RU2798952C2 - Obtaining a nucleic acid library using electrophoresis - Google Patents

Abstract

FIELD: electrophoresis medical devices.

SUBSTANCE: group of inventions relates to a method of performing an enzymatic reaction using electrophoresis, a method of obtaining a library of labeled nucleic acid fragments from a target double-stranded nucleic acid, an electrophoresis device and a system for obtaining a library of labeled nucleic acid fragments from a target double-stranded nucleic acid. The electrophoresis system comprises an electrophoresis gel matrix having first and second ends and a length between the first and second ends. At the first and second ends, respectively, there is a pair of positive and negative electrodes. The first site near the first end contains the first cofactor of the enzyme. The second site near the second end contains the second cofactor of the enzyme. The second enzyme cofactor has an electrical charge opposite to the electrical charge of the first enzyme cofactor. The reaction site between the first site and the second site contains the enzyme. The application of an electric field between a pair of electrodes causes the molecules to migrate through the electrophoresis gel matrix to obtain the desired product.

EFFECT: reduction of the risk of physical damage to nucleic acids.

27 cl, 8 dwg

Description

CROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of priority of U.S. Provisional Application No. 62/873,603, filed July 12, 2019, the contents of which are incorporated herein by reference in their entirety for all purposes.

DESCRIPTION

FIELD OF THE INVENTION

[0002] The present application relates to methods and systems for processing nucleic acid molecules into nucleic acid libraries using electrophoresis. The present application also relates to methods, devices and systems for obtaining a library using electrophoresis.

BACKGROUND OF THE INVENTION

[0003] There are many methods and applications for which it is desirable to create a library of fragmented and labeled nucleic acid (eg, DNA) molecules from target double-stranded nucleic acid molecules (eg, double-stranded DNA (dsDNA)). Often the goal is to generate smaller nucleic acid molecules (eg, nucleic acid fragments or DNA) from larger target nucleic acid molecules for use as templates in sequencing reactions. Obtaining libraries for sequencing is difficult when using large nucleic acid molecules: large molecules are brittle and easily damaged (e.g., generating baseless sites or single-strand breaks) when over-transported and manipulated through many different physical processes, such as cell lysis , centrifugation, pipetting, sample transfer and vigorous mixing. Such damage leads to errors in the sequencing of target nucleic acids.

[0004] This document describes methods for performing multiple steps of combining and separating using electrophoresis to obtain nucleic acid libraries for sequencing (eg, tagging) that reduce the risk of physical damage to nucleic acids. These approaches can also be readily applied to other processes such as sample preparation, sample extraction, biochemical reactions, product purification, and nucleic acid fragment size selection.

SUMMARY OF THE INVENTION

[0005] This application relates to methods and devices for combining and separating substrates, reagents and products for an enzymatic reaction using gel electrophoresis. The present application also relates to methods, systems and devices for fragmenting and labeling nucleic acids, such as DNA, using transposome complexes using gel electrophoresis. The methods, systems, and devices described herein relate to methods and compositions for fragmenting and labeling DNA with transposome complexes using gel electrophoresis. The methods, systems and devices provided herein can be used, for example, to create libraries of labeled nucleic acid fragments (e.g., DNA) for use in, for example, next generation sequencing methods, etc. In some embodiments, the present application relates to obtain DNA fragments from target DNA containing any double-stranded DNA of interest (including double-stranded cDNA derived from RNA), from any source for genomic, subgenomic, transcriptional or metagenomic analysis or analysis of RNA expression.

[0006] As described herein, in one embodiment, a method for performing an enzymatic reaction using electrophoresis comprises:

(a) providing an electrophoresis system comprising:

an electrophoresis gel matrix having a first end and a second end and a length between the first and second ends;

a first region near the first end containing a first enzyme cofactor for the enzyme;

a second region near the second end and containing a second enzyme cofactor for said enzyme, the second enzyme cofactor having an electrical charge opposite to that of the first enzyme cofactor;

a reaction site between the first site and the second site and containing the enzyme; And

a pair of positive and negative electrodes located at the first and second ends, respectively; And

(b) applying an electric field between a pair of electrodes to move the first enzyme cofactor from the first site to the reaction site and move the second enzyme cofactor from the second site to the reaction site to form an activated enzyme complex containing the enzyme, the first enzyme cofactor, and the second enzyme cofactor.

[0007] In some embodiments, a method for obtaining a library of labeled nucleic acid fragments from a target double-stranded nucleic acid is provided, comprising:

(a) providing an electrophoresis system comprising:

an electrophoresis gel matrix having a first end and a second end, a width and a length between the first and second ends;

a first region near the first end containing a first transposase cofactor, wherein the first transposase cofactor is a metal ion;

a reaction site located at a distance from the first end and containing a transposome complex containing a transposase and a polynucleotide transposase adapter containing a double-stranded transposon terminal sequence and a single-stranded tag region; And

a pair of positive and negative electrodes located at the first and second ends, respectively;

(b) applying the target double-stranded nucleic acid to the reaction site;

(c) applying a first electric field between a pair of electrodes to move the first transposase cofactor from the first site to the reaction site to form an activated transposome complex comprising the transposase, the polynucleotide transposase adapter, and the first transposase cofactor; And

(d) incubating the target double-stranded nucleic acid with the activated transposome complex at the reaction site under conditions sufficient for the target double-stranded nucleic acid fragment rather than a plurality of nucleic acid fragments, and labeling the nucleic acid fragments, thereby creating a library of labeled nucleic acid fragments.

[0008] In some embodiments, a method for obtaining a library of labeled nucleic acid fragments from a target double-stranded nucleic acid is provided, comprising:

(a) providing an electrophoresis system comprising:

an electrophoresis gel matrix having a first end and a second end, a width and a length between the first and second ends;

a first region near the first end containing a first transposase cofactor for transposase, wherein the first transposase cofactor is a metal ion;

a second region near the second end and containing a second transposase cofactor for transposase, wherein the second transposase cofactor has an electrical charge opposite to that of the first transposase cofactor, wherein the second transposase cofactor is a polynucleotide transposase adapter comprising a transposon double-stranded terminal sequence and a single-stranded tag region;

a reactive site between the first site and the second site and containing a transposase; And

a pair of positive and negative electrodes located at the first and second ends, respectively;

(b) applying the target double-stranded nucleic acid to the reaction site;

(c) applying a first electric field between a pair of electrodes to move the first transposase cofactor from the first site to the reactive site and move the second transposase cofactor from the second site to the reactive site to form an activated transposomal complex comprising transposase, the first transposase cofactor, and the second transposase cofactor; And

(d) incubating the target double-stranded nucleic acid with the activated transposome complex at the reaction site under conditions sufficient for the target double-stranded nucleic acid fragment rather than a plurality of nucleic acid fragments, and labeling the nucleic acid fragments, thereby creating a library of labeled nucleic acid fragments.

[0009] In some embodiments, a method for obtaining a library of labeled nucleic acid fragments from a target double-stranded nucleic acid is provided, comprising:

(a) providing an electrophoresis system comprising:

an electrophoresis gel matrix having a first end and a second end, a width and a length between the first and second ends;

a first region containing a first transposase cofactor for transposase, wherein the first transposase cofactor is a metal ion;

a second region containing a second transposase cofactor for transposase, wherein the second transposase cofactor has an electrical charge opposite to that of the first transposase cofactor, wherein the second transposase cofactor is a polynucleotide transposase adapter comprising a transposon double-stranded terminal sequence and a single-stranded tag region;

a third site containing a lysing reagent;

a fourth site containing transposase;

a reaction site between the first site and the second site; And

a first pair of positive and negative electrodes located at the first and second ends, respectively; And

a second pair of positive and negative electrodes located on opposite sides of the width at one of: the first end or the second end;

(b) applying whole cells containing the target double-stranded nucleic acid to the reaction site;

(c) applying a first electric field to move a lysing agent into and/or through the reaction site to lyse the cells, thereby depositing the target double-stranded nucleic acid into the sample site;

(d) applying a second electric field to move the first transposase cofactor from the first site to the reactive site, move the second transposase cofactor from the second site to the reactive site, and/or move the transposase from the transposase site to the reactive site to form an activated transposomal complex containing the transposase, the first a transposase cofactor and a second transposase cofactor; And

(e) incubating the target double-stranded nucleic acid with the activated transposome complex at the reaction site under conditions sufficient for the target double-stranded nucleic acid fragment rather than a plurality of nucleic acid fragments, and labeling the nucleic acid fragments, thereby creating a library of labeled nucleic acid fragments.

[0010] In some embodiments, the electrophoresis device comprises an electrophoresis gel matrix having a first end, a second end, and a length between the first and second ends; a first region near the first end containing a first enzyme cofactor for the enzyme; a second region near the second end and containing a second enzyme cofactor for said enzyme, the second enzyme cofactor having an electrical charge opposite to that of the first enzyme cofactor; a reaction site between the first site and the second site and containing the enzyme; and a pair of positive and negative electrodes located at the first and second ends, respectively.

[0011] In some embodiments, the electrophoresis device comprises an electrophoresis gel matrix having a first end and a second end, a width and a length between the first and second ends; a first region near the first end containing a first transposase cofactor, wherein the first transposase cofactor is a metal ion; a reaction site located at a distance from the first end and containing a transposome complex containing a transposase and a polynucleotide transposase adapter containing a double-stranded transposon terminal sequence and a single-stranded tag region; and a pair of positive and negative electrodes located at the first and second ends, respectively.

[0012] In some embodiments, the electrophoresis device comprises an electrophoresis gel matrix having a first end, a second end, and a length between the first and second ends; a first region near the first end containing a first transposase cofactor for transposase, wherein the first transposase cofactor is a metal ion; a second region near the second end and containing a second transposase cofactor for transposase, wherein the second transposase cofactor has an electrical charge opposite to that of the first transposase cofactor, wherein the second transposase cofactor is a polynucleotide transposase adapter comprising a transposon double-stranded terminal sequence and a single-stranded tag region; a reactive site between the first end and the second end and containing a transposase; and a pair of positive and negative electrodes located at the first and second ends, respectively.

[0013] In some embodiments, the electrophoresis device comprises an electrophoresis gel matrix having a first end and a second end, a width and a length between the first and second ends; a first region near the first end containing a first transposase cofactor for transposase, wherein the first transposase cofactor is a metal ion; a second region near the second end and containing a second transposase cofactor for transposase, wherein the second transposase cofactor has an electrical charge opposite to that of the first transposase cofactor, wherein the second transposase cofactor is a polynucleotide transposase adapter comprising a transposon double-stranded terminal sequence and a single-stranded tag region; a third site containing a lysing reagent; the fourth site containing a transposase; a reaction site between the first end and the second end; and a first pair of positive and negative electrodes located at the first and second ends, respectively; and a second pair of positive and negative electrodes located on opposite sides of the width at one of the first end or the second end.

[0014] Additional objects and advantages will be set forth in part in the description below and in part will be obvious from the description or may be learned in practice. The objects and advantages will be realized and achieved with the elements and combinations specifically set forth in the appended claims.

[0015] It is to be understood that both the foregoing general description and the following detailed description are for the purpose of example and explanation only and are not intended to limit the claims.

[0016] The accompanying drawings, included in and forming part of this specification, illustrate one (several) embodiment(s) and, together with the description, serve to explain the principles described herein.

BRIEF DESCRIPTION OF GRAPHICS

[0017] In FIG. 1A shows general schemes for performing a chemical reaction using gel electrophoresis. A, B: reagents; c: product.

[0018] In FIG. 1B shows general schemes for performing an enzymatic reaction using gel electrophoresis. E: enzyme; S: substrate; C1, C2: enzyme cofactors; P: product.

[0019] In FIG. 2A shows an embodiment of methods for producing labeled nucleic acid fragments using gel electrophoresis. Tn5: A transposome complex containing a transposase (eg, Tn5 transposase) and a polynucleotide transposase adapter.

[0020] In FIG. 2B shows another embodiment of methods for producing labeled nucleic acid fragments using gel electrophoresis. Tn5: transposase (eg, Tn5 transposase); Ad.: Polynucleotide transposase adapter.

[0021] In FIG. 3A-3C show another embodiment of methods for producing labeled nucleic acid fragments using gel electrophoresis containing multiple reaction sites in a gel matrix and performing multiple sequential steps (t0-t5). Tn5: transposase (eg, Tn5 transposase); Ad.: polynucleotide transposase adapter; Lysir. rgt: lysing reagent.

[0022] In FIG. 4 shows general schemes for performing a variety of biochemical reactions in a variety of reagents having different electrophoretic mobilities placed on different regions of the gel matrix.

DETAILED DESCRIPTION

[0023] The section headings used in this specification are for organizational purposes only and should not be construed as limiting the subject matter described.

[0024] The present invention relates to methods and systems for performing chemical and/or enzymatic processes using electrophoresis and, in particular, relates to obtaining a library for sequencing nucleic acids (eg, DNA).

[0025] The gel electrophoresis system moves molecules between positions in a three-dimensional matrix. An electric field is applied to move the molecules through the three-dimensional matrix along the intersection paths. Different molecules migrate through the electric field with different electrophoretic mobilities. The methods described herein provide for a plurality of reactions at various locations in a three-dimensional matrix by predetermining the arrangement of the reactants such that they move along paths that intersect at successive time and position intervals, thus allowing multi-step processes to be performed: for example, obtaining nucleic acid libraries, sample extraction, biochemistry, product purification and sizing, all of which are performed in a gel.

[0026] In one embodiment, two molecules of known electrophoretic mobility may be located in a gel matrix and subjected to the same electric field in such a way that they migrate in different directions and at different speeds, but intersect at a certain point in time. As shown in FIG. 1A, two reactants, A and B, migrate in opposite but opposite directions from their starting positions at time t0, eventually combining after some time in an electric field (at time t2), where they react to form product C. In the next time interval (t3), the unreacted molecules A and B continue to migrate in opposite directions, but the molecule C, due to its mobility, either remains in the location where it was formed, or moves with a different mobility than the molecules A and B, and thus separated and purified from unreacted molecules.

Obtaining a transposase-mediated library

[0027] The methods and compositions provided herein provide a number of advantages in obtaining a library for sequencing. Libraries of fragmented nucleic acids are often created from genomic nucleic acids for use in fields related to next generation sequencing (NGS). The present description provides methods, devices, and a system for obtaining a transposition library. Current protocols for sequencing nucleic acid samples typically use a sample preparation method that converts DNA or RNA into a library of templates. In standard library preparation methods, each template contains an adapter at each end of the insert, and multiple steps are often required both to modify the DNA and to purify the desired products of the modification reactions. The number of steps required to convert DNA into adapter-modified templates in solution ready for clustering and sequencing can be minimized by using transposase-mediated fragmentation and labeling. This process, referred to herein as "tagmentation", refers to the modification of DNA by a transposome complex containing the enzyme transposase in complex with adapters containing the transposon terminal sequence. Tagging provides simultaneous fragmentation of DNA and ligation of adapters to the 5'-ends of both chains of duplex fragments. Labeled fragments are amplified, amplicons of interest are optionally captured (eg, via hybridization probes), and labeled fragments are sequenced.

[0028] Obtaining libraries for sequencing by tagging can be difficult when using large nucleic acid molecules: large molecules are brittle and easily damaged (e.g., generate sites lacking a nitrogenous base or single-strand breaks) when over-transported and manipulated through many different physical and chemical processes such as cell lysis, centrifugation, pipetting, sample transfer, vigorous mixing, and other material handling.

[0029] This application provides methods for obtaining a library using gel electrophoresis within a three-dimensional matrix. An electric field is applied to move the molecules through the three-dimensional matrix along the intersection paths, thus performing the combining steps and the separation steps. By performing sample extraction manipulations and generating a library based on the electrophoretic mobilities of the reagents in the gel matrix, the risk of physical damage to nucleic acids can be reduced. Damage is also reduced due to the physical incorporation and protection of the nucleic acids within the gel matrix. In addition, following further DNA manipulation, labeled DNA fragments and reagents can be purified based on different mobilities.

[0030] In some embodiments, a method for performing an enzymatic reaction using electrophoresis is provided, comprising (a) providing an electrophoresis system comprising: an electrophoresis gel matrix having a first end and a second end and a length between the first and second ends; a first region near the first end containing a first enzyme cofactor for the enzyme; a second region near the second end and containing a second enzyme cofactor for said enzyme, the second enzyme cofactor having an electrical charge opposite to that of the first enzyme cofactor; a reaction site between the first site and the second site and containing the enzyme; and a pair of positive and negative electrodes located at the first and second ends, respectively; and (b) applying an electric field between the pair of electrodes to move the first enzyme cofactor from the first site to the reaction site and move the second enzyme cofactor from the second site to the reaction site to form an activated enzyme complex comprising the enzyme, the first enzyme cofactor, and the second enzyme cofactor.

[0031] In additional embodiments, when the first enzyme cofactor is a metal ion, the second enzyme cofactor is a polynucleotide. In additional embodiments, the method further comprises applying a substrate for the activated enzyme complex to the reaction site prior to step (c), the application of an electric field comprising reacting the activated enzyme complex with the substrate at the reaction site to form a reaction product. In additional embodiments, application of an electric field includes migrating unreacted first and second enzyme cofactors from the reaction site to separate unreacted first and second enzyme cofactors from the reaction product at the reaction site.

[0032] In some embodiments, the first electrode is a positive electrode and the first enzyme cofactor is positively charged, while the second electrode is a negative electrode and the second enzyme cofactor is negatively charged.

[0033] In some embodiments, the implementation of the substrate is a target double-stranded nucleic acid. In further embodiments, the target double-stranded nucleic acid is double-stranded DNA, double-stranded RNA, or a DNA/RNA hybrid.

[0034] In some embodiments, the enzyme is a transposase. In some embodiments, the enzyme is a Tn5 transposase. In additional embodiments, the implementation of the first cofactor of the enzyme is Mg ²⁺ . In some embodiments, the implementation of the concentration of Mg ²⁺ is in the millimolar range. In some embodiments, the implementation of the concentration of Mg ²⁺ is from 0.5 to 10 mm. In some embodiments, the implementation of the concentration of Mg ²⁺ is from 1 to 10 mm. In some embodiments, the implementation of the concentration of Mg ²⁺ is from 1 to 5 mm. In some embodiments, the implementation of the concentration of Mg ²⁺ is 2 mm. In some embodiments, the implementation of the Mg ²⁺ cations are in the form of Mg(OAc) ₂ . In some embodiments, the implementation of the Mg ²⁺ cations are in the form of MgCl ₂ .

[0035] In further embodiments, the second enzyme cofactor is a polynucleotide transposase adapter comprising a double-stranded transposon terminal sequence and a single-stranded tag region. In additional embodiments, the second enzyme cofactor is a mixture of two polynucleotide transposase adapters, each adapter containing the same double-stranded transposon terminal sequence and a different single-stranded tag region.

[0036] In some embodiments, more complex electric fields may be applied, such as varying the amplitude or direction of the electric field, or providing different electric fields at 90 degrees to each other. In such an embodiment, more complex trajectories of the individual reactants are possible. In such cases, the reagents can be placed at predetermined locations within the matrix, depending on their known or expected mobilities, so that the reagents can be combined and/or separated by alternating electrophoretic fields and moving molecules along selected trajectories between positions on the gel matrix. In some embodiments, one or more reactants (such as enzymes) can be immobilized on a solid support (beads at the reaction site) in a three-dimensional matrix, thus preventing them from moving in electric fields, while other reactants can move freely according to their mobility in electric fields.

[0037] In some embodiments, the implementation of the method includes changing the magnitude or direction of the electric field through the gel matrix for electrophoresis. In some embodiments, the implementation of the method includes changing the magnitude or direction of the electric field through the gel matrix for electrophoresis. In some embodiments, the implementation of the electrophoresis system contains additional sections along the width and length, each of which contains different reagents. In some embodiments, a second pair of positive and negative electrodes may be provided on opposite sides of the width at one of the first end or the second end to apply an additional electric field. The electric fields generated by the first and second pairs of electrodes may be located in different directions. The electric fields generated by the first and second pairs of electrodes may be perpendicular to each other.

[0038] In FIG. 1A shows an example configuration of the electrophoresis system described herein for performing a chemical reaction, in accordance with some embodiments. Upon application of an electric field, the two reactants, A and B (such as, without limitation, the first enzyme cofactor and the second enzyme cofactor), migrate in opposite but opposite directions from their starting positions at time t0, eventually combining after some time. in an electric field (at time t2), when they react with each other or with a third reagent to form product C. In the next time interval (t3), unreacted A and B continue to migrate in opposite directions, but the molecule of product C, due to of its mobility, either remains in place or moves with a different mobility than A and B, and thus is cleared of unreacted reagents.

[0039] In FIG. 1B depicts an example configuration of the electrophoresis system described herein for performing an enzymatic reaction, in accordance with some embodiments. The first enzyme cofactor C1 and the second enzyme cofactor C2 are located at the first and second sites near opposite ends of the electrophoresis gel matrix, respectively. The reaction site between the first site and the second site contains enzyme E. A support S is additionally provided on the reaction site. When an electric field is applied, the first cofactor C1 of the enzyme and the second cofactor C2 of the enzyme migrate in opposite but opposite directions from their initial positions at time t0. At time t2, when they react with each other and with the enzyme, an activated enzyme complex is formed containing the enzyme, the first enzyme cofactor and the second enzyme cofactor (E+C1+C2), which catalyzes the reaction of substrate S to form product P. B at a subsequent time t3, the unreacted C1 and C2 continue to migrate in opposite directions, but the product P, due to its mobility, either remains in place or moves with a different mobility than that of A and B, and thus is cleared of unreacted reactants.

[0040] In some embodiments, a method is provided for obtaining a library of labeled nucleic acid fragments from a target double-stranded nucleic acid. In some embodiments, the method includes: (a) providing an electrophoresis system comprising: an electrophoresis gel matrix having a first end and a second end, a width and a length between the first and second ends; a first region near the first end containing a first transposase cofactor, wherein the first transposase cofactor is a metal ion; a reaction site located at a distance from the first end and containing a transposome complex containing a transposase and a polynucleotide transposase adapter containing a double-stranded transposon terminal sequence and a single-stranded tag region; and a pair of positive and negative electrodes located at the first and second ends, respectively; (b) applying the target double-stranded nucleic acid to the reaction site; (c) applying a first electric field between a pair of electrodes to move the first transposase cofactor from the first site to the reaction site to form an activated transposome complex comprising the transposase, the polynucleotide transposase adapter, and the first transposase cofactor; and (d) incubating the target double-stranded nucleic acid with the activated transposome complex at the reaction site under conditions sufficient for the target double-stranded nucleic acid fragment rather than a plurality of nucleic acid fragments, and labeling the nucleic acid fragments, thereby creating a library of labeled nucleic acid fragments. In additional embodiments, the transposome complex is immobilized on a solid support at the reaction site. The transposome complex is optionally immobilized via a streptavidin-biotin interaction. In additional embodiments, the method further comprises releasing the transposome complex from the solid support after generation of labeled nucleic acid fragments. In additional embodiments, the method further comprises changing the magnitude of the first electric field after the step of introducing labeled nucleic acid fragments associated with the transposome complex released from the solid support at the collection site.

[0041] In FIG. 2A shows an example of a method performed using a two-well electrophoresis device. In the beginning, the first region on the left contains a metal ion, such as Mg ²⁺ , and the reactive region in the center contains a high molecular weight nucleic acid (eg, DNA) and a transposome complex. When an electric field is applied (time t1) Mg ²⁺ moves to the negative electrode and the content of the reaction site remains in place due to its size and hence lack of mobility in the gel matrix. In the next time interval (t2), Mg ²⁺ reaches the reaction site with the formation of an activated transposome complex, and then the activated complex binds to fragments and labels (tagged fragments) of large DNA molecules with small library templates. After completion of the reaction (time t3) Mg ²⁺ goes to the negative electrode. Tagged fragments can be collected or further processed at the reaction site. In an alternative embodiment, due to the greatly reduced size, the tag fragments can now move towards the positive electrode, thus separating and optionally clearing fragments that can be collected from a collection site (not shown).

[0042] In some embodiments, a method is provided for obtaining a library of labeled nucleic acid fragments from a target double-stranded nucleic acid. The method includes: (a) providing an electrophoresis system comprising: an electrophoresis gel matrix having a first end and a second end, a width and a length between the first and second ends; a first region near the first end containing a first transposase cofactor for transposase, wherein the first transposase cofactor is a metal ion; a second region near the second end and containing a second transposase cofactor for transposase, wherein the second transposase cofactor has an electrical charge opposite to that of the first transposase cofactor, wherein the second transposase cofactor is a polynucleotide transposase adapter comprising a transposon double-stranded terminal sequence and a single-stranded tag region; a reactive site between the first site and the second site and containing a transposase; and a pair of positive and negative electrodes located at the first and second ends, respectively; (b) applying the target double-stranded nucleic acid to the reaction site; (c) applying a first electric field between a pair of electrodes to move the first transposase cofactor from the first site to the reactive site and move the second transposase cofactor from the second site to the reactive site to form an activated transposomal complex comprising transposase, the first transposase cofactor, and the second transposase cofactor; and (d) incubating the target double-stranded nucleic acid with the activated transposome complex at the reaction site under conditions sufficient for the target double-stranded nucleic acid fragment rather than a plurality of nucleic acid fragments, and labeling the nucleic acid fragments, thereby creating a library of labeled nucleic acid fragments.

[0043] In further embodiments, the metal ion is Mg ²⁺ , optionally as Mg(OAc) ₂ or MgCl ₂ . In some embodiments, the implementation of the concentration of Mg ²⁺ is in the millimolar range. In some embodiments, the implementation of the concentration of Mg ²⁺ is from 0.5 to 10 mm. In some embodiments, the implementation of the concentration of Mg ²⁺ is from 1 to 10 mm. In some embodiments, the implementation of the concentration of Mg ²⁺ is from 1 to 5 mm. In some embodiments, the implementation of the concentration of Mg ²⁺ is 2 mm. In some embodiments, the implementation of the Mg ²⁺ cations are presented in the form of Mg(OAc) ₂ . In some embodiments, the implementation of the Mg ²⁺ cations are in the form of MgCl ₂ . When applying the target nucleic acid to the reaction site in step (b), the transposase or transposome complex first binds to the target nucleic acid in the absence of Mg ²⁺ . When an electric field is applied in step (c), the transposase does not migrate because it is bound to a large target nucleic acid, while Mg ²⁺ migrates to the reaction site.

[0044] In some embodiments, the single-stranded tag region contains one or more of: a primer sequence, a barcode sequence, a unique molecular identifier (UMI) sequence, an amplification tag, an enrichment tag, or a purification tag.

[0045] In some embodiments, the transposase is a Tn5, MuA, or Vibrio Haryi transposase, or an active mutant thereof. In some embodiments, the transposase is a Tn5 transposase. In some embodiments, the Tn5 transposase is an overactive Tn5 transposase. In some embodiments, the transposase is immobilized on a solid support within the reaction site. In some embodiments, the reaction site comprises a well and the solid support is a granular particle in the well, or the solid support is the surface of the well.

[0046] In some embodiments, the target double-stranded nucleic acid is double-stranded DNA, double-stranded RNA, or a DNA/RNA hybrid.

[0047] In some embodiments, when the first electric field is applied in step (c), the target double-stranded nucleic acid remains within the reaction site due to its large size, thus there is no mobility in the gel matrix. In some embodiments, the magnitude of the first electric field applied in step (c) is set such that the target double-stranded nucleic acid has substantially no electrophoretic mobility within the electrophoresis matrix.

[0048] In some embodiments, the electrophoresis system comprises a lengthwise collection site between the first site and the reaction site. In additional embodiments, application of the first electric field in step (c) includes moving labeled nucleic acid fragments to a collection site. In additional embodiments, the method includes increasing the magnitude of the first electric field after step (d) introducing labeled nucleic acid fragments to the collection site.

[0049] In some embodiments, the implementation of the method includes changing the magnitude or direction of the first electric field through the gel matrix for electrophoresis. In some embodiments, the electrophoresis system comprises additional regions along the width and length, each containing a different tagging reagent, and a second pair of positive and negative electrodes on opposite sides of the width at one of the first end or the second end. In some embodiments, the method includes applying a second electric field between a second pair of electrodes, wherein the direction of the second electric field is different from the direction of the first electric field applied in step (c). In some embodiments, the method includes applying a second electric field between a second pair of electrodes, wherein the direction of the second electric field is perpendicular to the direction of the first electric field applied in step (c).

[0050] In some embodiments, the electrophoresis system comprises a third site containing a lyse reagent; moreover, the reaction site contains whole cells. In some embodiments, the method further includes applying a third electric field to move the lytic agent into and/or through the reaction site to lyse cells, thereby depositing the target double-stranded nucleic acid at the sample site.

[0051] In some embodiments, applying the target double-stranded nucleic acid includes adding a biological sample to the reaction site. The biological sample may be of any type that contains a nucleic acid (eg, DNA) and that can be deposited on a reaction site for tagging. For example, the sample may contain nucleic acid in various purification states, including purified nucleic acid. However, the sample need not be completely purified and may contain, for example, DNA mixed with protein, other types of nucleic acids, other cellular components and/or any other contaminant. In some embodiments, the biological sample contains a mixture of DNA, protein, other types of nucleic acids, other cellular components, and/or any other contaminant, in approximately the same proportion as in vivo .

[0052] The biological sample may contain, for example, crude cell lysate or whole cells. For example, a crude cell lysate applied to a solid support by the method described herein does not necessarily need to be subjected to one or more separation steps that are traditionally used to isolate nucleic acids from other cellular components. Examples of separation steps are provided in Maniatis et al., Molecular Cloning: A Laboratory Manual, 2d Edition, 1989, and Short Protocols in Molecular Biology, ed. Ausubel, et al, incorporated herein by reference.

[0053] Thus, in some embodiments, the biological sample may comprise, for example, blood, plasma, serum, lymph, mucus, sputum, urine, semen, cerebrospinal fluid, bronchial aspirate, feces, and macerated tissue or a lysate thereof, or any other biological sample containing DNA.

[0054] In FIG. 2B shows an example of the method described herein using an electrophoresis system containing 4 wells a), b), c) and d) and a pair of electrodes. At the beginning of the process, the well a) contains Mg ²⁺ , b) is empty, c) contains high molecular weight DNA and a transposase (eg, Tn5 transposase), and d) contains a polynucleotide transposase adapter (eg , Nextera ^TM adapters, Illumina). On application of an electric field (time t1) the Mg ²⁺ moves towards the negative electrode while the small adapters move towards the positive electrode, the content c) remaining in place due to its size and therefore lack of mobility in the gel matrix. In the next time interval (t2) adapters and Mg ²⁺ intersect in well c) with the formation of an activated transposome complex containing transposase, Mg ²⁺ and adapters. The activated transposome complex then binds to fragments and tags (tagged fragments) of large DNA molecules with small library templates. After completion of the reaction (time t3) Mg ²⁺ goes to the negative electrode. Tagged fragments can be collected or further processed at the reaction site. In an alternative embodiment, due to the greatly reduced size, the tag fragments move towards the positive electrode, thus separating and optionally clearing the fragments that can be collected from well b) in the next time interval (t4).

[0055] In some embodiments, more complex electric fields may be applied, such as varying the amplitude or direction of the electric field, or providing different electric fields at 90 degrees to each other. In such an embodiment, more complex trajectories of the individual reactants are possible. In such cases, the reagents can be placed at predetermined locations within the matrix, depending on their known or expected mobilities, so that the reagents can be combined and/or separated by alternating electrophoretic fields and moving molecules along selected trajectories between positions on the gel matrix.

[0056] In some embodiments, a method is provided for obtaining a library of labeled nucleic acid fragments from a target double-stranded nucleic acid using more than one electric field. In some embodiments of the present invention, the method includes: (a) providing an electrophoresis system comprising: an electrophoresis gel matrix having a first end and a second end, a width and a length between the first and second ends; and containing the first plot, the second plot, the third plot and the fourth plot; a first pair of positive and negative electrodes located at the first and second ends, respectively; and a second pair of positive and negative electrodes located on opposite sides of the width at one of the first end or the second end. The first region contains the first transposase cofactor for transposase. The first transposase cofactor is a metal ion. The second region contains a second transposase cofactor for said transposase. The second transposase cofactor has an electrical charge opposite to that of the first transposase cofactor. The second transposase cofactor is a polynucleotide transposase adapter containing a double-stranded transposon terminal sequence and a single-stranded tag region. The third section contains a lysing reagent. The fourth site contains a transposase. The system further comprises a reaction site between the first site and the second site.

[0057] In some embodiments, the implementation of the method further includes: (b) applying whole cells containing the target double-stranded nucleic acid to the reaction site; (c) applying a first electric field to move a lysing agent into and/or through the reaction site to lyse the cells, thereby depositing the target double-stranded nucleic acid into the sample site; (d) applying a second electric field to move the first transposase cofactor from the first site to the reactive site, move the second transposase cofactor from the second site to the reactive site, and/or move the transposase from the transposase site to the reactive site to form an activated transposomal complex containing the transposase, the first a transposase cofactor and a second transposase cofactor; and (e) incubating the target double-stranded nucleic acid with the activated transposome complex at the reaction site under conditions sufficient for the target double-stranded nucleic acid fragment rather than a plurality of nucleic acid fragments, and labeling the nucleic acid fragments, thereby creating a library of labeled nucleic acid fragments.

[0058] In other embodiments, the first electric field and the second electric field are different, and step (c) is performed before step (d). In further embodiments, the first electric field and the second electric field are the same and step (c) is performed simultaneously with step (d). In additional embodiments, the method includes applying one or more electric fields after the library of labeled nucleic acid fragments has been generated to move from the reaction site one or more of: a lyse reagent, a transposome complex, a transposase, a transposase adaptor, a metal ion, and labeled nucleic acid fragments. In some embodiments, the method further comprises moving the labeled nucleic acid fragments to a collection site. In some embodiments, the method further comprises moving the lyse, the transposome complex, the metal ion, and the labeled nucleic acid fragments from the reaction site to separate receiving sites.

[0059] In FIG. 3A-3C illustrate an embodiment of the method described herein. The electrophoresis system contains Mg ²⁺ , transposase (eg, transposase Tn5), adapters, and lysing reagents placed in wells at the start of t0. The sample (eg, cells having high molecular weight target DNA) is loaded onto the reaction site. Two alternating electric fields at 90 degrees to each other are applied in a controlled manner, resulting in the movement of reagents and substrates through the gel matrix. In the next time interval (t1), lysing reagents enter the reaction site and combine with the sample for cell lysis. Simultaneously, other reagents migrate to the reaction part in accordance with their mobility. In the next time interval (t2), lysing reagents migrate from the reaction part, leaving behind purified high molecular weight DNA. At the next time interval (t3), the tagging reagents (transposase (e.g., transposase Tn5), Mg ²⁺ and adapters) enter the sample well and form an activated complex, which then binds to fragments and tags (tagged fragments) of the target DNA. In the next time interval (t4), the tagging reagents migrate additionally, leaving behind the purified tagged library matrices. Tagged fragments can be collected or further processed at the reaction site. In an alternative embodiment, at the next time interval (t5), the tagged library matrices further migrate into the sample collection well.

[0060] In some embodiments, transposome complexes bind to a target nucleic acid and create single strand breaks in the backbone, 9 bases apart on either strand. In other embodiments, the transposome creates a gap between single strand breaks of 7, 8, 9, 10, 11, or 12 base pairs (bp). In some embodiments, the method further comprises filling gaps and ligating single strand breaks in the nucleic acid fragments. Any known ligase capable of single strand break ligation (adjacent 5'-phosphate end and 3'-OH) can be used. A ligase may be provided in a second reaction site, the second reaction site being the same as or different from the tagmentation reaction site.

[0061] In some embodiments, filling gaps and ligating single strand breaks in nucleic acid fragments includes incubating the labeled fragments with a strand replacement polymerase under conditions and for a sufficient time that gaps in the labeled fragments are filled. In some embodiments, filling gaps and ligating single-strand gaps in nucleic acid fragments includes incubating labeled fragments with a non-strand replacement polymerase to span the gap, and then with ligase under conditions and for a sufficient time that single-strand gaps in the labeled fragments are filled.

[0062] In some embodiments, the method further comprises amplifying the resulting nucleic acid fragments. Nucleic acid fragments obtained by transposome-mediated tagmentation can be amplified according to any suitable amplification methods known in the art. In some embodiments, the amplification comprises the use of one or more of: nucleic acid amplification reaction, strand displacement amplification, rolling ring amplification (RCA), ligase chain reaction, transcription-mediated amplification, or loop amplification.

[0063] In some embodiments, the processed nucleic acid fragments may be provided with a barcode to maintain continuity of sequencing information from the target nucleic acid. As used herein, the term "adjacency" refers to the spatial relationship between two or more DNA fragments based on common information. The general aspect of information can refer to near, compartment, and distant spatial relationships. Information about these relationships in molecules, in turn, facilitates the hierarchical assembly or mapping of sequence reads derived from DNA fragments. In some embodiments, the single strand region of the polynucleotide transposase adapter tag further comprises a barcode sequence. In some embodiments, the methods described herein further include contacting labeled fragments with a solid support-linked barcode sequence to transfer barcode sequence information to fragments of the target nucleic acid. In some embodiments, the barcode sequence is added while the fragment remains bound to the transposase. Continuity information of the target nucleic acid is determined by identifying barcode sequences. Examples of preparations of barcoded target nucleic acid fragments that can be readily adapted for use with the methods of the present application are described, for example, in US 2019/0040382, WO2014142850A1 and WO 2014/108810, each of which is incorporated herein by reference in its entirety.

[0064] When whole cells are applied to the reaction sample, extraction and processing of nucleic acids is performed before tagging, which requires additional reagents. Non-limiting examples of reagents for such pre-processing include lysing agents; solutions containing enzymes for splitting the walls of bacterial, fungal or plant cells; protease solutions; and solutions containing enzymes for DNA processing. In some embodiments, they may be loaded into one or more different locations of the gel matrix. In some embodiments, the system may be configured to sequentially add and remove a number of reagents from a single location. Adding and removing reagents can be done from the top of the container using standard liquid handling equipment (such as, for example, gantry liquid handling robots available from Beckman, Agilent, Tecan, Hamilton, etc.). In other embodiments, the addition and removal of reagents may be via fluid channels within the container.

[0065] In some embodiments, the transposases of the transposome complexes are removed from the nucleic acid fragments after transposition. In some embodiments, transposases are removed from nucleic acid fragments after transposition and after subsequent hybridization of transposon adapter sequences with a complementary capture sequence. In some embodiments, transposases are removed by SDS treatment. In some embodiments, transposases are removed by proteinase treatment.

[0066] In some embodiments, the processed nucleic acid fragments can be transferred from the electrophoresis gel matrix for analysis or to other processes for obtaining libraries, such as, for example, size selection processes, such as those described in U.S. Patent Nos. 8,361,298 and 8,361,299, both of which are incorporated herein by reference in their entirety.

[0067] In some embodiments, processed nucleic acid fragments generated by transposome-mediated tagmentation can be assembled and sequenced according to any suitable sequencing technique, such as direct sequencing, including sequencing by synthesis, sequencing by ligation, sequencing by hybridization, sequencing through nanopores, and the like. In some embodiments, fragments of a desired size or size range (e.g., 25 to 500 base pairs (bp), or 50 to 500 bp, or 50 to 350 bp ., or from 100 to 300 bp or about 50, 150, 250 or 300 bp) can be selectively collected per collection site. Upon application of an electric field, processed nucleic acid fragments may further migrate out of the reaction site. Since fragments of different sizes have different mobilities, fragments of the required size or range of sizes can be selectively separated and collected from the collection site.

[0068] In some embodiments, a method for performing a plurality of sequential chemical and/or enzymatic processes is provided. In some embodiments, more complex electric fields may be applied, such as varying the amplitude or direction of the electric field, or providing different electric fields at 90 degrees to each other. In such an embodiment, more complex trajectories of the individual reactants are possible. In such cases, the reagents can be placed at predetermined locations within the matrix, depending on their known or expected mobilities, so that the reagents can be combined and/or separated by alternating electrophoretic fields and moving molecules along selected trajectories between positions on the gel matrix. In some embodiments, one or more reactants (such as enzymes) can be immobilized on a solid support (beads at the reaction site) in a three-dimensional matrix, thus preventing them from moving in electric fields, while other reactants can move freely according to their mobility in electric fields.

[0069] In FIG. 4 illustrates the general scheme of a method for performing a variety of biochemical reactions using gel electrophoresis. The electrophoresis device contains a plurality of sections along the width and length, each of which contains different reagents. Two pairs of positive and negative electrodes are provided on opposite sides of the width at one of the first end or the second end to apply alternating electric fields perpendicular to each other. The reagents migrate to the first reaction site to perform the first biochemical reaction. By changing the amplitude or direction of the electric field(s), the product of the first biochemical reaction migrates to the second reaction site and reacts with the reagent to perform the second biochemical reaction. These steps can be repeated for subsequent biochemical reactions at additional reaction sites.

Devices/systems

[0070] In some embodiments, an electrophoresis system for performing an enzymatic reaction is provided. In some embodiments, said electrophoresis system comprises an electrophoresis gel matrix having a first end and a second end and a length between the first and second ends; a first region near the first end containing a first enzyme cofactor for the enzyme; a second region near the second end and containing a second enzyme cofactor for said enzyme, the second enzyme cofactor having an electrical charge opposite to that of the first enzyme cofactor; a reaction site between the first site and the second site and containing the enzyme; and a pair of positive and negative electrodes located at the first and second ends, respectively. In additional embodiments, a substrate for the enzyme is provided at the reaction site.

[0071] In some embodiments, an electrophoresis device is provided, comprising an electrophoresis gel matrix having a first end and a second end, a width and a length between the first and second ends; a first region near the first end containing a first transposase cofactor, wherein the first transposase cofactor is a metal ion; a reaction site located at a distance from the first end and containing a transposome complex containing a transposase and a polynucleotide transposase adapter containing a double-stranded transposon terminal sequence and a single-stranded tag region; and a pair of positive and negative electrodes located at the first and second ends, respectively.

[0072] In some embodiments, an electrophoresis device is provided, comprising an electrophoresis gel matrix having a first end, a second end, and a length between the first and second ends; the first section near the first end; a second section near the second end; a reaction site between the first end and the second end; and a pair of positive and negative electrodes located at the first and second ends, respectively. The first region contains the first transposase cofactor for transposase. In some embodiments, the first transposase cofactor is a metal ion. The second region contains a second transposase cofactor for transposase, wherein the second transposase cofactor has an electrical charge opposite to that of the first transposase cofactor. In some embodiments, the second transposase cofactor is a polynucleotide transposase adapter comprising a transposon double-stranded terminal sequence and a single-stranded tag region. The reaction site contains a transposase. In some embodiments, a target nucleic acid is provided at the reaction site.

[0073] In some embodiments, an electrophoresis device is provided, comprising an electrophoresis gel matrix having a first end, a second end, and a length between the first and second ends; first section; second section; the third section and the fourth section; reaction site; a first pair of positive and negative electrodes located at the first and second ends, respectively; and a second pair of positive and negative electrodes located on opposite sides of the width at one of the first end or the second end. The first region contains a first transposase cofactor for transposase, wherein the first transposase cofactor is a metal ion. The second region contains a second transposase cofactor for transposase, wherein the second transposase cofactor has an electrical charge opposite to that of the first transposase cofactor. The second transposase cofactor is a polynucleotide transposase adapter containing a double-stranded transposon terminal sequence and a single-stranded tag region. The third section contains a lysing reagent. In some embodiments, whole cells containing the target nucleic acid are provided in the reaction site. In some embodiments, the implementation of the device contains additional areas along the width and/or length, each of which contains different reagents for tagging. In some embodiments, the device comprises a collection site for receiving labeled nucleic acid fragments. In some embodiments, the implementation of the device contains one or more receiving areas for receiving unreacted reagents.

[0074] In some embodiments, the first site, second site, third site, fourth site, reactive site, and/or additional sites comprise a well. The well may contain enzymes, target nucleic acid molecules, or any other substrate or reagents. In some embodiments, the reaction site comprises a well and the solid support is a granular particle in the well, or the solid support is the surface of the well.

[0075] In some embodiments, the electrophoresis device may comprise a container containing an electrophoresis buffer and configured to hold an electrophoresis gel matrix. In some embodiments, the implementation of the electrophoresis device may contain more than one container described in this document.

[0076] The electrophoresis gel matrix may be agar, agarose, or polyacrylamide. In some embodiments, the electrophoresis gel matrix is agarose. The electrophoresis buffer may have a pH in the range of pH 7 to pH 9 and may contain ethylenediaminetetraacetic acid (EDTA) as a chelating agent. When the target nucleic acid is fragmented into sizes ranging from several hundred to several thousand bp. in length, a higher concentration of agarose in the reaction site will help limit the diffusion of library products from the reaction site, allowing free reagents/adapters to be efficiently removed.

[0077] In some embodiments, the electrophoresis device may also comprise one or more pairs of positive and negative electrodes. In some embodiments, a pair of positive and negative electrodes is in direct contact with the electrophoresis gel matrix. In some embodiments, one or more electrodes are embedded in a gel matrix. In some embodiments, the pair of positive and negative electrodes are not in direct contact with the electrophoresis gel matrix. In some embodiments, one or more electrodes are embedded in chambers filled with an electrophoresis buffer that is fluidly coupled to an electrophoresis gel matrix.

[0078] In some embodiments, the electrophoresis device may also include a barrier or ultrafiltration membrane with pores small enough to retain nucleic acid fragments. One such example of a membrane is a 10 kDa molecular weight cut-off polyethersulfone membrane (Biomax® 10 kDa from EMD Millipore).

[0079] In some embodiments, an electrophoresis system is provided. In some embodiments, an electrophoresis system is provided for obtaining a library of labeled nucleic acid fragments from a target double-stranded nucleic acid. In some embodiments, the electrophoresis system comprises an electrophoresis device described herein, a power source, and a controller configured to control the direction and/or magnitude of one or more electric fields to move reagents and/or labeled nucleic acid fragments to a reaction site, a site for collection and/or receiving areas and/or through them.

[0080] When a voltage is applied to the electrodes, the reactants can move through the electrophoresis gel matrix and into and through the reaction site. Reversing the voltage direction can send molecules in the opposite direction. In addition, when a voltage is applied to one and/or the other pair of electrodes, the reactants move to one and/or the other respective reaction site or collection site, depending on the electrophoretic mobilities.

[0081] In some embodiments, the electric field can be manipulated to selectively reduce reagents and nucleic acid fragments within certain size ranges. For example, pulsed field methods can be used to elute processed nucleic acid fragments of 50-500 kb, leaving nucleic acid fragments larger than about 2000 kb. If a larger fragment is required that does not contain a smaller fragment, the lower fraction can be eluted first under size-selective pulsed field conditions, and then the higher fraction can be recovered under different pulsed field conditions or under constant field conditions. For more information, see Jann Noolandi, and Chantal Turmel in In Methods in Molecular Biology Volume 12: Pulsed-field gel electrophoresis, Protocols, Methods, and Theories. Ed. Burmeister, Margit, and Ulanovsky, Levy. Humana., pp. 73-103 and 135-143, which is incorporated herein by reference in its entirety.

[0082] In addition, the gel concentration, voltage, and/or duration of electrophoresis can be chosen such that the reagent components move efficiently and/or that the target nucleic acid remains at the reaction site. Such conditions are suitable for very high molecular weight nucleic acids that migrate so slowly in an agarose gel. When dealing with a shorter target nucleic acid (eg, a fragment size of about 500 bp), higher concentration gels, lower voltages, and a higher degree of optimization can be used.

Definitions

[0083] Unless otherwise indicated, all technical and scientific terms used in this document have the same meaning as commonly used by a person skilled in the art. All patents, applications, published applications, and other publications referenced herein are incorporated herein by reference in their entirety, unless otherwise noted. Unless otherwise noted, where there are multiple definitions for a term provided in this document, the definitions provided in this section take precedence. As used in this specification and the appended claims, the singular forms include references to the plural forms, unless the context clearly indicates otherwise. The use of the union "or" or "and" means "and/or", unless otherwise indicated. Moreover, the use of the term "including", as well as other forms such as "include", "includes" and "included", is not intended to be limiting. When used in the present description, either in a transitional phrase or in the structure of a claim, the terms "comprises" and "comprising" should be interpreted as having an unrestricted meaning. In other words, the terms should be interpreted as synonymous with the phrases "having at least" or "comprising at least". In the context of a process, the term "comprising" means that the process includes at least the above steps, but may include additional steps. In the context of a compound, composition, or device, the term "comprising" means that the compound, composition, or device includes at least the specified features or components, but may include additional features or components.

Target nucleic acid

[0084] As used herein, the term "target nucleic acid" refers to any double-stranded nucleic acid of interest that undergoes transposition, e.g., to create a library of labeled nucleic acid fragments (e.g., 5'- and 3'-labeled or dilabeled linear ssDNA fragments or dsDNA or labeled fragments of circular ssDNA). A "target nucleic acid" can be obtained from any in vivo or in vitro source, including one or more cells, tissues, organs, or organisms, whether living or dead, or from any biological or environmental source (e.g., water, air, the soil). For example, in some embodiments, the target nucleic acid comprises or consists of a eukaryotic and/or prokaryotic double-stranded nucleic acid that is derived from or derived from humans, animals, plants, fungi (e.g., molds or yeasts), bacteria, viruses, viroids, mycoplasma or other microorganisms. In some embodiments, the target nucleic acid comprises or consists of genomic DNA, subgenomic DNA, chromosomal DNA (e.g., from an isolated chromosome or part of a chromosome, e.g., from one or more genes or loci from a chromosome), mitochondrial DNA, chloroplast DNA, plasmids, or other episomal DNA (or recombinant DNA placed therein), or double-stranded cDNA obtained by reverse transcription of RNA using RNA-dependent DNA polymerase or reverse transcriptase to obtain a first strand cDNA and then extending the primer annealed with the first strand cDNA to obtain dsDNA. In some embodiments, the target nucleic acid comprises a plurality of dsDNA molecules in or derived from nucleic acid molecules (e.g., a plurality of dsDNA molecules in or derived from genomic DNA) or cDNA derived from RNA in a biological source (e.g., cell, tissue, organ , organism) or environmental source (e.g. water, air, soil, saliva, sputum, urine, faeces) or from them. In some embodiments, the target nucleic acid is obtained from an in vitro source. For example, in some embodiments, the target nucleic acid comprises or consists of dsDNA prepared in vitro from single-stranded DNA (ssDNA) or from single-stranded or double-stranded RNA (e.g., using methods well known in the art, such as primer extension using an appropriate DNA-dependent and/or RNA-dependent DNA polymerase (reverse transcriptase) In some embodiments, the target nucleic acid is a target DNA that contains or consists of dsDNA derived from all or part of one or more double-stranded or single-stranded DNA molecules, or RNA, using any methods known in the art, including methods for: amplifying DNA or RNA (e.g., PCR or reverse transcription PCR (RT-PCR), transcription-mediated amplification methods, amplifying all or part of one or more nucleic acid molecules acids); molecular cloning of all or part of one or more nucleic acid molecules in a plasmid, fosmid, BAC or other vector, which is subsequently replicated in an acceptable host cell; or capturing one or more nucleic acid molecules by hybridization, for example, by hybridization with DNA probes on an array or microarray (eg, "sequence capturing"; for example, using kits and/or templates from ROCHE NIMBLEGEN, AGILENT or FEBIT).

[0085] In some embodiments, "target nucleic acid" or "target DNA" means a double-stranded nucleic acid that is prepared or modified (e.g., using various biochemical or molecular biological techniques) before being used to create a library of labeled nucleic acid fragments (e.g., , 5' and 3' labeled or dilabeled linear ssDNA or dsDNA fragments or labeled circular ssDNA).

Transposome complexes, polynucleotide transposase adapters, tags and transposases

[0086] Transposon-based technology can be used to fragment a nucleic acid (e.g., DNA), for example, as shown in the example workflow for NEXTERA™ XT and FLEX DNA Sample Preparation Kits (Illumina, Inc.), in which target nucleic acids, such as genomic DNA are treated with transposome complexes that simultaneously fragment and tag ("tag") the target, thus creating a population of fragmented nucleic acid molecules labeled with unique adapter sequences at the ends of the fragments.

[0087] A transposition reaction is a reaction in which one or more transposons are introduced into target nucleic acids at random sites or substantially random sites. The components of the transposition reaction include a transposase (or other enzyme capable of fragmenting and labeling a nucleic acid as described herein, such as an integrase) and a polynucleotide transposase adapter that includes a transposon double-stranded terminal sequence that binds to the enzyme and a label attached to one or both of the two terminal sequences of the transposon. One strand of the double-stranded transposon terminal sequence is transferred to one strand of the target nucleic acid at the site of fragmentation (transfer strand), while the complementary strand of the transposon terminal sequence is not covalently linked to the fragmented nucleic acid (non-transfer strand), but remains hybridized to the transfer strand. If necessary or desired, the polynucleotide transposase adapter may be tagged with one or more functional sequences (eg, primer sequences).

[0088] A "transposome complex" consists of at least one transposase enzyme and a transposon recognition sequence. In some of these systems, a transposase binds to a transposon recognition sequence to form a functional complex that is capable of catalyzing the transposition reaction. In some aspects, the transposon recognition sequence is the double-stranded terminal sequence of the transposon. A transposase or integrase binds to a transposase recognition site in a target nucleic acid and inserts a transposon recognition sequence into the target nucleic acid. In some such insertion events, one strand of a transposon recognition sequence (or terminal sequence) is transferred into the target nucleic acid, which also results in a cleavage phenomenon. Examples of transposition procedures and systems that can be readily adapted for use with transposases of the present disclosure are described, for example, in PCT Publication No. WO2010/048605, US Patent Publication No. 2012/0301925, US Patent Publication No. 2012/13470087 or US Patent Publication No. 2013 /0143774, each of which is incorporated herein by reference in its entirety.

[0089] Examples of transposases that can be used with certain embodiments provided herein include the following (or are encoded as follows): Tn5 transposase (see Reznikoff et al., Biochem. Biophys. Res. Commun. 2000, 266, 729 -734), Vibrio Haryi (a transposase characterized by Agilent and used in the SureSelect QXT product), MuA transposase, and a Mu transposase recognition site containing R1 and R2 terminal sequences (Mizuchi, K., Cell, 35: 785, 1983; Savilahti, H , et al., EMBO J., 14:4893, 1995), Staphylococcus aureus Tn552 (Colegio, O. et al., J. Bacteriol., 183:2384-8, 2001; Kirby, C. et al., Mol Microbiol., 43:173-86, 2002), Tyl (Devine & Boeke, Nucleic Acids Res., 22:3765-72, 1994 and PCT Publication No. WO95/23875), Transposon Tn7 (Craig, NL, Science, 271 :1512, 1996; Craig, NL, Curr. Top. Microbiol. Immunol., 204:27-48, 1996), Tn/O and IS10 (Kleckner N. et al., Curr. Top. Microbiol. Immunol., 204 :49-82, 1996), Mariner transposase (Lampe, DJ et al., EMBO J., 15:5470-9, 1996), Tc1 (Plasterk, RH, Curr. top. microbiol. Immunol., 204:125-43, 1996), P Element (Gloor, GB, Methods Mol. Biol., 260:97-114, 2004), Tn3 (Ichikawa & Ohtsubo, J. Biol. Chem., 265:18829 -32, 1990), bacterial insertion sequences (Ohtsubo & Sekine, Curr. Top. Microbiol. Immunol. 204:1-26, 1996), retroviruses (Brown et al., Proc. Natl. Acad. Sci. USA, 86: 2525-9, 1989) and a yeast retrotransposon (Boeke & Corces, Ann. Rev. Microbiol. 43:403-34, 1989). Additional examples include IS5, Tn10, Tn903, IS911, and engineered versions of the transposase family of enzymes (Zhang et al., (2009) PLoS Genet. 5:e1000689. Epub October 16; Wilson C. et al. (2007) J. Microbiol (Methods 71:332-5).

[0090] In some embodiments, the transposase is a Tn5, MuA, or Vibrio Haryi transposase, or an active mutant thereof. In other embodiments, the transposase is a Tn5 transposase or an active mutant thereof. In some embodiments, TN5 transposase is hyperactive transposase TN5 (see, for example, Reznikoff et al., PCT publication No. WO2001/009363, US patents No. 5.925.545, 5,965,443, 7,083,980 and 7,608,434 and Goryshin and Reazni KOFF, J. Biol. Chem. 273:7367, 1998) or an active mutant thereof. In some aspects, the Tn5 transposase is the Tn5 transposase described in PCT Publication No. WO2015/160895, which is incorporated herein by reference. In some embodiments, the Tn5 transposase is a fusion protein. In some embodiments, the Tn5 transposase fusion protein contains a Ts extension factor (Tsf) fusion tag. In some embodiments, the Tn5 transposase is an overactive Tn5 transposase containing mutations at amino acids 54, 56, and 372 relative to the wild-type sequence. In some embodiments, the overactive Tn5 transposase is a fusion protein, optionally the fusion protein is a Ts extension factor (Tsf). The methods described herein may also include combinations of transposases, not just one transposase. In some embodiments, the recognition site is a Tn5 type transposase recognition site (Goryshin and Reznikoff, J. Biol. Chem., 273:7367, 1998). In one embodiment, a transposase recognition site complexed with an overactive Tn5 transposase (eg, EZ-Tn5™ transposase, Epicentre Biotechnologies, Madison, Wis.) is used.

[0091] In some embodiments, the transposase enzyme is a dimer (eg, a dimer of Tn5 transposase). In some of these embodiments, the transposome complex comprises a dimer of two transposase molecules. In some embodiments, the transposase complex comprises a transposase dimer (eg, Tn5 transposase) containing first and second monomers. Each monomer contains a first transposon and a second transposon, with the first transposon containing the first transposon terminal sequence at its 3' end and the first adapter sequence (and the adapter sequences in each dimer monomer are the same or different), and the second transposon contains the transposon's second terminal sequence, at least partially complementary to the first terminal sequence of the transposon. In some embodiments, the transposome complex is a homodimer in which two transposase molecules are each linked to a polynucleotide adapter sequence with the same transposon terminal sequence and tag (e.g., each monomer is linked to a molecule of the same polynucleotide adapter sequence to form a "homodimer"). In some embodiments, the compositions and methods described herein use two populations of transposome complexes. In some embodiments, the transposases in each population are dimers and are the same enzyme. In some embodiments, the transposome complexes in each population are heterodimers, wherein the first population has a first polynucleotide transposase adapter in each of the two monomers, and the second population has a second polynucleotide adapter (which is different from the first polynucleotide transposase adapter) in each monomer. In some embodiments, the terminal sequence of the transposon in each heterodimer is the same, but the polynucleotide transposase adapters contain different tags. In some embodiments, each population contains a different label sequence. In some embodiments, the first population contains an adapter tagged with an A14 primer sequence and the second population contains an adapter tagged with a B15 primer sequence.

[0092] In some embodiments, a polynucleotide transposase adapter is a mixture of two polynucleotide transposase adapters, each containing the same transposon terminal sequence and a different tag. When the mixture of adapters is combined with a Tn5 transposase dimer, a mixture of three transposome complexes is obtained: (a) a first transposome dimer complex containing a transposase and two of the first polynucleotide transposase adapters (first homodimer); (b) a second transposome dimeric complex comprising a transposase and two of the second polynucleotide transposase adapters (second homodimer); and (c) the third transposome dimeric complex contains a transposase and one monomer with a first adapter and one monomer with a second adapter (heterodimer). When this mixture is tagged with three complexes, the resulting fragments are labeled appropriately to produce three populations of fragments (one labeled at each 5' end with a first adapter; a second labeled at each 5' end with a second adapter; and a third labeled with at one 5' end with the first adapter and at the second 5' end with the second adapter).

[0093] Transposase adapters contain: (a) a 3' region containing the double-stranded transposon terminal sequence, and (b) a tag. The terminal sequence of the transposon is recognized by the transposase. Binding of a transposase to the terminal sequence of a transposon forms a transposome complex. In the process of tagmentation, the transposase adapter strand is transferred to (renature) the 5' end of the double-stranded nucleic acid fragment. The non-transfer complementary strand is not covalently linked to the resulting fragment, but hybridizes to the transfer strand and is thus incorporated into the product fragment.

[0094] As used herein, the terms "label" and "label region" refer to the portion of a polynucleotide transposase adapter that displays the sequence for the intended purpose or use. Some embodiments provided herein include a transposome complex comprising a polynucleotide transposase adapter having a 3' region containing the transposon's double-stranded terminal sequence and a tag region. The label regions may contain any sequence provided for any desired purpose. In some embodiments, the label contains one or more functional sequences selected from the group consisting of: universal sequences, primer sequences, index sequences, capture sequences, barcode sequences (used, for example, for counting or error correction), cleavage sequences, sequences related to sequencing, sequences for enrichment and their combinations. For example, in some embodiments, the tag region contains one or more restriction endonuclease recognition sites. In some embodiments, the label contains a primer sequence. In other embodiments, the label contains a primer sequence and an index or barcode sequence. The primer sequence may also be a universal sequence. A universal sequence is a region of a nucleotide sequence that is common to two or more nucleic acid fragments. Optionally, two or more nucleic acid fragments also have regions of sequence differences. A universal sequence that may be present in different members of a plurality of nucleic acid fragments may allow for the replication or amplification of a plurality of different sequences using a single universal primer that is complementary to the universal sequence.

[0095] In some embodiments, the tag region contains one or more regions suitable for hybridization with a primer for a cluster amplification reaction. In some embodiments, the tag region contains one or more regions suitable for hybridization with a primer for a sequencing reaction. It should be understood that any other suitable element may be included in the label area. In some embodiments, the label region contains a sequence having a length of 5 to 200 bp. In some embodiments, the label region contains a sequence having a length of 10 to 100 bp. In some embodiments, the label region contains a sequence having a length of 20 to 50 bp. In some embodiments, the label region contains a sequence having a length of 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150 to 200 bp. The invention is not limited to the type of labels that can be used, and the skilled artisan will recognize additional sequences that can be used for library preparation and next generation sequencing.

Immobilized reagents

[0096] In some embodiments, reagents such as enzymes can be immobilized on surfaces such as beads at locations or wells in an electrophoresis gel matrix, thereby preventing them from moving in electric fields while other reagents can move freely. according to their mobility in electric fields.

[0097] When referring to the immobilization of molecules on a solid support, the terms "immobilized" and "anchored" are used interchangeably herein, and it is intended that, unless the context implies otherwise, either directly or indirectly, both terms encompass direct or indirect, covalent or non-covalent attachment. In some embodiments, covalent attachment may be preferred.

[0098] Immobilization of the reagents can be achieved by other methods known in the art. In some embodiments, the transposase or transposome complex is immobilized to a substrate, such as a bead, with covalent or non-covalent binding partners, such as an affinity element and an affinity binding partner. In some such embodiments, the affinity element is biotin and the solid support contains streptavidin. For example, the transposome complex is immobilized on a streptavidin-coated bead with a biotinylated linker associated with the transposome complex. In some embodiments, the transposome complex is immobilized on the bead with biotin or another affinity element covalently linked to a polynucleotide transposase adapter (or one or both polynucleotide transposase adapters if the transposase is a dimer).

[0099] In some embodiments, the transposase enzyme and the polynucleotide are immobilized on a solid support. In some embodiments, the transposase enzymes are immobilized only on a solid support while the adapter polynucleotides are free to migrate. In some embodiments, the transposome complex is immobilized on a solid support at the reaction site. In some embodiments, the transposase is immobilized on a solid support at the reaction site. In a further embodiment, the solid support comprises or is a bead. In one embodiment, the bead is a paramagnetic bead.

[0100] As used herein, an affinity element is a moiety that can be used to bind, covalently or non-covalently, to an affinity binding partner. In some aspects, the affinity element is on the transposome complex and the affinity binding partner is on a solid support. Examples of affinity element/binding partner combinations that can be readily adapted for use with the present invention are described, for example, in WO 2018/156519 or US Patent Publication No. 2018/0245069, each of which is incorporated herein by reference in its entirety. In other embodiments, the affinity element/binding partner combination comprises or is FITC/anti-FITC antibody, digoxigenin/digoxigenin antibody, or hapten/antibody. Other suitable affinity pairs include, without limitation, dithiobiotinavidin, iminobiotinavidin, biotinavidin, dithiobiotinsuccinylated avidin, iminobiotinsuccinylated avidin, biotinstreptavidin, and biotinsuccinylated avidin.

[0101] As used herein, a cleavable linker is a molecule with two functional heads linked together via a cleavable bond. Two functional heads serve to attach the linker to other functional groups; in this case, a cleavable linker connects the 5' end of the first transposon sequence to the affinity element. As used herein, a cleavable linker is a linker that can be cleaved off by chemical or physical means such as, for example, photolysis, chemical cleavage, thermal cleavage, or enzymatic cleavage. In some embodiments, the cleavage may be carried out by biochemical, chemical, enzymatic, nucleophilic, reduction-sensitive means, or other means. For a review of cleavable linkers, classified according to their cleavage conditions and biological applications, see Wagner et al., Bioorg. Med. Chem. 20, 571-582 (2012), which is incorporated herein by reference; see also, for example, US Patent Publications No. 2012/0208705 and 2012/0208724, and PCT Publication No. WO 2012/061832, each of which is incorporated by reference in its entirety.

[0102] The terms "solid surface", "solid support" and other grammatical equivalents refer to any material suitable for or capable of attaching transposome complexes. As will be appreciated by those skilled in the art, the number of possible substrates is wide. Possible substrates include, without limitation, glass and modified or functionalized glass, plastics (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, Teflon, etc.), polysaccharides, nylon or nitrocellulose, ceramics , resins, silica, or silica-based materials, including silicon and modified silicon, carbon, metals, inorganic glasses, plastics, fiber optic bundles, beads, paramagnetic beads, and a variety of other polymers.

[0103] In the methods and devices provided herein, transposome complexes are immobilized on a solid support. In one embodiment, the solid support is a bead. Suitable granular compositions include, without limitation, plastics, ceramics, glass, polystyrene, methylstyrene, acrylic polymers, paramagnetic materials, thorium sol, graphite carbon, titanium dioxide, latex, or cross-linked dextrans such as sepharose, cellulose, nylon, cross-linked micelles and Teflon, as well as any other materials described herein in relation to solid substrates. In certain embodiments, the microspheres are magnetic microspheres or beads, such as paramagnetic particles, spheres or beads. The granules need not be spherical; irregularly shaped particles can be used. Alternatively or additionally, the granules may be porous. Bead sizes range from nanometers, such as 100 nm, to millimeters, such as 1 mm, preferably from 0.2 microns to 200 microns, and particularly preferably from 0.5 to 5 microns, although in some embodiments smaller granules can be used. or larger. The bead may be coated with an affinity binding partner, for example the bead may be coated with streptavidin. In some embodiments, the beads are streptavidin-coated paramagnetic beads, e.g., Dynabeads MyOne streptavidin C1 beads (Thermo Scientific, Cat # 65601), Streptavidin MagneSphere Paramagnetic Beads (Promega, Cat # Z5481), Streptavidin Magnetic Beads (NEB, P/N S1420S) and MaxBead Streptavidin (Abnova, P/N U0087). The solid support may also be a glass slide, such as a flow cell or other glass slide, modified so that the transposome complex can be immobilized on it.

[0104] In some embodiments, implementation of the present invention, solid substrates, consisting of an inert substrate or matrix (for example, glass slides, polymer beads, etc.) that have been functionalized, for example, by applying a layer or coating of an intermediate material containing reactive groups that provide covalent attachment to molecules such as polynucleotides. Examples of such supports include, without limitation, polyacrylamide hydrogels supported on an inert substrate such as glass, in particular the polyacrylamide hydrogels described in WO2005/065814 and US2008/0280773, the contents of which are incorporated herein by reference in their entirety. Methods for tagging (fragmenting and labeling) DNA on a solid surface to construct a tagged DNA library are described in WO2016/189331 and US2014/0093916A1, which are incorporated herein by reference in their entirety.

Amplification

[0105] It should be understood that any of the amplification methodologies described herein or as known per se with universal or target-specific primers can be used to amplify DNA fragments. Suitable amplification methods include, without limitation, polymerase chain reaction (PCR), strand displacement amplification (SDA), transcription-mediated amplification (TMA), and nucleic acid sequence-based amplification (NASBA), as described in U.S. Patent No. 8,003,354, which is fully incorporated herein by reference. The above amplification methods can be used to amplify one or more nucleic acids of interest. For example, PCR can be used to amplify nucleic acid fragments, including multiplex PCR, SDA, TMA, NASBA, and the like. In some embodiments, primers specifically targeting the nucleic acid of interest are included in the amplification reaction.

[0106] Other suitable nucleic acid amplification methods may include oligonucleotide extension and ligation, rolling ring amplification (RCA) (Lizardi et al., Nat. Genet. 19:225-232 (1998), which is incorporated herein by reference ) and Oligonucleotide Probe Ligation (OLA) method (see mainly US Pat. 01069 WO 89/ 12696 and WO 89/09835, all of which are incorporated herein by reference). It should be understood that these amplification methodologies can be configured to amplify nucleic acid fragments. For example, in some embodiments, the amplification method may include probe ligation amplification reactions or oligonucleotide probe ligation (OLA) methods that include primers specifically targeted to the nucleic acid of interest. In some embodiments, the amplification method may include a primer extension-ligation reaction that contains primers that directly target the nucleic acid of interest. As a non-limiting example of primers for primer extension and ligation that can be specifically designed to amplify the nucleic acid of interest, the amplification can include primers used for the GoldenGate assay (Illumina, Inc., San Diego, CA, US) as shown in US Patent Nos. 7,582,420 and 7,611,869, each of which is incorporated herein by reference in its entirety.

[0107] Examples of isothermal amplification methods that can be used in the method of the present invention include, without limitation, multiple displacement amplification (MDA) as exemplified in Dean et al., Proc. Natl. Acad. sci. USA 99:5261-66 (2002), or isothermal strand displacement nucleic acid amplification as exemplified in US Pat. No. 6,214,587, each of which is incorporated herein by reference in its entirety. Other non-PCR based methods that can be used herein include, for example, strand displacement amplification (SDA) as described in, for example, Walker et al., Molecular Methods for Virus Detection, Academic Press, Inc., 1995 ; U.S. Patent Nos. 5,455,166 and 5,130,238 and Walker et al., Nucl. Acids Res. 20:1691-96 (1992), or hyperbranched-chain displacement amplification as described, for example, in Lage et al., Genome Research 13:294-307 (2003), each of which is incorporated herein by reference in its entirety. For amplification of genomic DNA with a random primer, isothermal amplification methods can be used with Phi 29 polymerase, which replaces the strands, or a large fragment of Bst DNA polymerase, 5'->3' exo ^- . Polymerases take advantage of their high processivity and strand displacement activity. High processivity allows polymerases to produce fragments 10–20 kb long. As noted above, smaller fragments can be prepared under isothermal conditions using polymerases having low processivity and low chain displacement activity, such as Klenow polymerase. Additional description of the reactions, conditions and components of the amplification is detailed in the description of US patent No. 7,670,810, which is fully incorporated herein by reference.

[0108] Another nucleic acid amplification method used herein is labeled PCR, which uses a population of two-domain primers having a constant 5' region followed by a random 3' region, as described, for example, in the publication Grothues et al. Nucleic Acids Res. 21(5):1321-2 (1993), which is incorporated herein by reference in its entirety. The first rounds of amplification are performed to provide multiple initiations on heat denatured DNA based on individual hybridization with a randomly synthesized 3' region. Due to the nature of the 3' region, initiation sites are assumed to be randomly distributed throughout the genome. The unbound primers can then be removed and further replication can be carried out using primers complementary to the 5' constant region.

Obtaining sequencing fragments - amplification of labeled fragments

[0109] As described herein, in some aspects, methods for obtaining sequencing fragments from a target nucleic acid are provided, comprising: providing a solid support containing immobilized thereon the transposome complex described herein; bringing the solid support into contact with the target nucleic acid under conditions to fragment the target nucleic acid and ligate the first transposon to the 5' ends of the fragments, whereby the fragment is immobilized on the solid support. In some aspects, the method further comprises amplifying the fragmented nucleic acids. In some embodiments, the state of the fragment is a state suitable for tagging using the transposome complex for the fragment and labeling the target nucleic acid.

[0110] In some embodiments of the methods described herein, after fragmentation and labeling, the methods further comprise removing transposase from 5'-labeled target fragments to obtain uncomplexed 5'-labeled target fragments. Removal of the transposase can be accomplished under chemical conditions such as treatment with a denaturing agent such as sodium dodecyl sulfate (SDS). Such methods may further include generating full duplex versions of the 5'-labeled target fragments. Obtaining a full duplex may include removing the renatured (but not ligated) second transposon from the 5'-labeled target fragments and extending the 5'-labeled target fragments to obtain fully duplexed 5'-labeled target fragments. Preparation can be carried out, for example, by heating uncomplexed 5'-labeled target fragments to a temperature sufficient to selectively denature the second transposon, leaving the remaining duplex region of the fragment intact. Extension can be performed in the presence of dNTP and an appropriate polymerase. In an alternative embodiment, the preparation can be carried out in a single reaction by incubating uncomplexed 5'-labeled target fragments in the presence of single nucleotides (dNTPs) and a polymerase. In some embodiments, the implementation of the incubation includes heating at one or more temperatures sufficient to denature the second annealed transposon and elongate the remaining duplexes. In other embodiments, the polymerase is a strand replacement polymerase that serves to remove the second transposon and extend the remaining duplex to produce fully duplexed 5' labeled target fragments. Acceptable polymerases include KAPA HiFi, Pfu and similar enzymes. Suitable polymerases include chain replacement polymerases such as Bst, Bsu Vent, Klenow and similar enzymes.

[0111] In some aspects, the methods further include amplifying fully duplexed target 5'-labeled fragments. Amplification can be carried out by any suitable amplification method such as polymerase chain reaction (PCR), rolling ring amplification (RCA), or multiple displacement amplification (MDA). In some embodiments, amplification is performed by PCR. In some embodiments, amplification and extension are performed in a single reaction step by reacting with dNTP in the presence of a polymerase.

[0112] In some embodiments, amplification is used to add one or more secondary adapter sequences to fully duplexed 5'-labeled target fragments to form sequencing fragments. Amplification is performed by incubating a fully duplexed 5'-labeled target fragment containing a primer sequence at each end with a secondary adapter carrier, single nucleotides, and a polymerase under conditions sufficient to amplify the target fragments and incorporate the secondary adapter carrier (or its complement), wherein the secondary adapter carrier contains the complement of the primer sequence and the secondary adapter sequence.

[0113] In some embodiments, the secondary adapter carrier comprises a primer sequence, an index sequence, a barcode sequence, a clear mark, or a combination thereof. In some embodiments, the secondary adapter carrier contains a primer sequence. In some embodiments, the secondary adapter carrier contains an index sequence. In some embodiments, the secondary adapter carrier comprises an index sequence and a primer sequence.

[0114] In some embodiments, the fully duplexed 5'-tagged target fragments contain a different primer sequence at each end. In such embodiments, each secondary adapter carrier contains a complement for one of the two primer sequences. In some embodiments, the two primer sequences are an A14 primer sequence or a B15 primer sequence.

[0115] In some embodiments, a plurality of secondary adapters are added via amplification. In some embodiments, each of the secondary adapter carriers contains one of two primer sequences. In some embodiments, each of the secondary adapter carriers contains one of a plurality of index sequences. In some embodiments, secondary adapter carriers comprise P5 primer sequence secondary adapters and P7 primer sequence secondary adapters.

[0116] In some aspects, labeled fragments contain homo- and hetero-labeled fragments, for example, some fragments that have the same label at both ends (homo-labeled fragments), and some fragments that have a first label at one end and a second label at the other end (hetero-labeled fragments). In some aspects, amplification of the mixture by "suppression PCR" is used to enrich hetero-labeled fragments. In other aspects, amplification is performed using a "fork" adapter to set a different label than the first label. After obtaining a population of hetero-labeled fragments, additional amplification and sequencing can be performed.

[0117] In some embodiments, sequencing fragments are deposited on a flow cell. In some embodiments, the sequencing fragments are hybridized to complementary primers grafted onto a flow cell or surface. In some embodiments, the sequences of the sequencing fragments are detected using template sequencing or next generation sequencing methods, such as sequencing by synthesis.

[0118] Primers P5 and P7 are used on the surface of commercial flow cells supplied by Illumina, Inc. for sequencing on various Illumina platforms. US Patent Publication No. 2011/0059865 A1 describes primer sequences, which are incorporated herein by reference in their entirety. Examples of P5 and P7 primers that may have an alkyne end group at the 5' end include the following:

P5: AATGATACGGCGACCACCGAGAUCTACAC (SEQ ID NO. 1)

P7: CAAGCAGAAGACGGCATACGAG*AT (SEQ ID NO. 2)

and their derivatives. In some examples, the P7 sequence includes a modified guanine at the G* position, such as 8-oxoguanine. In other examples, * indicates that the bond between G* and the adjacent 3' A is a thiophosphate bond. In some examples, the P5 and/or P7 primers include non-naturally occurring linkers. Optionally, one or both of the P5 and P7 primers may include a poly-T tail. The poly-T tail is essentially located at the 5' end of the above sequence, for example between the 5' base and the terminal alkyne unit, but in some cases may be located at the 3' end. The poly-T sequence may include any number of T-nucleotides, for example from 2 to 20. While primers P5 and P7 are given as examples, it should be understood that any suitable amplification primers can be used in the examples provided herein.

[0119] In some embodiments, the amplification step of the method includes PCR or isothermal amplification. In some embodiments, the amplification step of the method includes PCR.

Sequencing methods

[0120] Some of the methods provided herein include methods for analyzing nucleic acids. Such methods include obtaining a template nucleic acid library of a target nucleic acid, obtaining sequence data from a template nucleic acid library, and assembling a sequence representation of the target nucleic acid. In some embodiments, the methods described herein can be used in next generation sequencing workflows, including, without limitation, sequencing by synthesis (SBS). Examples of sequencing by synthesis (SBS) procedures, detection fluid systems and platforms that can be readily adapted for use with nucleic acid libraries produced by the methods of the present invention are described, for example, in Bentley et al., Nature 456 :53-59 (2008), WO 04/018497; US 7,057,026; W091/06678; WO 07/123744; US 7,329,492; US 7,211,414; US 7,315,019; US 7,405,281 and US 2008/0108082, each of which is incorporated herein by reference.

[0121] Some embodiments of SBS include detecting a proton released when a nucleotide is inserted into an extension product. For example, sequencing based on the detection of released protons may use an electrical detector and related techniques that are commercially available from Ion Torrent (Gilford, Conn., USA, a subsidiary of Life Technologies), or the sequencing methods and systems described in in US 2009/0026082 A1; US 2009/0127589A1; US 2010/0137143A1; US 2010/0282617 A1, each of which is incorporated herein by reference.

[0122] Another sequencing technique used is nanopore sequencing (see, for example, Deamer et al. Trends Biotechnol. 18, 147-151 (2000); Deamer et al. Acc. Chem. Res. 35:817-825 (2002 ); Li et al. Nat. Mater. 2:611-615 (2003, the descriptions of which are incorporated herein by reference). The methods described herein are not limited to any particular type of sequencing equipment used.

[0123] The following numbered paragraphs provide additional support and description of the embodiments presented herein.

[0124] Claim 1. A method for performing an enzymatic reaction using electrophoresis, comprising:

(a) providing an electrophoresis system comprising:

an electrophoresis gel matrix having a first end and a second end and a length between the first and second ends;

a first region near the first end containing a first enzyme cofactor for the enzyme;

a second region near the second end and containing a second enzyme cofactor for said enzyme, the second enzyme cofactor having an electrical charge opposite to that of the first enzyme cofactor;

a reaction site between the first site and the second site and containing the enzyme; And

a pair of positive and negative electrodes located at the first and second ends, respectively; And

(b) applying an electric field between a pair of electrodes to move the first enzyme cofactor from the first site to the reaction site and move the second enzyme cofactor from the second site to the reaction site to form an activated enzyme complex containing the enzyme, the first enzyme cofactor, and the second enzyme cofactor.

[0125] Item 2. The method of item 1, wherein when the first enzyme cofactor is a metal ion, the second enzyme cofactor is a polynucleotide.

[0126] Item 3. The method of claim 1, further comprising applying a substrate for the activated enzyme complex to the reaction site prior to step (c), wherein applying an electric field comprises reacting the activated enzyme complex with the substrate at the reaction site to form a reaction product.

[0127] Item 4. The method of any one of items 1-3, wherein applying an electric field includes migrating unreacted first and second enzyme cofactors from the reaction site to separate the unreacted first and second enzyme cofactors from the reaction product at the reaction site.

[0128] Item 5. The method of any one of items 1-4, wherein the first electrode is a positive electrode and the first enzyme cofactor is positively charged, wherein the second electrode is a negative electrode and the second enzyme cofactor is negatively charged.

[0129] Item 6. The method of any one of items 3-5, wherein the substrate is the target double-stranded nucleic acid.

[0130] Item 7. The method of item 6, wherein the target double-stranded nucleic acid is double-stranded DNA, double-stranded RNA, or a DNA/RNA hybrid.

[0131] Item 8. The method of any one of items 1-7, wherein the enzyme is a transposase, optionally the transposase is a Tn5 transposase.

[0132] Item 9. The method of item 8, wherein the first enzyme cofactor is Mg ²⁺ , optionally Mg(OAc) ₂ or MgCl ₂ .

[0133] Item 10. The method of item 8 or item 9, wherein the second enzyme cofactor is a polynucleotide transposase adapter comprising a transposon double-stranded terminal sequence and a single-stranded tag region.

[0134] Item 11. The method of item 10, wherein the second enzyme cofactor is a mixture of two polynucleotide transposase adapters, each adapter containing the same double-stranded transposon terminal sequence and a different single-stranded tag region.

[0135] Item 12. A method of obtaining a library of labeled nucleic acid fragments from a target double-stranded nucleic acid, comprising:

(a) providing an electrophoresis system comprising:

an electrophoresis gel matrix having a first end and a second end, a width and a length between the first and second ends;

a first region near the first end containing a first transposase cofactor, wherein the first transposase cofactor is a metal ion;

a reaction site located at a distance from the first end and containing a transposome complex containing a transposase and a polynucleotide transposase adapter containing a double-stranded transposon terminal sequence and a single-stranded tag region; And

a pair of positive and negative electrodes located at the first and second ends, respectively;

(b) applying the target double-stranded nucleic acid to the reaction site;

(c) applying a first electric field between a pair of electrodes to move the first transposase cofactor from the first site to the reaction site to form an activated transposome complex comprising the transposase, the polynucleotide transposase adapter, and the first transposase cofactor; And

(d) incubating the target double-stranded nucleic acid with the activated transposome complex at the reaction site under conditions sufficient for the target double-stranded nucleic acid fragment rather than a plurality of nucleic acid fragments, and labeling the nucleic acid fragments, thereby creating a library of labeled nucleic acid fragments.

[0136] Item 13. The method of item 12, wherein the transposome complex is immobilized on a solid support at the reaction site, optionally via a streptavidin-biotin interaction.

[0137] Item 14. The method of item 13, comprising releasing the transposome complex from the solid support after generating labeled nucleic acid fragments.

[0138] Item 15. The method of item 14, further comprising changing the magnitude of the first electric field after the step to move labeled nucleic acid fragments associated with the transposome complex released from the solid support at the collection site.

[0139] Item 16. A method of obtaining a library of labeled nucleic acid fragments from a target double-stranded nucleic acid, comprising:

(a) providing an electrophoresis system comprising:

an electrophoresis gel matrix having a first end and a second end, a width and a length between the first and second ends;

a first region near the first end containing a first transposase cofactor for transposase, wherein the first transposase cofactor is a metal ion;

a second region near the second end and containing a second transposase cofactor for transposase, wherein the second transposase cofactor has an electrical charge opposite to that of the first transposase cofactor, wherein the second transposase cofactor is a polynucleotide transposase adapter comprising a transposon double-stranded terminal sequence and a single-stranded tag region;

a reactive site between the first site and the second site and containing a transposase; And

a pair of positive and negative electrodes located at the first and second ends, respectively;

(b) applying the target double-stranded nucleic acid to the reaction site;

(c) applying a first electric field between a pair of electrodes to move the first transposase cofactor from the first site to the reactive site and move the second transposase cofactor from the second site to the reactive site to form an activated transposomal complex comprising transposase, the first transposase cofactor, and the second transposase cofactor; And

(d) incubating the target double-stranded nucleic acid with the activated transposome complex at the reaction site under conditions sufficient for the target double-stranded nucleic acid fragment rather than a plurality of nucleic acid fragments, and labeling the nucleic acid fragments, thereby creating a library of labeled nucleic acid fragments.

[0140] Item 17. The method of any one of items 12-16, wherein the metal ion is Mg ²⁺ , optionally Mg(OAc) ₂ or MgCl ₂ .

[0141] Item 18. The method of any one of items 12-17, wherein the single strand region of the tag contains one or more of: a primer sequence, a barcode sequence, a unique molecular identifier (UMI) sequence, an amplification tag, an enrichment tag, or a purification tag.

[0142] Item 19. The method of any one of items 12-18, wherein the transposase is a Tn5 transposase.

[0143] Item 20. The method of any one of items 16-19, wherein the transposase is immobilized on a solid support at a reaction site, the reaction site optionally comprising a well, wherein the solid support is a granular particle or well surface.

[0144] Item 21. The method of any one of items 12-20, wherein the target double-stranded nucleic acid is double-stranded DNA, double-stranded RNA, or a DNA/RNA hybrid.

[0145] Item 22. The method of any one of items 12-21, wherein the magnitude of the first electric field applied in step (c) is set such that the target double-stranded nucleic acid has substantially no electrophoretic mobility within the electrophoresis matrix .

[0146] Item 23. The method of any one of items 12-22, wherein the electrophoresis system comprises a lengthwise collection site between the first site and the reaction site.

[0147] Item 24. The method of item 23, wherein the application of the first electric field in step (c) includes moving labeled nucleic acid fragments to a collection site.

[0148] Item 25. The method of item 23, comprising increasing the magnitude of the first electric field after step (d) to move the labeled nucleic acid fragments to the collection site.

[0149] Item 26. The method of any one of items 12-25, comprising changing the magnitude or direction of the first electric field through the electrophoresis gel matrix.

[0150] Item 27. The method of any one of items 12-26, wherein the electrophoresis system comprises additional sections along the width and length, each of which contains different reagents for tagging, and a second pair of positive and negative electrodes on opposite sides of the width on one of: the first end or the second end.

[0151] Claim 28. The method of claim 27, comprising applying a second electric field between the second pair of electrodes, wherein the direction of the second electric field is perpendicular to the direction of the first electric field applied in step (c).

[0152] Item 29. The method of any one of items 12-28, wherein applying the target double-stranded nucleic acid comprises adding a biological sample to the reaction site.

[0153] Item 30. The method of item 29, wherein the biological sample contains a cell lysate.

[0154] Item 31. The method of item 29, wherein the biological sample contains whole cells.

[0155] Item 32. The method of any one of items 12-31, wherein the electrophoresis system comprises a third site containing a lyse agent and the reaction site contains whole cells, the method further comprising applying a third electric field to move the lyse agent to the reaction site and/or through it to lyse the cells, thereby applying the target double-stranded nucleic acid to the sample site.

[0156] Item 33. A method of obtaining a library of labeled nucleic acid fragments from a target double-stranded nucleic acid, comprising:

(a) providing an electrophoresis system comprising:

an electrophoresis gel matrix having a first end and a second end, a width and a length between the first and second ends;

a first region containing a first transposase cofactor for transposase, wherein the first transposase cofactor is a metal ion;

a second region containing a second transposase cofactor for transposase, wherein the second transposase cofactor has an electrical charge opposite to that of the first transposase cofactor, wherein the second transposase cofactor is a polynucleotide transposase adapter comprising a transposon double-stranded terminal sequence and a single-stranded tag region;

a third site containing a lysing reagent;

a fourth site containing transposase;

a reaction site between the first site and the second site; And

a first pair of positive and negative electrodes located at the first and second ends, respectively; And

a second pair of positive and negative electrodes located on opposite sides of the width at one of: the first end or the second end;

(b) applying whole cells containing the target double-stranded nucleic acid to the reaction site;

(c) applying a first electric field to move a lysing agent into and/or through the reaction site to lyse the cells, thereby depositing the target double-stranded nucleic acid into the sample site;

(d) applying a second electric field to move the first transposase cofactor from the first site to the reactive site, move the second transposase cofactor from the second site to the reactive site, and/or move the transposase from the transposase site to the reactive site to form an activated transposomal complex containing the transposase, the first a transposase cofactor and a second transposase cofactor; And

(e) incubating the target double-stranded nucleic acid with the activated transposome complex at the reaction site under conditions sufficient for the target double-stranded nucleic acid fragment rather than a plurality of nucleic acid fragments, and labeling the nucleic acid fragments, thereby creating a library of labeled nucleic acid fragments.

[0157] Item 34. The method of item 33, wherein the first electric field and the second electric field are different and step (c) is performed before step (d).

[0158] Item 35. The method of item 33, wherein the first electric field and the second electric field are the same, and step (c) is performed simultaneously with step (d).

[0159] Item 36. The method of any one of items 33-35, comprising applying one or more electric fields after generating a library of labeled nucleic acid fragments to move from the reaction site one or more of: lyse reagent, transposome complex, transposase, transposase adapter , metal ion, and labeled nucleic acid fragments.

[0160] Item 37. The method of item 36, comprising moving the labeled nucleic acid fragments to a collection site.

[0161] Item 38. The method of item 36, comprising moving the lyse reagent, transposome complex, metal ion, and labeled nucleic acid fragments from the reaction site to separate receiving sites.

[0162] Item 39. An electrophoresis device, comprising:

an electrophoresis gel matrix having a first end, a second end, and a length between the first and second ends;

a first region near the first end containing a first enzyme cofactor for the enzyme;

a second region near the second end and containing a second enzyme cofactor for said enzyme, the second enzyme cofactor having an electrical charge opposite to that of the first enzyme cofactor;

a reaction site between the first site and the second site and containing the enzyme; And

a pair of positive and negative electrodes located at the first and second ends, respectively.

[0163] Item 40. The apparatus of item 39, wherein the enzyme substrate is provided in the reaction site.

[0164] Item 41. An electrophoresis device, comprising:

an electrophoresis gel matrix having a first end and a second end, a width and a length between the first and second ends;

a first region near the first end containing a first transposase cofactor, wherein the first transposase cofactor is a metal ion;

a reaction site located at a distance from the first end and containing a transposome complex containing a transposase and a polynucleotide transposase adapter containing a double-stranded transposon terminal sequence and a single-stranded tag region; And

a pair of positive and negative electrodes located at the first and second ends, respectively.

[0165] Item 42. An electrophoresis device, comprising:

an electrophoresis gel matrix having a first end, a second end, and a length between the first and second ends;

a first region near the first end containing a first transposase cofactor for transposase, wherein the first transposase cofactor is a metal ion;

a second region near the second end and containing a second transposase cofactor for transposase, wherein the second transposase cofactor has an electrical charge opposite to that of the first transposase cofactor, wherein the second transposase cofactor is a polynucleotide transposase adapter comprising a transposon double-stranded terminal sequence and a single-stranded tag region;

a reactive site between the first end and the second end and containing a transposase; And

a pair of positive and negative electrodes located at the first and second ends, respectively.

[0166] Item 43. The device of item 41 or 42, wherein the target nucleic acid is provided in the reaction site.

[0167] Item 44. An electrophoresis device, comprising:

an electrophoresis gel matrix having a first end and a second end, a width and a length between the first and second ends;

a first region near the first end containing a first transposase cofactor for transposase, wherein the first transposase cofactor is a metal ion;

a second region near the second end and containing a second transposase cofactor for transposase, wherein the second transposase cofactor has an electrical charge opposite to that of the first transposase cofactor, wherein the second transposase cofactor is a polynucleotide transposase adapter comprising a transposon double-stranded terminal sequence and a single-stranded tag region;

a third site containing a lysing reagent;

the fourth site containing a transposase;

a reaction site between the first end and the second end; And

a first pair of positive and negative electrodes located at the first and second ends, respectively; And

a second pair of positive and negative electrodes located on opposite sides of the width at one of: the first end or the second end.

[0168] Item 45. The device of item 44, wherein whole cells containing the target nucleic acid are provided in the reaction site.

[0169] Item 46. The device according to any one of items 41-45, containing additional areas along the width and/or length, each of which contains different reagents for tagging.

[0170] Item 47. The device of any one of items 41-46, comprising a collection site for receiving labeled nucleic acid fragments.

[0171] Item 48. The apparatus of any one of items 41-47, comprising one or more receiving areas for receiving unreacted reagents.

[0172] Item 49. An apparatus according to any one of items 41-48, wherein a pair of positive and negative electrodes are in direct contact with an electrophoresis gel matrix, optionally embedded in the gel matrix.

[0173] Item 50. A system for obtaining a library of labeled nucleic acid fragments from a target double-stranded nucleic acid, comprising:

the device according to any one of paragraphs 41-49;

power supply;

a controller configured to control the direction and/or magnitude of the first and second electric fields to move reagents and/or labeled nucleic acid fragments to and/or through the reaction site, collection site and/or receiving sites.

[0174] Throughout the text of this application, references have been made to various publications, patents, and/or patent applications. The description of these publications is incorporated herein by reference in its entirety.

[0175] The above written description is considered sufficient to enable a person skilled in the art to practice the embodiments. The preceding description and examples describe certain embodiments in detail and describe the best method envisaged by the inventors. However, it should be understood that no matter how detailed the above may appear in the text, the embodiment may be practiced in a variety of ways and should be construed in accordance with the appended claims and any equivalents thereof.

[0176] As used herein, the term "about" refers to a numerical value, including, for example, integers, fractions, and percentages, whether explicitly indicated or not. Each number in the description or claims may be considered a modified term for "about". The term "about" essentially refers to a range of numerical values (eg, +/-5-10% of the specified range) that one skilled in the art considers equivalent to the specified value (eg, having the same function or result). When terms such as "at least" and "about" precede a list of numerical values or ranges, the terms modify all values or ranges given in the list. In some cases, the term "about" may include numerical values rounded to the nearest significant figure.

Claims (90)

1. A method for performing an enzymatic reaction using electrophoresis, comprising: (a) providing an electrophoresis system comprising: an electrophoresis gel matrix having a first end and a second end and a length between the first and second ends; a first region near the first end containing a first enzyme cofactor for the enzyme; a second region near the second end and containing a second enzyme cofactor for said enzyme, the second enzyme cofactor having an electrical charge opposite to that of the first enzyme cofactor; a reaction site between the first site and the second site and containing the enzyme; And a pair of positive and negative electrodes located at the first and second ends, respectively; And (b) applying an electric field between a pair of electrodes to move the first enzyme cofactor from the first site to the reaction site and move the second enzyme cofactor from the second site to the reaction site to form an activated enzyme complex containing the enzyme, the first enzyme cofactor, and the second enzyme cofactor. 2. The method of claim 1, wherein when the first enzyme cofactor is a metal ion, the second enzyme cofactor is a polynucleotide. 3. The method of claim 1 further comprising applying a substrate for the activated enzyme complex to the reaction site prior to step (c), the application of an electric field comprising reacting the activated enzyme complex with the substrate at the reaction site to form a reaction product. 4. The method of claim 1, wherein the application of an electric field includes migrating unreacted first and second enzyme cofactors from the reaction site to separate the unreacted first and second enzyme cofactors from the reaction product at the reaction site. 5. The method of claim 1, wherein the first electrode is a positive electrode and the first enzyme cofactor is positively charged, wherein the second electrode is a negative electrode and the second enzyme cofactor is negatively charged. 6. The method of claim 3, wherein the substrate is the target double-stranded nucleic acid, optionally the target double-stranded nucleic acid is double-stranded DNA, double-stranded RNA, or a DNA/RNA hybrid. 7. The method according to p. 1, in which the enzyme is a transposase, and optionally the transposase is a Tn5 transposase, and optionally the first cofactor of the enzyme contains Mg ²⁺ , optionally in the form of Mg(OAc) ₂ or MgCl ₂ and optionally the second cofactor The enzyme is a polynucleotide transposase adapter containing a double-stranded transposon terminal sequence and a single-stranded tag region. 8. A method for obtaining a library of labeled nucleic acid fragments from a target double-stranded nucleic acid, comprising: (a) providing an electrophoresis system comprising: an electrophoresis gel matrix having a first end and a second end, a width and a length between the first and second ends; a first region near the first end containing a first transposase cofactor, wherein the first transposase cofactor is a metal ion; a reaction site located at a distance from the first end and containing a transposome complex containing a transposase and a polynucleotide transposase adapter containing a double-stranded transposon terminal sequence and a single-stranded tag region; And a pair of positive and negative electrodes located at the first and second ends, respectively; (b) applying the target double-stranded nucleic acid to the reaction site; (c) applying a first electric field between a pair of electrodes to move the first transposase cofactor from the first site to the reaction site to form an activated transposome complex comprising the transposase, the polynucleotide transposase adapter, and the first transposase cofactor; And (d) incubating the target double-stranded nucleic acid with the activated transposome complex at the reaction site under conditions sufficient for the target double-stranded nucleic acid fragment rather than a plurality of nucleic acid fragments, and labeling the nucleic acid fragments, thereby creating a library of labeled nucleic acid fragments. 9. The method of claim 8 wherein the transposome complex is immobilized on a solid support at the reaction site, optionally via a streptavidin-biotin interaction. 10. The method of claim 9, comprising releasing the transposome complex from the solid support after generation of labeled nucleic acid fragments. 11. The method of claim 10, further comprising changing the magnitude of the first electric field after the step to move labeled nucleic acid fragments associated with the transposome complex released from the solid support at the collection site. 12. A method for obtaining a library of labeled nucleic acid fragments from a target double-stranded nucleic acid, comprising: (a) providing an electrophoresis system comprising: an electrophoresis gel matrix having a first end and a second end, a width and a length between the first and second ends; a first region near the first end containing a first transposase cofactor for transposase, wherein the first transposase cofactor is a metal ion; a second region near the second end and containing a second transposase cofactor for transposase, wherein the second transposase cofactor has an electrical charge opposite to that of the first transposase cofactor, wherein the second transposase cofactor is a polynucleotide transposase adapter comprising a transposon double-stranded terminal sequence and a single-stranded tag region; a reactive site between the first site and the second site and containing a transposase; And a pair of positive and negative electrodes located at the first and second ends, respectively; (b) applying the target double-stranded nucleic acid to the reaction site; (c) applying a first electric field between a pair of electrodes to move the first transposase cofactor from the first site to the reactive site and move the second transposase cofactor from the second site to the reactive site to form an activated transposomal complex comprising transposase, the first transposase cofactor, and the second transposase cofactor; And (d) incubating the target double-stranded nucleic acid with the activated transposome complex at the reaction site under conditions sufficient for the target double-stranded nucleic acid fragment rather than a plurality of nucleic acid fragments, and labeling the nucleic acid fragments, thereby creating a library of labeled nucleic acid fragments. 13. The method of claim 12, wherein the single strand region of the tag contains one or more of: a primer sequence, a barcode sequence, a unique molecular identifier (UMI) sequence, an amplification tag, an enrichment tag, or a purification tag. 14. The method of claim 12, wherein the transposase is immobilized on a solid support at a reaction site, the reaction site optionally containing a well, wherein the solid support is a granular particle or well surface. 15. The method of claim 12, wherein the magnitude of the first electric field applied in step (c) is set such that the target double-stranded nucleic acid has substantially no electrophoretic mobility within the electrophoresis template. 16. The method of claim 12 wherein the electrophoresis system comprises a lengthwise collection site between the first site and the reaction site. 17. The method of claim 16, wherein the application of the first electric field in step (c) comprises moving labeled nucleic acid fragments to a collection site. 18. The method of claim. 12, including changing the magnitude or direction of the first electric field through the gel matrix for electrophoresis. 19. The method according to claim 12, in which the electrophoresis system contains additional sections along the width and length, each of which contains different reagents for tagging, and a second pair of positive and negative electrodes on opposite sides of the width at one of: the first end or the second end . 20. The method of claim 19, comprising applying a second electric field between the second pair of electrodes, wherein the direction of the second electric field is perpendicular to the direction of the first electric field applied in step (c). 21. A method for obtaining a library of labeled nucleic acid fragments from a target double-stranded nucleic acid, comprising: (a) providing an electrophoresis system comprising: an electrophoresis gel matrix having a first end and a second end, a width and a length between the first and second ends; a first region containing a first transposase cofactor for transposase, wherein the first transposase cofactor is a metal ion; a second region containing a second transposase cofactor for transposase, wherein the second transposase cofactor has an electrical charge opposite to that of the first transposase cofactor, wherein the second transposase cofactor is a polynucleotide transposase adapter comprising a transposon double-stranded terminal sequence and a single-stranded tag region; a third site containing a lysing reagent; a fourth site containing transposase; a reaction site between the first site and the second site; And a first pair of positive and negative electrodes located at the first and second ends, respectively; And a second pair of positive and negative electrodes located on opposite sides of the width at one of: the first end or the second end; (b) applying whole cells containing the target double-stranded nucleic acid to the reaction site; (c) applying a first electric field to move a lysing agent into and/or through the reaction site to lyse the cells, thereby depositing the target double-stranded nucleic acid into the sample site; (d) applying a second electric field to move the first transposase cofactor from the first site to the reactive site, move the second transposase cofactor from the second site to the reactive site, and/or move the transposase from the transposase site to the reactive site to form an activated transposomal complex containing the transposase, the first a transposase cofactor and a second transposase cofactor; And (e) incubating the target double-stranded nucleic acid with the activated transposome complex at the reaction site under conditions sufficient for the target double-stranded nucleic acid fragment rather than a plurality of nucleic acid fragments, and labeling the nucleic acid fragments, thereby creating a library of labeled nucleic acid fragments. 22. The method according to p. 21, in which the first electric field and the second electric field are different, and step (c) is performed before step (d); or wherein the first electric field and the second electric field are the same, and step (c) is performed simultaneously with step (d). 23. An electrophoresis device, comprising: an electrophoresis gel matrix having a first end, a second end, and a length between the first and second ends; a first region near the first end containing a first enzyme cofactor for the enzyme; a second region near the second end and containing a second enzyme cofactor for said enzyme, the second enzyme cofactor having an electrical charge opposite to that of the first enzyme cofactor; a reaction site between the first site and the second site and containing the enzyme; And a pair of positive and negative electrodes located at the first and second ends, respectively. 24. An electrophoresis device, comprising: an electrophoresis gel matrix having a first end and a second end, a width and a length between the first and second ends; a first region near the first end containing a first transposase cofactor, wherein the first transposase cofactor is a metal ion; a reaction site located at a distance from the first end and containing a transposome complex containing a transposase and a polynucleotide transposase adapter containing a double-stranded transposon terminal sequence and a single-stranded tag region; And a pair of positive and negative electrodes located at the first and second ends, respectively. 25. An electrophoresis device, comprising: an electrophoresis gel matrix having a first end, a second end, and a length between the first and second ends; a first region near the first end containing a first transposase cofactor for transposase, wherein the first transposase cofactor is a metal ion; a second region near the second end and containing a second transposase cofactor for transposase, wherein the second transposase cofactor has an electrical charge opposite to that of the first transposase cofactor, wherein the second transposase cofactor is a polynucleotide transposase adapter comprising a transposon double-stranded terminal sequence and a single-stranded tag region; a reactive site between the first end and the second end and containing a transposase; And a pair of positive and negative electrodes located at the first and second ends, respectively. 26. An electrophoresis device, comprising: an electrophoresis gel matrix having a first end and a second end, a width and a length between the first and second ends; a first region near the first end containing a first transposase cofactor for transposase, wherein the first transposase cofactor is a metal ion; a second region near the second end and containing a second transposase cofactor for transposase, wherein the second transposase cofactor has an electrical charge opposite to that of the first transposase cofactor, wherein the second transposase cofactor is a polynucleotide transposase adapter comprising a transposon double-stranded terminal sequence and a single-stranded tag region; a third site containing a lysing reagent; a fourth site containing transposase; a reaction site between the first end and the second end; And a first pair of positive and negative electrodes located at the first and second ends, respectively; And a second pair of positive and negative electrodes located on opposite sides of the width at one of: the first end or the second end. 27. A system for obtaining a library of labeled nucleic acid fragments from a target double-stranded nucleic acid, containing: device according to any one of paragraphs. 23-26; power supply; a controller configured to control the direction and/or magnitude of the first and second electric fields to move reagents and/or labeled nucleic acid fragments to and/or through the reaction site, collection site and/or receiving sites.

Images