RU2796767C1 - Method of trichoscopy using artificial neural networks for the diagnosis of hair damaged by dermatophyte spores in cats - Google Patents

Abstract

FIELD: veterinary medicine; veterinary dermatology.

SUBSTANCE: invention represents a method of trichoscopy using artificial neural networks for diagnosing cat hair damaged by dermatophyte spores. The method includes the following: obtaining material by removing 30–50 hairs using a surgical clamp; the resulting hair is placed on a glass slide, after adding mineral oil; the preparation is covered with a coverslip and microscoped at 4x and 40x magnification, the condenser is lowered, the diaphragm is covered. An optical microscope with an ocular digital USB camera and an electronic computer with the Unix operating system is used for microscopy. A trained artificial neural network YOLO v5 and microscopy are used to identify hair damaged by spores of dermatophyte dermatophytes in cats, followed by analysis of the obtained data.

EFFECT: invention provides the use of artificial neural networks for diagnosing cat hair damaged by dermatophyte spores.

1 cl, 6 dwg, 2 ex

Description

The field of technology to which the invention belongs

This invention belongs to the field of veterinary medicine, in particular to veterinary dermatology, and represents a method of trichoscopy using artificial neural networks for diagnosing hair damaged by dermatophyte spores in cats. The invention can be used to diagnose dermatitis in cats damaged by dermatophyte spores in private and public veterinary clinics.

State of the art

A known method for the diagnosis of animal dermatophytosis caused by filamentous fungi species Microsporum canis and Trichophyton mentagrophytes . Selective nutrient medium for isolation of pathogens of dermatophytosis includes glucose, mannitol, meat peptone, phenol red, agar-agar, cycloheximide, enrofloxacin and distilled water at a given content of components. EFFECT: invention allows to reduce the time for diagnosing animal dermatophytosis, to increase the reliability of the results of differentiation of dermatophyte fungi using routine microbiological methods and to expand the arsenal of nutrient media for the isolation of pathogens of dermatophytosis (see US Pat.RU 2745159, IPC C12N 1/14 (2006.01), C12R 1/645 ( 2006.01) published on 03/22/2021).

The disadvantage of this method for diagnosing dermatophytosis in animals caused by filamentous fungi species Microsporum canis and Trichophyton mentagrophytes is the interpretation of the results of the study.

A known method for laboratory diagnosis of dermatomycosis, which is carried out by inoculation and isolation of dermatophytes from clinical material on a selective medium with the addition of liquid medical bile, yeast autolysate and an antibiotic from the group of fluoroquinolones, such as ciprofloxacin, in the following ratio, g/l: glucose 40.0, peptone 10.0, agar 18.0-20.0, distilled water up to 1 l, liquid medical bile 1.0, concentrated yeast autolysate 5.0, ciprofloxacin 5.0. Sowing is incubated at a temperature of 37°C for 5-7 days and 15 days at a temperature of 28-30°C and the type of colonies is identified. The method increases the efficiency of isolation of pathogenic fungi - dermatophytes from clinical material, allows for a shorter period to obtain a pure culture of dermatophytes (see US Pat. RU 2181144, IPC C12N 1/14 (2000.01), C12Q 1/04 (2000.01) publ. 10.04.2002 ).

The disadvantage of the method of laboratory diagnosis of dermatomycosis, which is carried out by seeding and isolation of dermatophytes from clinical material on a selective medium with the addition of liquid medical bile, is the interpretation of the results of the study.

A known method for assessing the growth properties of the nutrient medium to control the growth properties of nutrient media intended for the diagnosis of dermatophytosis caused by filamentous fungi species Microsporum canis and Trichophyton mentagrophytes . Microsporum canis strain "FL 79-18 Viev", deposited in the All-Russian State Collection of Pathogenic and Vaccine Strains of Microorganisms-Causative Agents of Infectious Animal Diseases F-81, as well as Trichophyton mentagrophytes strain "CN 38-18 Viev", deposited in the All-Russian State Collection of Pathogenic and Vaccine Strains of Microorganisms Causing Infectious Animal Diseases of the Federal State Budget Scientific Institution of the Federal Scientific Center of VIEV RAS under the number F-82. The strains are weakly pathogenic for laboratory animals and have cultural properties typical of the species, allow assessing the growth properties of the nutrient medium used, thereby confirming its suitability for use, increasing the reliability of the results obtained. The advantage of the invention is to increase the stability and reliability of the results of laboratory diagnosis of dermatophytosis, as well as to reduce the time for diagnosing dermatophytosis in animals (see US Pat.RU 2741097, IPC C12N 1/14 (2006.01), C12R 1/645 (2006.01) publ.

The disadvantage of the method for assessing the growth properties of the nutrient medium to control the growth properties of nutrient media intended for the diagnosis of dermatophytosis is the interpretation of the results of the study.

A known method for the diagnosis of microsporia, which includes the isolation of total native DNA from the skin and hair, specific amplification of a fragment of the 5.8S rRNA gene Trichophyton verrucosum using primers of the following structure: 5' CCACGATAGGGATCAGCGTT 3', 5' GAAAGTTTTAACTGATTTTGCTTG 3'. Then, upon electrophoretic detection of an amplification product with a size of 231 b.p. determine the presence of a pathogen. The use of the invention makes it possible to establish the fact of human infection with Trichophyton verrucosum in various clinical forms of the disease, including erased and atypical ones (see US Pat.RU 2562540, IPC G01N 33/48 (2006.01) publ. 19.09.2015).

The disadvantage of the method for diagnosing microsporia, which includes the isolation of total native DNA from the skin and hair, is the interpretation of the results of the study.

A known method for the detection of the fungus Microsporum canis , which is carried out by isolating total native DNA from a sample of skin and hair, polymerase chain reaction and amplification of the 5.8S rRNA gene fragment of Microsporum canis using specific primers. When electrophoretic detection of an amplification product with a size of 182 b.p. determine the presence of a pathogen. EFFECT: invention provides specific detection of Microsporum canis in clinical material and can be used to diagnose microsporia (see US Pat. RU 2558927, IPC G01N 33/68 (2006.01), C12Q 1/68 (2006.01) publ. 10.08.2015).

The disadvantage of the method for detecting the fungus Microsporum canis , which is carried out by isolating total native DNA from a skin and hair sample, is the interpretation of the results of the study.

A method is known for detecting microscopic fungi of the genus Coccidioides posadasii 36 S and Coccidioides immitis C-5 in vitro, which includes pre-cultivation of the culture in the mycelial phase, preparation of a suspension corresponding to 5 units of a standard turbidity sample, enabling the formation of spherules and detection of spherules filled with endospores. The culture in the mycelial phase is grown for 3 days. Ensuring the formation of spherules is carried out by infecting a daily culture of cells of mouse splenocytes obtained on RPMI-1640 medium, and subsequent cultivation for 5 days at a temperature of 37°C, with a content of 5% CO ₂ in the atmosphere. To detect spherules in the form of rounded bypass formations filled with endospores, a sample is taken, disinfected with formalin, and the sample is examined by light microscopy. The invention allows to simplify the method and reduce the time of research (see US Pat. RU 2503715, IPC C12N 1/14 (2006.01), C12Q 1/02 (2006.01) publ. 10.01.2013).

The disadvantage of the method for detecting microscopic fungi of the genus Coccidioides posadasii 36 S and Coccidioides immitis C-5 in vitro is the interpretation of the results of the study.

A known method for the detection of the fungus Microsporum canis , which is the causative agent of microsporia. The proposed nutrient medium contains glucose, peptone, agar, low molecular weight water-soluble food chitosan and distilled water at a given content of components. EFFECT: invention allows to reduce the time for isolating the culture of M. canis from clinical material from patients (see US Pat.RU 2695675, IPC C12N 1/14 (2006.01) publ. 25.07.2019).

The disadvantage of the method for the detection of the fungus Microsporum canis is the interpretation of the results of the study.

The closest in technical essence and the achieved positive effect adopted by the authors for the prototype is a method for diagnosing microsporia is carried out by establishing the features of the clinical manifestations of the process, studying the macro- and microphology of the culture. In the presence of 1-2 foci 0.5-1.5 cm in size with localization mainly on the scalp and the presence of single two-cell macroconidia in the form of a horseshoe with a thick corroded wall, microsporia caused by Microsporum canis var. distortum . EFFECT: invention allows using a complex of anamnestic, clinical, microscopic and morpho-biological signs to establish an accurate etiological diagnosis of the causative agent of microsporia - M. canis var. distortum , which is important in the course of antimycotic therapy. Using the method will improve the diagnosis, prediction of the clinical course of microsporia, the duration of the disease and treatment (see US Pat. RU 2458991, IPC C12Q 1/04 (2006.01), C12N 1/20 (2006.01), C12R 1/645 (2006.01) publ. 20.08 .2012).

The disadvantage of the method for diagnosing microsporia, which is carried out by establishing the features of the clinical manifestations of the process, studying the macro- and microphology of the culture, is the interpretation of the results of the study.

Disclosure of invention

The objective of the present invention is to develop a trichoscopy method using artificial neural networks for diagnosing hair in cats damaged by dermatophyte spores.

The technical result that can be achieved with the present invention is the use of artificial neural networks for diagnosing hair in cats damaged by dermatophyte spores.

The technical result is achieved using a method for diagnosing microsporia by establishing the features of the clinical manifestations of the process, studying the macro- and microphology of the culture, characterized in that the material is obtained by removing 30-50 hairs using a surgical clamp. When removing no more than 30 hairs at a time, this procedure is completely painless for small pets; plucked hair is placed on a glass slide, after adding mineral oil; the preparation is covered with a coverslip and microscoped at a magnification of 4x and 40x, the condenser is lowered, the diaphragm is covered (contrast is adjusted); for microscopy, an optical microscope is used using an ocular digital USB camera and an electronic computer with the Unix operating system; a trained artificial neural network YOLO v5 is used to identify dermatophyte-damaged hair spores in cats.

Dermatophytes are the main group of fungi pathogenic to humans. They are represented by 39 species united in the genera Trichophytoh , Microsporum and Epidermophiton . A possible feature that unites these fungi is that in the process of evolution, the main pathogenic representatives of dermatophytes left the soil and adapted to life in human and animal tissues containing keratin. The source of infection is the soil, an infected person or animal. Dermatophytes infect hair, nail plates and human skin and occupy one of the first places in the structure of skin pathology (see US Pat.

Drawings and other materials

The figure 1 shows the diagnosis of hair in cats damaged by dermatophyte spores using the artificial neural network YOLO v5 (lens 10x/0.25) according to example No. 1.

The figure 2 demonstrates the diagnosis of hair in cats damaged by dermatophyte spores using the YOLO v5 artificial neural network (lens 10x/0.25) according to example No. 1.

The figure 3 shows the diagnosis of hair in cats damaged by dermatophyte spores using the YOLO v5 artificial neural network (lens 10x/0.25) according to example No. 2.

The figure 4 demonstrates the diagnosis of hair in cats damaged by dermatophyte spores using the YOLO v5 artificial neural network (lens 10x/0.25) according to example No. 2.

The figure 5 demonstrates the diagnosis of hair in cats damaged by dermatophyte spores using the YOLO v5 artificial neural network (lens 10x/0.25) according to example No. 3.

Figure 6 demonstrates the diagnosis of hair in cats damaged by dermatophyte spores using the YOLO v5 artificial neural network (10x/0.25 objective).

Implementation of the invention

Trichoscopy allows you to identify in small pets: the phase of hair growth - anagen, catagen, telogen; self-induced and spontaneous hair lesions (pay attention to the tip of the hair, with alopecia due to itching, trauma to the tips of the hair is observed); allow to differentiate pediculosis and cheiletiellosis on the hair shaft, it is possible to detect demodicosis in the hair follicle; when evaluating the hair shaft, it is possible to detect spores of dermatophytes; suggests dilute color alopecia (abnormally large melanin granules that damage the hair shaft).

The method of trichoscopy using artificial neural networks for the diagnosis of hair damaged by dermatophyte spores in cats is carried out: the material is obtained by removing 30-50 hairs using a surgical clamp. When removing no more than 30 hairs at a time, this procedure is completely painless for small pets; plucked hair is placed on a glass slide, after adding mineral oil; the preparation is covered with a coverslip and microscoped at a magnification of 4x and 40x, the condenser is lowered, the diaphragm is covered (contrast is adjusted); an optical microscope is used for microscopy using an ocular digital USB camera and an electronic computer with the Unix operating system; architecture YOLO (high-precision artificial neural network), which provide high accuracy and speed of detection of objects in images (see US Pat.

On the basis of the Pirogov Veterinary Center, 60 cat hair samples were collected, a small tuft of hair was captured with fingertips or a clip with rubber sponges and pulled out in the direction of hair growth. For microscopy, an optical microscope is used using an ocular digital USB camera and an electronic computer with the Unix operating system; a trained artificial neural network YOLO v5 is used to identify dermatophyte-damaged hair spores in cats.

Example #1. Microscopy of cat hair damaged by dermatophyte spores is carried out using an artificial neural network. Diagnostics was carried out in three stages. The first stage: the diagnosis of hair in cats damaged by dermatophyte spores was carried out using a trained artificial neural network. The second stage: microscopy by veterinary specialists of the Pirogov Veterinary Center and staff of the department. The third stage: analysis of the data received from the trained artificial neural network, veterinary specialists and staff of the department.

Cat hair samples (n=20) collected from cats are transferred to a glass slide for microscopy. For microscopy, an optical microscope is used with an ocular digital USB camera and an electronic computer with the Unix operating system.

It was found that out of 20 samples, the trained artificial network found 5 samples of hair from cats that were damaged by dermatophyte spores (see Fig. 1-2). Veterinary specialists and staff of the department found 5 samples of cat hair damaged by dermatophyte spores. In the remaining 15 samples, the trained neural network, veterinary specialists and staff of the department did not find cat hair that was damaged by dermatophyte spores.

Example #2. Carried out similarly to example No. 1. It was found that out of 20 samples, the trained artificial network found 7 samples of cat hair damaged by dermatophyte spores (see Fig. 3-4). Veterinary specialists and staff of the department found 7 samples of cat hair damaged by dermatophyte spores. In the remaining 13 samples, the trained neural network, veterinary specialists and staff of the department did not find hair in cats that were damaged by dermatophyte spores.

Example #3. Carried out similarly to example No. 1. It was found that out of 20 samples, the trained artificial network detected 12 hair samples from cats damaged by dermatophyte spores (see Fig. 5-6). Veterinary specialists and staff of the department found 12 samples of hair from cats damaged by dermatophyte spores. In the remaining 8 samples, the trained neural network, veterinary specialists and staff of the department did not find hair in cats that were damaged by dermatophyte spores.

In the course of research of the proposed method of trichoscopy using artificial neural networks for diagnosing spore-damaged hair dermatitis in cats, it was proved that a trained artificial neural network of 60 test samples diagnosed dermatophyte spore damage in 20 samples. The result obtained is similar to the results of the study of samples by veterinary specialists and employees of the Department of Therapy and Pharmacology of the Stavropol State Agrarian University.

The proposed invention compared with the prototype and other known technical solutions has the following advantages: reducing the time for trichoscopy, simplifying the interpretation of trichoscopy results, automation of the trichoscopy method.

Claims (1)

A trichoscopy method for determining hair damaged by dermatophyte spores in cats, comprising: obtaining material by removing 30-50 hairs using a surgical clamp; the resulting hair is placed on a glass slide, after adding mineral oil; the preparation is covered with a coverslip and microscoped at a magnification of 4x and 40x, the condenser is lowered, the diaphragm is covered; at the same time, an optical microscope with an ocular digital USB camera and an electronic computer with the Unix operating system is used for microscopy, a trained artificial neural network YOLO v5 and microscopy are used to identify dermatophyte-damaged hair spores in cats, and microscopy is used, followed by analysis of the data obtained.

Images