leu Ile Asn Pro

260 265 270

Tyr Asn Gly Gly Thr Ile Tyr Asn Gln Lys Phe Lys Gly Lys Ala Thr

275 280 285

Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Glu Leu Leu Ser

290 295 300

Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Asp Tyr Gly

305 310 315 320

Phe Val Leu Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

325 330 335

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

340 345 350

Gly Gly Gly Ser Gln Ile Val Leu Thr Gln Ser Pro Ser Ile Met Ser

355 360 365

Val Ser Pro Gly Glu Lys Val Thr Ile Thr Cys Ser Ala Ser Ser Ser

370 375 380

Val Ser Tyr Met His Trp Phe Gln Gln Lys Pro Gly Thr Ser Pro Lys

385 390 395 400

Leu Trp Ile Tyr Ser Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg

405 410 415

Phe Ser Gly Arg Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg

420 425 430

Val Ala Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Arg Ser Asn

435 440 445

Tyr Pro Pro Trp Thr Phe Gly Cys Gly Thr Lys Leu Glu Ile Lys Ser

450 455 460

Ala Trp Ser His Pro Gln Phe Glu Lys

465 470

<210> 17

<211> 484

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 17

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr

20 25 30

Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Thr Leu Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe

115 120 125

Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu

130 135 140

Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp

145 150 155 160

Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu

165 170 175

Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser

180 185 190

Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro

195 200 205

Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Ser Gly

210 215 220

Pro Gly Gly Gly Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

225 230 235 240

Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

245 250 255

Ser Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr

260 265 270

Thr Met Asn Trp Val Lys Gln Ser His Gly Lys Cys Leu Glu Trp Ile

275 280 285

Gly Leu Ile Asn Pro Tyr Asn Gly Gly Thr Ile Tyr Asn Gln Lys Phe

290 295 300

Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

305 310 315 320

Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

325 330 335

Ala Arg Asp Tyr Gly Phe Val Leu Asp Tyr Trp Gly Gln Gly Thr Thr

340 345 350

Leu Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

355 360 365

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Ile Val Leu Thr Gln Ser

370 375 380

Pro Ser Ile Met Ser Val Ser Pro Gly Glu Lys Val Thr Ile Thr Cys

385 390 395 400

Ser Ala Ser Ser Ser Val Ser Tyr Met His Trp Phe Gln Gln Lys Pro

405 410 415

Gly Thr Ser Pro Lys Leu Trp Ile Tyr Ser Thr Ser Asn Leu Ala Ser

420 425 430

Gly Val Pro Ala Arg Phe Ser Gly Arg Gly Ser Gly Thr Ser Tyr Ser

435 440 445

Leu Thr Ile Ser Arg Val Ala Ala Glu Asp Ala Ala Thr Tyr Tyr Cys

450 455 460

Gln Gln Arg Ser Asn Tyr Pro Pro Trp Thr Phe Gly Cys Gly Thr Lys

465 470 475 480

Leu Glu Ile Lys

<210> 18

<211> 484

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 18

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr

20 25 30

Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Thr Leu Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe

115 120 125

Pro Leu Ala Pro Cys Ser Lys Ser Thr Ser Glu Gly Thr Ala Ala Leu

130 135 140

Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp

145 150 155 160

Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu

165 170 175

Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser

180 185 190

Ser Asn Phe Gly Thr Gln Thr Tyr Thr Cys Asn Val Asp His Lys Pro

195 200 205

Ser Asn Thr Lys Val Asp Lys Thr Val Glu Pro Lys Ser Ala Ser Gly

210 215 220

Pro Gly Gly Gly Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

225 230 235 240

Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

245 250 255

Ser Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr

260 265 270

Thr Met Asn Trp Val Lys Gln Ser His Gly Lys Cys Leu Glu Trp Ile

275 280 285

Gly Leu Ile Asn Pro Tyr Asn Gly Gly Thr Ile Tyr Asn Gln Lys Phe

290 295 300

Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

305 310 315 320

Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

325 330 335

Ala Arg Asp Tyr Gly Phe Val Leu Asp Tyr Trp Gly Gln Gly Thr Thr

340 345 350

Leu Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

355 360 365

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Ile Val Leu Thr Gln Ser

370 375 380

Pro Ser Ile Met Ser Val Ser Pro Gly Glu Lys Val Thr Ile Thr Cys

385 390 395 400

Ser Ala Ser Ser Ser Val Ser Tyr Met His Trp Phe Gln Gln Lys Pro

405 410 415

Gly Thr Ser Pro Lys Leu Trp Ile Tyr Ser Thr Ser Asn Leu Ala Ser

420 425 430

Gly Val Pro Ala Arg Phe Ser Gly Arg Gly Ser Gly Thr Ser Tyr Ser

435 440 445

Leu Thr Ile Ser Arg Val Ala Ala Glu Asp Ala Ala Thr Tyr Tyr Cys

450 455 460

Gln Gln Arg Ser Asn Tyr Pro Pro Trp Thr Phe Gly Cys Gly Thr Lys

465 470 475 480

Leu Glu Ile Lys

<210> 19

<211> 463

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 19

Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly

1 5 10 15

Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met

20 25 30

Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr

35 40 45

Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly Ser

50 55 60

Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu

65 70 75 80

Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu Thr

85 90 95

Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg Thr Val Ala Ala Pro

100 105 110

Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr

115 120 125

Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys

130 135 140

Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu

145 150 155 160

Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser

165 170 175

Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala

180 185 190

Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe

195 200 205

Asn Arg Gly Glu Cys Asp Val Pro Gly Gly Ser Glu Val Gln Leu Gln

210 215 220

Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala Ser Met Lys Ile Ser

225 230 235 240

Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr Thr Met Asn Trp Val

245 250 255

Lys Gln Ser His Gly Lys Cys Leu Glu Trp Ile Gly Leu Ile Asn Pro

260 265 270

Tyr Asn Gly Gly Thr Ile Tyr Asn Gln Lys Phe Lys Gly Lys Ala Thr

275 280 285

Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Glu Leu Leu Ser

290 295 300

Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Asp Tyr Gly

305 310 315 320

Phe Val Leu Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

325 330 335

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

340 345 350

Gly Gly Gly Ser Gln Ile Val Leu Thr Gln Ser Pro Ser Ile Met Ser

355 360 365

Val Ser Pro Gly Glu Lys Val Thr Ile Thr Cys Ser Ala Ser Ser Ser

370 375 380

Val Ser Tyr Met His Trp Phe Gln Gln Lys Pro Gly Thr Ser Pro Lys

385 390 395 400

Leu Trp Ile Tyr Ser Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg

405 410 415

Phe Ser Gly Arg Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg

420 425 430

Val Ala Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Arg Ser Asn

435 440 445

Tyr Pro Pro Trp Thr Phe Gly Cys Gly Thr Lys Leu Glu Ile Lys

450 455 460

<210> 20

<211> 118

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 20

Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Thr Arg Ser Trp Arg Gly Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Leu Thr Val Ser Ser

115

<210> 21

<211> 118

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 21

Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Cys Leu Glu Trp Ile

35 40 45

Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Thr Arg Ser Trp Arg Gly Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Leu Thr Val Ser Ser

115

<210> 22

<211> 113

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 22

Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly

1 5 10 15

Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser

20 25 30

Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln

35 40 45

Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val

50 55 60

Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr

65 70 75 80

Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn

85 90 95

Asp Tyr Ser Tyr Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile

100 105 110

Lys

<210> 23

<211> 113

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 23

Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly

1 5 10 15

Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser

20 25 30

Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln

35 40 45

Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val

50 55 60

Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr

65 70 75 80

Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn

85 90 95

Asp Tyr Ser Tyr Pro Phe Thr Phe Gly Cys Gly Thr Lys Leu Glu Ile

100 105 110

Lys

<210> 24

<211> 116

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 24

Gln Ile Gln Leu Val Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu

1 5 10 15

Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr

20 25 30

Gly Met Asn Trp Val Lys Gln Ala Pro Gly Lys Gly Leu Lys Trp Met

35 40 45

Gly Trp Ile Asn Thr Asn Thr Gly Glu Pro Thr Tyr Ala Glu Glu Phe

50 55 60

Lys Gly Arg Phe Ala Phe Ser Leu Glu Thr Ser Ala Ser Thr Ala Tyr

65 70 75 80

Leu Gln Ile Asn Asn Leu Lys Asn Glu Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Leu Gly Phe Gly Asn Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Ser Val Thr Val

115

<210> 25

<211> 113

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 25

Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly

1 5 10 15

Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser

20 25 30

Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln

35 40 45

Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val

50 55 60

Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr

65 70 75 80

Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn

85 90 95

Asp Tyr Ser Tyr Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu

100 105 110

Lys

<210> 26

<211> 251

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 26

Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Thr Arg Ser Trp Arg Gly Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Leu Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln

130 135 140

Ser Pro Ser Ser Leu Thr Val Thr Ala Gly Glu Lys Val Thr Met Ser

145 150 155 160

Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn Tyr

165 170 175

Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

180 185 190

Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Thr Gly

195 200 205

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Val Gln Ala

210 215 220

Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn Asp Tyr Ser Tyr Pro Phe

225 230 235 240

Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys

245 250

<210> 27

<211> 256

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 27

Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly

1 5 10 15

Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser

20 25 30

Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln

35 40 45

Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val

50 55 60

Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr

65 70 75 80

Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn

85 90 95

Asp Tyr Ser Tyr Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile

100 105 110

Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln

130 135 140

Pro Gly Ala Glu Leu Val Arg Pro Gly Ala Ser Val Lys Leu Ser Cys

145 150 155 160

Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Ile Asn Trp Val Lys

165 170 175

Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Asn Ile Tyr Pro Ser

180 185 190

Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu

195 200 205

Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Pro

210 215 220

Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Thr Arg Ser Trp Arg Gly

225 230 235 240

Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

245 250 255

<210> 28

<211> 251

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 28

Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Cys Leu Glu Trp Ile

35 40 45

Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Thr Arg Ser Trp Arg Gly Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Leu Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln

130 135 140

Ser Pro Ser Ser Leu Thr Val Thr Ala Gly Glu Lys Val Thr Met Ser

145 150 155 160

Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn Tyr

165 170 175

Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

180 185 190

Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Thr Gly

195 200 205

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Val Gln Ala

210 215 220

Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn Asp Tyr Ser Tyr Pro Phe

225 230 235 240

Thr Phe Gly Cys Gly Thr Lys Leu Glu Ile Lys

245 250

<210> 29

<211> 256

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 29

Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly

1 5 10 15

Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser

20 25 30

Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln

35 40 45

Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val

50 55 60

Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr

65 70 75 80

Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn

85 90 95

Asp Tyr Ser Tyr Pro Phe Thr Phe Gly Cys Gly Thr Lys Leu Glu Ile

100 105 110

Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln

130 135 140

Pro Gly Ala Glu Leu Val Arg Pro Gly Ala Ser Val Lys Leu Ser Cys

145 150 155 160

Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Ile Asn Trp Val Lys

165 170 175

Gln Arg Pro Gly Gln Cys Leu Glu Trp Ile Gly Asn Ile Tyr Pro Ser

180 185 190

Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu

195 200 205

Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Pro

210 215 220

Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Thr Arg Ser Trp Arg Gly

225 230 235 240

Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

245 250 255

<210> 30

<211> 500

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 30

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr

20 25 30

Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Thr Leu Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe

115 120 125

Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu

130 135 140

Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp

145 150 155 160

Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu

165 170 175

Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser

180 185 190

Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro

195 200 205

Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Ser Gly

210 215 220

Pro Gly Gly Gly Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

225 230 235 240

Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala

245 250 255

Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

260 265 270

Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

275 280 285

Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe

290 295 300

Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

305 310 315 320

Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

325 330 335

Thr Arg Ser Trp Arg Gly Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr

340 345 350

Thr Leu Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

355 360 365

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln

370 375 380

Ser Pro Ser Ser Leu Thr Val Thr Ala Gly Glu Lys Val Thr Met Ser

385 390 395 400

Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn Tyr

405 410 415

Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

420 425 430

Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Thr Gly

435 440 445

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Val Gln Ala

450 455 460

Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn Asp Tyr Ser Tyr Pro Phe

465 470 475 480

Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys Gly Gly Ser His His

485 490 495

His His His His

500

<210> 31

<211> 500

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 31

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr

20 25 30

Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Thr Leu Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe

115 120 125

Pro Leu Ala Pro Cys Ser Lys Ser Thr Ser Glu Gly Thr Ala Ala Leu

130 135 140

Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp

145 150 155 160

Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu

165 170 175

Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser

180 185 190

Ser Asn Phe Gly Thr Gln Thr Tyr Thr Cys Asn Val Asp His Lys Pro

195 200 205

Ser Asn Thr Lys Val Asp Lys Thr Val Glu Pro Lys Ser Ala Ser Gly

210 215 220

Pro Gly Gly Gly Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

225 230 235 240

Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala

245 250 255

Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

260 265 270

Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

275 280 285

Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe

290 295 300

Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

305 310 315 320

Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

325 330 335

Thr Arg Ser Trp Arg Gly Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr

340 345 350

Thr Leu Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

355 360 365

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln

370 375 380

Ser Pro Ser Ser Leu Thr Val Thr Ala Gly Glu Lys Val Thr Met Ser

385 390 395 400

Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn Tyr

405 410 415

Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

420 425 430

Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Thr Gly

435 440 445

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Val Gln Ala

450 455 460

Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn Asp Tyr Ser Tyr Pro Phe

465 470 475 480

Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys Gly Gly Ser His His

485 490 495

His His His His

500

<210> 32

<211> 480

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 32

Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly

1 5 10 15

Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met

20 25 30

Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr

35 40 45

Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly Ser

50 55 60

Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu

65 70 75 80

Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu Thr

85 90 95

Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg Thr Val Ala Ala Pro

100 105 110

Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr

115 120 125

Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys

130 135 140

Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu

145 150 155 160

Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser

165 170 175

Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala

180 185 190

Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe

195 200 205

Asn Arg Gly Glu Cys Asp Val Pro Gly Gly Ser Gln Val Gln Leu Gln

210 215 220

Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala Ser Val Lys Leu Ser

225 230 235 240

Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Ile Asn Trp Val

245 250 255

Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Asn Ile Tyr Pro

260 265 270

Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr

275 280 285

Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser

290 295 300

Pro Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Thr Arg Ser Trp Arg

305 310 315 320

Gly Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser

325 330 335

Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

340 345 350

Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu

355 360 365

Thr Val Thr Ala Gly Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln

370 375 380

Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln

385 390 395 400

Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr

405 410 415

Arg Glu Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr

420 425 430

Asp Phe Thr Leu Thr Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val

435 440 445

Tyr Tyr Cys Gln Asn Asp Tyr Ser Tyr Pro Phe Thr Phe Gly Ser Gly

450 455 460

Thr Lys Leu Glu Ile Lys Ser Ala Trp Ser His Pro Gln Phe Glu Lys

465 470 475 480

<210> 33

<211> 503

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 33

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr

20 25 30

Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Thr Leu Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe

115 120 125

Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu

130 135 140

Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp

145 150 155 160

Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu

165 170 175

Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser

180 185 190

Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro

195 200 205

Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Ser Gly

210 215 220

Pro Gly Gly Gly Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

225 230 235 240

Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly

245 250 255

Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser

260 265 270

Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln

275 280 285

Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val

290 295 300

Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr

305 310 315 320

Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn

325 330 335

Asp Tyr Ser Tyr Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile

340 345 350

Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

355 360 365

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln

370 375 380

Pro Gly Ala Glu Leu Val Arg Pro Gly Ala Ser Val Lys Leu Ser Cys

385 390 395 400

Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Ile Asn Trp Val Lys

405 410 415

Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Asn Ile Tyr Pro Ser

420 425 430

Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu

435 440 445

Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Pro

450 455 460

Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Thr Arg Ser Trp Arg Gly

465 470 475 480

Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

485 490 495

Ser His His His His His His His

500

<210> 34

<211> 503

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 34

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr

20 25 30

Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Thr Leu Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe

115 120 125

Pro Leu Ala Pro Cys Ser Lys Ser Thr Ser Glu Gly Thr Ala Ala Leu

130 135 140

Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp

145 150 155 160

Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu

165 170 175

Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser

180 185 190

Ser Asn Phe Gly Thr Gln Thr Tyr Thr Cys Asn Val Asp His Lys Pro

195 200 205

Ser Asn Thr Lys Val Asp Lys Thr Val Glu Pro Lys Ser Ala Ser Gly

210 215 220

Pro Gly Gly Gly Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

225 230 235 240

Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly

245 250 255

Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser

260 265 270

Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln

275 280 285

Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val

290 295 300

Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr

305 310 315 320

Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn

325 330 335

Asp Tyr Ser Tyr Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile

340 345 350

Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

355 360 365

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln

370 375 380

Pro Gly Ala Glu Leu Val Arg Pro Gly Ala Ser Val Lys Leu Ser Cys

385 390 395 400

Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Ile Asn Trp Val Lys

405 410 415

Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Asn Ile Tyr Pro Ser

420 425 430

Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu

435 440 445

Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Pro

450 455 460

Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Thr Arg Ser Trp Arg Gly

465 470 475 480

Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

485 490 495

Ser His His His His His His His

500

<210> 35

<211> 485

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 35

Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly

1 5 10 15

Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met

20 25 30

Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr

35 40 45

Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly Ser

50 55 60

Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu

65 70 75 80

Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu Thr

85 90 95

Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg Thr Val Ala Ala Pro

100 105 110

Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr

115 120 125

Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys

130 135 140

Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu

145 150 155 160

Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser

165 170 175

Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala

180 185 190

Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe

195 200 205

Asn Arg Gly Glu Cys Asp Val Pro Gly Gly Ser Asp Ile Val Met Thr

210 215 220

Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly Glu Lys Val Thr Met

225 230 235 240

Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn

245 250 255

Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu

260 265 270

Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Thr

275 280 285

Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Val Gln

290 295 300

Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn Asp Tyr Ser Tyr Pro

305 310 315 320

Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys Gly Gly Gly Gly

325 330 335

Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

340 345 350

Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu

355 360 365

Val Arg Pro Gly Ala Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr

370 375 380

Thr Phe Thr Ser Tyr Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln

385 390 395 400

Gly Leu Glu Trp Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn

405 410 415

Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser

420 425 430

Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser

435 440 445

Ala Val Tyr Tyr Cys Thr Arg Ser Trp Arg Gly Asn Ser Phe Asp Tyr

450 455 460

Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser Ser Ala Trp Ser His

465 470 475 480

Pro Gln Phe Glu Lys

485

<210> 36

<211> 491

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 36

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr

20 25 30

Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Thr Leu Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe

115 120 125

Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu

130 135 140

Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp

145 150 155 160

Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu

165 170 175

Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser

180 185 190

Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro

195 200 205

Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Ser Gly

210 215 220

Pro Gly Gly Gly Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

225 230 235 240

Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala

245 250 255

Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

260 265 270

Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

275 280 285

Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe

290 295 300

Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

305 310 315 320

Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

325 330 335

Thr Arg Ser Trp Arg Gly Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr

340 345 350

Thr Leu Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

355 360 365

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln

370 375 380

Ser Pro Ser Ser Leu Thr Val Thr Ala Gly Glu Lys Val Thr Met Ser

385 390 395 400

Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn Tyr

405 410 415

Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

420 425 430

Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Thr Gly

435 440 445

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Val Gln Ala

450 455 460

Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn Asp Tyr Ser Tyr Pro Phe

465 470 475 480

Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys

485 490

<210> 37

<211> 470

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 37

Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly

1 5 10 15

Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met

20 25 30

Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr

35 40 45

Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly Ser

50 55 60

Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu

65 70 75 80

Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu Thr

85 90 95

Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg Thr Val Ala Ala Pro

100 105 110

Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr

115 120 125

Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys

130 135 140

Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu

145 150 155 160

Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser

165 170 175

Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala

180 185 190

Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe

195 200 205

Asn Arg Gly Glu Cys Asp Val Pro Gly Gly Ser Gln Val Gln Leu Gln

210 215 220

Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala Ser Val Lys Leu Ser

225 230 235 240

Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Ile Asn Trp Val

245 250 255

Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Asn Ile Tyr Pro

260 265 270

Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr

275 280 285

Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser

290 295 300

Pro Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Thr Arg Ser Trp Arg

305 310 315 320

Gly Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser

325 330 335

Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

340 345 350

Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu

355 360 365

Thr Val Thr Ala Gly Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln

370 375 380

Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln

385 390 395 400

Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr

405 410 415

Arg Glu Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr

420 425 430

Asp Phe Thr Leu Thr Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val

435 440 445

Tyr Tyr Cys Gln Asn Asp Tyr Ser Tyr Pro Phe Thr Phe Gly Ser Gly

450 455 460

Thr Lys Leu Glu Ile Lys

465 470

<210> 38

<211> 496

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 38

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr

20 25 30

Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Thr Leu Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe

115 120 125

Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu

130 135 140

Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp

145 150 155 160

Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu

165 170 175

Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser

180 185 190

Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro

195 200 205

Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Ser Gly

210 215 220

Pro Gly Gly Gly Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

225 230 235 240

Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly

245 250 255

Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser

260 265 270

Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln

275 280 285

Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val

290 295 300

Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr

305 310 315 320

Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn

325 330 335

Asp Tyr Ser Tyr Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile

340 345 350

Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

355 360 365

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln

370 375 380

Pro Gly Ala Glu Leu Val Arg Pro Gly Ala Ser Val Lys Leu Ser Cys

385 390 395 400

Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Ile Asn Trp Val Lys

405 410 415

Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Asn Ile Tyr Pro Ser

420 425 430

Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu

435 440 445

Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Pro

450 455 460

Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Thr Arg Ser Trp Arg Gly

465 470 475 480

Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

485 490 495

<210> 39

<211> 475

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 39

Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly

1 5 10 15

Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met

20 25 30

Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr

35 40 45

Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly Ser

50 55 60

Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu

65 70 75 80

Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu Thr

85 90 95

Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg Thr Val Ala Ala Pro

100 105 110

Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr

115 120 125

Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys

130 135 140

Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu

145 150 155 160

Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser

165 170 175

Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala

180 185 190

Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe

195 200 205

Asn Arg Gly Glu Cys Asp Val Pro Gly Gly Ser Asp Ile Val Met Thr

210 215 220

Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly Glu Lys Val Thr Met

225 230 235 240

Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn

245 250 255

Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu

260 265 270

Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Thr

275 280 285

Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Val Gln

290 295 300

Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn Asp Tyr Ser Tyr Pro

305 310 315 320

Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys Gly Gly Gly Gly

325 330 335

Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

340 345 350

Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu

355 360 365

Val Arg Pro Gly Ala Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr

370 375 380

Thr Phe Thr Ser Tyr Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln

385 390 395 400

Gly Leu Glu Trp Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn

405 410 415

Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser

420 425 430

Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser

435 440 445

Ala Val Tyr Tyr Cys Thr Arg Ser Trp Arg Gly Asn Ser Phe Asp Tyr

450 455 460

Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

465 470 475

<210> 40

<211> 491

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 40

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr

20 25 30

Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Thr Leu Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe

115 120 125

Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu

130 135 140

Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp

145 150 155 160

Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu

165 170 175

Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser

180 185 190

Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro

195 200 205

Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Ser Gly

210 215 220

Pro Gly Gly Gly Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

225 230 235 240

Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala

245 250 255

Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

260 265 270

Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Cys Leu Glu Trp Ile

275 280 285

Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe

290 295 300

Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

305 310 315 320

Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

325 330 335

Thr Arg Ser Trp Arg Gly Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr

340 345 350

Thr Leu Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

355 360 365

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln

370 375 380

Ser Pro Ser Ser Leu Thr Val Thr Ala Gly Glu Lys Val Thr Met Ser

385 390 395 400

Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn Tyr

405 410 415

Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

420 425 430

Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Thr Gly

435 440 445

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Val Gln Ala

450 455 460

Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn Asp Tyr Ser Tyr Pro Phe

465 470 475 480

Thr Phe Gly Cys Gly Thr Lys Leu Glu Ile Lys

485 490

<210> 41

<211> 470

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 41

Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly

1 5 10 15

Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met

20 25 30

Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr

35 40 45

Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly Ser

50 55 60

Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu

65 70 75 80

Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu Thr

85 90 95

Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg Thr Val Ala Ala Pro

100 105 110

Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr

115 120 125

Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys

130 135 140

Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu

145 150 155 160

Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser

165 170 175

Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala

180 185 190

Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe

195 200 205

Asn Arg Gly Glu Cys Asp Val Pro Gly Gly Ser Gln Val Gln Leu Gln

210 215 220

Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala Ser Val Lys Leu Ser

225 230 235 240

Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Ile Asn Trp Val

245 250 255

Lys Gln Arg Pro Gly Gln Cys Leu Glu Trp Ile Gly Asn Ile Tyr Pro

260 265 270

Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr

275 280 285

Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser

290 295 300

Pro Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Thr Arg Ser Trp Arg

305 310 315 320

Gly Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser

325 330 335

Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

340 345 350

Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu

355 360 365

Thr Val Thr Ala Gly Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln

370 375 380

Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln

385 390 395 400

Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr

405 410 415

Arg Glu Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr

420 425 430

Asp Phe Thr Leu Thr Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val

435 440 445

Tyr Tyr Cys Gln Asn Asp Tyr Ser Tyr Pro Phe Thr Phe Gly Cys Gly

450 455 460

Thr Lys Leu Glu Ile Lys

465 470

<210> 42

<211> 496

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 42

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr

20 25 30

Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Thr Leu Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe

115 120 125

Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu

130 135 140

Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp

145 150 155 160

Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu

165 170 175

Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser

180 185 190

Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro

195 200 205

Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Ser Gly

210 215 220

Pro Gly Gly Gly Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

225 230 235 240

Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly

245 250 255

Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser

260 265 270

Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln

275 280 285

Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val

290 295 300

Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr

305 310 315 320

Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn

325 330 335

Asp Tyr Ser Tyr Pro Phe Thr Phe Gly Cys Gly Thr Lys Leu Glu Ile

340 345 350

Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

355 360 365

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln

370 375 380

Pro Gly Ala Glu Leu Val Arg Pro Gly Ala Ser Val Lys Leu Ser Cys

385 390 395 400

Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Ile Asn Trp Val Lys

405 410 415

Gln Arg Pro Gly Gln Cys Leu Glu Trp Ile Gly Asn Ile Tyr Pro Ser

420 425 430

Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu

435 440 445

Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Pro

450 455 460

Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Thr Arg Ser Trp Arg Gly

465 470 475 480

Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

485 490 495

<210> 43

<211> 475

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 43

Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly

1 5 10 15

Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met

20 25 30

Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr

35 40 45

Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly Ser

50 55 60

Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu

65 70 75 80

Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu Thr

85 90 95

Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg Thr Val Ala Ala Pro

100 105 110

Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr

115 120 125

Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys

130 135 140

Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu

145 150 155 160

Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser

165 170 175

Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala

180 185 190

Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe

195 200 205

Asn Arg Gly Glu Cys Asp Val Pro Gly Gly Ser Asp Ile Val Met Thr

210 215 220

Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly Glu Lys Val Thr Met

225 230 235 240

Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn

245 250 255

Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu

260 265 270

Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Thr

275 280 285

Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Val Gln

290 295 300

Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn Asp Tyr Ser Tyr Pro

305 310 315 320

Phe Thr Phe Gly Cys Gly Thr Lys Leu Glu Ile Lys Gly Gly Gly Gly

325 330 335

Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

340 345 350

Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu

355 360 365

Val Arg Pro Gly Ala Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr

370 375 380

Thr Phe Thr Ser Tyr Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln

385 390 395 400

Cys Leu Glu Trp Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn

405 410 415

Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser

420 425 430

Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser

435 440 445

Ala Val Tyr Tyr Cys Thr Arg Ser Trp Arg Gly Asn Ser Phe Asp Tyr

450 455 460

Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

465 470 475

<210> 44

<211> 8

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<400> 44

Gly Tyr Ser Phe Thr Gly Tyr Thr

15

<210> 45

<211> 8

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<400> 45

Ile Asn Pro Tyr Asn Gly Gly Thr

15

<210> 46

<211> 10

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<400> 46

Ala Arg Asp Tyr Gly Phe Val Leu Asp Tyr

1 5 10

<210> 47

<211> 10

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<400> 47

Ala Arg Asp Tyr Gly Tyr Val Leu Asp Tyr

1 5 10

<210> 48

<211> 8

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<220>

<221> MISC_FEATURE

<222>(8)..(8)

<223> Any amino acids, preferably Thr, Ser or Ile, most preferably Thr

<400> 48

Ile Asn Pro Tyr Asn Gly Gly Xaa

15

<210> 49

<211> 10

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<220>

<221> MISC_FEATURE

<222> (4)..(4)

<223> Any amino acids, preferably an aromatic amino acid, more

preferably Phe or Tyr, most preferably Tyr

<220>

<221> MISC_FEATURE

<222>(6)..(6)

<223> Any amino acids, preferably an aromatic amino acid, more

preferably Phe or Tyr, most preferably Tyr

<220>

<221> MISC_FEATURE

<222>(8)..(8)

<223> Any amino acids, preferably Leu or Phe, more preferably Leu

<400> 49

Ala Arg Asp Xaa Gly Xaa Val Xaa Asp Tyr

1 5 10

<210> 50

<211> 5

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<400> 50

Ser Ser Val Ser Tyr

15

<210> 51

<211> 3

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<400> 51

Ser Thr Ser

1

<210> 52

<211> 10

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<400> 52

Gln Gln Arg Ser Asn Tyr Pro Pro Trp Thr

1 5 10

<210> 53

<211> 10

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<400> 53

Gln Gln Arg Ser Ile Tyr Pro Pro Trp Thr

1 5 10

<210> 54

<211> 5

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<220>

<221> MISC_FEATURE

<222> (4)..(4)

<223> Any amino acids, preferably Ser or Asn, most preferably Ser

<400> 54

Ser Ser Val Xaa Tyr

15

<210> 55

<211> 10

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<220>

<221> MISC_FEATURE

<222> (4)..(4)

<223> Any amino acids, preferably Ser or Asn, most preferably Ser

<220>

<221> MISC_FEATURE

<222> (5)..(5)

<223> Any amino acids, preferably Tyr, Ser, Ile, Asn or Thr, more

preferably Ile, Asn or Thr, most preferably Ile or Asn

<220>

<221> MISC_FEATURE

<222>(6)..(6)

<223> Any amino acids, preferably Ser or Tyr, more preferably Tyr

<400> 55

Gln Gln Arg Xaa Xaa Xaa Pro Pro Trp Thr

1 5 10

<210> 56

<211> 8

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<400> 56

Gly Tyr Thr Phe Thr Ser Tyr Trp

15

<210> 57

<211> 8

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<400> 57

Ile Tyr Pro Ser Asp Ser Tyr Thr

15

<210> 58

<211> 11

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<400> 58

Thr Arg Ser Trp Arg Gly Asn Ser Phe Asp Tyr

1 5 10

<210> 59

<211> 8

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<400> 59

Gly Tyr Thr Phe Thr Asn Tyr Gly

15

<210> 60

<211> 8

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<400> 60

Ile Asn Thr Asn Thr Gly Glu Pro

15

<210> 61

<211> 11

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<400> 61

Ala Arg Leu Gly Phe Gly Asn Ala Met Asp Tyr

1 5 10

<210> 62

<211> 12

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<400> 62

Gln Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn Tyr

1 5 10

<210> 63

<211> 3

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<400> 63

Trp Ala Ser

1

<210> 64

<211> 9

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<400> 64

Gln Asn Asp Tyr Ser Tyr Pro Phe Thr

15

<210> 65

<211> 9

<212> PRT

<213> Artificial Sequence

<220>

<223> CDR sequence

<400> 65

Gln Asn Asp Tyr Ser Tyr Pro Leu Thr

15

<210> 66

<211> 18

<212> PRT

<213> Artificial Sequence

<220>

<223> Link sequence

<400> 66

Ser Gly Pro Gly Gly Gly Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly

1 5 10 15

Gly Ser

<210> 67

<211> 6

<212> PRT

<213> Artificial Sequence

<220>

<223> Link sequence

<400> 67

Asp Val Pro Gly Gly Ser

15

<210> 68

<211> 20

<212> PRT

<213> Artificial Sequence

<220>

<223> Link sequence

<400> 68

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

1 5 10 15

Gly Gly Gly Ser

20

<210> 69

<211> 25

<212> PRT

<213> Artificial Sequence

<220>

<223> Link sequence

<400> 69

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

1 5 10 15

Gly Gly Gly Ser Gly Gly Gly Gly Ser

20 25

<210> 70

<211> 5

<212> PRT

<213> Artificial Sequence

<220>

<223> Link sequence

<220>

<221> REPEAT

<222> (1)..(5)

<223> Sequence repeated x times, when x is 3, 4, 5 or 6

<400> 70

Gly Gly Gly Gly Ser

15

<210> 71

<211> 19

<212> PRT

<213> Artificial Sequence

<220>

<223> Secretion signal

<400> 71

Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly

1 5 10 15

Val His Ser

<210> 72

<211> 9

<212> PRT

<213> Artificial Sequence

<220>

<223> His tag

<400> 72

Gly Gly Ser His His His His His His

15

<210> 73

<211> 6

<212> PRT

<213> Artificial Sequence

<220>

<223> His tag

<400> 73

His His His His His His His

15

<210> 74

<211> 494

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 74

Asp Ile Lys Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr

20 25 30

Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Thr Leu Thr Val Ser Ser Val Glu Gly Gly Ser Gly Gly Ser Gly

115 120 125

Gly Ser Gly Gly Ser Gly Gly Val Asp Asp Ile Gln Leu Thr Gln Ser

130 135 140

Pro Ala Ile Met Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys

145 150 155 160

Arg Ala Ser Ser Ser Val Ser Tyr Met Asn Trp Tyr Gln Gln Lys Ser

165 170 175

Gly Thr Ser Pro Lys Arg Trp Ile Tyr Asp Thr Ser Lys Val Ala Ser

180 185 190

Gly Val Pro Tyr Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser

195 200 205

Leu Thr Ile Ser Ser Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys

210 215 220

Gln Gln Trp Ser Ser Asn Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu

225 230 235 240

Glu Leu Lys Ser Gly Gly Gly Gly Ser Glu Val Gln Leu Gln Gln Ser

245 250 255

Gly Pro Glu Leu Val Lys Pro Gly Ala Ser Met Lys Ile Ser Cys Lys

260 265 270

Ala Ser Gly Tyr Ser Phe Thr Gly Tyr Thr Met Asn Trp Val Lys Gln

275 280 285

Ser His Gly Lys Asn Leu Glu Trp Ile Gly Leu Ile Asn Pro Tyr Asn

290 295 300

Gly Gly Thr Ile Tyr Asn Gln Lys Phe Lys Gly Lys Ala Thr Leu Thr

305 310 315 320

Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Glu Leu Leu Ser Leu Thr

325 330 335

Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Asp Tyr Gly Phe Val

340 345 350

Leu Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser Gly Gly

355 360 365

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val

370 375 380

Leu Thr Gln Ser Pro Ser Ile Met Ser Val Ser Pro Gly Glu Lys Val

385 390 395 400

Thr Ile Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met His Trp Phe

405 410 415

Gln Gln Lys Pro Gly Thr Ser Pro Lys Leu Leu Ile Tyr Ser Thr Ser

420 425 430

Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Arg Gly Ser Gly

435 440 445

Thr Ser Tyr Ser Leu Thr Ile Ser Arg Val Ala Ala Glu Asp Ala Ala

450 455 460

Thr Tyr Tyr Cys Gln Gln Arg Ser Asn Tyr Pro Pro Trp Thr Phe Gly

465 470 475 480

Gly Gly Thr Lys Leu Glu Ile Lys His His His His His His His

485 490

<210> 75

<211> 495

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 75

Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Thr Arg Ser Trp Arg Gly Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Leu Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu

130 135 140

Thr Val Thr Ala Gly Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln

145 150 155 160

Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln

165 170 175

Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr

180 185 190

Arg Glu Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr

195 200 205

Asp Phe Thr Leu Thr Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val

210 215 220

Tyr Tyr Cys Gln Asn Asp Tyr Ser Tyr Pro Phe Thr Phe Gly Ser Gly

225 230 235 240

Thr Lys Leu Glu Ile Lys Ser Gly Gly Gly Gly Ser Asp Ile Lys Leu

245 250 255

Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala Ser Val Lys Met

260 265 270

Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr Thr Met His Trp

275 280 285

Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Tyr Ile Asn

290 295 300

Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala

305 310 315 320

Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser

325 330 335

Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Tyr Tyr

340 345 350

Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr

355 360 365

Val Ser Ser Val Glu Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly

370 375 380

Ser Gly Gly Val Asp Asp Ile Gln Leu Thr Gln Ser Pro Ala Ile Met

385 390 395 400

Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser

405 410 415

Ser Val Ser Tyr Met Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro

420 425 430

Lys Arg Trp Ile Tyr Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr

435 440 445

Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser

450 455 460

Ser Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser

465 470 475 480

Ser Asn Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys

485 490 495

<210> 76

<211> 511

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 76

Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Thr Arg Ser Trp Arg Gly Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Leu Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln

130 135 140

Ser Pro Ser Ser Leu Thr Val Thr Ala Gly Glu Lys Val Thr Met Ser

145 150 155 160

Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn Tyr

165 170 175

Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

180 185 190

Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Thr Gly

195 200 205

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Val Gln Ala

210 215 220

Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn Asp Tyr Ser Tyr Pro Phe

225 230 235 240

Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys Ser Gly Gly Gly Gly

245 250 255

Ser Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly

260 265 270

Ala Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg

275 280 285

Tyr Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp

290 295 300

Ile Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys

305 310 315 320

Phe Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Ser Thr Ala

325 330 335

Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr

340 345 350

Cys Ala Arg Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln

355 360 365

Gly Thr Thr Leu Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly

370 375 380

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Ile Val Leu

385 390 395 400

Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu Lys Val Thr

405 410 415

Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met Asn Trp Tyr Gln

420 425 430

Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr Asp Thr Ser Lys

435 440 445

Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly Ser Gly Ser Gly Thr

450 455 460

Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu Asp Ala Ala Thr

465 470 475 480

Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu Thr Phe Gly Ala Gly

485 490 495

Thr Lys Leu Glu Leu Lys Gly Gly Ser His His His His His His

500 505 510

<210> 77

<211> 516

<212> PRT

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 77

Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly

1 5 10 15

Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser

20 25 30

Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln

35 40 45

Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val

50 55 60

Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr

65 70 75 80

Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn

85 90 95

Asp Tyr Ser Tyr Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile

100 105 110

Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln

130 135 140

Pro Gly Ala Glu Leu Val Arg Pro Gly Ala Ser Val Lys Leu Ser Cys

145 150 155 160

Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Ile Asn Trp Val Lys

165 170 175

Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Asn Ile Tyr Pro Ser

180 185 190

Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu

195 200 205

Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Pro

210 215 220

Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Thr Arg Ser Trp Arg Gly

225 230 235 240

Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

245 250 255

Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln Ser Gly Ala Glu

260 265 270

Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys Thr Ser Gly

275 280 285

Tyr Thr Phe Thr Arg Tyr Thr Met His Trp Val Lys Gln Arg Pro Gly

290 295 300

Gln Gly Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr

305 310 315 320

Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys

325 330 335

Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp

340 345 350

Ser Ala Val Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp His Tyr Ser Leu

355 360 365

Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser Gly Gly Gly

370 375 380

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

385 390 395 400

Ser Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro

405 410 415

Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr

420 425 430

Met Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile

435 440 445

Tyr Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly

450 455 460

Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala

465 470 475 480

Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu

485 490 495

Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Gly Gly Ser His His

500 505 510

His His His His

515

<210> 78

<211> 1479

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 78

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactctcag 60

atcgtgctga cccagtctcc cgccatcatg tctgctagcc ctggcgagaa agtgacaatg 120

acctgccggg cctcctcctc cgtgtcctac atgaactggt atcagcagaa gtccggcacc 180

tcccccaagc ggtggatcta cgacacctcc aaggtggcct ctggcgtgcc ctacagattc 240

tccggctctg gctctggcac ctcctacagc ctgaccatct ccagcatgga agccgaggat 300

gccgccacct actactgcca gcagtggtcc tccaaccccc tgacctttgg cgctggcacc 360

aagctggaac tgaagcggac cgtggccgct ccttccgtgt tcatcttccc tccctccgac 420

gagcagctga agtccggcac cgcctccgtg gtgtgcctgc tgaacaactt ctaccctcgg 480

540

gtcaccgagc aggactccaa ggacagcacc tactccctgt cctccaccct gaccctgtcc 600

aaggccgact acgagaagca caaggtgtac gcctgcgagg tgacccacca gggcctgtcc 660

agccctgtga ccaagtcctt caaccggggc gagtgtgacg tgcctggtgg tagcgaagtg 720

cagctgcagc agagcggccc tgagctggtg aaacccggcg ctagcatgaa gatcagctgc 780

aaggccagcg gctacagctt caccggctac accatgaact gggtgaaaca gagccacggc 840

aagtgcctgg aatggatcgg cctgatcaac ccctacaacg gcggcaccat ctacaaccag 900

aagttcaagg gcaaggccac actgaccgtg gacaagagca gcagcaccgc ctacatggaa 960

ctgctgagcc tgaccagcga ggacagcgcc gtgtactact gcgccagaga ctacggcttc 1020

gtgctggact actggggcca gggcaccacc ctgacagtgt ctagcggagg cggaggatct 1080

ggtggtggcg gatctggcgg cggtggaagt ggcggaggtg gtagccagat cgtgctgacc 1140

cagtccccct ccatcatgtc cgtgtctccc ggcgagaaag tgacaattac ctgctccgcc 1200

tcctcctccg tgtcctacat gcactggttc cagcagaagc ccggcacctc ccccaagctg 1260

tggatctact ccacctccaa cctggcctcc ggcgtgcccg ccagattctc cggaagaggc 1320

tccggcacca gctactccct gaccactctcc agagtggccg ccgaggacgc cgccacctac 1380

tactgccagc agcggtccaa ctaccccccc tggacctttg gctgcggcac caagctggaa 1440

atcaagtctg cctggagcca cccacagttc gagaagtga 1479

<210> 79

<211> 1539

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 79

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactcccag 60

gtgcagctgc agcagtctgg cgctgagctg gctagacctg gcgcctccgt gaagatgtcc 120

tgcaagacct ccggctacac cttcacccgg tacaccatgc actgggtcaa gcagaggcct 180

ggacagggcc tggaatggat cggctacatc aacccctccc ggggctacac caactacaac 240

cagaagttca aggacaaggc caccctgaca accgacaagt cctcctccac cgcctacatg 300

cagctgtcct ccctgacctc cgaggactcc gccgtgtact actgcgcccg gtactacgac 360

gaccactact ccctggacta ctggggccag ggcaccacac tgacagtgtc tagcgcctcc 420

accaagggcc cttccgtgtt ccctctggcc ccttcctcca agtccacctc cggcggcacc 480

gccgctctgg gctgcctggt gaaggactac ttccctgagc ctgtgaccgt gagctggaac 540

tctggcgccc tgaccagcgg cgtgcacacc ttccctgccg tgctgcagtc ctccggcctg 600

tactccctgt cctccgtggt gaccgtgcct tcctcctccc tgggcaccca gacctacatc 660

tgcaacgtga accacaagcc ttccaacacc aaggtggaca agcgggtgga gcctaagtcc 720

tgctccggcc ctgggggcgg acgcagcggc ggaggcggat ccggcgggagg aggctctgaa 780

gtgcagctgc agcagagcgg ccctgagctg gtgaaacccg gcgctagcat gaagatcagc 840

tgcaaggcca gcggctacag cttcaccggc tacaccatga actgggtgaa acagagccac 900

ggcaagtgcc tggaatggat cggcctgatc aacccctaca acggcggcac catctacaac 960

cagaagttca agggcaaggc cacactgacc gtggacaaga gcagcagcac cgcctacatg 1020

gaactgctga gcctgaccag cgaggacagc gccgtgtact actgcgccag agactacggc 1080

ttcgtgctgg actactgggg ccagggcacc accctgacag tgtctagcgg aggcggagga 1140

tctggtggtg gcggatctgg cggcggtgga agtggcggag gtggtagcca gatcgtgctg 1200

acccagtccc cctccatcat gtccgtgtct cccggcgaga aagtgacaat tacctgctcc 1260

gcctcctcct ccgtgtccta catgcactgg ttccagcaga agcccggcac ctcccccaag 1320

ctgtggatct actccacctc caacctggcc tccggcgtgc ccgccagatt ctccggaaga 1380

ggctccggca ccagctactc cctgaccatc tccagagtgg ccgccgagga cgccgccacc 1440

tactactgcc agcagcggtc caactacccc ccctggacct ttggctgcgg caccaagctg 1500

gaaatcaagg gcggctccca ccaccaccat caccactga 1539

<210> 80

<211> 1539

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 80

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactcccag 60

gtgcagctgc agcagtctgg cgctgagctg gctagacctg gcgcctccgt gaagatgtcc 120

tgcaagacct ccggctacac cttcacccgg tacaccatgc actgggtcaa gcagaggcct 180

ggacagggcc tggaatggat cggctacatc aacccctccc ggggctacac caactacaac 240

cagaagttca aggacaaggc caccctgaca accgacaagt cctcctccac cgcctacatg 300

cagctgtcct ccctgacctc cgaggactcc gccgtgtact actgcgcccg gtactacgac 360

gaccactact ccctggacta ctggggccag ggcaccacac tgacagtgtc tagcgcctcc 420

accaagggcc cttccgtgtt ccctctggcc ccttgctcca agtccacctc cgaaggcacc 480

gccgctctgg gctgcctggt gaaggactac ttccctgagc ctgtgaccgt gagctggaac 540

tctggcgccc tgaccagcgg cgtgcacacc ttccctgccg tgctgcagtc ctccggcctg 600

tactccctgt cctccgtggt gaccgtgcct tcctccaact tcggcaccca gacctacacc 660

tgcaacgtgg accacaagcc ttccaacacc aaggtggaca agaccgtgga gcctaagtcc 720

gcctccggcc ctgggggcgg acgcagcggc ggaggcggat ccggcgggagg aggctctgaa 780

gtgcagctgc agcagagcgg ccctgagctg gtgaaacccg gcgctagcat gaagatcagc 840

tgcaaggcca gcggctacag cttcaccggc tacaccatga actgggtgaa acagagccac 900

ggcaagtgcc tggaatggat cggcctgatc aacccctaca acggcggcac catctacaac 960

cagaagttca agggcaaggc cacactgacc gtggacaaga gcagcagcac cgcctacatg 1020

gaactgctga gcctgaccag cgaggacagc gccgtgtact actgcgccag agactacggc 1080

ttcgtgctgg actactgggg ccagggcacc accctgacag tgtctagcgg aggcggagga 1140

tctggtggtg gcggatctgg cggcggtgga agtggcggag gtggtagcca gatcgtgctg 1200

acccagtccc cctccatcat gtccgtgtct cccggcgaga aagtgacaat tacctgctcc 1260

gcctcctcct ccgtgtccta catgcactgg ttccagcaga agcccggcac ctcccccaag 1320

ctgtggatct actccacctc caacctggcc tccggcgtgc ccgccagatt ctccggaaga 1380

ggctccggca ccagctactc cctgaccatc tccagagtgg ccgccgagga cgccgccacc 1440

tactactgcc agcagcggtc caactacccc ccctggacct ttggctgcgg caccaagctg 1500

gaaatcaagg gcggctccca ccaccaccat caccactga 1539

<210> 81

<211> 1449

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 81

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactctcag 60

atcgtgctga cccagtctcc cgccatcatg tctgctagcc ctggcgagaa agtgacaatg 120

acctgccggg cctcctcctc cgtgtcctac atgaactggt atcagcagaa gtccggcacc 180

tcccccaagc ggtggatcta cgacacctcc aaggtggcct ctggcgtgcc ctacagattc 240

tccggctctg gctctggcac ctcctacagc ctgaccatct ccagcatgga agccgaggat 300

gccgccacct actactgcca gcagtggtcc tccaaccccc tgacctttgg cgctggcacc 360

aagctggaac tgaagcggac cgtggccgct ccttccgtgt tcatcttccc tccctccgac 420

gagcagctga agtccggcac cgcctccgtg gtgtgcctgc tgaacaactt ctaccctcgg 480

540

gtcaccgagc aggactccaa ggacagcacc tactccctgt cctccaccct gaccctgtcc 600

aaggccgact acgagaagca caaggtgtac gcctgcgagg tgacccacca gggcctgtcc 660

agccctgtga ccaagtcctt caaccggggc gagtgtgacg tgcctggtgg tagcgaagtg 720

cagctgcagc agagcggccc tgagctggtg aaacccggcg ctagcatgaa gatcagctgc 780

aaggccagcg gctacagctt caccggctac accatgaact gggtgaaaca gagccacggc 840

aagtgcctgg aatggatcgg cctgatcaac ccctacaacg gcggcaccat ctacaaccag 900

aagttcaagg gcaaggccac actgaccgtg gacaagagca gcagcaccgc ctacatggaa 960

ctgctgagcc tgaccagcga ggacagcgcc gtgtactact gcgccagaga ctacggcttc 1020

gtgctggact actggggcca gggcaccacc ctgacagtgt ctagcggagg cggaggatct 1080

ggtggtggcg gatctggcgg cggtggaagt ggcggaggtg gtagccagat cgtgctgacc 1140

cagtccccct ccatcatgtc cgtgtctccc ggcgagaaag tgacaattac ctgctccgcc 1200

tcctcctccg tgtcctacat gcactggttc cagcagaagc ccggcacctc ccccaagctg 1260

tggatctact ccacctccaa cctggcctcc ggcgtgcccg ccagattctc cggaagaggc 1320

tccggcacca gctactccct gaccactctcc agagtggccg ccgaggacgc cgccacctac 1380

tactgccagc agcggtccaa ctaccccccc tggacctttg gctgcggcac caagctggaa 1440

atcaagtga 1449

<210> 82

<211> 1512

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 82

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactcccag 60

gtgcagctgc agcagtctgg cgctgagctg gctagacctg gcgcctccgt gaagatgtcc 120

tgcaagacct ccggctacac cttcacccgg tacaccatgc actgggtcaa gcagaggcct 180

ggacagggcc tggaatggat cggctacatc aacccctccc ggggctacac caactacaac 240

cagaagttca aggacaaggc caccctgaca accgacaagt cctcctccac cgcctacatg 300

cagctgtcct ccctgacctc cgaggactcc gccgtgtact actgcgcccg gtactacgac 360

gaccactact ccctggacta ctggggccag ggcaccacac tgacagtgtc tagcgcctcc 420

accaagggcc cttccgtgtt ccctctggcc ccttcctcca agtccacctc cggcggcacc 480

gccgctctgg gctgcctggt gaaggactac ttccctgagc ctgtgaccgt gagctggaac 540

tctggcgccc tgaccagcgg cgtgcacacc ttccctgccg tgctgcagtc ctccggcctg 600

tactccctgt cctccgtggt gaccgtgcct tcctcctccc tgggcaccca gacctacatc 660

tgcaacgtga accacaagcc ttccaacacc aaggtggaca agcgggtgga gcctaagtcc 720

tgctccggcc ctgggggcgg acgcagcggc ggaggcggat ccggcgggagg aggctctgaa 780

gtgcagctgc agcagagcgg ccctgagctg gtgaaacccg gcgctagcat gaagatcagc 840

tgcaaggcca gcggctacag cttcaccggc tacaccatga actgggtgaa acagagccac 900

ggcaagtgcc tggaatggat cggcctgatc aacccctaca acggcggcac catctacaac 960

cagaagttca agggcaaggc cacactgacc gtggacaaga gcagcagcac cgcctacatg 1020

gaactgctga gcctgaccag cgaggacagc gccgtgtact actgcgccag agactacggc 1080

ttcgtgctgg actactgggg ccagggcacc accctgacag tgtctagcgg aggcggagga 1140

tctggtggtg gcggatctgg cggcggtgga agtggcggag gtggtagcca gatcgtgctg 1200

acccagtccc cctccatcat gtccgtgtct cccggcgaga aagtgacaat tacctgctcc 1260

gcctcctcct ccgtgtccta catgcactgg ttccagcaga agcccggcac ctcccccaag 1320

ctgtggatct actccacctc caacctggcc tccggcgtgc ccgccagatt ctccggaaga 1380

ggctccggca ccagctactc cctgaccatc tccagagtgg ccgccgagga cgccgccacc 1440

tactactgcc agcagcggtc caactacccc ccctggacct ttggctgcgg caccaagctg 1500

gaaatcaagt ga 1512

<210> 83

<211> 1512

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 83

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactcccag 60

gtgcagctgc agcagtctgg cgctgagctg gctagacctg gcgcctccgt gaagatgtcc 120

tgcaagacct ccggctacac cttcacccgg tacaccatgc actgggtcaa gcagaggcct 180

ggacagggcc tggaatggat cggctacatc aacccctccc ggggctacac caactacaac 240

cagaagttca aggacaaggc caccctgaca accgacaagt cctcctccac cgcctacatg 300

cagctgtcct ccctgacctc cgaggactcc gccgtgtact actgcgcccg gtactacgac 360

gaccactact ccctggacta ctggggccag ggcaccacac tgacagtgtc tagcgcctcc 420

accaagggcc cttccgtgtt ccctctggcc ccttgctcca agtccacctc cgaaggcacc 480

gccgctctgg gctgcctggt gaaggactac ttccctgagc ctgtgaccgt gagctggaac 540

tctggcgccc tgaccagcgg cgtgcacacc ttccctgccg tgctgcagtc ctccggcctg 600

tactccctgt cctccgtggt gaccgtgcct tcctccaact tcggcaccca gacctacacc 660

tgcaacgtgg accacaagcc ttccaacacc aaggtggaca agaccgtgga gcctaagtcc 720

gcctccggcc ctgggggcgg acgcagcggc ggaggcggat ccggcgggagg aggctctgaa 780

gtgcagctgc agcagagcgg ccctgagctg gtgaaacccg gcgctagcat gaagatcagc 840

tgcaaggcca gcggctacag cttcaccggc tacaccatga actgggtgaa acagagccac 900

ggcaagtgcc tggaatggat cggcctgatc aacccctaca acggcggcac catctacaac 960

cagaagttca agggcaaggc cacactgacc gtggacaaga gcagcagcac cgcctacatg 1020

gaactgctga gcctgaccag cgaggacagc gccgtgtact actgcgccag agactacggc 1080

ttcgtgctgg actactgggg ccagggcacc accctgacag tgtctagcgg aggcggagga 1140

tctggtggtg gcggatctgg cggcggtgga agtggcggag gtggtagcca gatcgtgctg 1200

acccagtccc cctccatcat gtccgtgtct cccggcgaga aagtgacaat tacctgctcc 1260

gcctcctcct ccgtgtccta catgcactgg ttccagcaga agcccggcac ctcccccaag 1320

ctgtggatct actccacctc caacctggcc tccggcgtgc ccgccagatt ctccggaaga 1380

ggctccggca ccagctactc cctgaccatc tccagagtgg ccgccgagga cgccgccacc 1440

tactactgcc agcagcggtc caactacccc ccctggacct ttggctgcgg caccaagctg 1500

gaaatcaagt ga 1512

<210> 84

<211> 1542

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 84

atgggctggt cctgcatcat cctgtttctg gtggccaccg ccaccggcgt gcacagcgac 60

atcaagctgc agcagagcgg agccgagctg gccagacctg gggccagcgt gaagatgagc 120

tgcaagacca gcggctacac cttcacccgg tacaccatgc actgggtgaa acagcggcct 180

ggacagggcc tggaatggat cggctacatc aaccccagcc ggggctacac caactacaac 240

cagaagttca aggacaaggc caccctgacc accgacaaga gcagcagcac cgcctacatg 300

cagctgagca gcctgaccag cgaggacagc gccgtgtact actgcgcccg gtactacgac 360

gaccactaca gcctggacta ctggggccag ggcaccaccc tgacagtgtc tagcgtggaa 420

ggaggaagcg gaggatctgg cggctctggg ggaagcggtg gcgtggacga catccagctg 480

acccagagcc ccgccatcat gtctgccagc cctggcgaga aagtgaccat gacctgccgg 540

gccagcagca gcgtgtccta catgaactgg tatcagcaga agtccggcac cagccccaag 600

cggtggatct acgacaccag caaggtggca agcggcgtgc cctacagatt cagcggcagc 660

ggctccggca ccctcctactc cctgaccatc agcagcatgg aagccgagga cgccgccacc 720

tactactgcc agcagtggtc caagcaacccc ctgaccttcg gagccggcac caagctggaa 780

ctgaagtctg gcgggggagg atccgaggtg cagctgcagc agtccggccc tgagctggtg 840

aaacccggcg ctagcatgaa gatctcttgc aaggcctccg gctacagctt taccggctac 900

acaatgaatt gggtgaagca gagccacggc aagaatctgg aatggattgg cctgatcaac 960

ccttacaacg gcggcacaat ctataatcag aagtttaaag ggaaggccac actgacagtg 1020

gacaagtcca gctccacagc ctacatggaa ctgctgagcc tgacctccga ggactctgcc 1080

gtgtattact gtgccagaga ctacggcttc gtgctggatt attggggaca gggaacaaca 1140

1200

gatatcgtgc tgacccagtc ccctagcatc atgagcgtgt ccccaggcga aaaagtgaca 1260

atcacttgca gcgccagctc ctccgtgtct tatatgcatt ggttccagca gaagcctggc 1320

acatccccca aactgttaat ctacagcacc tccaacctgg cttccggcgt gcccgccaga 1380

ttttctggca gaggcagcgg caccagctac agcctgacaa tcagccgggt ggccgccgaa 1440

gatgccgcca catattattg tcagcagcgg agcaactacc ccccctggac attcggggga 1500

ggaacaaagc tggaaatcaa gcaccaccac caccaccact ga 1542

<210> 85

<211> 1500

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 85

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactctcag 60

atcgtgctga cccagtctcc cgccatcatg tctgctagcc ctggcgagaa agtgacaatg 120

acctgccggg cctcctcctc cgtgtcctac atgaactggt atcagcagaa gtccggcacc 180

tcccccaagc ggtggatcta cgacacctcc aaggtggcct ctggcgtgcc ctacagattc 240

tccggctctg gctctggcac ctcctacagc ctgaccatct ccagcatgga agccgaggat 300

gccgccacct actactgcca gcagtggtcc tccaaccccc tgacctttgg cgctggcacc 360

aagctggaac tgaagcggac cgtggccgct ccttccgtgt tcatcttccc tccctccgac 420

gagcagctga agtccggcac cgcctccgtg gtgtgcctgc tgaacaactt ctaccctcgg 480

540

gtcaccgagc aggactccaa ggacagcacc tactccctgt cctccaccct gaccctgtcc 600

aaggccgact acgagaagca caaggtgtac gcctgcgagg tgacccacca gggcctgtcc 660

agccctgtga ccaagtcctt caaccggggc gagtgtgacg tgcctggtgg tagccaggtg 720

cagctgcagc agcctggcgc tgaactggtc cgacctggcg cctccgtgaa gctgtcctgc 780

aaggcctccg gctacacctt caccagctac tggatcaact gggtcaagca gcggcctggc 840

cagggcctgg aatggatcgg caacatctac ccctccgact cctacaccaa ctacaaccag 900

aagttcaagg acaaggccac cctgaccgtg gacaagtcct cctccaccgc ctacatgcag 960

ctgtccagcc ccacctccga ggactccgcc gtgtactact gcacccggtc ctggcggggc 1020

aactccttcg actattgggg ccagggcacc accctgacag tgtcctctgg aggcggagga 1080

tctggtggtg gcggatctgg cggcggtgga agtggcggag gtggtagcga catcgtgatg 1140

acccagtccc cctccagcct gaccgtgacc gctggcgaga aagtgaccat gagctgcaag 1200

tcctcccagt ccctgctgaa ctccggcaac cagaagaact acctgacctg gtatcagcag 1260

aagcccggcc agccccccaa gctgctgatc tactgggcct ccacccgcga gtctggcgtg 1320

cccgatagat tcaccggctc cggcagcggc accgacttta ccctgaccat ctccagcgtg 1380

caggccgagg acctggccgt gtattactgt cagaacgact actcctaccc cttcaccttc 1440

ggctctggca ccaagctgga aatcaagtct gcctggagcc acccacagtt cgagaagtga 1500

<210> 86

<211> 1515

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 86

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactctcag 60

atcgtgctga cccagtctcc cgccatcatg tctgctagcc ctggcgagaa agtgacaatg 120

acctgccggg cctcctcctc cgtgtcctac atgaactggt atcagcagaa gtccggcacc 180

tcccccaagc ggtggatcta cgacacctcc aaggtggcct ctggcgtgcc ctacagattc 240

tccggctctg gctctggcac ctcctacagc ctgaccatct ccagcatgga agccgaggat 300

gccgccacct actactgcca gcagtggtcc tccaaccccc tgacctttgg cgctggcacc 360

aagctggaac tgaagcggac cgtggccgct ccttccgtgt tcatcttccc tccctccgac 420

gagcagctga agtccggcac cgcctccgtg gtgtgcctgc tgaacaactt ctaccctcgg 480

540

gtcaccgagc aggactccaa ggacagcacc tactccctgt cctccaccct gaccctgtcc 600

aaggccgact acgagaagca caaggtgtac gcctgcgagg tgacccacca gggcctgtcc 660

agccctgtga ccaagtcctt caaccggggc gagtgtgacg tgcctggtgg tagcgacatc 720

gtgatgaccc agtccccctc cagcctgacc gtgaccgctg gcgagaaagt gaccatgagc 780

tgcaagtcct cccagtccct gctgaactcc ggcaaccaga agaactacct gacctggtat 840

cagcagaagc ccggccagcc ccccaagctg ctgatctact gggcctccac ccgcgagtct 900

ggcgtgcccg atagattcac cggctccggc agcggcaccg actttaccct gaccatctcc 960

agcgtgcagg ccgaggacct ggccgtgtat tactgtcaga acgactactc ctaccccttc 1020

accttcggct ctggcaccaa gctggaaatc aagggaggcg gtggttcagg cggcgggaggc 1080

agcggtggag gtggtagtgg cggtggcggt tcagggggag gtggctcgca ggtgcagctg 1140

cagcagcctg gcgctgaact ggtccgacct ggcgcctccg tgaagctgtc ctgcaaggcc 1200

tccggctaca ccttcaccag ctactggatc aactgggtca agcagcggcc tggccaggggc 1260

ctggaatgga tcggcaacat ctacccctcc gactcctaca ccaactacaa ccagaagttc 1320

aaggacaagg ccaccctgac cgtggacaag tcctcctcca ccgcctacat gcagctgtcc 1380

agccccacct ccgaggactc cgccgtgtac tactgcaccc ggtcctggcg gggcaactcc 1440

ttcgactatt ggggccaggg caccaccctg acagtgtcct cttctgcctg gagccaccca 1500

cagttcgaga agtga 1515

<210> 87

<211> 1560

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 87

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactcccag 60

gtgcagctgc agcagtctgg cgctgagctg gctagacctg gcgcctccgt gaagatgtcc 120

tgcaagacct ccggctacac cttcacccgg tacaccatgc actgggtcaa gcagaggcct 180

ggacagggcc tggaatggat cggctacatc aacccctccc ggggctacac caactacaac 240

cagaagttca aggacaaggc caccctgaca accgacaagt cctcctccac cgcctacatg 300

cagctgtcct ccctgacctc cgaggactcc gccgtgtact actgcgcccg gtactacgac 360

gaccactact ccctggacta ctggggccag ggcaccacac tgacagtgtc tagcgcctcc 420

accaagggcc cttccgtgtt ccctctggcc ccttcctcca agtccacctc cggcggcacc 480

gccgctctgg gctgcctggt gaaggactac ttccctgagc ctgtgaccgt gagctggaac 540

tctggcgccc tgaccagcgg cgtgcacacc ttccctgccg tgctgcagtc ctccggcctg 600

tactccctgt cctccgtggt gaccgtgcct tcctcctccc tgggcaccca gacctacatc 660

tgcaacgtga accacaagcc ttccaacacc aaggtggaca agcgggtgga gcctaagtcc 720

tgctccggcc ctgggggcgg acgcagcggc ggaggcggat ccggcggagg aggctctcag 780

gtgcagctgc agcagcctgg cgctgaactg gtccgacctg gcgcctccgt gaagctgtcc 840

tgcaaggcct ccggctacac cttcaccagc tactggatca actgggtcaa gcagcggcct 900

ggccagggcc tggaatggat cggcaacatc tacccctccg actcctacac caactacaac 960

cagaagttca aggacaaggc caccctgacc gtggacaagt cctcctccac cgcctacatg 1020

cagctgtcca gccccacctc cgaggactcc gccgtgtact actgcacccg gtcctggcgg 1080

ggcaactcct tcgactattg gggccagggc accaccctga cagtgtcctc tggaggcgga 1140

ggatctggtg gtggcggatc tggcggcggt ggaagtggcg gaggtggtag cgacatcgtg 1200

atgacccagt ccccctccag cctgaccgtg accgctggcg agaaagtgac catgagctgc 1260

aagtcctccc agtccctgct gaactccggc aaccagaaga actacctgac ctggtatcag 1320

cagaagcccg gccagccccc caagctgctg atctactggg cctccacccg cgagtctggc 1380

gtgcccgata gattcaccgg ctccggcagc ggcaccgact ttaccctgac catctccagc 1440

gtgcaggccg aggacctggc cgtgtattac tgtcagaacg actactccta ccccttcacc 1500

ttcggctctg gcaccaagct ggaaatcaag ggcggctccc accaccacca tcaccactga 1560

<210> 88

<211> 1569

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 88

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactcccag 60

gtgcagctgc agcagtctgg cgctgagctg gctagacctg gcgcctccgt gaagatgtcc 120

tgcaagacct ccggctacac cttcacccgg tacaccatgc actgggtcaa gcagaggcct 180

ggacagggcc tggaatggat cggctacatc aacccctccc ggggctacac caactacaac 240

cagaagttca aggacaaggc caccctgaca accgacaagt cctcctccac cgcctacatg 300

cagctgtcct ccctgacctc cgaggactcc gccgtgtact actgcgcccg gtactacgac 360

gaccactact ccctggacta ctggggccag ggcaccacac tgacagtgtc tagcgcctcc 420

accaagggcc cttccgtgtt ccctctggcc ccttcctcca agtccacctc cggcggcacc 480

gccgctctgg gctgcctggt gaaggactac ttccctgagc ctgtgaccgt gagctggaac 540

tctggcgccc tgaccagcgg cgtgcacacc ttccctgccg tgctgcagtc ctccggcctg 600

tactccctgt cctccgtggt gaccgtgcct tcctcctccc tgggcaccca gacctacatc 660

tgcaacgtga accacaagcc ttccaacacc aaggtggaca agcgggtgga gcctaagtcc 720

tgctccggcc ctgggggcgg acgcagcggc ggaggcggat ccggcggagg aggctctgac 780

atcgtgatga cccagtcccc ctccagcctg accgtgaccg ctggcgagaa agtgaccatg 840

agctgcaagt cctcccagtc cctgctgaac tccggcaacc agaagaacta cctgacctgg 900

tatcagcaga agcccggcca gccccccaag ctgctgatct actgggcctc cacccgcgag 960

tctggcgtgc ccgatagatt caccggctcc ggcagcggca ccgactttac cctgaccatc 1020

tccagcgtgc aggccgagga cctggccgtg tattactgtc agaacgacta ctcctacccc 1080

ttcaccttcg gctctggcac caagctggaa atcaagggag gcggtggttc aggcggcgga 1140

ggcagcggtg gaggtggtag tggcggtggc ggttcagggg gaggtggctc gcaggtgcag 1200

ctgcagcagc ctggcgctga actggtccga cctggcgcct ccgtgaagct gtcctgcaag 1260

gcctccggct acaccttcac cagctactgg atcaactggg tcaagcagcg gcctggccag 1320

ggcctggaat ggatcggcaa catctacccc tccgactcct acaccaacta caaccagaag 1380

ttcaaggaca aggccaccct gaccgtggac aagtcctcct ccaccgccta catgcagctg 1440

tccagcccca cctccgagga ctccgccgtg tactactgca cccggtcctg gcggggcaac 1500

tccttcgact attggggcca gggcaccacc ctgacagtgt cctcttctca ccaccaccat 1560

caccactga 1569

<210> 89

<211> 1560

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 89

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactcccag 60

gtgcagctgc agcagtctgg cgctgagctg gctagacctg gcgcctccgt gaagatgtcc 120

tgcaagacct ccggctacac cttcacccgg tacaccatgc actgggtcaa gcagaggcct 180

ggacagggcc tggaatggat cggctacatc aacccctccc ggggctacac caactacaac 240

cagaagttca aggacaaggc caccctgaca accgacaagt cctcctccac cgcctacatg 300

cagctgtcct ccctgacctc cgaggactcc gccgtgtact actgcgcccg gtactacgac 360

gaccactact ccctggacta ctggggccag ggcaccacac tgacagtgtc tagcgcctcc 420

accaagggcc cttccgtgtt ccctctggcc ccttgctcca agtccacctc cgaaggcacc 480

gccgctctgg gctgcctggt gaaggactac ttccctgagc ctgtgaccgt gagctggaac 540

tctggcgccc tgaccagcgg cgtgcacacc ttccctgccg tgctgcagtc ctccggcctg 600

tactccctgt cctccgtggt gaccgtgcct tcctccaact tcggcaccca gacctacacc 660

tgcaacgtgg accacaagcc ttccaacacc aaggtggaca agaccgtgga gcctaagtcc 720

gcctccggcc ctgggggcgg acgcagcggc ggaggcggat ccggcggagg aggctctcag 780

gtgcagctgc agcagcctgg cgctgaactg gtccgacctg gcgcctccgt gaagctgtcc 840

tgcaaggcct ccggctacac cttcaccagc tactggatca actgggtcaa gcagcggcct 900

ggccagggcc tggaatggat cggcaacatc tacccctccg actcctacac caactacaac 960

cagaagttca aggacaaggc caccctgacc gtggacaagt cctcctccac cgcctacatg 1020

cagctgtcca gccccacctc cgaggactcc gccgtgtact actgcacccg gtcctggcgg 1080

ggcaactcct tcgactattg gggccagggc accaccctga cagtgtcctc tggaggcgga 1140

ggatctggtg gtggcggatc tggcggcggt ggaagtggcg gaggtggtag cgacatcgtg 1200

atgacccagt ccccctccag cctgaccgtg accgctggcg agaaagtgac catgagctgc 1260

aagtcctccc agtccctgct gaactccggc aaccagaaga actacctgac ctggtatcag 1320

cagaagcccg gccagccccc caagctgctg atctactggg cctccacccg cgagtctggc 1380

gtgcccgata gattcaccgg ctccggcagc ggcaccgact ttaccctgac catctccagc 1440

gtgcaggccg aggacctggc cgtgtattac tgtcagaacg actactccta ccccttcacc 1500

ttcggctctg gcaccaagct ggaaatcaag ggcggctccc accaccacca tcaccactga 1560

<210> 90

<211> 1569

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 90

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactcccag 60

gtgcagctgc agcagtctgg cgctgagctg gctagacctg gcgcctccgt gaagatgtcc 120

tgcaagacct ccggctacac cttcacccgg tacaccatgc actgggtcaa gcagaggcct 180

ggacagggcc tggaatggat cggctacatc aacccctccc ggggctacac caactacaac 240

cagaagttca aggacaaggc caccctgaca accgacaagt cctcctccac cgcctacatg 300

cagctgtcct ccctgacctc cgaggactcc gccgtgtact actgcgcccg gtactacgac 360

gaccactact ccctggacta ctggggccag ggcaccacac tgacagtgtc tagcgcctcc 420

accaagggcc cttccgtgtt ccctctggcc ccttgctcca agtccacctc cgaaggcacc 480

gccgctctgg gctgcctggt gaaggactac ttccctgagc ctgtgaccgt gagctggaac 540

tctggcgccc tgaccagcgg cgtgcacacc ttccctgccg tgctgcagtc ctccggcctg 600

tactccctgt cctccgtggt gaccgtgcct tcctccaact tcggcaccca gacctacacc 660

tgcaacgtgg accacaagcc ttccaacacc aaggtggaca agaccgtgga gcctaagtcc 720

gcctccggcc ctgggggcgg acgcagcggc ggaggcggat ccggcggagg aggctctgac 780

atcgtgatga cccagtcccc ctccagcctg accgtgaccg ctggcgagaa agtgaccatg 840

agctgcaagt cctcccagtc cctgctgaac tccggcaacc agaagaacta cctgacctgg 900

tatcagcaga agcccggcca gccccccaag ctgctgatct actgggcctc cacccgcgag 960

tctggcgtgc ccgatagatt caccggctcc ggcagcggca ccgactttac cctgaccatc 1020

tccagcgtgc aggccgagga cctggccgtg tattactgtc agaacgacta ctcctacccc 1080

ttcaccttcg gctctggcac caagctggaa atcaagggag gcggtggttc aggcggcgga 1140

ggcagcggtg gaggtggtag tggcggtggc ggttcagggg gaggtggctc gcaggtgcag 1200

ctgcagcagc ctggcgctga actggtccga cctggcgcct ccgtgaagct gtcctgcaag 1260

gcctccggct acaccttcac cagctactgg atcaactggg tcaagcagcg gcctggccag 1320

ggcctggaat ggatcggcaa catctacccc tccgactcct acaccaacta caaccagaag 1380

ttcaaggaca aggccaccct gaccgtggac aagtcctcct ccaccgccta catgcagctg 1440

tccagcccca cctccgagga ctccgccgtg tactactgca cccggtcctg gcggggcaac 1500

tccttcgact attggggcca gggcaccacc ctgacagtgt cctcttctca ccaccaccat 1560

caccactga 1569

<210> 91

<211> 1533

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 91

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactcccag 60

gtgcagctgc agcagtctgg cgctgagctg gctagacctg gcgcctccgt gaagatgtcc 120

tgcaagacct ccggctacac cttcacccgg tacaccatgc actgggtcaa gcagaggcct 180

ggacagggcc tggaatggat cggctacatc aacccctccc ggggctacac caactacaac 240

cagaagttca aggacaaggc caccctgaca accgacaagt cctcctccac cgcctacatg 300

cagctgtcct ccctgacctc cgaggactcc gccgtgtact actgcgcccg gtactacgac 360

gaccactact ccctggacta ctggggccag ggcaccacac tgacagtgtc tagcgcctcc 420

accaagggcc cttccgtgtt ccctctggcc ccttcctcca agtccacctc cggcggcacc 480

gccgctctgg gctgcctggt gaaggactac ttccctgagc ctgtgaccgt gagctggaac 540

tctggcgccc tgaccagcgg cgtgcacacc ttccctgccg tgctgcagtc ctccggcctg 600

tactccctgt cctccgtggt gaccgtgcct tcctcctccc tgggcaccca gacctacatc 660

tgcaacgtga accacaagcc ttccaacacc aaggtggaca agcgggtgga gcctaagtcc 720

tgctccggcc ctgggggcgg acgcagcggc ggaggcggat ccggcggagg aggctctcag 780

gtgcagctgc agcagcctgg cgctgaactg gtccgacctg gcgcctccgt gaagctgtcc 840

tgcaaggcct ccggctacac cttcaccagc tactggatca actgggtcaa gcagcggcct 900

ggccagggcc tggaatggat cggcaacatc tacccctccg actcctacac caactacaac 960

cagaagttca aggacaaggc caccctgacc gtggacaagt cctcctccac cgcctacatg 1020

cagctgtcca gccccacctc cgaggactcc gccgtgtact actgcacccg gtcctggcgg 1080

ggcaactcct tcgactattg gggccagggc accaccctga cagtgtcctc tggaggcgga 1140

ggatctggtg gtggcggatc tggcggcggt ggaagtggcg gaggtggtag cgacatcgtg 1200

atgacccagt ccccctccag cctgaccgtg accgctggcg agaaagtgac catgagctgc 1260

aagtcctccc agtccctgct gaactccggc aaccagaaga actacctgac ctggtatcag 1320

cagaagcccg gccagccccc caagctgctg atctactggg cctccacccg cgagtctggc 1380

gtgcccgata gattcaccgg ctccggcagc ggcaccgact ttaccctgac catctccagc 1440

gtgcaggccg aggacctggc cgtgtattac tgtcagaacg actactccta ccccttcacc 1500

ttcggctctg gcaccaagct ggaaatcaag tga 1533

<210> 92

<211> 1548

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 92

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactcccag 60

gtgcagctgc agcagtctgg cgctgagctg gctagacctg gcgcctccgt gaagatgtcc 120

tgcaagacct ccggctacac cttcacccgg tacaccatgc actgggtcaa gcagaggcct 180

ggacagggcc tggaatggat cggctacatc aacccctccc ggggctacac caactacaac 240

cagaagttca aggacaaggc caccctgaca accgacaagt cctcctccac cgcctacatg 300

cagctgtcct ccctgacctc cgaggactcc gccgtgtact actgcgcccg gtactacgac 360

gaccactact ccctggacta ctggggccag ggcaccacac tgacagtgtc tagcgcctcc 420

accaagggcc cttccgtgtt ccctctggcc ccttcctcca agtccacctc cggcggcacc 480

gccgctctgg gctgcctggt gaaggactac ttccctgagc ctgtgaccgt gagctggaac 540

tctggcgccc tgaccagcgg cgtgcacacc ttccctgccg tgctgcagtc ctccggcctg 600

tactccctgt cctccgtggt gaccgtgcct tcctcctccc tgggcaccca gacctacatc 660

tgcaacgtga accacaagcc ttccaacacc aaggtggaca agcgggtgga gcctaagtcc 720

tgctccggcc ctgggggcgg acgcagcggc ggaggcggat ccggcggagg aggctctgac 780

atcgtgatga cccagtcccc ctccagcctg accgtgaccg ctggcgagaa agtgaccatg 840

agctgcaagt cctcccagtc cctgctgaac tccggcaacc agaagaacta cctgacctgg 900

tatcagcaga agcccggcca gccccccaag ctgctgatct actgggcctc cacccgcgag 960

tctggcgtgc ccgatagatt caccggctcc ggcagcggca ccgactttac cctgaccatc 1020

tccagcgtgc aggccgagga cctggccgtg tattactgtc agaacgacta ctcctacccc 1080

ttcaccttcg gctctggcac caagctggaa atcaagggag gcggtggttc aggcggcgga 1140

ggcagcggtg gaggtggtag tggcggtggc ggttcagggg gaggtggctc gcaggtgcag 1200

ctgcagcagc ctggcgctga actggtccga cctggcgcct ccgtgaagct gtcctgcaag 1260

gcctccggct acaccttcac cagctactgg atcaactggg tcaagcagcg gcctggccag 1320

ggcctggaat ggatcggcaa catctacccc tccgactcct acaccaacta caaccagaag 1380

ttcaaggaca aggccaccct gaccgtggac aagtcctcct ccaccgccta catgcagctg 1440

tccagcccca cctccgagga ctccgccgtg tactactgca cccggtcctg gcggggcaac 1500

tccttcgact attggggcca gggcaccacc ctgacagtgt cctcttga 1548

<210> 93

<211> 1470

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 93

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactctcag 60

atcgtgctga cccagtctcc cgccatcatg tctgctagcc ctggcgagaa agtgacaatg 120

acctgccggg cctcctcctc cgtgtcctac atgaactggt atcagcagaa gtccggcacc 180

tcccccaagc ggtggatcta cgacacctcc aaggtggcct ctggcgtgcc ctacagattc 240

tccggctctg gctctggcac ctcctacagc ctgaccatct ccagcatgga agccgaggat 300

gccgccacct actactgcca gcagtggtcc tccaaccccc tgacctttgg cgctggcacc 360

aagctggaac tgaagcggac cgtggccgct ccttccgtgt tcatcttccc tccctccgac 420

gagcagctga agtccggcac cgcctccgtg gtgtgcctgc tgaacaactt ctaccctcgg 480

540

gtcaccgagc aggactccaa ggacagcacc tactccctgt cctccaccct gaccctgtcc 600

aaggccgact acgagaagca caaggtgtac gcctgcgagg tgacccacca gggcctgtcc 660

agccctgtga ccaagtcctt caaccggggc gagtgtgacg tgcctggtgg tagccaggtg 720

cagctgcagc agcctggcgc tgaactggtc cgacctggcg cctccgtgaa gctgtcctgc 780

aaggcctccg gctacacctt caccagctac tggatcaact gggtcaagca gcggcctggc 840

cagggcctgg aatggatcgg caacatctac ccctccgact cctacaccaa ctacaaccag 900

aagttcaagg acaaggccac cctgaccgtg gacaagtcct cctccaccgc ctacatgcag 960

ctgtccagcc ccacctccga ggactccgcc gtgtactact gcacccggtc ctggcggggc 1020

aactccttcg actattgggg ccagggcacc accctgacag tgtcctctgg aggcggagga 1080

tctggtggtg gcggatctgg cggcggtgga agtggcggag gtggtagcga catcgtgatg 1140

acccagtccc cctccagcct gaccgtgacc gctggcgaga aagtgaccat gagctgcaag 1200

tcctcccagt ccctgctgaa ctccggcaac cagaagaact acctgacctg gtatcagcag 1260

aagcccggcc agccccccaa gctgctgatc tactgggcct ccacccgcga gtctggcgtg 1320

cccgatagat tcaccggctc cggcagcggc accgacttta ccctgaccat ctccagcgtg 1380

caggccgagg acctggccgt gtattactgt cagaacgact actcctaccc cttcaccttc 1440

ggctctggca ccaagctgga aatcaagtga 1470

<210> 94

<211> 1485

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 94

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactctcag 60

atcgtgctga cccagtctcc cgccatcatg tctgctagcc ctggcgagaa agtgacaatg 120

acctgccggg cctcctcctc cgtgtcctac atgaactggt atcagcagaa gtccggcacc 180

tcccccaagc ggtggatcta cgacacctcc aaggtggcct ctggcgtgcc ctacagattc 240

tccggctctg gctctggcac ctcctacagc ctgaccatct ccagcatgga agccgaggat 300

gccgccacct actactgcca gcagtggtcc tccaaccccc tgacctttgg cgctggcacc 360

aagctggaac tgaagcggac cgtggccgct ccttccgtgt tcatcttccc tccctccgac 420

gagcagctga agtccggcac cgcctccgtg gtgtgcctgc tgaacaactt ctaccctcgg 480

540

gtcaccgagc aggactccaa ggacagcacc tactccctgt cctccaccct gaccctgtcc 600

aaggccgact acgagaagca caaggtgtac gcctgcgagg tgacccacca gggcctgtcc 660

agccctgtga ccaagtcctt caaccggggc gagtgtgacg tgcctggtgg tagcgacatc 720

gtgatgaccc agtccccctc cagcctgacc gtgaccgctg gcgagaaagt gaccatgagc 780

tgcaagtcct cccagtccct gctgaactcc ggcaaccaga agaactacct gacctggtat 840

cagcagaagc ccggccagcc ccccaagctg ctgatctact gggcctccac ccgcgagtct 900

ggcgtgcccg atagattcac cggctccggc agcggcaccg actttaccct gaccatctcc 960

agcgtgcagg ccgaggacct ggccgtgtat tactgtcaga acgactactc ctaccccttc 1020

accttcggct ctggcaccaa gctggaaatc aagggaggcg gtggttcagg cggcgggaggc 1080

agcggtggag gtggtagtgg cggtggcggt tcagggggag gtggctcgca ggtgcagctg 1140

cagcagcctg gcgctgaact ggtccgacct ggcgcctccg tgaagctgtc ctgcaaggcc 1200

tccggctaca ccttcaccag ctactggatc aactgggtca agcagcggcc tggccaggggc 1260

ctggaatgga tcggcaacat ctacccctcc gactcctaca ccaactacaa ccagaagttc 1320

aaggacaagg ccaccctgac cgtggacaag tcctcctcca ccgcctacat gcagctgtcc 1380

agccccacct ccgaggactc cgccgtgtac tactgcaccc ggtcctggcg gggcaactcc 1440

ttcgactatt ggggccaggg caccaccctg acagtgtcct cttga 1485

<210> 95

<211> 1533

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 95

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactcccag 60

gtgcagctgc agcagtctgg cgctgagctg gctagacctg gcgcctccgt gaagatgtcc 120

tgcaagacct ccggctacac cttcacccgg tacaccatgc actgggtcaa gcagaggcct 180

ggacagggcc tggaatggat cggctacatc aacccctccc ggggctacac caactacaac 240

cagaagttca aggacaaggc caccctgaca accgacaagt cctcctccac cgcctacatg 300

cagctgtcct ccctgacctc cgaggactcc gccgtgtact actgcgcccg gtactacgac 360

gaccactact ccctggacta ctggggccag ggcaccacac tgacagtgtc tagcgcctcc 420

accaagggcc cttccgtgtt ccctctggcc ccttcctcca agtccacctc cggcggcacc 480

gccgctctgg gctgcctggt gaaggactac ttccctgagc ctgtgaccgt gagctggaac 540

tctggcgccc tgaccagcgg cgtgcacacc ttccctgccg tgctgcagtc ctccggcctg 600

tactccctgt cctccgtggt gaccgtgcct tcctcctccc tgggcaccca gacctacatc 660

tgcaacgtga accacaagcc ttccaacacc aaggtggaca agcgggtgga gcctaagtcc 720

tgctccggcc ctgggggcgg acgcagcggc ggaggcggat ccggcggagg aggctctcag 780

gtgcagctgc agcagcctgg cgctgaactg gtccgacctg gcgcctccgt gaagctgtcc 840

tgcaaggcct ccggctacac cttcaccagc tactggatca actgggtcaa gcagcggcct 900

ggccagtgcc tggaatggat cggcaacatc tacccctccg actcctacac caactacaac 960

cagaagttca aggacaaggc caccctgacc gtggacaagt cctcctccac cgcctacatg 1020

cagctgtcca gccccacctc cgaggactcc gccgtgtact actgcacccg gtcctggcgg 1080

ggcaactcct tcgactattg gggccagggc accaccctga cagtgtcctc tggaggcgga 1140

ggatctggtg gtggcggatc tggcggcggt ggaagtggcg gaggtggtag cgacatcgtg 1200

atgacccagt ccccctccag cctgaccgtg accgctggcg agaaagtgac catgagctgc 1260

aagtcctccc agtccctgct gaactccggc aaccagaaga actacctgac ctggtatcag 1320

cagaagcccg gccagccccc caagctgctg atctactggg cctccacccg cgagtctggc 1380

gtgcccgata gattcaccgg ctccggcagc ggcaccgact ttaccctgac catctccagc 1440

gtgcaggccg aggacctggc cgtgtattac tgtcagaacg actactccta ccccttcacc 1500

ttcggctgcg gcaccaagct ggaaatcaag tga 1533

<210> 96

<211> 1548

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 96

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactcccag 60

gtgcagctgc agcagtctgg cgctgagctg gctagacctg gcgcctccgt gaagatgtcc 120

tgcaagacct ccggctacac cttcacccgg tacaccatgc actgggtcaa gcagaggcct 180

ggacagggcc tggaatggat cggctacatc aacccctccc ggggctacac caactacaac 240

cagaagttca aggacaaggc caccctgaca accgacaagt cctcctccac cgcctacatg 300

cagctgtcct ccctgacctc cgaggactcc gccgtgtact actgcgcccg gtactacgac 360

gaccactact ccctggacta ctggggccag ggcaccacac tgacagtgtc tagcgcctcc 420

accaagggcc cttccgtgtt ccctctggcc ccttcctcca agtccacctc cggcggcacc 480

gccgctctgg gctgcctggt gaaggactac ttccctgagc ctgtgaccgt gagctggaac 540

tctggcgccc tgaccagcgg cgtgcacacc ttccctgccg tgctgcagtc ctccggcctg 600

tactccctgt cctccgtggt gaccgtgcct tcctcctccc tgggcaccca gacctacatc 660

tgcaacgtga accacaagcc ttccaacacc aaggtggaca agcgggtgga gcctaagtcc 720

tgctccggcc ctgggggcgg acgcagcggc ggaggcggat ccggcggagg aggctctgac 780

atcgtgatga cccagtcccc ctccagcctg accgtgaccg ctggcgagaa agtgaccatg 840

agctgcaagt cctcccagtc cctgctgaac tccggcaacc agaagaacta cctgacctgg 900

tatcagcaga agcccggcca gccccccaag ctgctgatct actgggcctc cacccgcgag 960

tctggcgtgc ccgatagatt caccggctcc ggcagcggca ccgactttac cctgaccatc 1020

tccagcgtgc aggccgagga cctggccgtg tattactgtc agaacgacta ctcctacccc 1080

ttcaccttcg gctgcggcac caagctggaa atcaagggag gcggtggttc aggcggcgga 1140

ggcagcggtg gaggtggtag tggcggtggc ggttcagggg gaggtggctc gcaggtgcag 1200

ctgcagcagc ctggcgctga actggtccga cctggcgcct ccgtgaagct gtcctgcaag 1260

gcctccggct acaccttcac cagctactgg atcaactggg tcaagcagcg gcctggccag 1320

tgcctggaat ggatcggcaa catctacccc tccgactcct acaccaacta caaccagaag 1380

ttcaaggaca aggccaccct gaccgtggac aagtcctcct ccaccgccta catgcagctg 1440

tccagcccca cctccgagga ctccgccgtg tactactgca cccggtcctg gcggggcaac 1500

tccttcgact attggggcca gggcaccacc ctgacagtgt cctcttga 1548

<210> 97

<211> 1470

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 97

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactctcag 60

atcgtgctga cccagtctcc cgccatcatg tctgctagcc ctggcgagaa agtgacaatg 120

acctgccggg cctcctcctc cgtgtcctac atgaactggt atcagcagaa gtccggcacc 180

tcccccaagc ggtggatcta cgacacctcc aaggtggcct ctggcgtgcc ctacagattc 240

tccggctctg gctctggcac ctcctacagc ctgaccatct ccagcatgga agccgaggat 300

gccgccacct actactgcca gcagtggtcc tccaaccccc tgacctttgg cgctggcacc 360

aagctggaac tgaagcggac cgtggccgct ccttccgtgt tcatcttccc tccctccgac 420

gagcagctga agtccggcac cgcctccgtg gtgtgcctgc tgaacaactt ctaccctcgg 480

540

gtcaccgagc aggactccaa ggacagcacc tactccctgt cctccaccct gaccctgtcc 600

aaggccgact acgagaagca caaggtgtac gcctgcgagg tgacccacca gggcctgtcc 660

agccctgtga ccaagtcctt caaccggggc gagtgtgacg tgcctggtgg tagccaggtg 720

cagctgcagc agcctggcgc tgaactggtc cgacctggcg cctccgtgaa gctgtcctgc 780

aaggcctccg gctacacctt caccagctac tggatcaact gggtcaagca gcggcctggc 840

cagtgcctgg aatggatcgg caacatctac ccctccgact cctacaccaa ctacaaccag 900

aagttcaagg acaaggccac cctgaccgtg gacaagtcct cctccaccgc ctacatgcag 960

ctgtccagcc ccacctccga ggactccgcc gtgtactact gcacccggtc ctggcggggc 1020

aactccttcg actattgggg ccagggcacc accctgacag tgtcctctgg aggcggagga 1080

tctggtggtg gcggatctgg cggcggtgga agtggcggag gtggtagcga catcgtgatg 1140

acccagtccc cctccagcct gaccgtgacc gctggcgaga aagtgaccat gagctgcaag 1200

tcctcccagt ccctgctgaa ctccggcaac cagaagaact acctgacctg gtatcagcag 1260

aagcccggcc agccccccaa gctgctgatc tactgggcct ccacccgcga gtctggcgtg 1320

cccgatagat tcaccggctc cggcagcggc accgacttta ccctgaccat ctccagcgtg 1380

caggccgagg acctggccgt gtattactgt cagaacgact actcctaccc cttcaccttc 1440

ggctgcggca ccaagctgga aatcaagtga 1470

<210> 98

<211> 1485

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 98

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactctcag 60

atcgtgctga cccagtctcc cgccatcatg tctgctagcc ctggcgagaa agtgacaatg 120

acctgccggg cctcctcctc cgtgtcctac atgaactggt atcagcagaa gtccggcacc 180

tcccccaagc ggtggatcta cgacacctcc aaggtggcct ctggcgtgcc ctacagattc 240

tccggctctg gctctggcac ctcctacagc ctgaccatct ccagcatgga agccgaggat 300

gccgccacct actactgcca gcagtggtcc tccaaccccc tgacctttgg cgctggcacc 360

aagctggaac tgaagcggac cgtggccgct ccttccgtgt tcatcttccc tccctccgac 420

gagcagctga agtccggcac cgcctccgtg gtgtgcctgc tgaacaactt ctaccctcgg 480

540

gtcaccgagc aggactccaa ggacagcacc tactccctgt cctccaccct gaccctgtcc 600

aaggccgact acgagaagca caaggtgtac gcctgcgagg tgacccacca gggcctgtcc 660

agccctgtga ccaagtcctt caaccggggc gagtgtgacg tgcctggtgg tagcgacatc 720

gtgatgaccc agtccccctc cagcctgacc gtgaccgctg gcgagaaagt gaccatgagc 780

tgcaagtcct cccagtccct gctgaactcc ggcaaccaga agaactacct gacctggtat 840

cagcagaagc ccggccagcc ccccaagctg ctgatctact gggcctccac ccgcgagtct 900

ggcgtgcccg atagattcac cggctccggc agcggcaccg actttaccct gaccatctcc 960

agcgtgcagg ccgaggacct ggccgtgtat tactgtcaga acgactactc ctaccccttc 1020

accttcggct gcggcaccaa gctggaaatc aagggaggcg gtggttcagg cggcgggaggc 1080

agcggtggag gtggtagtgg cggtggcggt tcagggggag gtggctcgca ggtgcagctg 1140

cagcagcctg gcgctgaact ggtccgacct ggcgcctccg tgaagctgtc ctgcaaggcc 1200

tccggctaca ccttcaccag ctactggatc aactgggtca agcagcggcc tggccagtgc 1260

ctggaatgga tcggcaacat ctacccctcc gactcctaca ccaactacaa ccagaagttc 1320

aaggacaagg ccaccctgac cgtggacaag tcctcctcca ccgcctacat gcagctgtcc 1380

agccccacct ccgaggactc cgccgtgtac tactgcaccc ggtcctggcg gggcaactcc 1440

ttcgactatt ggggccaggg caccaccctg acagtgtcct cttga 1485

<210> 99

<211> 1593

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 99

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactctcag 60

gtgcagctgc agcagcctgg cgctgaactg gtccgacctg gcgcctccgt gaagctgtcc 120

tgcaaggcct ccggctacac cttcaccagc tactggatca actgggtcaa gcagcggcct 180

ggccagggcc tggaatggat cggcaacatc tacccctccg actcctacac caactacaac 240

cagaagttca aggacaaggc caccctgacc gtggacaagt cctcctccac cgcctacatg 300

cagctgtcca gccccacctc cgaggactcc gccgtgtact actgcacccg gtcctggcgg 360

ggcaactcct tcgactattg gggccagggc accaccctga cagtgtcctc tggaggcgga 420

ggatctggtg gtggcggatc tggcggcggt ggaagtggcg gaggtggtag cgacatcgtg 480

atgacccagt ccccctccag cctgaccgtg accgctggcg agaaagtgac catgagctgc 540

aagtcctccc agtccctgct gaactccggc aaccagaaga actacctgac ctggtatcag 600

cagaagcccg gccagcccc caagctgctg atctactggg cctccacccg cgagtctggc 660

gtgcccgata gattcaccgg ctccggcagc ggcaccgact ttaccctgac catctccagc 720

gtgcaggccg aggacctggc cgtgtattac tgtcagaacg actactccta ccccttcacc 780

ttcggctctg gcaccaagct ggaaatcaag tctggcggag gcggatccca ggtgcagctg 840

cagcagtctg gcgctgagct ggctagacct ggcgcctccg tgaagatgtc ctgcaagacc 900

tccggctaca ccttcacccg gtacaccatg cactgggtca agcagaggcc tggacagggc 960

ctggaatgga tcggctacat caacccctcc cggggctaca ccaactacaa ccagaagttc 1020

aaggacaagg ccaccctgac aaccgacaag tcctcctcca ccgcctacat gcagctgtcc 1080

tccctgacct ccgaggactc cgccgtgtac tactgcgccc ggtactacga cgaccactac 1140

tccctggact actggggcca gggcaccaca ctgacagtgt ctagcggtgg tggaggaagc 1200

ggagggggtg gtagcggtgg tggaggctct ggcgggggag ggagtcagat cgtgctgacc 1260

cagtctcccg ccatcatgtc tgctagccct ggcgagaaag tgacaatgac ctgccgggcc 1320

tcctcctccg tgtcctacat gaactggtat cagcagaagt ccggcacctc ccccaagcgg 1380

tggatctacg acacctccaa ggtggcctct ggcgtgccct acagattctc cggctctggc 1440

tctggcacct cctacagcct gaccactctcc agcatggaag ccgaggatgc cgccacctac 1500

tactgccagc agtggtcctc caaccccctg acctttggcg ctggcaccaa gctggaactg 1560

aagggcggct ctcaccacca ccatcaccac tga 1593

<210> 100

<211> 1608

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 100

atgggctggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcactctgac 60

atcgtgatga cccagtcccc ctccagcctg accgtgaccg ctggcgagaa agtgaccatg 120

agctgcaagt cctcccagtc cctgctgaac tccggcaacc agaagaacta cctgacctgg 180

tatcagcaga agcccggcca gccccccaag ctgctgatct actgggcctc cacccgcgag 240

tctggcgtgc ccgatagatt caccggctcc ggcagcggca ccgactttac cctgaccatc 300

tccagcgtgc aggccgagga cctggccgtg tattactgtc agaacgacta ctcctacccc 360

ttcaccttcg gctctggcac caagctggaa atcaagggag gcggtggttc aggcggcgga 420

ggcagcggtg gaggtggtag tggcggtggc ggttcagggg gaggtggctc gcaggtgcag 480

ctgcagcagc ctggcgctga actggtccga cctggcgcct ccgtgaagct gtcctgcaag 540

gcctccggct acaccttcac cagctactgg atcaactggg tcaagcagcg gcctggccag 600

ggcctggaat ggatcggcaa catctacccc tccgactcct acaccaacta caaccagaag 660

ttcaaggaca aggccaccct gaccgtggac aagtcctcct ccaccgccta catgcagctg 720

tccagcccca cctccgagga ctccgccgtg tactactgca cccggtcctg gcggggcaac 780

tccttcgact attggggcca gggcaccacc ctgacagtgt cctcttctgg cggaggcgga 840

tcccaggtgc agctgcagca gtctggcgct gagctggcta gacctggcgc ctccgtgaag 900

atgtcctgca agacctccgg ctacaccttc acccggtaca ccatgcactg ggtcaagcag 960

aggcctggac agggcctgga atggatcggc tacatcaacc cctcccgggg ctacaccaac 1020

tacaaccaga agttcaagga caaggccacc ctgacaaccg acaagtcctc ctccaccgcc 1080

tacatgcagc tgtcctccct gacctccgag gactccgccg tgtactactg cgcccggtac 1140

tacgacgacc actactccct ggactactgg ggccagggca ccacactgac agtgtctagc 1200

ggaggcggag gatctggtgg tggcggatct ggcggcggtg gaagtggcgg aggtggtagc 1260

cagatcgtgc tgacccagtc tcccgccatc atgtctgcta gccctggcga gaaagtgaca 1320

atgacctgcc gggcctcctc ctccgtgtcc tacatgaact ggtatcagca gaagtccggc 1380

acctccccca agcggtggat ctacgacacc tccaaggtgg cctctggcgt gccctacaga 1440

ttctccggct ctggctctgg cacctcctac agcctgacca tctccagcat ggaagccgag 1500

gatgccgcca ccctactactg ccagcagtgg tcctccaacc ccctgacctt tggcgctggc 1560

accaagctgg aactgaaggg cggctctcac caccaccatc accactga 1608

<210> 101

<211> 1545

<212> DNA

<213> Artificial Sequence

<220>

<223> Antibody-derived sequence

<400> 101

atgggatggt cctgcatcat cctgtttctg gtggctaccg ccaccggcgt gcacagccag 60

gtgcagctgc agcagcctgg agctgaactg gtgcggcctg gagccagcgt gaagctgtcc 120

tgcaaggcca gcggctacac cttcaccagc tactggatca actgggtgaa gcagcggcct 180

ggacagggcc tggaatggat cggcaacatc taccccagcg acagctacac caactacaac 240

cagaagttca aggacaaggc caccctgacc gtggacaaga gcagcagcac cgcctacatg 300

cagctgtcca gccccacctc cgaggacagc gccgtgtact actgcaccag aagctggcgg 360

ggcaacagct tcgactactg gggccagggc accacactga cagtcagcag cggaggaggg 420

ggatctggcg ggggaggaag cggagggggg ggaagcgaca tcgtgatgac ccagagcccc 480

agcagcctga ccgtgacagc cggggaaaag gtgaccatga gctgcaagag cagccagagc 540

ctgctgaaca gcggcaacca gaagaactac ctgacctggt atcagcagaa gcccggccag 600

ccccccaagc tgctgatcta ctgggccagc acccgggaga gcggcgtgcc cgaccggttt 660

accggctccg gctccggcac cgacttcacc ctgaccatca gcagcgtgca ggccgaggac 720

ctggccgtgt attactgtca gaacgactac agctacccct tcaccttcgg cagcggcacc 780

aagctggaaa tcaagagcgg agggggagga tccgatatca agctgcagca gagcggagct 840

gaactggcta ggccaggcgc ctccgtgaag atgagctgta agacctccgg ctataccttt 900

acccggtaca ccatgcactg ggtgaaacag aggcccggac aggggctgga atggattggc 960

tatatcaacc ccctcccgggg ctacacaaat tacaatcaga aattcaaaga taaagccaca 1020

ctgacaaccg acaagtccag ctccacagcc tatatgcagc tgtcctccct gaccagcgag 1080

gactctgccg tgtactattg cgccggtac tacgacgacc actacagcct ggattattgg 1140

gggcagggga caacactgac agtctccagc gtggagggcg gcagcgggagg atctggcggg 1200

agcggcggct ctgggggcgt cgacgacatc cagctgaccc agtcccccgc catcatgagc 1260

gccagccctg gcgagaaggt gacaatgacc tgccgggcca gcagcagcgt gagctacatg 1320

aattggtatc agcagaaaag cggcaccagc cccaagcggt ggatctacga caccagcaag 1380

gtggcctccg gcgtgccta cagattctcc ggctccggct ctggcaccag ctacagcctg 1440

acaatttcta gcatggaagc cgaggacgcc gccacctact actgccagca gtggagcagc 1500

aaccccctga cctttggcgc cggaacaaag ctggaactga agtga 1545

<---

Claims (130)

1. A binding agent that binds to CD3 T-cell specific antigen and claudin 6 (CLDN6), where the binding agent contains three binding domains, where the first binding domain binds to CD3 T-cell specific antigen, and the second binding domain and the third binding domain bind to claudin 6, where the first binding domain is in Fab molecular format and the second binding domain and third binding domain are in scFv molecular format, where the binding agent contains (a) a first polypeptide comprising an immunoglobulin heavy chain (VH) variable domain with specificity for CD3 T-cell specific antigen (VH(CD3)), a VH domain with specificity for claudin 6 (VH(CLDN6)) and an immunoglobulin light chain variable domain (VL) with specificity for claudin 6 (VL(CLDN6)); And (b) a second polypeptide comprising a VL domain with specificity for CD3 T cell antigen (VL(CD3)), a VH domain with specificity for claudin 6 (VH(CLDN6)) and a VL domain with specificity for claudin 6 (VL(CLDN6) ), where the first polypeptide and the second polypeptide are linked so as to form a binding agent, Where each VH(CD3) contains: HCDR1 having the amino acid sequence GYTFTRYT, HCDR2 having the amino acid sequence INPSRGYT, and HCDR3 having the amino acid sequence ARYYDDHYSLDY; and each VL(CD3) contains: LCDR1 having the amino acid sequence SSVSY, LCDR2 having the amino acid sequence DTS, and LCDR3 having the amino acid sequence QQWSSNPLT, And Where each VH(CLDN6) contains: HCDR1 having the amino acid sequence shown in SEQ ID NO: 44, HCDR2 having the amino acid sequence shown in SEQ ID NO: 45, and HCDR3 having the amino acid sequence shown in SEQ ID NO: 46; and each VL(CLDN6) contains: LCDR1 having the amino acid sequence shown in SEQ ID NO: 50, LCDR2 having the amino acid sequence shown in SEQ ID NO: 51, and LCDR3 having the amino acid sequence shown in SEQ ID NO: 52. 2. The binding agent of claim 1, wherein the first polypeptide further comprises an immunoglobulin heavy chain constant domain 1 (CH1), and the second polypeptide further comprises an immunoglobulin light chain constant domain (CL), wherein both domains are capable of association. 3. The binding agent according to claim 2, characterized in that the first polypeptide and the second polypeptide are covalently linked through a disulfide bridge between the CH1 domain and the CL domain. 4. The binding agent according to claim 2 or 3, characterized in that in the first polypeptide and the second polypeptide, the VH domain(s), the VL domain(s), the CH1 domain, and the CL domain are located from the N-terminus to the C-terminus, in order -VH(CD3)-CH1-VH(CLDN6)-VL(CLDN6) and VL(CD3)-CL-VH(CLDN6)-VL(CLDN6); or VH(CD3)-CH1-VL(CLDN6)-VH(CLDN6) and VL(CD3)-CL-VL(CLDN6)-VH(CLDN6). 5. The binding agent according to claim 4, characterized in that the VH-VL or VL-VH domains are linked to the CH1 domain or the CL domain via a peptide linker, for example, a peptide linker containing the amino acid sequence DVPG ₂ S or SGPG ₃ RS(G ₄ S) ₂ . 6. The binding agent according to claim 4 or 5, characterized in that the VH and VL domains are connected via a peptide linker to form VH-VL or VL-VH domains, such as a peptide linker containing the amino acid sequence (G ₄ S) _x , where x is 3, 4, 5, or 6. 7. The binding agent according to any one of paragraphs. 1-6, characterized in that the T-cell specific antigen is expressed on the surface of the T-cell. 8. The binding agent according to any one of paragraphs. 1-7, characterized in that the binding of the binding agent to the T-cell specific antigen CD3 on T-cells leads to the proliferation and/or activation of T-cells. 9. A binding agent according to claim 1, characterized in that the first binding domain binds to the CD3 epsilon chain. 10. The binding agent according to any one of paragraphs. 1-9, characterized in that claudin 6 is expressed on the surface of the cancer cell. 11. The binding agent according to any one of paragraphs. 1-10, characterized in that the binding agent binds to the extracellular domain of claudin 6. 12. The binding agent according to any one of paragraphs. 1-11, characterized in that binding to T-cell specific CD3 antigen and/or binding to claudin 6 is specific binding. 13. The binding agent according to any one of paragraphs. 1-12, characterized in that the binding agent induces T-cell mediated cytotoxicity against cancer cells expressing claudin 6. 14. The binding agent according to claim 13, wherein the binding agent induces T-cell mediated cytotoxicity against claudin 6-expressing cancer cells with an EC ₅₀ < 10 nM or < 1 nM or < 500 pM or < 250 pM, or < 100 pM, or < 50 pM. 15. The binding agent according to any one of paragraphs. 10-14, characterized in that the cancer(s) cell(s) are cells or derived from cancer cells selected from the group consisting of: bladder cancer, ovarian cancer, in particular ovarian adenocarcinoma and ovarian teratocarcinoma, lung cancer, including small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), in particular squamous cell lung cancer and adenocarcinoma, gastric cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer, in particular basal cell carcinoma and squamous cell carcinoma, malignant melanoma, head and neck cancer, in particular malignant pleomorphic adenoma, sarcoma, in particular synovial sarcoma and carcinosarcoma, bile duct cancer, bladder cancer, in particular transitional cell carcinoma and papillary carcinoma, kidney cancer, in particular renal cell carcinoma, including clear cell renal cell carcinoma and papillary renal cell carcinoma, colon cancer, small intestine cancer, including ileum cancer, in particular small intestine adenocarcinoma and ileal adenocarcinoma, embryonic testicular carcinoma, placental choriocarcinoma, cervical cancer, testicular cancer, in particular testicular seminoma, testicular teratoma and fetal testicular cancer, uterine cancer, germ cell tumors such as teratocarcinoma or fetal carcinoma, in particular testicular germinomas, and their metastatic forms. 16. The binding agent according to any one of paragraphs. 1-15, characterized in that VH(CD3) includes or consists of the amino acid sequence represented by SEQ ID NO: 5 or an amino acid sequence variant, where this variant is at least 95% identical to the amino acid sequence represented by SEQ ID NO: 5 entire length, or where said variant contains at most one amino acid substitution in the amino acid sequence represented by SEQ ID NO: 5 and/or VL(CD3) includes or consists of the amino acid sequence represented by SEQ ID NO: 6, or an amino acid sequence variant, where the variant is at least 95% identical to the amino acid sequence represented by SEQ ID NO: 6 throughout, or where the variant contains at most one amino acid substitution in the amino acid sequence shown in SEQ ID NO: 6. 17. The binding agent according to any one of paragraphs. 1-16, wherein the VH (CLDN6) comprises or consists of the amino acid sequence represented by SEQ ID NO: 8, or an amino acid sequence variant, where the variant is at least 95% identical to the amino acid sequence represented by SEQ ID NO: 8 throughout , or where the variant contains at most one amino acid substitution in the amino acid sequence represented by SEQ ID NO: 8, and/or VL(CLDN6) includes or consists of the amino acid sequence represented by SEQ ID NO: 10, or an amino acid sequence variant, where the variant is at least 95% identical to the amino acid sequence represented by SEQ ID NO: 10 throughout, or where the variant contains at most one amino acid substitution in the amino acid sequence shown in SEQ ID NO: 10. 18. The binding agent according to any one of paragraphs. 1-17, characterized in that the first polypeptide includes or consists of the amino acid sequence represented by SEQ ID NO: 14, or an amino acid sequence variant where the variant is at least 95% identical to the amino acid sequence represented by SEQ ID NO: 14 throughout, or where the variant contains at most one amino acid substitution in the amino acid sequence represented by SEQ ID NO: 14, and the second polypeptide comprises or consists of the amino acid sequence shown in SEQ ID NO. 16, or an amino acid sequence variant, where the variant is at least 95% identical to the amino acid sequence represented by SEQ ID NO: 16 throughout, or where the variant contains a maximum of one amino acid substitution in the amino acid sequence represented by SEQ ID NO: 16; - the first polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO: 15, or an amino acid sequence variant, where the variant is at least 95% identical to the amino acid sequence represented by SEQ ID NO: 15 throughout, or where the variant contains at most one an amino acid substitution in the amino acid sequence shown by SEQ ID NO: 15, and the second polypeptide comprises or consists of the amino acid sequence shown in SEQ ID NO. 16, or an amino acid sequence variant, where the variant is at least 95% identical to the amino acid sequence represented by SEQ ID NO: 16 throughout, or where the variant contains a maximum of one amino acid substitution in the amino acid sequence represented by SEQ ID NO: 16; - the first polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO: 17, or an amino acid sequence variant, where the variant is at least 95% identical to the amino acid sequence represented by SEQ ID NO: 17 throughout, or where the variant contains at most one an amino acid substitution in the amino acid sequence shown in SEQ ID NO: 17, and the second polypeptide comprises or consists of the amino acid sequence shown in SEQ ID NO. 19, or an amino acid sequence variant, where the variant is at least 95% identical to the amino acid sequence represented by SEQ ID NO: 19 throughout, or where the variant contains a maximum of one amino acid substitution in the amino acid sequence represented by SEQ ID NO: 19; or - the first polypeptide comprises or consists of the amino acid sequence represented by SEQ ID NO: 18, or an amino acid sequence variant, where the variant is at least 95% identical to the amino acid sequence represented by SEQ ID NO: 18 throughout, or where the variant contains at most one an amino acid substitution in the amino acid sequence shown by SEQ ID NO: 18, and the second polypeptide comprises or consists of the amino acid sequence shown in SEQ ID NO. 19, or an amino acid sequence variant, where the variant is at least 95% identical to the amino acid sequence represented by SEQ ID NO: 19 throughout, or where the variant contains a maximum of one amino acid substitution in the amino acid sequence represented by SEQ ID NO: 19. 19. Nucleic acid encoding a binding agent according to any one of paragraphs. 1-18, where the binding agent contains at least three binding domains, where the first binding domain binds to the CD3 T-cell specific antigen, and the second binding domain and the third binding domain bind to claudin 6, where the first binding domain is in Fab molecular format and the second binding domain and third binding domain are in scFv molecular format, where the binding agent contains (a) a first polypeptide comprising an immunoglobulin heavy chain (VH) variable domain with specificity for CD3 T-cell specific antigen (VH(CD3)), a VH domain with specificity for claudin 6 (VH(CLDN6)) and an immunoglobulin light chain variable domain (VL) with specificity for claudin 6 (VL(CLDN6)); And (b) a second polypeptide comprising a VL domain with specificity for CD3 T cell antigen (VL(CD3)), a VH domain with specificity for claudin 6 (VH(CLDN6)) and a VL domain with specificity for claudin 6 (VL(CLDN6) ), each VH(CD3) contains: HCDR1 having the amino acid sequence GYTFTRYT, HCDR2 having the amino acid sequence INPSRGYT, and HCDR3 having the amino acid sequence ARYYDDHYSLDY; and each VL(CD3) contains: LCDR1 having the amino acid sequence SSVSY, LCDR2 having the amino acid sequence DTS, and LCDR3 having the amino acid sequence QQWSSNPLT, And each VH(CLDN6) contains: HCDR1 having the amino acid sequence shown in SEQ ID NO: 44, HCDR2 having the amino acid sequence shown in SEQ ID NO: 45, and HCDR3 having the amino acid sequence shown in SEQ ID NO: 46; and each VL(CLDN6) contains: LCDR1 having the amino acid sequence shown in SEQ ID NO: 50, LCDR2 having the amino acid sequence shown in SEQ ID NO: 51, and LCDR3 having the amino acid sequence shown in SEQ ID NO: 52. 20. Nucleic acid according to claim 19, which is in the form of RNA. 21. A vector that contains a nucleic acid according to any one of claims 19-20, wherein the vector is an expression vector. 22. A host cell for expressing a binding agent encoded by a nucleic acid, where the host cell contains the nucleic acid according to any one of paragraphs. 19-20 or vector according to item 21. 23. A mixture of nucleic acids encoding a binding agent according to any one of paragraphs. 1-18, where the mixture contains: (a) a nucleic acid or nucleic acids encoding the first polypeptide contained in the binding agent, as defined in any of paragraphs. 1-18, wherein the first polypeptide chain comprises an immunoglobulin heavy chain (VH) variable domain with specificity for T-cell specific antigen CD3 (VH(CD3)), a VH domain with specificity for claudin 6 (VH(CLDN6)) and a light variable domain. immunoglobulin chains (VL) with specificity for claudin 6 (VL(CLDN6)); and/or (b) a nucleic acid or nucleic acids encoding a second polypeptide contained in the binding agent, as defined in any one of paragraphs. 1-18, wherein the second polypeptide comprises a VL domain with specificity for CD3 T cell antigen (VL(CD3)), a VH domain with specificity for claudin 6 (VH(CLDN6)) and a VL domain with specificity for claudin 6 (VL(CLDN6 )), each VH(CD3) contains: HCDR1 having the amino acid sequence GYTFTRYT, HCDR2 having the amino acid sequence INPSRGYT, and HCDR3 having the amino acid sequence ARYYDDHYSLDY; and each VL(CD3) contains: LCDR1 having the amino acid sequence SSVSY, LCDR2 having the amino acid sequence DTS, and LCDR3 having the amino acid sequence QQWSSNPLT, And each VH(CLDN6) contains: HCDR1 having the amino acid sequence shown in SEQ ID NO: 44, HCDR2 having the amino acid sequence shown in SEQ ID NO: 45, and HCDR3 having the amino acid sequence shown in SEQ ID NO: 46; and each VL(CLDN6) contains: LCDR1 having the amino acid sequence shown in SEQ ID NO: 50, LCDR2 having the amino acid sequence shown in SEQ ID NO: 51, and LCDR3 having the amino acid sequence shown in SEQ ID NO: 52. 24. A mixture of nucleic acids encoding a binding agent according to any one of paragraphs. 1-18, where the mixture contains nucleic acids encoding a binding agent according to any one of paragraphs. 1-18, where the binding agent contains at least three binding domains, where the first binding domain binds to the CD3 T-cell specific antigen, and the second binding domain and the third binding domain bind to claudin 6, where the first binding domain is in Fab molecular format and the second binding domain and third binding domain are in scFv molecular format, where the binding agent contains (a) a first polypeptide comprising an immunoglobulin heavy chain (VH) variable domain with specificity for CD3 T-cell specific antigen (VH(CD3)), a VH domain with specificity for claudin 6 (VH(CLDN6)) and an immunoglobulin light chain variable domain (VL) with specificity for claudin 6 (VL(CLDN6)); And (b) a second polypeptide comprising a VL domain with specificity for CD3 T cell antigen (VL(CD3)), a VH domain with specificity for claudin 6 (VH(CLDN6)) and a VL domain with specificity for claudin 6 (VL(CLDN6) ), where the first polypeptide and the second polypeptide are linked so as to form a binding agent, Where each VH(CD3) contains: HCDR1 having the amino acid sequence GYTFTRYT, HCDR2 having the amino acid sequence INPSRGYT, and HCDR3 having the amino acid sequence ARYYDDHYSLDY; and each VL(CD3) contains: LCDR1 having the amino acid sequence SSVSY, LCDR2 having the amino acid sequence DTS, and LCDR3 having the amino acid sequence QQWSSNPLT, And Where each VH(CLDN6) contains: HCDR1 having the amino acid sequence shown in SEQ ID NO: 44, HCDR2 having the amino acid sequence shown in SEQ ID NO: 45, and HCDR3 having the amino acid sequence shown in SEQ ID NO: 46; and each VL(CLDN6) contains: LCDR1 having the amino acid sequence shown in SEQ ID NO: 50, LCDR2 having the amino acid sequence shown in SEQ ID NO: 51, and LCDR3 having the amino acid sequence shown in SEQ ID NO: 52. 25. A mixture of nucleic acids according to claim 23 or 24, where the nucleic acids are in the form of RNA. 26. Composition of vectors for the expression of a binding agent, where the composition contains a mixture of nucleic acids according to any one of paragraphs. 23-25, where the nucleic acids in the mixture of nucleic acids are in the form of vectors. 27. A host cell for expressing a binding agent encoded by nucleic acids, where the host cell contains a mixture of nucleic acids according to any one of paragraphs. 23-26. 28. The use of a binding agent according to any one of paragraphs. 1-18, a nucleic acid according to any one of paragraphs. 19-20, a vector according to claim 21, a host cell according to claim 22 or 27, a mixture of nucleic acids according to any one of paragraphs. 23-25, or compositions according to claim 26 as a drug for the treatment or prevention of cancer characterized by the expression of claudin 6. 29. The use of a binding agent according to any one of paragraphs. 1-18, a nucleic acid according to any one of paragraphs. 19-20, a vector according to claim 21, a host cell according to claim 22 or 27, a mixture of nucleic acids according to any one of paragraphs. 23-25, or compositions according to claim 26 in the treatment or prevention of cancer, characterized in that the cancer cells express claudin to which the binding agent is able to bind. 30. Use according to claim 28 or 29, characterized in that the cancer is selected from the group consisting of bladder cancer, ovarian cancer, in particular ovarian adenocarcinoma and ovarian teratocarcinoma, lung cancer, including small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), in particular lung squamous cell carcinoma and adenocarcinoma, gastric cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer, in particular basal cell carcinoma and squamous cell carcinoma, malignant melanoma, head and neck cancer, in particular malignant pleomorphic adenoma , sarcomas, in particular synovial sarcoma and carcinosarcoma, bile duct cancer, bladder cancer, in particular transitional cell carcinoma and papillary carcinoma, kidney cancer, in particular renal cell carcinoma, including clear cell renal cell carcinoma and papillary renal cell carcinoma , colon cancer, small intestine cancer, including ileum cancer, in particular small bowel adenocarcinoma and ileal adenocarcinoma, embryonic testicular carcinoma, placental choriocarcinoma, cervical cancer, testicular cancer, in particular testicular seminoma, testicular teratoma and embryonic testicular cancer, uterine cancer, germ cell tumors such as teratocarcinoma or embryonic carcinoma, in particular testicular germinomas, and their metastatic forms. 31. Pharmaceutical composition for the treatment of cancer, characterized in that cancer cells express claudin 6, where the pharmaceutical composition includes a binding agent according to any one of paragraphs. 1-18, a nucleic acid according to any one of paragraphs. 19-20, a vector according to claim 21, a host cell according to claim 22 or 27, a mixture of nucleic acids according to any one of paragraphs. 23-25, or a composition according to claim 26, wherein the binding agent is capable of binding to said claudin 6. 32. Pharmaceutical composition according to claim 31, characterized in that the cancer is selected from the group consisting of bladder cancer, ovarian cancer, in particular ovarian adenocarcinoma and ovarian teratocarcinoma, lung cancer, including small cell lung cancer (SCLC) and non-small cell lung cancer ( NSCLC), in particular lung squamous cell carcinoma and adenocarcinoma, gastric cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer, in particular basal cell carcinoma and squamous cell carcinoma, malignant melanoma, head and neck cancer, in particular malignant pleomorphic adenoma, sarcomas, in particular synovial sarcoma and carcinosarcoma, bile duct cancer, bladder cancer, in particular transitional cell carcinoma and papillary carcinoma, kidney cancer, in particular renal cell carcinoma, including clear cell renal cell carcinoma and papillary renal cell carcinoma, colon cancer, small bowel cancer, including ileum cancer, in particular small bowel adenocarcinoma and ileal adenocarcinoma, fetal testicular carcinoma, placental choriocarcinoma, cervical cancer, testicular cancer, in particular testicular seminoma, testicular teratoma and fetal testicular cancer, cancer uterus, germ cell tumors such as teratocarcinoma or embryonic carcinoma, in particular testicular germinomas, and their metastatic forms. 33. A method for the treatment or prevention of cancer, characterized in that cancer cells express claudin 6, comprising administering a binding agent according to claim 1 to claim 18, a nucleic acid according to any one of claims. 19-20, a vector according to claim 21 for expressing a binding agent encoded by a nucleic acid, a host cell according to claim 22 or 27 for producing a binding agent encoded by a nucleic acid, a mixture of nucleic acids according to any one of paragraphs. 23-25, or a vector composition according to claim 26 for expressing a binding agent encoded by a nucleic acid or a pharmaceutical composition according to claim 31 or 32, wherein the binding agent is capable of binding to said claudin. 34. The method of treating or preventing cancer according to claim 33, characterized in that the cancer is selected from the group consisting of bladder cancer, ovarian cancer, in particular ovarian adenocarcinoma and ovarian teratocarcinoma, lung cancer, including small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), in particular lung squamous cell carcinoma and adenocarcinoma, gastric cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer, in particular basal cell carcinoma and squamous cell carcinoma, malignant melanoma, head and neck cancer, in particular malignant pleomorphic adenoma, sarcoma, in particular synovial sarcoma and carcinosarcoma, bile duct cancer, bladder cancer, in particular transitional cell carcinoma and papillary carcinoma, kidney cancer, in particular renal cell carcinoma, including clear cell renal cell carcinoma and papillary renal cell carcinoma, colon cancer, small bowel cancer, including ileum cancer, in particular small bowel adenocarcinoma and ileal adenocarcinoma, fetal testicular carcinoma, placental choriocarcinoma, cervical cancer, testicular cancer, in particular testicular seminoma, testicular teratoma and fetal cancer testis, uterine cancer, germ cell tumors such as teratocarcinoma or embryonic carcinoma, in particular testicular germinomas, and their metastatic forms.

Images