RU2795456C2 - USE OF iNOS INHIBITORS TO INCREASE VIRUS YIELD IN CULTURE - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to the methods for obtaining viruses and recombinant virions in culture. Described is a method for producing virions of a recombinant adeno-associated virus (rAAV), which includes cultivating a recombinant herpes simplex virus (rHSV) in a cell culture that contains aurine tricarboxylic acid and fetal calf serum. rHSV is cultured in 293 or Vero cells, where the aurine tricarboxylic acid is present at a concentration of 10–60 μM and where the aurine tricarboxylic acid is present in an amount that increases the yield of herpes virus. Further, the cultured recombinant herpes simplex virus is used to obtain recombinant adeno-associated virus virions.

EFFECT: technical result is to increase the production of HSV through the use of ATK.

5 cl, 11 dwg, 4 tbl, 8 ex

Description

FIELD OF TECHNOLOGY

The present invention generally relates to methods for producing viruses and recombinant virions in culture. In particular, the invention relates to the use of iNOS inhibitors such as auryntricarboxylic acid, dexamethasone and valproic acid to increase the yield of various viruses in culture, including recombinant herpesviruses, which in turn can be used as helper viruses for the production of recombinant adeno-associated virus virions. .

PRIOR ART

Herpesviruses are widely distributed in nature and are found in most animal species. At least one hundred herpesviruses have been characterized, including several from humans, such as herpes simplex virus-1 (HSV-1) and herpes simplex virus-2 (HSV-2), varicella zoster virus (VZV), Epstein- Barr (EBV), cytomegalovirus (CMV) and other human herpesviruses such as HHV6 and HHV7. These viruses are responsible for various human diseases such as skin infections, genital herpes, viral encephalitis, and the like.

HSV-1 infection activates host defenses and the innate immune response by inducing intracellular signaling pathways that result in the expression of proteins with pro-inflammatory and antimicrobial properties, including cytokines and interferons (IFs) (Sainz and Halford, J. Virol (2002) 76 : 11541-11550; Haller et al., Virology (2006) 344 : 119-130; Paludan et al., Nat. Rev. Immunol. (2011) 11 : 143-154). The interferon signaling pathway is one of the most important cellular defense mechanisms for virus elimination (Brandner & Mueller, Hoppe-Seyler's Zeitschriftfur physiologische Chemie (1973) 354 :1176; De Vries et al., Gene Ther. (2008) 15 :545-552 ).

Researchers have reported antiviral activity of nitric oxide (NO) against several viruses such as vaccinia virus, vesicular stomatitis virus, and Japanese encephalitis virus, among others (Bi et al., J. Virol. (1995) 69 :6466-6472; Harris et al., J. Virol.(1995) 69 :910-915; Lin et al., Virol. (1997) 71 :5227-5235; Pertile et al., Avian Dis. (1996) 40 :342-348 NO is a free radical gaseous molecule and mediates the body's immune system (Croen KD, J. Clin. Invest. (1993) 91 :2446-2452; Karupiah et al., Science (1993) 261 :1445-1448; Rolph et al., Virol.(1996) 217 :470-477; Amaro et al., J. Med Virol. (1997) 51 :326-331; Lane et al., J. Virol. (1997) 71 :2202-2210 HSV-1 is known to be able to both elicit and evade antiviral responses in the body (Mossman et al., J. Virol. (2001) 75 :750-758) Infection with HSV is capable of inducing the expression of inducible nitric oxide synthase ( iNOS), a gene encoding an inducible isoform of NOS that produces large amounts of NO.

Herpesviruses and their recombinant proteins are used in the production of a number of vaccines. In addition to adenoviruses, herpesviruses have been shown to provide complete helper virus functions for the production of recombinant adeno-associated virus virions (Buller, RML, J. Virol. (1981) 40 :241-247; Mishra et al., Virology (1990) 179 :632 -639). The minimum set of HSV-1 genes required for AAV replication and packaging has been established to include the early genes UL5, UL8, UL52 and UL29 (Weindler et al., J. Virol. (1991) 65 :2476-2483). These genes encode components of the HSV-1 core replication complex, helicase, primase, and primase accessory proteins (UL5, UL8, and UL52) and a single-stranded DNA binding protein (UL29).

Recombinant AAV (rAAV) vectors have been successfully used to obtain high levels of long-term transduction in vivo . Despite the above advantages, the production of large quantities of high titer rAAV virions for clinical use in gene therapy continues to be challenging due to limitations in the scalability of the cotransfection protocol. The process requires efficient cellular delivery of three components: (1) a vector containing the gene of interest flanked by AAV inverted terminal repeats (ITRs); (2) a vector containing the AAV rep and cap genes; and (3) genes allowing the use of a helper virus such as adenovirus or herpes simplex virus or the use of virus-free helper plasmids (see, Muzyczka, N., Curr. Top. Microbiol. Immunol. (1992) 158 :97-129) . Thus, in rHSV-based rAAV production protocols, rAAV yield is limited by the maximum titer of rHSV helper vectors.

A replication-deficient HSV-1 vector called d27.1-rc expresses the rep and cap AAV genes (Conway et al., Gene Ther. (1999) 6 :986-993) and is constructed from the parent d27-1 virus. (Rice at al., J. Virol. 1989 vol. 63 (8) pp. 3399-407), which does not produce ICP27, a protein required for HSV-1 replication.

Although this vector is replication deficient, it still expresses the early HSV-1 genes required for rAAV replication and packaging (Conway et al., Gene Ther. (1999) 6 :986-993).

Typically, one vector carrying the rAAV template and another vector expressing the AAV rep and cap regions are co-infected in 293 cells to produce rAAV virions. Both HSV-1 based vectors are replication deficient and thus can only propagate in a cell line supplemented with ICP27, V27 (Fig at al., J. Virol. 1989 vol. 63 (8) pp. 3399-407 ). The HSV-based AAV protocol requires 293 cells to be infected with HSV-1 with a high MOI of 12. This is a limitation because yields of d27-1 derived vectors in V27 cells are typically approximately 1 X 10 ⁷ plaque forming units (PFU)/ml.

Several methods and reagents have been explored to further increase HSV-1 titers (see, eg, Wechucket al., Biotechnol. Prog. (2000) 16 :493-496; Ozuer et al., Biotechnol. Prog. (2002) 18 :476-482; Erlandsson et al., J. Endocrinol, (2002) 175 :165-176; Otsuki et al., Mol. Ther. (2008) 16 :1546-1555).

Both dexamethasone and valproic acid inhibit the body's defense mechanisms represented by several interferon (IFN)-responsive antiviral genes, increase the level of transcription of viral genes, and thus improve virus spread and HSV-1 harvest (Erlandsson et al., J. Endocrinol (2002) 17 5:165-176; Otsuki et al., Mol Ther (2008) 16 :1546-1555).

Despite the foregoing knowledge, additional methods are needed to inhibit the immune system in order to improve virus production in culture. As mentioned above, investigators report antiviral activity of nitric oxide (NO) against certain viruses such as vaccinia virus, vesicular stomatitis virus, and Japanese encephalitis virus, among others (Bi et al, J. Virol. (1995) 69 :6466- 6472; Harris et al., J. Virol. (1995) 69 :910-915; Lin et al., J. Virol. (1997) 71 :5227-5235; Pertile et al. Avian Dis. (1996) 40 :342 -348 NO is a free radical gaseous molecule and is an immune system mediator (Croen KD, J. Clin. Invest. (1993) 91 :2446-2452; Karupiah et al., Science (1993) 261 :1445-1448; Rolph et al., Virol.(1996) 217 :470-477; Amaro et al., J. Med. Virol. (1997) 51 :326-331; Lane et al., J. Virol. (1997) 71 :2202- 2210) As described above, HSV infection can cause the expression of iNOS, a gene encoding an inducible isoform of NOS that produces large amounts of NO.

The presence of the iNOS inhibitor, N-methyl-L-arginine (L-NMA), abolishes the inhibition of viral replication for all three of these viruses (Karupiah et al. Science (1993) 261 : 1445-1448). For a review of iNOS inhibitors, see Southan et al, Biochem. Pharmacol. (1996) 51 :383-394. Another compound, auryl tricarboxylic acid (ATA), has been shown to protect macrophages from bacterial lipopolysaccharide-induced cell death by downregulating iNOS expression and thus reducing NO production (Chen et al., British Journal of Pharmacology (2002) vol. 137 (7) pp. 1011-20). ATK is a heterogeneous mixture of polymers to which an increasing number of biological activities are attributed, such as interaction with a number of enzymes, including DNA polymerases, RNA polymerases, reverse transcriptase (RNA-dependent DNA polymerase), aminoacyl-tRNA synthetase, ribonucleotide reductase , ribonuclease nuclease, inhibition of protein synthesis, prevention of apoptosis and blocking of DNA fragmentation in oligodendrocytes induced by oxidative stress (Tscherne and Pestka, Antimicrob. Agents Chemother. (1975) 8 :479-487; Mikelens et al., Biochemical Pharmacology (1976) 25 :821-827; Vollgraf et al., J. Neurochem.(l999) 73 :2501-2509).

It has also been reported that aurine tricarboxylic acid (ATA) prevents IFN-mediated transcriptional activation (Tsi et al., Mol. Pharmacol. (2002) 101 :90-101; Chen et al., British J. Pharmacol. (2002) 137 :1011 -1020). ATK is known to be an activator of the Raf/MEK/MAPK pathway, IGF-1 receptor, and protein kinase C signaling pathway (Beery et al., Endocrinology (2001) 142 :3098-3107; Chen et al., J. Biol. Chem. (2001) 276 :46722-46728). The antiviral, antimicrobial, and antiproliferative effects of cytokines such as interferons may be related to their ability to induce the expression of iNOS, a gene encoding an isoform of nitric oxide synthase (NOS) that produces large amounts of the radical gas, NO, from the guanidine nitrogen of L-arginine (Nathan , C, FASAB J. (1992) 6 :3051; Werner-Felmayer et al., J. Exp. Med. (1990) 172 :1599). Treatment with macrophages with IFN-γ has been shown to severely limit the replication of murine pox virus (EV), vaccinia virus (VV), and HSV-1.

On the one hand, ATK is also known as an antiviral agent against several viruses, including HIV, herpes virus HHV-7, SARS-CoV, and others (Cushman et al., J. Med. Chem. (1991) 34 :329-3371991; Zhang et al., Antiviral Res. (1999) 43 :23-35; Yap et al., ComputationalBiol and Chem. (2005) 29 :212-219; De Clercq, Advents, Advances, and Adventures Med. Res. Rev. (2011 ) 31 :118-160). ATK, however, does not block adenovirus type 5 (Ad5) replication in HEK-293 cells (He, Biochem. Biophys. Res. Comm. (2004) 320 :1199-1203). In addition, it is reported that ATK unexpectedly increased the titer of the control adenoviral vector in 293 cells while having an antiviral effect on vaccinia at the same time (Myskiw et al., J. Virol. (2007) 81 :3027-3032).

SUMMARY OF THE INVENTION

The present invention thus overcomes the shortcomings of the prior art by solving problems that limit virus production, such as low production of rHSV, which hinders efforts to produce sufficient quantities of rHSV for various purposes, including vaccine production, as well as to produce rAAV virions in quantities necessary for effective gene therapy procedures. Using the methods described herein, it is possible to obtain higher titers of viruses, such as at least an order of magnitude greater than conventional methods.

In particular, the inventors herein have discovered that aurine tricarboxylic acid (ATA) inhibits iNOS and increases HSV production. As shown in the examples herein, micromolar concentrations of ATK in the presence of fetal bovine serum (FBS) increased both the yield of HSV-1/d27-1 vector in V27 cells and wild-type (wt) HSV-1 virus in Vero, V27 cells. and 293. Other iNOS inhibitors, including dexamethasone and valproic acid, also increased HSV-1 titers in culture. HSV-induced iNOS expression was shown to be downregulated in HSV+ATK samples when analyzed with the SABiosciences microarray. Similarly, analysis with the Affymetrix human genome panel confirmed that HSV-induced overexpression of all three nitric oxide synthase genes (nNOS, iNOS, and eNOS) was reduced in HSV+ATK samples. Affymetrix Gene Array also revealed that the expression of genes that are involved in IgE and IFN signaling associated with inflammation and in systemic immune responses was downregulated by HSV-1 and downregulated after ATK supplementation. On the other hand, the expression of genes predominantly involved in the G1/S phase of the cell cycle and signaling in WNT-mediated development was significantly reduced by HSV and increased after the addition of ATK.

These results are significant due to the demand for higher titers of HSV-1 for the production of rAAV virions, as well as for prophylactic, therapeutic and diagnostic purposes.

Thus, in one of the embodiments, the invention relates to a method for obtaining a virus, including culturing the virus in a cell culture that contains aurine tricarboxylic acid. In certain embodiments, the virus is a herpes virus such as HSV-1.

In further embodiments, the herpes virus is wild-type HSV-1 or a recombinant HSV-1 vector such as HSV-1 d27.1 vector.

In further embodiments, the virus is cultured in 293, HeLa, or Vero cells, such as V27 cells.

In additional embodiments, the invention relates to a method for culturing the HSV-1 d27.1 vector, comprising:

(a) infecting V27 cells with HSV-1 d27.1 vector; And

(b) culturing infected V27 cells in a cell culture containing auryl tricarboxylic acid, valproic acid, or dexamethasone.

In certain embodiments, the cell culture further comprises serum, such as fetal calf serum.

In additional embodiments, the invention relates to a cell culture containing aurine tricarboxylic acid and 293, HeLa or Vero cells, such as V27 cells.

These and other embodiments of the subject invention will be apparent to those skilled in the art in light of the disclosures herein.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 is a Western blot showing that aurine tricarboxylic acid (ATA) inhibits iNOS expression in V27 lysates infected with d27-1.

Figures 2A-2C show the principles of the ATK-HSV protocol (Figure 2A) and optimization of d27-1 HSV-1 titers in V27 supernatants in order to determine which concentrations and conditions of ATK supplementation affect HSV yields. Figure 2B shows viral titers expressed as DNase resistant particles (DRP/ml) at different concentrations of ATK in 6-well plates (Figure 2B) and T150 flasks (Figure 2C).

Figure 3 shows the importance of the presence of serum in the ATK-HSV protocol. An additional optimization and the importance of the presence of ETS in the ATK-HSV protocol was demonstrated on HSV-1 d27-l titers expressed as drp/mL and PFU/mL.

Figures 4A-4B show the effect of ATK on wild-type KOS and McIntyre HSV strains in culture. ATK increases the yield of both types of virus in Vero cells, however, ATK appears to inhibit the growth of HSV-1 KOS in 293 cells. On the other hand, the McIntyre wtHSV-1 strain achieves the highest titers after ATK induction in 293 cells. In addition, ATK appears to inhibit both types of HSV-1 viruses in HeLa cells.

Figures 5A-5B show the effect of ATK in HSV effluents on rAAV virion production. rAAV titers were slightly increased when HSV stock prepared with 20 μM ATK added at the time of infection was added. ATK was also shown to increase rAAV titer when 10 μM ATK was injected directly into 293 cell media during the 2 hour co-infection step with HSV.

The figure 6 shows the effect of dexamethasone (Dex) on the viral titer of d27-1/GFP HSV-1. End-point titers of d27-1/GFP HSV-1 were generally slightly elevated after pretreatments or dex treatments compared to untreated controls.

The figure 7 shows the effect of pre-treatment with valproic acid (VK) on the viral titer of d27-1/GFP HSV-1. VA at 5 mM slightly increased HSV-1 d27-1/GFP titer, but concentrations below and above 5 mM appeared to have an inhibitory effect on HSV-1 d27-1/GFP titer compared to untreated control.

DETAILED DESCRIPTION OF THE INVENTION

In the practice of the present invention, unless otherwise indicated, conventional methods of chemistry, biochemistry, recombinant DNA technology and immunology within the art are used. Such methods are fully described in the literature. See, for example, Fundamental Virology, 2nd Edition, vol. I & II (B.N. Fields and D.M. Knipe, eds.); Handbook of Experimental Immunology, Vols. I-IV (D.M. Weir and C.C. Blackwell eds., Blackwell Scientific Publications); THOSE. Creighton, Proteins: Structures and Molecular Properties (W.H. Freeman and Company, 1993); A.L. Lehninger, Biochemistry (Worth Publishers, Inc., current addition); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.).

All publications, patents and patent applications cited herein, above or below, are hereby incorporated by reference in their entirety.

1. DEFINITIONS

In describing the present invention, the following terms will be used and are defined as follows.

It should be noted that, as used in this specification and the appended claims, singular forms include references to plural forms unless the text clearly indicates otherwise. Thus, for example, reference to "herpes virus" includes a mixture of two or more such viruses, and the like.

The terms "recombinant HSV", "rHSV" and "rHSV vector" refer to isolated, genetically modified forms of herpes simplex virus (HSV) containing heterologous genes inserted into the viral genome. By "rHSV/rc" or "rHSV/rc" or "helper-function rHSV" is meant rHSV in which the AAV rep and/or cap genes are inserted into the rHSV genome. The terms "rHSV expressing virus" and "rHSV/AAV" refer to rHSV in which inverted terminal repeat (ITR) sequences from AAV are inserted into the rHSV genome.

The terms "polypeptide" and "protein" refer to a polymer of amino acid residues and are not limited to a minimum product length. Thus, peptides, oligopeptides, dimers, multimers, and the like. included in the definition. The definition includes both full-length proteins and their fragments. The terms also include post-expression modifications of a polypeptide, such as glycosylation, acetylation, phosphorylation, and the like. In addition, for the purposes of the present invention, a "polypeptide" refers to a protein that contains modifications such as deletions, insertions and substitutions (generally conservative in nature) in the native sequence, provided that the protein retains the desired activity. These modifications may be intentional, such as through site-directed mutagenesis, or may be accidental, such as mutations in organisms that produce proteins, or errors due to amplification by PCR. Depending on the expression system used, the N-terminal methionine may or may not be present in the polypeptide. In addition, the polypeptide may or may not contain a native signal sequence if it is present initially. If the signal sequence is normally absent, the protein can be produced with a heterologous sequence.

"Native" polypeptide refers to a polypeptide with the same amino acid sequence as the corresponding molecule obtained from a natural source. Such native sequences can be isolated from natural sources or can be obtained by recombinant or synthetic methods. The term "native" sequence specifically includes naturally occurring truncated or secreted forms of a particular molecule (eg, extracellular domain sequence), naturally occurring variant forms (eg, alternatively spliced forms), and naturally occurring allelic variants of a polypeptide.

By "variant" is meant an active polypeptide as defined herein that has at least about 80% amino acid sequence identity with the corresponding full-length native sequence, a polypeptide without a signal peptide, an extracellular domain of a polypeptide, with or without a signal peptide, or any other a sequence fragment of a full length polypeptide as described herein. Such polypeptide variants include, for example, polypeptides wherein one or more amino acid residues are added to or removed from the N- and/or C-terminus of the full-length native amino acid sequence. Typically, such a variant will have at least about 80% amino acid sequence identity, alternatively at least about 81% amino acid sequence identity, alternatively at least about 82% amino acid sequence identity, alternatively at least , about 83% amino acid sequence identity, alternatively at least about 84% amino acid sequence identity, alternatively at least about 85% amino acid sequence identity, alternatively at least about 86% amino acid sequence identity, alternatively, at least about 87% amino acid sequence identity, alternatively at least about 88% amino acid sequence identity, alternatively at least about 89% amino acid sequence identity, alternatively at least about 90% amino acid sequence identity, alternatively at least about 91% amino acid sequence identity, alternatively at least about 92% amino acid sequence identity, alternatively at least about 93% amino acid sequence identity, alternatively at least about 94% amino acid sequence identity alternatively at least about 95% amino acid sequence identity, alternatively at least about 96% amino acid sequence identity, alternatively at least about 97% amino acid sequence identity, alternatively at least about 98% amino acid sequence identity amino acid sequences; and alternatively, at least about 99% amino acid sequence identity with the corresponding full-length native sequence. Typically, variant polypeptides are at least about 10 amino acids in length, such as at least about 20 amino acids in length, such as at least about 30 amino acids in length, alternatively at least about 40 amino acids in length. amino acids in length, alternatively at least about 50 amino acids in length, alternatively at least about 60 amino acids in length, alternatively at least about 70 amino acids in length, alternatively at least about 80 amino acids in length length, alternatively at least about 90 amino acids in length, alternatively at least about 100 amino acids in length, alternatively at least about 150 amino acids in length, alternatively at least about 200 amino acids in length, alternatively, at least about 300 amino acids in length or greater.

Particularly preferred variants contain substitutions that are conservative in nature, ie those substitutions that occur within a family of amino acids that are related in their side chains. Specifically, amino acids are generally divided into four families: (1) acidic - aspartic acid and glutamic acid; (2) the main ones are lysine, arginine, histidine; (3) non-polar - alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar ones - glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. For example, it is predictable that a single substitution of leucine for isoleucine or valine, aspartic acid for glutamic acid, threonine for serine, or a similar conservative substitution of an amino acid for a structurally related amino acid, will not have an important effect on biological activity. For example, a polypeptide of interest may contain up to about 5-10 conservative or non-conservative amino acid substitutions, or even up to about 15-25 or 50 conservative or non-conservative amino acid substitutions, or any number between 5 and 50, provided that the desired function of the molecule remains intact.

"Homology" refers to the percent identity between two polynucleotides or two polypeptide molecules. Two DNA or two polypeptide sequences are "substantially homologous" to each other if the sequences show at least about 50%, preferably at least about 75%, more preferably at least about 80%-85% , preferably at least about 90%, and most preferably at least about 95%-98% sequence identity over the entire defined molecular length. As used herein, the term "substantially homologous" also refers to a sequence showing complete identity with a particular DNA or polypeptide sequence.

In general, "identity" refers to the exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotide or polypeptide sequences, respectively. Percent identity can be determined by directly comparing the sequence information between two molecules by matching the sequences, counting the exact number of matches between the two matched sequences, dividing the number by the length of the shorter sequence, and multiplying the result by 100. Readily available computer programs such as as ALIGN, Dayhoff, MO in Atlas of Protein Sequence and Structure MO Dayhoff ed., 5 Suppl. 3 :353-358, National Biomedical Research Foundation, Washington, DC, which adapts the local homology algorithm from Smith and Waterman Advances in Appl. Math. 2 :482-489, 1981 for peptide analysis. Nucleotide sequence identity programs are available from the Wisconsin Sequence Analysis Package, Version 8 (available from Genetics Computer Group, Madison, WI), such as BESTFIT, FASTA, and GAP, which also rely on the Smith and Waterman algorithm. These programs are easy to use with the default settings recommended by the manufacturer and described in the above Wisconsin Sequence Analysis Package. For example, the percent identity of a particular nucleotide sequence to a reference sequence can be determined using the Smith and Waterman homology algorithm with a default scoring table and a penalty for missing six nucleotide positions.

Another way to estimate percent identity in the context of the present invention is to use the MPSRCH software package, copyrighted by the University of Edinburgh, developed by John F. Collins and Shane S. Sturrok and distributed by IntelliGenetics, Inc. (Mountain View, CA). From this set of packages, the Smith-Waterman algorithm can be used, where default parameters are used for the scoring table (eg, gap creation penalty of 12 nucleotides, gap extension penalty of one, and gap of six). From the generated data, the "Match" value reflects "sequence identity". Other suitable programs for calculating percent identity or similarity between sequences are generally known in the art, for example another alignment program is BLAST used with default parameters. For example, BLASTN and BLASTP can be used with the following default settings: genetic code = standard; filter = missing; chain = both; threshold = 60; expected = 10; matrix=BLOSUM62; descriptions = 50 sequences; sort by = highest rating; databases = not reserved, GenBank + EMBL + DDBJ + PDB + GenBank CDS translations + Swiss protein + Spupdate + PIR. The details of these programs are well known in the art.

Alternatively, homology can be determined by hybridizing polynucleotides under conditions that form stable duplexes between the homologous regions, followed by digestion with single-stranded DNA specific nuclease/nucleases and sizing the cleaved fragments. DNA sequences that are substantially homologous can be detected in Southern hybridization experiments, for example, under the stringent conditions specified for that particular system. Determination of suitable hybridization conditions is known to those skilled in the art. See, for example, Sambrook et al., supra; DNA Cloning, above; Nucleic Acid Hybridization, supra.

By "degenerate variant" is meant a polynucleotide containing substitutions in its nucleic acid sequence encoding a polypeptide with the same amino acid sequence as the polypeptide encoding the polynucleotide from which the degenerate variant is derived.

A "coding sequence" or a sequence that "encodes" a selected polypeptide is a nucleic acid molecule that is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by the start codon at the 5'- (amino) end and the translational stop codon at the 3'- (carboxy) end. The transcription termination sequence may be located 3' to the coding sequence.

By "vector" is meant any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, virus, virion, etc., which is capable of replication when associated with appropriate control elements and which can transfer gene sequences into cells . The term thus includes cloning and expression vehicles as well as viral vectors.

By "recombinant vector" is meant a vector which contains a heterologous nucleic acid sequence capable of in vivo expression.

By "recombinant virus" is meant a virus that has been genetically modified, for example by adding or inserting a heterologous nucleic acid construct into a particle.

The term "transgene" refers to a polynucleotide that is introduced into a cell and that is capable of being transcribed into RNA and optionally translated and/or expressed under suitable conditions. In one aspect, it confers a desired property on the cell into which it has been introduced, or otherwise results in a desired therapeutic or diagnostic outcome.

The terms "genomic particles (gp)" and "genome equivalents" when used in relation to viral titer refer to the number of virions containing the DNA of the recombinant AAV genome, regardless of infectivity or functionality. The number of genomic particles in a particular vector preparation can be measured by methods known in the art, such as those described, for example, in Clark et al., Hum. Gene Ther. (1999) 10 :1031-1039; and Veldwijk et al., Mol. Ther. (2002) 6 :272-278.

The terms "infection unit (iu)", "infectious particle" or "replication unit", when used in relation to viral titer, refer to the number of infectious particles of a recombinant AAV vector, measured by the infected foci assay, also known as the replication foci assay, as described, for example , in McLaughlin et al., J. Virol. (1988) 62 :1963-1973.

The term "transduction unit (tu)" when used in relation to viral titer refers to the number of infectious particles of the recombinant cAAV vector that result in the production of a functional transgene product as measured by functional assays such as those described, for example, by Xiao et al. ,Exp. neurobiol. (1997) 144 :1 13-124; or in Fisher et al., J. Virol. (1996) 70 :520-532 (LFU analysis).

The term "transfection" is used to refer to the uptake of foreign DNA by a cell, and a cell is "transfected" when the exogenous DNA is introduced into the cell membrane. A number of transfection methods are generally known in the art. See, for example, Graham et al. (1973) Virology, 52 :456, Sambrook et al. (1989) Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York, Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier, and Chu et al. (1981) Gene 13 :197. Such methods can be used to introduce one or more exogenous DNA molecules into suitable host cells.

The term "heterologous" in relation to nucleic acid sequences, such as coding sequences and control sequences, means sequences that are not normally linked together and/or that are not normally associated with a particular cell. Thus, a "heterologous" region of a nucleic acid construct or vector is a segment of a nucleic acid contained within or attached to another nucleic acid molecule that is not found to naturally associate with another molecule. For example, a heterologous region of a nucleic acid construct could contain a coding sequence flanked by sequences that do not naturally occur in association with the coding sequence. Another example of a heterologous coding sequence is a construct where the coding sequence itself is not found in nature (eg, synthetic sequences with codons other than the native gene). Likewise, a cell transformed with a construct that is not normally present in the cell could be considered heterologous for the purposes of the present invention. Allelic variation or naturally occurring mutational events do not result in the heterologous DNA used herein.

A "nucleic acid" sequence refers to a DNA or RNA sequence. The term includes sequences that contain any of the known base analogs of DNA and RNA, such as 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxyl-methyl)uracil, 5-fluorouracil, as non-limiting examples. , 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine , 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxy-amino-methyl-2-thiouracil, beta-D-mannosylqueosine, 5'- methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-hydroxyacetic acid methyl ester, uracil-5-hydroxyacetic acid, oxybutoxosine, pseudouracil, queosin, 2-thiocytosine, 5-methyl-2-thiouracil, 2- thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-hydroxyacetic acid methyl ester, uracil-5-hydroxyacetic acid, pseudouracil, queosine, 2-thiocytosine and 2,6-diaminopurine.

The term DNA "control sequences" refers generically to promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome binding sites ("IRES"), enhancers, and the like, which together provide replication, transcription and translation of the coding sequence in the recipient cell. Not all of these control sequences must always be present, provided that the selected coding sequence is capable of replication, transcribing and translation in a suitable host cell.

The term "promoter" is used herein in its usual sense in relation to a nucleotide region containing a DNA regulatory sequence, where the regulatory sequence is derived from a gene, and is capable of binding to RNA polymerase and initiating transcription of the downstream (3' direction) coding sequence. Transcriptional promoters may include "inducible promoters" (where expression of a polynucleotide sequence operably linked to a promoter is induced by an analyte, cofactor, regulatory protein, etc.), "repressible promoters" (where expression of a polynucleotide sequence operably linked to a promoter is induced by an analyte , cofactor, regulatory protein, etc.) and "constitutive promoters".

"Operably linked" refers to rearrangement of elements where the components thus described are configured to perform their normal function. Thus, control sequences operably linked to a coding sequence are capable of influencing the expression of the coding sequence. Control sequences need not be contiguous with a coding sequence, provided they function to direct its expression. Thus, for example, intermediate untranslated but transcribed sequences may be present between the promoter sequence and the coding sequence, and the promoter sequence will still be considered "operably linked" to the coding sequence.

By "isolated" with respect to a protein or nucleotide sequence is meant that said molecule is present in the absence of substantially biological macromolecules of the same type. Thus, for example, "an isolated nucleic acid molecule that encodes for a particular polypeptide" refers to a nucleic acid molecule that is substantially free of other nucleic acid molecules that do not encode for said polypeptide; however, the molecule may contain some additional bases or groups that do not adversely affect the essential characteristics of the composition.

For the purpose of describing the relative positions of nucleotide sequences in a particular nucleic acid molecule throughout this application, in cases where a particular nucleotide sequence is described as being "above" or "below" the "3-bar (3')" or "5-bar (5')" relative to another sequence is to be understood as the position of the sequences in the "sense" or "coding" strand of the DNA molecule, which is designated as conventional in the art.

The term "approximately", in particular in relation to a given amount, means that the amount includes deviations of plus or minus five percent.

2. METHODS FOR CARRYING OUT THE INVENTION

Before describing the present invention in detail, it should be understood that this invention is not limited to particular formulations or process parameters, as these may, of course, vary. It should also be understood that the terminology used herein is only intended to describe specific embodiments of the invention and is non-limiting.

While a number of methods and materials similar or equivalent to those described herein may be used in the practice of the present invention, the preferred materials and methods are those described herein.

Central to the present invention is the discovery that auryl tricarboxylic acid (ATA) at micromolar concentrations increases the yield of the HSV-1 vector. This fact is important both for the large-scale production of HSV and for the development of the rHSV and rAAV vectors. In addition, surprisingly, as demonstrated in the examples, the presence of ATK in rHSV-1 effluents does not adversely affect rAAV yield. This result is unexpected since ATK at millimolar levels and at higher concentrations is known to be an antiviral agent (Cushman et al., J. Med. Chem. (1991) 34 :329-337; Zhang et al., Antiviral Res. (1999) 43 :23-35; Yap et al., Computational Biol. and Chem. (2005) 29 :212-219; De Clercq, Advents, Advances, and Adventures Med. Res. Rev. (2011) 31 :118 -160).

As mentioned above, researchers have reported antiviral activity of nitric oxide (NO) against certain viruses such as vaccinia virus, vesicular stomatitis virus, and Japanese encephalitis virus, among others (Bi et al., J. Virol. (1995) 69 :6466 -6472; Harris et al., J. Virol. (1995) 69 :910-915; Lin et al., 1997; Pertile et al., Avian Dis. (1996) 40 :342-348). NO is a free radical gaseous molecule and is an immune system mediator (Croen KD, J. Clin. Invest. (1993) 91 :2446-2452; Karupiah et al., Science (1993) 261 :145-1448; Rolph et al., Virol (1996) 217 :470-477; Amaro et al., J. Med. Virol. (1997) 51 :326-331; Lane et al., J. Virol. (1997) 71 :2202-2210). HSV infection is capable of inducing the expression of iNOS, a gene encoding an inducible isoform of NOS that produces large amounts of NO.

As shown herein, ATK suppresses the HSV-induced increase in iNOS expression and thus increases HSV titers. Additional iNOS inhibitors, including dexamethasone and valproic acid, also have the same effect. In one embodiment, the use of such iNOS inhibitors increases the titers of recombinant herpesvirus in culture, allowing the production of significantly more virus than is produced in the absence of the particular inhibitor. Viruses produced by the method can be used for a variety of purposes, including for prophylactic, therapeutic and diagnostic purposes, as well as for the production of a sufficient number of recombinant constructs for use in obtaining recombinant virions for gene delivery and gene therapy.

Aurintricarboxylic acid (ATA), 5-((3-carboxy-4-hydroxyphenyl)(3-carboxy-4-oxo-2,5-cyclohexadien-1-ylidene)methyl)-2-hydroxybenzoic acid, is a heterogeneous mixture of non-sulfated negatively charged aromatic polymers that form when salicylic acid is treated with formaldehyde, sulfuric acid, and sodium nitrite (see Cushman, et al., (1991) J. Med. Chem. 34 :329-337; Cushman, et al., J. Med Chem 34 :337-342). Aurintricarboxylic acid has the formula:

A heterogeneous mixture of ATK has been described to inhibit protein-nucleic acid interactions (Gonzalezet al., Biochim. Biophys. Acta, (1979) 562 :534-545); interacts with steroid receptors at the level of uptake and binding to the nucleus (Mellon, WS, Biochem. Pharmacol. (1984) 33 :1047-1057; Moudgilet al., J. Steroid Biochem. (1985) 23 :125-132); inhibits DNA polymerase (Nakaneet al., Eur. J. Biochem. (1988) 177 :91-96); and acts as an RNase inhibitor (Skidmore et al., Biochem. J. (1989) 263 :73-80).

For addition to the virus in culture, ATK can be used in acid form or in the form of a salt, such as trisodium salt of auryl tricarboxylic acid, calcium salt, ammonium salt, etc.

Additional agents that will find use in the present methods include dexamethasone (Dex) and valproic acid (VA). Dex has been shown to inhibit iNOS expression in rat mesangial cells at transcriptional and post-transcriptional levels (Kunz et al., Biochem. J. (1994) 304 :337-340; Kunz et al., Proc. Natl. Acad. Sci. USA (1996) 93 :255-259). Dex has also been shown to promote oriL HSV-1 DNA replication in PC12 cells. Sodium valproate, the sodium salt of VA, has been shown to stimulate the replication of HSV-1, human cytomegalovirus, HIF-1, human herpesvirus-8, measles virus, and poliovirus type 1 (Motamedifar et al., Iran. J. Med. Sci. (2006) 31 :28-32 Kuntz-Simon et al., J. Gen. Virol (1995) 76 :1409-1415 Moog et al., J. Gen. Virol (1996) 77 :1993-1999 Ylisastigui et al., AIDS (2004) 18 :1101-1108; Shaw et al., AIDS (2000) 14 :899-902; Kabiri et al. Iran J. Med. Sci. (2001) 26 :55-61). In addition, valproic acid has been shown to inhibit iNOS (Guo et al. Surgery (2007) 142 :156-162). As with ATK, VA, or salts thereof, such as sodium, calcium, ammonium salts, and the like, can be used in the present methods.

Although the use of ATK, Dex, and BK to generate higher titers of rHSV-1 vectors is given as an example herein, these iNOS inhibitors can be used to increase the titer of a variety of viruses in culture, such as, but not limited to, those of the Adenoviridae family. , Picornaviridae (eg polioviruses, etc.); Caliciviridae ; Togaviridae (eg rubella virus, dengue fever virus, etc.); Flaviviridae ; Coronaviridae ; Reoviridae ; Birnaviridae ; Rhabodoviridae (eg rabies virus, etc.); Poxviridae ; filoviridae ; Paramyxoviridae (eg, mumps virus, measles virus, respiratory syncytial virus, etc.); Orthomyxoviridae (eg, influenza virus types A, B and C, etc.); Bunyaviridae ; arenaviridae ; various hepatitis viruses such as HAV, HBV and HCV; papillomaviruses and rotaviruses; retroviruses; etc. See, for example, Virology, 3rd Edition (WK Joklik ed. 1988); Fundamental Virology, 2nd Edition (BN Fields and DM Knipe, eds. 1991), for a description of these and other viruses. These viruses, or immunogens derived from them, can be used for vaccine production and diagnostics. In addition, some of these viruses, and in particular herpesviruses, can be used to generate recombinant vectors for the production of recombinant virions for use in the gene delivery methods described below.

Thus, ATK, Dex and BK can be used to increase the yield of any of the herpesviruses that are members of the herpesviridae family. Among others, it includes equine herpes virus, bovine herpes virus (BHV) and human herpes simplex virus (HSV) types 1 and 2 such as BHV-1, BHV-2, HSV-1 and HSV-2, varicella zoster virus (VZV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), HHV6 and HHV7. Herpesviruses can be obtained from any of a variety of strains. For example, if an HSV virus is produced using the invention, the virus can be obtained from, for example, HSV-1 or HSV-2, and can be from any of the various strains of HSV, such as HSV-1 strain KOS, HSV-1 strain McIntyre, HSV- 1 strain Patton, HSV-2 strain 333, HSV-2 strain G, etc. In addition, the resulting viruses can be wild-type viruses or their derivatives, including recombinant viruses, and intertype recombinants containing DNA from HSV-1 and HSV-2. The derivatives preferably have at least 70% sequence homology with or parts of the HSV-1 or HSV-2 genomes, more preferably at least 80%, even more preferably at least 90 or 95%. The derivative may have the HSV-1 or HSV-2 genome sequence modified with nucleotide substitutions, for example, from 1, 2 or 3 to 10, 25, 50 or 100 substitutions. The HSV-1 or HSV-2 genome may alternatively or additionally be modified with one or more insertions and/or deletions and/or with an extension at one or both ends.

Other derivatives include strains that already have mutations in genes, in particular mutations in genes that result in weakening of the virus. Examples of such viruses include strain 1716 (MacLean et al., J. Gen. Virol. (1991) 72 :632-639), strains R3616 and R4009 (Chou and Roizman, Proc. Natl. Acad. Sci USA (1992) 89 : 3266-3270) and R930 (Chou et al., J. Virol. (1994) 68 :8304-8311) which all have mutations in ICP34.5, strain d120 which has a deletion in ICP4 (DeLuca et al., J Virol (1985) 56 :558-570), strain d27-1 (Rice and Knipe, J. Virol. (1990) 64 :1704-1715) which has a deletion in ICP27), or strain d92 which has a deletion in ICP27 and ICP4 (Samaniego et al., J. Virol. (1995) 69 :5705-5715). The terminology used to describe the various HSV genes can be found, for example, in Coffin and Latchman (1996), In: Genetic Manipulation of Nervous System (DS Latchman Ed.) pp 99-114: Academic Press, London.

Obviously, any rHSV suitable for its intended purpose can be used in the invention. In certain embodiments, the implementation of rHSV, which is used according to the invention, is deficient in replication. For the production of rAAV virions, infection of producer cells with rHSV that is incapable of replication is preferred because, unlike methods involving the use of adenovirus, rHSV does not become a significant contaminant of the rAAV product. This may serve to increase the final yield of rAAV virions by removing the purification steps associated with the removal of adenovirus. In a particular embodiment, rHSV is constructed from an HSV-1 mutant in which the replication failure is caused by a deletion in the ICP27 gene. Any other suitable HSV mutants exhibiting a replication deficient phenotype can also be used for the rHSV construct.

One particularly preferred recombinant HSV-1 mutant strain for the production of rAAV using the present methods is HSV-1 strain d27-1. This strain can be obtained as described, for example, in Conway et al., Gene Ther. (1999) 6 :973,985 and US Pat. No. 7,091,029, incorporated herein by reference in its entirety. As described above, this mutant vector does not produce ICP27 and is predominantly used for the production of rAAV virions because mRNA splicing in the host cell is known to be inhibited by ICP27. ICP27 may also affect the corresponding splicing of rep and cap AAV-2 mRNA. This vector is replication deficient and exhibits reduced cytotoxicity compared to wild-type HSV-1 (wt). The d27-1 virus exhibits several other characteristics that are favorable for use as a helper virus for the production of rAAV virions. First, it expresses early genes known to be required for rAAV production (Weindler et al., J. Virol. (1991) 65 :2476-2483). In addition, d27.1 has overexpression of ICP8, a single-stranded DNA binding protein that is a product of UL29, one of the HSV-1 genes required for AAV replication and packaging (Weindler et al., J. Virol. (1991) 65 :2476-2483).

The AAV genome is a linear single stranded DNA molecule containing approximately 4681 nucleotides. The AAV genome typically contains an internal repeat-free genome flanked at each end by inverted terminal repeats (ITRs). The ITR is approximately 145 base pairs (bp) long. ITRs have many functions, including providing origins of DNA replication and a packaging signal for the viral genome. The interior of the repeatless genome contains two large open reading frames known as the AAV replication (rep) and capsid (cap) genes. The rep and cap genes code for viral proteins that allow the virus to replicate and package into a virion. In particular, a family of at least four viral proteins, Rep 78, Rep 68, Rep 52 and Rep 40, is expressed from the rep region of AAV, named according to their apparent molecular weight. The cap region of AAV encodes at least three proteins, VPI, VP2, and VP3.

By "rep AAV coding region" is meant the locally accepted region of the AAV genome that encodes the Rep 78, Rep 68, Rep 52 and Rep 40 replication proteins. break at the origin of AAV DNA replication, DNA helicase activity, and modulation of transcription from AAV (or other heterologous) promoters. Rep expression products are collectively required for the replication of the AAV genome. For a description of the rep AAV coding region, see, for example, Muzyczka, N. (1992) Current Topics in Microbiol, and Immunol. 158 :97-129: and Kotin, RM (1994) Human Genotherapy 5:793-S0. Suitable homologues of the AAV rep coding region include the human herpesvirus 6 (HHV-6) rep gene, which is also known to mediate AAV-2 DNA replication (Thomson et al. (1994) Virology 204 :304-311).

By "AAV cap coding region" is meant the art-recognized region of the AAV genome that encodes the VP1, VP2, and VP3 capsid proteins, or their functional homologues. These Cap expression products provide the packaging functions that are collectively required for the packaging of the viral genome. For a description of the cap AAV coding region, see, for example, Muzyczka, N. and Kotin, R.M. (higher).

Typically, two rHSV vectors will be used to generate rAAV virions. One is an rHSV helper function vector in which the AAV rep and/or cap genes are introduced into the rHSV genome. The other is an rHSV expression vector in which ITR sequences from AAV have been introduced into the rHSV genome and flank the gene of interest.

Thus, in one embodiment, an iNOS inhibitor can be used to increase the yield of a first rHSV vector that contains the AAV rep and/or cap genes. Embodiments of the first rHSV vector according to the method include, as non-limiting examples, genetic constructs based on the cap gene found in various AAV serotypes, including AAV-1, AAV-2, AAV-3, AAV-4, AAV-5 and AAV-6, AAV-7 and AAV-8, goat and bovine AAV (see, for example, US Publication No. 20080292595, incorporated herein by reference in its entirety), and variants thereof. Also within the scope of the invention are the rep and cap genes from new AAV serotypes, and the rep and cap genes modified by recombination or mutation of existing serotypes. The helper function AAV vector rep and cap genes can be derived from any known AAV serotypes as described above. For example, an rHSV vector with a helper function may have a rep gene derived from AAV-2 and a cap gene derived from AAV-6; one skilled in the art will appreciate that other combinations of the rep and cap genes are possible, the defining feature being the ability to support the production of rAAV virions.

In certain embodiments, the AAV rep and cap genes in a helper-function rHSV vector may be under the control of their native promoters. The p5 and p19 AAV-2 promoters control the expression of Rep 78 and 68 and Rep 52 and 40, respectively. The p40 promoter controls the expression of VP1, VP2 and VP3. In addition, heterologous promoters can be used to drive the expression of AAV genes. Examples of other promoters that can be used in the methods described include, but are not limited to, the SV40 early promoter, the CMV promoter, the HSV-1 thymidine kinase (HSV-1 tk) promoter, the inducible metallothionein promoter, the mouse mammary tumor virus promoter, and the chicken β-actin promoter. .

The genetic construct can be inserted at any site or sites in the HSV genome suitable for integration of the rep and cap genes. In certain embodiments, the vector is constructed by homologous recombination of the AAV rep and cap genes into the rHSV-1 thymidine kinase (tk) locus as described in Conway et al., Gene Ther. (1999) 6 :986-993 and US Pat. No. 7,091,029, incorporated herein by reference in their entirety.

As described herein, a helper-function rHSV vector encodes "helper-function AAV" sequences (ie, rep and cap) that function in trans for productive AAV replication and capsid packaging. Preferably, the helper function rHSV vector supports efficient production of rAAV virions without generating any detectable wild-type AAV virions (ie, AAV virions containing functional rep and cap genes). An example of such a vector is rHSV-1 d27.1 rc . The vector and methods for its production are described in the examples herein, as well as in Conway et al., Gene Ther. (1999) 6 :986-993; and US Pat. No. 7,091,029, incorporated herein by reference in their entirety.

The second rHSV vector is referred to as the rHSV expression vector and contains the AAV ITR with one or more genes of interest under the control of one or more promoters. In some embodiments, the gene of interest is inserted between a pair of ITRs. A heterologous gene is typically operably linked to a heterologous promoter (constitutive, cell-specific, or inducible) capable of directing gene expression in target cells of a patient under appropriate conditions. Termination signals such as polyadenylation sites may also be included.

The nucleotide sequences of the AAV ITR regions are known. See, for example, Kotin, RM (1994) Human Genotherapy 5 :793-801; Berns, KI "Parvoviridae and their Replication" in Fundamental Virology, 2nd Edition, (BN Fields and DM Knipe, eds.) for the AAV-2 sequence. The AAV ITRs used in the vectors of the invention do not need to have a wild-type nucleotide sequence, and this can be changed, for example, by insertion, deletion or substitution of nucleotides. In addition, AAV ITRs can be derived from any of several AAV serotypes, including, but not limited to, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, and AAV. -8, goat and bovine AAV (see, for example, US Publication No. 20080292595, incorporated herein by reference in its entirety), and variants thereof. In addition, the 5'- and 3'-ITRs that flank the selected nucleotide sequence in the expression vector need not be identical or derived from the same AAV serotype or isolate, provided they function properly, i.e., allow excision and extract sequences of interest from the genome of the host cell or vector, and introduce the DNA molecule into the genome of the recipient cell when AAV rep gene products are present in the cell.

AAV ITRs can be excised from the viral genome or from an AAV vector containing them and fused to the 5' and 3' ends of the selected nucleic acid construct using standard ligation techniques such as those described in Sambrook et al., supra. For example, ligation can be performed in 20 mM Tris-Cl pH 7.5, 10 mM MgCl ₂ , 10 mM DTT, 33 μg/ml BSA, 10 mM-50 mM NaCl, and either 40 μM ATP, 0.01- 0.02 (Weiss) T4 units of DNA ligase at 0°C (for sticky-end ligation) or with 1 mM ATP, 0.3-0.6 (Weiss) T4 units of DNA ligase at 14°C ( for ligation with "blunt ends"). Intermolecular ligation with "sticky ends", as a rule, is carried out at a total concentration of DNA 30-100 μg/ml (5-100 nm total concentration of ends). AAV vectors that contain ITRs have been described, for example, in US patent no. 5139941. In particular, some of the AAV vectors described in that patent are available from the American Type Culture Collection ("ATCC") under accession numbers 53222, 53223, 53224, 53225, and 53226.

The selected polynucleotide sequence is operably linked to control elements that direct its transcription or expression in the cells in question. Such control elements may include control sequences normally associated with the selected gene. Alternatively, heterologous control sequences may be used. Suitable heterologous control sequences generally include those derived from viral or mammalian coding sequences. Non-limiting examples include, neuron-specific enolase promoter, GFAP promoter, SV40 early promoter, mouse mammary tumor virus LTR promoter; adenovirus major late promoter (Ad MLP); herpes simplex virus (HSV) promoter, cytomegalovirus (CMV) promoter such as the CMV immediate early promoter region (CMVIE), rous sarcoma virus (RSV) promoter, synthetic promoters, hybrid promoters, and the like. In addition, sequences derived from non-viral genes, such as the mouse metallothionein gene, will also find use herein. Such promoter sequences are commercially available from, for example, StrATKgene (San Diego, CA), Invivogen (San Diego, CA) and others.

The gene of interest may be a gene that appears to be of therapeutic value. Non-limiting examples of therapeutic genes include α-1 antitrypsin, Factor VIII, Factor IX, GAA, erythropoietin, and PEDF. If it is necessary to select or detect successful transexpression of a gene, the gene of interest may be a reporter gene. There are many examples of genes that are used as reporter or for selection and which can be used in the invention. These genes include, as non-limiting examples, genes encoding β-galactosidase, neomycin, phosphorotransferase, chloramphenicol acetyltransferase, thymidine kinase, luciferase, beta-glucuronidase, aminoglycoside, phosphotransferase, hygromycin B, xanthine-guanine phosphoribosyl, luciferase, DHFR/meth otrexate, and green fluorescent protein (GFP).

Expression virus rHSV-1 can be obtained in much the same way as described above, namely, by homologous recombination into the tk gene of HSV-1, as described, for example, in Conway et al., Gene Ther. (1999) 6 :986-993 and US Pat. No. 7,091,029, incorporated herein by reference in its entirety.

Once generated, rHSV vectors, or any other virus of interest, are grown in culture in an appropriate cell line. For herpesviruses, such cell lines include, but are not limited to, Vero cells, 293 cells, HeLa cells, and the like, available from the American Type Culture Collection, Rockville, Md. If an HSV-1 d27.1 vector is used, the virus is typically cultured in an ICP27-supplemented V27 cell line (Rice et al., J. Virol. (1990) 64 : 1704-1715). Any suitable viral media discussed herein, with or without serum, such as fetal calf serum, such as, but not limited to, RPMI 1640, Dulbecco's Modified Eagle's Medium (DMEM), F12 medium, or a mixture of the latter (DF medium) may be used. ). If serum is present, the culture may contain, for example, 2% to 20% serum, more, typically 5% to 15% serum, 7% to 12% serum, or any number within these ranges, such as 5 %, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, etc. In addition, if serum is used, it may be present in the original culture and/or in the subsequent fresh medium that is added to the cultures.

The amount of iNOS inhibitor that is added in the method of the invention may vary and is a specific amount depending on the particular inhibitor used, the medium used and the virus being cultured. For example, if herpesviruses are cultured in Vero cells, the concentration of ATK in the initial culture, if ATK is present, will typically be 5 µM to 500 µM, preferably 10 µM to 250 µM, such as 20 µM to 100 µM, t .e., from 30 µM to 75 µM, such as 30..35..40..45..50..55..60..65..70..75, etc. or any integer within those specified ranges. Similarly, the concentration of dexamethasone, if present, in the initial culture will generally be from 1 µM to 500 µM, preferably from 5 µM to 250 µM, such as from 1 µM to 100 µM, i.e., from 5 µM up to 75 µM, such as 1..5..15..10.. 20..25..30..35..40..45..50..55..60..65..70. .75, etc. or any integer within those specified ranges. If valproic acid is used, the initial concentration will be from 1 mM to 500 mM, preferably from 5 mM to 250 mM, such as from 1 mM to 100 mM, i.e., from 5 mM to 75 mM, such as 1.. 5..15..10..20..25..30..35..40..45..50..55..60..65..70..75, etc. or any integer within those specified ranges.

In certain embodiments, virus-infected cells are initially cultured in the medium described above for 0.5 hours to 24 hours, 0.75 hours to 12 hours, 1 hour to 5 hours, 1 hour to 2 hours, or any number hours or fractions thereof within these ranges. The iNOS inhibitor and/or serum may or may not be present in the original culture. Fresh medium is then added and the cultures are incubated for 24 to 120 hours, 48 to 96 hours, 50 to 80 hours, 60 to 75 hours, 70 to 74 hours, or any number of hours or fractions thereof within these ranges. The iNOS inhibitor and/or serum may or may not be present in the subsequent culture, provided that the iNOS inhibitor is present in either or both of the initial culture and the subsequent culture.

In some embodiments, the iNOS inhibitor is present in the initial culture at a higher concentration than in the subsequent culture. Thus, for example, if the iNOS inhibitor is ATK, it may be present in an amount of 30 to 75 μM in the initial culture and then 5 to 25 μM in the subsequent culture. Alternatively, the inhibitor may be present only in the original or subsequent culture.

As shown in the examples below, one particularly preferred method using ATK involves the presence of 50 μm ATK in the original culture, with a decrease in the amount of ATK in the subsequent culture to 20 μm. In addition, in the case of ATK, it is preferable to include serum simultaneously with the presence of ATK. Thus, if ATK is added to the original culture, it is useful to add fetal calf serum (FBS) to the medium. Similarly, if ATK is added to a subsequent culture, the addition of ETS is necessary to obtain higher virus yields.

The viruses are then cultured to obtain the desired virus titer. For example, in the case of the HSV-1 d27-1 vectors described herein, ATK increases d27-l yields in V27 cell supernatants by 3-5 times and titers can be at least 1 x 10 ⁸ PFU/mL or 4 x 10 ⁸ DRP/ml. Similarly, ATK also increases yields of wild-type (wt) HSV-1 strains McIntyre and KOS by 1 log, and 293 or Vero titers can rise up to 1 x 10 ⁹ DRP/mL. The viruses are then harvested for further use.

For the purposes of the invention, suitable host cells for the production of rAAV virions include microorganisms, yeast cells, insect cells, and mammalian cells that are used or can be used as recipients of a heterologous DNA molecule and that are capable of growth, for example, in suspension culture, flasks , plates, bioreactor or the like. The term includes the progeny of the original cell that has been transfected. Thus, "host cell" as used herein generally refers to a cell that has been transduced with an exogenous DNA sequence. If recombinant herpesviruses for use in the production of rAAV virions are produced in one cell type, the assembled vectors are then transfected into another suitable host cell. 293 cells derived from a stable human cell line (readily available, for example, from the American Type Culture Collection under accession number ATCC CRL1573) are the preferred host cells for the production of rAAV virions. In particular, the human 293 cell line is a human embryonic kidney cell line that has been transformed with adenovirus type 5 DNA fragments (Graham et al. (1977) J. Gen. Virol. 36:59 ) and expresses the adenoviral genes E1a and E1b ( Aiello et al (1979) Virology 94 :460). The 293 cell line is easily transfected and provides a particularly suitable platform for the production of rAAV virions.

AAV helper functions are introduced into the host cell by transducing the host cell with a helper function rHSV construct, either prior to or simultaneously with the use of the rHSV expression vector. Thus, rHSV helper constructs are used to provide at least transient expression of the AAV rep and/or cap genes to replace lost AAV functions that are required for productive AAV infection. AAV helper constructs lack AAV ITRs and cannot self-replicate or package.

After recombinant AAV replication, rAAV virions can be purified from the host cell using a variety of conventional purification methods such as column chromatography, CsCl gradients, and the like. For example, multi-step column purifications such as an anion exchange column, an affinity column, and/or a cation exchange column may be used. See, for example, International Publication WO 02/12455.

The resulting rAAV virions, which contain the nucleotide sequence of interest, can then be used to deliver genes using methods well known in the art and described, for example, in US patent Nos. 5173414 and 5139941; international publications WO 92/01070 (published January 23, 1992) and WO 93/03769 (published March 4, 1993); Lebkowski et al., Molec. cell. Biol. (1988) 8 :3988-3996; Vincent et al., Vaccines 90 (1990) (Cold Spring Harbor Laboratory Press); Carter, BJ Current Opinion in Biotechnology (1992) 3 :533-539; Muzyczka, N. Current Topics in Microbiol. and Immunol. (1992) 158 :97-129; Kotin, RM Human Gene Therapy (1994) 5 :793-801; Shelling and Smith, Gene Therapy (1994) 1 :165-169; and Zhou et al., J. Exp. Med. (1994) 179 :1867-1875.

2. EXPERIMENTAL

The following are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only and are not intended to limit the scope of the present invention in any way.

Efforts have been made to ensure accuracy with respect to the numbers used (eg amounts, temperatures, etc.), but of course allowance must be made for some experimental errors and deviations.

Materials and Methods

Cells

Vero-derived V27 cells (Rice et al., J. Virol. (1989) 63 :3399-3407) and 293 cells derived from human embryonic kidney (HEK) cells (Graham et al., J. Gen. Virol. (1977) ) 36 :59-74) were obtained from Applied Genetic Technologies Corporation (AGTC, Alachua, FL), Vero and HeLa cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA). All cells were maintained in Dulbecco's Modified Eagle's Medium (DMEM; HyClone, South Logan, UT) containing 10% fetal calf serum (FES; HyClone) and either geneticin (50 mg/mL; Invitrogen) for V27 cells or 1% penicillin/streptomycin (Cellgro Mediatech, Manassas, VA) for other cells.

Production of HSV-1

Wild-type KOS HSV-1 strain and ICP27-deficient derivatives of wild-type KOS HSV-1 strain: vectors d27-1 (Rice and Knipe, J. Virol. (1990) 64 : 1 04-1715), rHSV-rep2/cap2 and rHSV-EGFP (Kang et al. Gene Ther. (2009) 16 :229-239) and their ICP27-supplemented V27 cell line were obtained from AGTC (Alachua, FL). Maclntyre HSV-1 wild type strain purchased from Advanced Biotechnologies Inc. (ABI, Columbia MD) and wild-type strain KOS HSV-1 (wtHSV-1 KOS) were grown in Vero, 293 or HeLa cell lines. Collected infectious vector particles 72 hours after infection by extracting the culture supernatant. HSV-1 effluent titers in DNase resistant particles/mL (DRP/mL) were determined by Taqman assay. Viral genomes in crude culture medium were quantified by treatment in the presence of DNase I (50 U/mL final concentration; Promega) at 37°C for 60 min, followed by digestion with Proteinase K (Invitrogen) (1 U/mL) at 50 °C for 60 min, followed by denaturation at 95°C for 30 min.

Linearized plasmid pZero 195 UL36 (obtained from AGTC, Inc., Alachua, FL) was used to generate standard curves. The following primer probe set was specific for the UL36 sequence of the vector genome (HSV-UL36 F: 5'- GTTGGTTATGGGGGAGTGTGG (SEQ ID NO: 1); HSV-UL36 R: 5'-TCCTTGTCTGGGGTGTCTTCG (SEQ ID NO: 2); HSV-UL36 Probe: 5'-6FAM-CGACGAAGACTCCGACGCCACCTC-TAMRA (SEQ ID NO:3) Amplification of the PCR product was performed with the following cycle parameters: 1 cycle at 50°C for 2 min, 1 cycle at 95°C for 10 min; 40 cycles with 95°C for 15 sec, and 60°C for 60 sec.

Experiments with ATK

An ATA stock solution (Sigma-A1895 Auryntricarboxylic acid, practical purity >85% (titration), powder) was prepared as a concentration of 500 μM in an aqueous solution of 100 mM sodium bicarbonate. The stock ATK solution was then diluted in DMEM+/-10% fetal bovine serum (ETS, Hyclone, Waltham, MA) over a concentration range of 12-60 µM ATK (8.5-21 µg ATK/mL). Infection with HSV-1 was carried out with a multiplicity of infection of 0.15 (MOI=0.15) (typically 6×10 ⁵ cells in a 6-well plate) in 40% (2/5 volume) of the total final medium volume for 1 -2 hours and the remaining medium (60% or 3/5 of the total final volume) was added during the dilution step. The cells were then incubated for 72 hours and the supernatant was collected for analysis of plaque-forming units per milliliter (PFU/ml) and DRP/ml titer analysis.

Experiments with dexamethasone (Dex)

Dexamethasone (Sigma-D4902) was dissolved to 2 mg/ml in absolute alcohol. Then diluted with DMEM to obtain a concentration of 1M and stored at 20°C.

V27 cells were seeded in 6-well plates one day before infection at a concentration of 6×10 ⁵ cells/well. Added dexamethasone to obtain a concentration of 1 μm in the medium for seeding. Mix well and add to wells.

The medium was removed and HSV-1 d27-1 infection stock was added with an MOI of 0.15 (= cell seeding density × 0.15/pfu titer of HSV stock) per 1 ml of DMEM (no additives). 1 ml infectious inoculum per well was added. Incubated for 1-2 hours at 37°C, in a 5% CO ₂ incubator, after which 1.5 ml of DMEM-10% with FTS was added. The cultures were returned to the incubator for 70-74 hours.

Free medium was collected, vortexed, centrifuged at 1,100×g for 10 minutes at 4°C. The supernatant was transferred to a new dosage tube, vortexed, aliquoted and stock frozen at -80°C.

Experiments with valproic acid (VA)

Valproic acid (Sigma-P4543) was dissolved to a concentration of 1M in water. V27 cells were seeded in 6-well plates one day before infection at a concentration of 6×10 ⁵ cells/well. 1M valproic acid was added to 1 ml DMEM-10% with FTS to give a concentration of 5 μM. Well vortexed and added to the wells. Plates were incubated for six hours, medium was removed and HSV-1 d27-1 infection stock was added with an MOI of 0.15 (= cell seeding density × 0.15/PFU titer of HSV stock) per 1 ml DMEM (no additives).

Added 1 ml infectious inoculum per well and incubated for 1-2 hours at 37°C, incubator 5% CO ₂ then added 1.5 ml of DMEM-10% with FTS. The cultures were returned to the incubator for 70-74 hours. Free medium was collected, vortexed, centrifuged at 1,100×g for 10 minutes at 4°C. The supernatant was transferred to a new dosage tube, vortexed, aliquoted and stock frozen at -80°C.

rAAV production

293 cells (2.5×10 ⁶ ) were co-infected simultaneously with rHSV-rep2/cap2 and rHSV-EGFP vectors as described by Kang et al., Gene Ther (2009) 16 :229-239. 2-4 hours after infection, the infected medium was replaced with DMEM + 10% FTS, in a volume equivalent to twice the culture volume before infection. At the time of cell collection, the cell pellet was frozen at -80°C. DRP titers were quantified by real-time polymerase chain reaction (qPCR) in a 96-well block thermal cycler (Applied Biosystems; 7500 Real Time PCR system). The crude samples were subjected to three cycles of freeze-thaw, then incubated in the presence of Benzonase (250U/ml), 2 mm MgCl ₂ , Tween 80 (Calbiochem) with a final concentration of 1% and incubated at 37°C for 60 min, followed by digestion of 0 .25% Trypsin (Gibco) at 50°C for 60 min. Finally, treated with DNase I (50 U/ml; Promega) at 37°C for 30 min and then denatured at 95°C for 20 min. Linearized plasmid pDC67/+SV40 was used to generate standard curves. The following primer probe set was specific for the simian virus 40 (SV40) poly(A) sequence: rAAV-F: 5'-AGCAATKGCATCACAAATTTCACAA-3' (SEQ ID NO:4); rAAV-R: 5'-GCAGACATGAATKAGATKCATTGATGAGTT-3' (SEQ ID NO:5); rAAV probe: 5'-6-FAM-AGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTC-TAMRA-3' (SEQ ID NO:6). Amplification of the PCR product was carried out with the following cycle parameters: 1 cycle at 50°C for 2 min, 1 cycle at 95°C for 10 min; 40 cycles with 95°C for 15 sec, and 60°C for 60 sec.

Human Genome Array Analysis

Confluent 293 cells (2.4×10 ⁶ cells in a 75 cm ² flask) were cultured in DMEM+10% FBS for approximately 20 hours and then infected with one plaque forming unit per cell (PFU/cell) of Maclntyre HSV-1 strain for 90 minutes. 90 minutes after infection, ATK was added at a concentration of 20 μM (final). Infected cells were harvested 24 hours after infection. Total RNA was isolated from the suspension in suitable quantity and quality using the RNeasy Plus Mini Kit (QIAGEN, Valencia, CA) according to the manufacturer's instructions. Genome-wide expression profiling was performed on the Affymetrix Human U133 Plus 2.0 Array from Asuragen, Inc. 3 µg of total RNA was used as starting material.

In general, RNA quality assessed on the bioanalyzer had RI values >9. Hybridization analysis and scaling factors were in the range of passing quality control. After scanning, raw CEL expression files were processed using Affymetrix Expression Console vs.1.1.2 (affymetrix.com). Each CEL file was processed by Robust Multichip Analysis (RMA) and the summary table was exported as a text file. All subsequent genomic and statistical analyzes were done using JMP Genomics (version 5) (jmp.com/software/genomics). First, a filtering step was used to filter out low expression, specifically values below 6 in log ² mode, in at least 2 of 8 samples. Out of a total of 54,675 Affy U133 Plus2 probes, 41,569 (76%) probes remained after dropout. Also observed were two positive controls, human brain and pooled universal human reference RNA, respectively, which hybridized well. These two samples were excluded from further analysis.

Principal component analysis revealed two distinct populations, namely samples treated with and untreated with HSV. The recovery of the first major component (91.7%) is thus attributed to the influence of HSV compared to the control solvent. Data were normalized by the average of each sample to give a mean signal of 0. Analysis of variance (ANOVA) was performed to detect significantly different transcripts between HSV versus solvent control, ATK versus solvent control, HSV+AVA versus solvent control , and HSV+ATK compared to HSV alone. Corrections for multiple comparisons were not introduced, and genes were considered significant at p-values less than 0.01.

A self-organizing map was used to study expression patterns in vehicle control, HSV1, and HSV1+ATK. It would be desirable to find specific transcripts that are either activated or repressed by ATK treatment. A distinct cluster of genes was found that showed some stimulation in the presence of HSV, and ATK adjustment brought these genes back to baseline solvent control levels. Similarly, a cluster of genes was also found that were downregulated by HSV compared to the solvent control and then upregulated by ATK treatment. These clusters have been named Clusters A and B, respectively (see Tables 1 and 2). The analysis was completed by inquiring about the biological functions of these clusters using the GeneGO software (genego.com).

RT ² Profiler™ PCR Array (SABiosciences-QIAGEN)

6x10 ⁵ 293 cells (from AGTC) were challenged with McIntyre wtHSV-1 with MOI 1 in the presence of DMEM and 10% FTS with or without 50 μM ATK for 1-2 hours and diluted to 40% with DMEM and 10% ETS (final concentration of ATK 20 µm). Three samples of total RNA were collected after 24 hours using the Qiagen RNeasy mini kit, treated with DNase on a column and eluted. Triple samples of the RNA eluate were combined and the OD of the eluate was measured on a spectrophotometer at 260 and 280 nm to determine the concentration. The RNA sample was converted to template cDNA using the SABiosciences RT2 First Strand Kit. The cDNA was then used in a PCR analysis of the human JAK/STAT signal transduction pathway (PAHS-039A).

Example 1

Inhibition of HSV-Induced iNOS Levels on V27 Cells Using ATK

V27 cells in Dulbecco's Modified Eagle's Medium (DMEM) (Hyclone, Waltham, MA) were infected with HSV-1 d27.1 vector at MOI 1 and treated with 30 μM ATK (Sigma, St. Louis, MO), with or without 10% fetal calf serum (ETS). Control experiments without ATK were also carried out. V27 cell lysates were obtained 24 hours post-infection (h.p.i.), Western blots of the lysates were performed, and iNOS protein was detected using purified rabbit anti-iNOS/NOS type II antibody PAT (BD Biosciences, Cat. No. 610332). The results are shown in figure 1.

As shown, HSV infection caused the expression of iNOS in those cultures that did not contain ATK (lanes 4 and 5). iNOS expression was inhibited in the presence of 30 μM ATK (lines 2 and 3). The presence or absence of 10% ETS did not affect iNOS expression.

Example 2

ATK-HSV protocol optimization

In order to test whether ATK could increase the yield of the rHSV-1 d27-l (d27-1) vector in V27 cells, ATK was added to the medium during infection (Step 1) or dilution steps (Step 2) (Figure 2A). Infection with d27-l was performed at MOI=0.15 in 2/5 of the final volume of medium and the remaining 3/5 of medium was added during the dilution step.

ATK treatment retarded HSV-1 plaque formation or cell lysis in V27 cell monolayers. The cytopathic effect (CPE) at the time of cell collection, 72 hours after infection (hpi), was in the range of 20-60% compared to 100% CPE in the absence of ATK.

Treatment with ATK at the HSV-1 challenge step (ATK at Step 1) showed elevated titers of d27-1 in V27 cell supernatants harvested 72 hours post challenge (Figure 4B). The optimal concentration of ATK when added during the infection step (ATK I) was 50 μM, and then was diluted to a final concentration of 20 μM ATK during the dilution step with the addition of the remaining 3/5 volume of medium. In this case, ATK increased the titers of d27-1 in the supernatant at the time of collection (72 hours after infection) approximately 10-fold: from 4.0±0.3×10 ⁷ DRP/ml or 1.4±0.2×10 ⁷ PFU/ml to 3.7±0.2×10 ⁸ DRP/ml or 1.2±0.3×10 ⁸ PFU/ml (Figure 4B).

In order to determine what concentrations and conditions for the addition of ATK affect the yields of HSV, conducted the following experiments. Various concentrations of ATK were added to V27 cultures infected with HSV-1 d27-1 vectors, either in six well plates (Figure 2B) or in T150 flasks (Figure 2C) in two steps as described below. In Step 1 of the protocol, V27 cells were infected with rHSV vector at 0.15 MOI in 2/5 of the final volume of DMEM with 10% FBS and ATK concentrations of 0-60 μM. Cells were cultured for 1-2 hours at 37°C to complete Stage 1. In Stage 2, the ATK concentration was reduced within the range of 12-24 μM by adding 3/5 of the final volume of medium. The cells were cultured for 70-74 hours at 37°C and the supernatant was collected. Viral titers were expressed as DNase resistant particles (DRP/ml) or Plaque Forming Units (PFU/ml) per ml and were determined as described above.

The results are shown in Figures 2B and 2C with optimal ATK concentrations in bold. As can be seen, in both six-well plates (Figure 2B) and T150 flasks (Figure 2C), cultures with ATK added in either Step 1 or Step 2 had significantly higher HSV titers than those without ATK. In addition, the highest titers were observed at ATK concentrations of 50 μM in Step 1 reduced to 20 μM in Step 2 (Figure 2B), although all ATK concentrations produced higher viral titers than ATK-free cultures.

Conducted additional experiments to determine the optimal conditions and the impact of the presence or absence of ETS on the titer of HSV. The presence of serum, specifically 10% fetal bovine serum (FBS), in the ATK-containing medium was the most important parameter for the ATK-induced HSV-1 crop titer. The addition of ATK to the serum-free medium during the dilution step (ATK in Step 2) resulted in a decrease in viral titer, with the "DRP" titer below the control level and no PFU/mL titer being detected (Figure 3). An even more significant effect in serum-free medium was observed when ATK was added during the infection step, starting at a concentration of 3 μM, and both titers, DRP/ml and PFU/ml, were below the detection limit.

In this experiment, V27 cells were seeded in six-well plates the day before infection at 6×10 ⁵ cells/well. Infecting 2x HSV solution was prepared as follows: stock HSV-1 d27.1 was added to DMEM (without FBS) at 2x titer to infect V27 cells with a final MOI of 0.15. Received several combinations of 2x ATK solution containing either 100 μm or 40 μm ATK in DMEM and without FTS or with 20% FTS. Infection 2x HSV solution was mixed in equal volumes with either DMEM -/+ 20% FTS or desired 2x APA -/+ 20% FTS, vortexed, and 1 ml of infective inoculum per well in Step 1 was added. 1, the concentration was 50 μM and all wells were incubated for 1-2 hours. In Step 2, an additional 1.5 ml combinations of DMEM -/+ 40 μM ATK and -/+20% FTS were added. If the wells contained ATK in either Stage 1 or Stage 2, the final concentration of ATK was 20 μM. The plates were returned to the incubator for 70-74 hours, after which the free medium was collected, vortexed, and centrifuged at 1,100 xg for 10 minutes at 4°C. The supernatants were transferred to a new dosage tube, vortexed, aliquoted, and stock frozen at -80°C.

Example 3

Importance of the presence of serum in the ATK-HSV protocol

Conducted additional experiments to determine the optimal conditions and the impact of the presence or absence of ETS on the titer of HSV. The presence of serum, specifically 10% fetal bovine serum (FBS), in the ATK-containing medium was the most important parameter for ATK-induced HSV-1 crop titer. The addition of ATK to the serum-free medium during the dilution step (ATK in Step 2) resulted in a decrease in viral titer, with the "DRP" titer below the control level and no PFU/mL titer being detected (Figure 3). An even more significant effect in serum-free medium was observed when ATK was added during the infection step, starting at a concentration of 3 μM, and both titers, DRP/ml and PFU/ml, were below the detection limit.

In this experiment, V27 cells were seeded in six-well plates the day before infection at 6×10 ⁵ cells/well. Infecting 2x HSV solution was prepared as follows: stock HSV-1 d27.1 was added to DMEM (without FBS) at 2x titer to infect V27 cells with a final MOI of 0.15. Received several combinations of 2x ATK solution containing either 100 μm or 40 μm ATK in DMEM and without FTS or with 20% FTS.

Infection 2x HSV solution was mixed in equal volumes with either DMEM -/+ 20% FTS or desired 2x APA -/+ 20% FTS, vortexed, and 1 ml of infective inoculum per well in Step 1 was added. 1, the concentration was 50 μM and all wells were incubated for 1-2 hours. In Step 2, an additional 1.5 ml combinations of DMEM -/+ 40 μM ATK and -/+20% FTS were added. If the wells contained ATK in either Stage 1 or Stage 2, the final concentration of ATK was 20 μM. The plates were returned to the incubator for 70-74 hours, after which the free medium was collected, vortexed, and centrifuged at 1,100 x g for 10 minutes at 4°C. The supernatants were transferred to a new dosage tube, vortexed, aliquoted, and stock frozen at -80°C.

Example 4

Effect of ATK on wild-type HSV titers in culture

Figure 4A shows the titers of KOS and McIntyre wtHSV-1 strains in supernatants of cell lines that allow expansion of wtHSV-1: 293, HeLa and Vero cells. KOS and McIntyre wtHSV-1 strains were grown in 293, HeLa and Vero cells using the ATK-HSV protocol in which 50 μM ATK was added in Step 1, the final concentration after Step 2 was diluted to 20 μM ATK. Virus-containing supernatants were harvested three days later as described above. ATK increased the yield of both types of virus in Vero cells. The McIntyre wtHSV-1 strain achieved the highest titers after ATK induction in 293 cells, however, ATK appeared to inhibit the growth of HSV-1 KOS in 293 cells. Finally, ATK also appeared to inhibit both types of HSV-1 viruses in HeLa cells. Two-way analysis of variance (ANOVA); Bonferroni test; - ATK vs. + ATK: ***: p 0.001, ns: p>0.05; n=4 independent experiments.

For statistical purposes, a large batch of ten independent experiments (n=10) in 6-well plates with or without ATK added during the infection step (Step 1) was performed in a large study compared to replication-deficient d27-GFP and also McIntyre wtHSV. -1 in order to investigate whether ATK can also increase the titer of the wtHSV-1 strain (Figure 4B). ATK was added at a concentration of 50 mM to cofluent cell monolayers, V27 for d27-1 or 293 for McIntyre wtHSV-1, during the infection step (Step 1), and cells were infected with vectors at MOI=0.15 while ATK was diluted after one hour to a final concentration of 20 mM. After the addition of ATK, the d27-1 titer significantly increased 6.1-fold from 5.4×10 ⁷ DRP/mL or 1.1×10 ⁸ DRP/mL (**P<0.01) and the McIntyre wtHSV-1 titer significantly increased 9.1-fold from 3.3×10 ⁸ DRP/ml or 1.0×10 ⁹ DRP/ml (***P<0.001) in 2-way ANOVA and Bonferroni test (Figure 4B).

Example 5

Effect of ATK in HSV effluent on rAAV production or virions

In order to determine whether the presence of ATK during HSV production affects the yield of rAAV virions produced by HSV vectors, the following experiment was performed showing that rAAV titers are affected by the ATK residue present in rHSV-1 effluents produced in 293 cells (Figure 5A). The rAAV-GFP vector was produced by co-infection of 293 cells with rHSV-rep2/cap2 and rHSV-EGFP vectors in 60 mm plates using rHSV-1 ATK-containing stocks prepared at different concentrations of ATK (12 µM or 20 µM final concentrations) (see .Materials and methods). The rAAV titer in DRP/mL was slightly increased by a factor of 1.3 when using the rHSV-rep2/cap2 stock, which was prepared with 20 μM ATK added at the time of infection (ATK in Step 1) compared to the "No ATK" control ( *p<0.05), where the ATK concentration during rAAV production was approximately 3 μM. No significant increase in rAAV titer was detected using the rHSV-rep2/cap2 stock, which was prepared with 12 μM ATK (Figure 5A). One-way analysis of variance (ANOVA); Tukey's test:*p<0.05; 20 µM ATK versus no ATK; n=4 independent experiments.

In another experiment, ATK was shown to increase rAAV titer when 10 μM ATK was added directly to 293 cell media during the 2 hour rHSV-rep2/cap2 and rHSV-EGFP co-infection step. This effect was not observed when ATK concentrations were above 20 μM (Figure 5B).

Example 6

Mechanism of action of ATK

In order to elucidate the mechanism of action of ATK by analyzing the human genome, and given the fact that Vero and V27 are monkey-derived cell lines, wtHSV-1 propagation was tested in several human cell lines (Figures 4A-4B). Propagation of two wild-type strains of HSV-1 (wtHSV-1), KOS and McIntyre, were compared in three cell lines: human embryonic kidney 293 (293 cells), human cervical cancer HeLa cells, and Vero African green monkey kidney epithelial cells. Experiments were performed in media containing 10% ETS followed by an ATK protocol I where 50 µM ATK was added during the infection step and further diluted to a final concentration of 20 µM ATK (see Materials and Methods). In human-derived 293 cells, only the wtHSV-1 McIntyre virus titer increased significantly due to ATK, from 1.4×10 ⁸ DRP/ml to 1.2×10 ⁹ DRP/ml (***p<0.001). In Vero cells, ATK significantly increased the titers of only the KOS wtHSV-1 strain from 1.7×10 ⁸ DRP/mL to 9.1×10 ⁸ DRP/mL (***p<0.001; both statistical tests: two-way ANOVA, Bonferroni test n=4). Surprisingly, in HeLa cells, ATK appears to suppress both KOS and McIntyre HSV-1 strains.

To identify genetic profiles of the cellular response to wtHSV-1 McIntyre challenge, transcriptional profiling was performed with the Affymetrix Human U133 Plus 2.0 Array on 293 cells that were either sham-treated or ATK-treated, infected with wtHSV-1 McIntyre (HSV) or treated with ATK and infected with wtHSV-1 McIntyre(HSV&ATK) within 24 hours. Changes in gene expression caused by infection or treatment with ATK were detected by comparing the level of gene expression for each probe with the level of expression of the corresponding standardized cell sample. Infection with HSV-1 itself had a major impact on the gene expression profile of 293 cells compared to the genetic profile of untreated cells.

First, a filtration step was used to eliminate low expression, and out of a total of 54,675 Affy U133 Plus2 probes, 41,569 (76%) probes remained after the elimination.

Principal component analysis revealed two distinct populations, namely samples treated with and untreated with HSV. Analysis of variance (ANOVA) was performed to detect significantly different transcripts between HSV versus vehicle control, ATK versus vehicle control, HSV+AVA versus vehicle control, and HSV+ATK versus HSV alone. Genes were considered significant at p values less than 0.01. A self-organizing map was used to study expression patterns in vehicle control, HSV1, and HSV1+ATK. A separate gene cluster, Cluster A and B (Tables 1 and 2), was found, which showed changes in transcriptional profiles induced by HSV-1 and their ATK correction, which returned these genes back to baseline solvent control levels.

The biological functions of these clusters were analyzed in GeneGo. Cluster A (Table 2) was 58 probes that showed increased expression in HSV-1 and suppression after the addition of ATK. These genes have been predominantly involved in IgE and IFN inflammatory signaling, and in the overall immune response. Cluster B (Table 1) were 152 probes that showed a decrease in expression due to HSV-1 and their subsequent activation by ATK by returning them back to the original level of the control solvent. The genes in this cluster were predominantly involved in the G1/S cell cycle, PTEN signaling, and WNT-mediated development. For example, ATK in the presence of HSV-1 increases the expression of CDC25A, CDKNIA, CDKNIC, CCNK, CNNM2 genes from the cell cycle cascade and genes from the Ras/Raf/MEK cascade, including FOXC1, FOXD3, FOXO3 (See Table 1).

Tables 3A and 3B show the reduction in nNOS, iNOS and eNOS expression in HSV-ATK samples assayed by Affymetrix Gen Array and the reduction in iNOS expression in HSV+ATK samples when analyzed on a Qiagene SAB Jak-Stat RT-PCR microarray.

Example 7

Effect of Dexamethasone on HSV Yields

In order to determine whether the iNOS inhibitor dexamethasone also increases rHSV yields in culture, the following experiment was performed (FIG. 6). It shows the effect of dexamethasone (Dex) on the d27-1/GFP HSV-1 viral titer. Final d27-1/GFP HSV-1 titers were generally slightly elevated after dex pretreatment or treatment compared to untreated control.

V27 cells were seeded in six-well plates one day before infection at 6×10 ⁵ cells/well, the next day various concentrations of dexamethasone (dex) were added to the wells either before infection with HSV-1 (pretreatment) or during infection (treatment) in 2 /5 volumes of DMEM-10% ETS medium. After 1-2 hours of incubation at 37°C, 3/5 volume of DMEM-10% FTS was added. The cultures were returned to the incubator and the supernatant was collected after 70-74 hours. Data are shown as mean titers + SD in PFU/mL (n=2).

Example 8

Effect of Valproic Acid on HSV Yields

In order to determine whether the iNOS inhibitor valproic acid also increases rHSV yields in culture, the following experiment was performed. The figure 7 shows the effect of pre-treatment with valproic acid (VK) on the viral titer of d27-1/GFP HSV-1. VA at 5 mM slightly increased HSV-1 d27-1/GFP titer, but concentrations below and above 5 mM appeared to have an inhibitory effect on HSV-1 d27-1/GFP titer compared to untreated control.

V27 cells were seeded in six-well plates the day before infection at 6×10 ⁵ cells/well, the next day various concentrations of VA were added to the wells. The plates were incubated for 6 hours, the medium was taken, 2/5 of the volume of the medium containing the infecting stock HSV-1 d27-1 was added, and incubated for 1-2 hours at 37°C, after which 3/5 of the volume of the DMEM 10 medium was added % ETS. The cultures were returned to the incubator and the supernatant was collected after 70-74 hours.

As shown in the above examples, ATK at micromolar concentrations increases the yield of the HSV-1 vector. This fact is important both for large-scale production of HSV and for the production of rHSV and rAAV vectors. Also, surprisingly, the presence of ATK in rHSV-1 effluent does not adversely affect rAAV yield. This result is unexpected since ATK at millimolar amounts and higher concentrations is known to be an antiviral agent (Cushman et al., J. Med. Chem. (1991) 34 :329-337; Zhang et al., Antiviral Res. ( 1999) 43 :23-35; Yap et al., Computational YOU and Chem. (2005) 29 :212-219; De Clercq, Advents, Advances, and Adventures Med. Res. Rev. (2011) 31 :118- 160).

In serum-free medium, but not in the presence of serum (10% FTS), the inventors also observed the possible antiviral effect of ATK at micromolar concentrations.

Also as shown herein, ATK treatment slows down HSV-1 plaque formation and cell lysis in V27 cell monolayers and cytopathic activity (CPE), indicative of anti-apoptotic properties. The mechanism of action of ATK associated with increased HSV-1 yield appears to involve altering the factors required for HSV-1 production and reducing the cellular intrinsic antiviral immune response that is responsible for virus clearance. From the above analysis of the human genome, it was found that HSV-1 infection itself has a strong effect on the gene expression profile in 293 cells, and that the effect of ATK is mainly observed in V27 cells treated with both HSV-1 and ATK. Genes involved in the G1/S cell cycle, PTEN signaling, and WNT-mediated development were significantly downregulated by HSV-1 and upregulated after ATK supplementation.

Genes predominantly involved in IgE and IFN inflammatory signaling and the overall immune response were downregulated by HSV-1 and were suppressed after ATK addition. In the presence of HSV-1, ATK increases the expression of CDC25A, CDKNIA, CDKNIC, CCNK, CNNM2 genes from the cell cycle cascade and genes from the Ras/Raf/MEK cascade, including FOXC1, FOXD3, FOXO3.

The fact that ATK can increase HSV-1 yield is important because higher yields of HSV-1 vectors are needed for large-scale production for gene therapy and other applications.

Thus, methods are described for increasing the yield of viruses using iNOS inhibitors. While the preferred embodiments of the present invention have been described in some detail, it should be understood that obvious variations can be made within the spirit and scope of the invention as defined herein.

Table 1.
Cluster B gene list: HSV-suppressed and HSV+ATK-regulated genes Probe Set_ID Gene symbol Gene name HSV+ATK score versus HSV P value for assessing HSV+ATK versus HSV 230304_at - - 2.1691 0.0001 225806_at JUB jub, homologue of ajuba (Xenopus laevis) 2.126171 0.0004 202935_s_at SOX9 SRY (sex-determining region of the Y chromosome) - box 9 1.855105 0.000046 204790_at SMAD7 member 7 of the SMAD family 1.797951 0.0029 214633_at SOX3 SRY (sex-determining region of the Y chromosome) - box 3 1.797254 0.000007 210512_s_at VEGFA Vascular endothelial growth factor A 1.754719 0.000021 216652_s_at DR1 Negative transcriptional regulator 1, TBP-binding (negative cofactor 2) 1.745529 0.0036 205932_s_at MSX1 msh homeobox 1 1.726634 6.90E-06 209348_s_at MAF v-maf oncogene homologue of musculoaponeurotic sarcoma (avian) 1.685705 0.0073 217028_at CXCR4 Chemokine receptor 4 (C-X-C motif) 1.652962 0.0093 218251_at MID1IP1 MID1 interacting protein 1 (gastrulation-specific G12 homologue (zebrafish)) 1.642017 0.0064 1553764_a_at JUB jub, homologue of ajuba (Xenopus laevis) 1.623019 0.0017 214446_at ELL2 elongation factor 2 RNA polymerase II 1.602283 0.0001 227718_at PURB Protein B that binds purine-rich elements 1.59314 0.0019 219624_at BAG4 Athanogen 4 associated with BCL2 1.578527 0.0007 225642_at KTI12 Chromatin-associated KTI12 homologue (S. cerevisiae) 1.566082 0.0002 203705_s_at FZD7 frizzled homologue 7 (Drosophila) 1.54382 0.0002 222696_at AXIN2 Aksin 2 1.526076 0.0066 202007_at NID1 Nidogen 1 1.521713 0.0029 226858_at CSNK1E casein kinase 1, epsilon 1.51752 0.0002 57739_at DND1 Homolog of the 1st terminal stage of differentiation (zebrafish) 1.515518 0.0005 1558290_a_at PVT1 Pvtl oncogene (non-coding protein) 1.515288 0.0016 215694_at SPATA5L1 Similar to associate
with spermatogenesis-5, 1 1.51283 0.0012 206302_s_at NUDT4///
NUDT4P1 nudix (nucleoside diphosphate linked part X)-type, motif 4/// nudix (nucleoside diphosphate linked part X)-type, motif 4, pseudogene 1 1.49443 0.0073 218486_at KLF11 Kruppel-like factor 11 1.493386 0.0006 201695_s_at NP Nucleoside phosphorylase 1.492386 0.0004 203002_at AMOTL2 Angiomotin-like 2 1.489062 0.0093 227195_at ZNF503 protein with zinc fingers 503 1.478008 0.0094 238012_at DPP7 Dipeptidyl peptidase 7 1.471194 0.0003 209905_at HOXA9 homeobox A9 1.46661 0.0003 209188_x_at DR1 Negative transcriptional regulator 1, TBP-binding (negative cofactor 2) 1.4541 0.0001 221168_at PRDM13 Containing PR domain, 13 1.448075 0.0043 213338_at TMEM158 Transmembrane protein 158 1.436626 0.0001 209098_s_at JAG1 Jagged protein type 1 (Alagille syndrome) 1.433177 0.0001 206300_s_at PTHLH A hormone similar to parathyroid hormone 1.430301 0.0004 220018_at CBLL1 Similar-1 ecotropic retroviral transforming sequence Cas-Br-M (mouse) 1.427214 0.00003 226284_at ZBTB2 Protein with zinc fingers and containing BTB-domain, 2 1.421748 6.50Е-06 213348_at CDKN1C inhibitor of 1C cyclin-dependent kinase (p57, Kip2) 1.413731 0.0001 209565_at RNF113A Protein 113A with RING-type zinc finger 1.413412 7.80E-0.6 239696_at - - 1.413287 0.0006 212696_s_at RNF4 Protein 4 with RING-type zinc finger 1.408882 0.0034 214651_s_at HOXA9 homeobox A9 1.404355 0.000042 217741_s_at ZFAND5 Protein 5 with zinc finger and AN1-type domain 1.401465 0.0003 229309_at ADRB1 Adrenergic receptor beta-1 1.398788 0.0008 228953_at WHAMM WAS protein homologue associated with actin, Golgi membranes, and microtubules 1.392654 0.0013 1554522_at CNNM2 Cyclin M2 1.389108 0.0049 204913_s_at SOX11 SRY (sex-determining region of the Y chromosome) - box 11 1.385923 0.0004 231901_at C19orf52 Open reading frame 52, chromosome 19 1.378798 0.0034 224314_s_at EGLN1 Homolog 1 egl nine (C. elegans) 1.375757 0.0001 209099_x_at JAG1 Jagged protein type 1 (Alagille syndrome) 1.374203 0.0029 205555_s_at MSX2 msh homeobox 2 1.368114 0.00003 216035_x_at TCF7L2 Transcription factor 7-like protein 2 (T-cell specific, HMG box) 1.368112 0.0003 225824_at CCNK cyclin K 1.363977 0.0076 209201_x_at CXCR4 Chemokine receptor 4 (C-X-C motif) 1.360311 0.0001 235147_at FU32063 Hypothetical LOC150538 1.357503 0.0008 204527_at MYO5A myosin VA (heavy chain 12, myoxin) 1.356721 0.0017 242963_at SGMS2 sphingomyelin synthase 2 1.356199 0.0008 218247_s_at MEX3C mex-3C homologue (C. elegans) 1.3496 0.0001 207654_x_a t DR1 Negative transcriptional regulator 1, TBP-binding (negative cofactor 2) 1.348295 9.30E-06 209357_at CITED2 Cbp/p300 interacting transactivator with Glu/Asp-rich carboxy-terminal domain, 2 1.347165 0.0002 202241_at TRIB1 tribbles, homologue 1 (Drosophila) 1.340674 0.0009 209372_x_a t TUBB2A///TUBB2B tubulin, beta 2A///tubulin, beta 2B 1.339095 0.0001 205541_s_a t GSPT2 G1 to S phase transition protein, 2 1.33517 0.005 1568815_a_at DDX50 DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 1.329483 0.0043 204805_s_at H1FX Histone family H1, member X 1.324347 0.0013 213152_s_a SFRS2B Splicing factor, arginine/serine-rich, 2B 1.322967 6.70E-06 225699_at C7orf40 Chromosome 7, open reading frame 40 1.321373 0.0014 218295_s_at NUP50 nucleoporin 50kDa 1.318229 0.0014 224739_at PIM3 pim-3 oncogene 1.31654 0.0001 214911_s_at BRD2 Protein 2 containing bromodomain 1.313049 0.0015 208938_at PRCC Papillary carcinoma of kidney cells (associated with translocation) 1.304724 0.000041 206907_at TNFSF9 Tumor necrosis factor superfamily (ligand), member 9 1.295621 0.0032 202284_s_a t CDKN1A inhibitor of 1A cyclin-dependent kinase (p21, Cip1) 1.28534 0.0001 206915_at NKX2-2 NK2 homeobox 2 1.280773 0.000021 215087_at C15orf39 chromosome 15, open reading frame 39 1.277596 0.0013 202219_at SLC6A8 Solute transporter family 6 (neurotransmitter transporter, creatine), member 8 1.273131 0.0006 202704_at TOB1 transducer ERBB2,1 1.272848 0.0016 213038_at RNF19B Protein with zinc fingers 19B 1.27284 0.0022 213150_at HOXA10 homeobox A10 1.272477 0.008 204383_at DGCR14 Gene 14 from the critical region for DiGeorge syndrome 1.268562 0.000043 1553613_s_at FOXC1 forkhead box C1 1.26852 0.0003 218398_at MRPS30 Mitochondrial ribosomal protein S30 1.266043 0.0057 202166_s_at PPP1R2 Regulatory (inhibitory) subunit 2 of protein phosphatase 1 1.264115 0.00003 235004_at RBM24 Protein 24 with RNA binding motif 1.260011 0.0086 223742_at MRPL4 Ribosomal mitochondrial protein L4 1.251284 0.000049 211756_at PTHLH A hormone similar to parathyroid hormone 1.24883 0.0016 209211_at KLF5 Kruppel-like factor 5 (intestinal) 1.241821 0.0003 225796_at PXK PX-domain-containing serine-threonine kinase 1.239504 0.0002 225434_at DEDD2 Protein 2 containing the death domain 1.23754 0.000044 208686_s_at BRD2 Protein 2 containing bromodomain 1.229145 0.0001 217821_s_a t WBP11 Protein 11 binding WW domain 1.218077 0.0002 244519_at ASXL1 Protein-like accessory genital ridges, 1 (Drosophila) 1.208056 0.000044 208415_x_at ING1 Growth inhibitor family member 1 1.184054 0.0017 216511_s_a t TCF7L2 Transcription factor 7-like protein 2 (T-cell specific, HMG box) 1.174677 0.0024 235959_at - - 1.172362 0.0008 243707_at - - 1.171741 0.0005 227852_at RP9 Retinitis pigmentosa 9 (autosomal dominant) 1.171328 0.0002 1555772_a_at CDC25A Division cell cycle protein 25, homologue A (S. pombe) 1.170244 0.0051 221841_s_at KLF4 Kruppel-like factor 4 (gut) 1.16333 0.0006 214789_x_at SFRS2B Splicing factor, arginine/serine rich 2B 1.162135 0.0001 216997_x_at TLE4 Transducin-like cleavage enhancer 4 (E(spl) homologue, Drosophila) 1.159916 0.0001 205780_at BIK Killer interacting with BCL2 (inducing apoptosis) 1.158085 0.0001 212075_s_at CSNK2A1 casein kinase 2, alpha 1 polypeptide 1.156022 0.0049 228820_at XPNPEP3 X-prolyl aminopeptidase (aminopeptidase P) 3 putative 1.152448 0.0008 209653_at KPNA4 Karyopherin alfa 4 (importin alfa 3) 1.146903 0.0004 209457_at DUSP5 Phosphatase 5 with dual specificity 1.144663 0.0016 224671_at MRPL10 Mitochondrial ribosomal protein L10 1.144585 0.0061 200618_at LASP1 UM and SH3 protein 1 1.140405 0.0097 228931_at COQ4 coenzyme Q4, homologue (S. cerevisiae) 1.136018 0.0008 224583_at COTL1 Coactosin-like 1 (Dictyostelium) 1.128103 0.001 238738_at PSMD7 26S proteasome subunit (prosome, multicatalytic), non-APTase, 7 1.128031 0.0062 202501_at MAPRE2 Microtubule associated protein, RP/EB family, member 2 1.12791 0.0046 214321_at NOV Gene overexpressed in nephroblastoma 1.123481 0.0004 202936_s_a t SOX9 SRY (sex-determining region of the Y chromosome) - box 9 1.12181 0.0054 222163_s_a t SPATA5L1 similar to that associated with spermatogenesis 5, 1 1.116794 0.0013 241612_at FOXD3 forkhead box D3 1.11263 0.0041 20243l_s_at MYC v-myc
myelomatosis viral oncogene, homologue (birds) 1.105333 0.0007 215933_s_at HEX Hematopoietically expressed homeobox 1.105321 0.0002 204132_s_at FOXО3///
FOXO3B forkhead box 03///forkhead box 03, pseudogene 1.100606 0.0007 201041_s_at DUSP1 Phosphatase 1 with dual specificity 1.09043 0.0004 230233_at - - 1.087609 0.0005 215223_s_at SOD2 Superoxide dismutase 2, mitochondrial 1.087493 0.0001 225689_at C3orf39 chromosome 3, open reading frame 39 1.080337 0.003 223132_s_at TPJM8 Protein 8 containing a three-component motif 1.073976 0.0065 203313_s_at TGIF1 homeobox 1 factor induced by TGFB 1.073363 0.0008 201461_s_a t MAPKAPK2 Protein kinase 2 activated by mitogen-activated protein kinase 1.070375 0.0088 236174_at - - 1.069052 0.0013 223679_at CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1.060314 0.0044 204039_at SEVRA CCAAT/enhancer binding protein (C/EBP), alpha 1.052213 0.01 234302_s_at ALKBH5 alkB, alkylation reduction, homologue 5 (E. coli) 1.049599 0.0043 223290_at PDXP pyridoxal (pyridoxine, vitamin B6) phosphatase 1.048187 0.0022 226644_at MIB2 mindbomb homologue 2 (Drosophila) 1.041356 0.0011 206363_at MAF v-maf oncogene homologue of musculoaponeurotic sarcoma (avian) 1.037386 0.0008 1555639_a_at RBM14 Protein 14 with RNA binding motif 1.035626 0.0003 222527_s_a t RBM22 Protein 22 with RNA binding motif 1.027056 0.0008 213419_at APBB2 Amyloid Beta Precursor Protein Binding Protein (A4), Family B, Member 2 1.025879 0.0009 213360_s_at POM 121///
POM121C POM121 membrane glycoprotein (rat)///POM121 membrane glycoprotein C 1.023715 0.0013 225832_s_at DAG LB diacylglycerol lipase, beta 1.001586 0.0001 212445_s_at NEDD4L A protein similar to that expressed in neural progenitors
repressed during development 4 0.997235 0.0022 224562_at WASF2 WAS protein family member 2 0.996687 0.0043 223389_s_a t ZNF581 Protein with zinc fingers 581 0.99618 0.0004 231721_at JAM3 Nodal adhesion molecule 3 0.989941 0.0001 203140_at BCL6 B-cell CLL/lymphoma 6 0.984695 0.0004 213823_at HOXA11 homeobox A11 0.974615 0.0036 1552275_s_at PXK PX-domain-containing serine/threonine kinase 0.973552 0.0002 52731_at AMBRA1 autophagy/beclin-1 regulator 1 0.970744 0.000027 238624_at - - 0.970064 0.0005 210479_s_at RORA RAR-bound orphan receptor A 0.965295 0.0006 220941_s_at C21orf91 open reading frame 91, chromosome 21 0.943651 0.0013 203234_at UPP1 uridine phosphorylase 1 0.932337 0.0009 202102_s_at BRD4 Protein 4 containing bromodomain 0.930432 0.0034 217775_s_at BDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 0.92863 0.0029

Table 2.
List of cluster A genes: Genes that were activated by HSV and suppressed by HSV+ATK Probe Set_ID Gene symbol Gene name HSV+ATK score versus HSV1 P value for assessing HSV+ATK versus HSV1 243160_at - - -1.01645 0.0022 205247_at NOTCH4 Notch homologue 4 (Drosophila) -0.93759 0.0007 219256_s_at SH3TC1 SH3 domain and tetratricopeptide repeats, 1 -0.91997 0.0021 221631_at CACNA1I Alpha 1I subunit of T-type voltage-gated calcium channel -0.90394 0.0018 1569961_at - - -0.89195 0.0013 220277_at CXXC4 CXXC finger 4 -0.85343 0.0054 229611_at LMLN Leishmanolysin-like (M8 metallopeptidase family) -0.85329 0.0005 232341_x_at HABP4 Hyaluronan binding protein 4 -0.84077 0.0071 242219_at - - -0.83521 0.0028 233767_at HHLA1 Associated with HERV-H LTR, 1 -0.8339 0.0017 236925_at LOC728288 hypothetical LOC728288 -0.81812 0.008 231905_at C20orf96 open reading frame 96, chromosome 20 -0.80575 0.0041 233313_at - - -0.80466 0.0011 1563507_at - - -0.79441 0.0043 232456_at C10orf71 open reading frame 71, chromosome 10 -0.78722 0.0067 203468_at CDK10 Cyclin-dependent kinase 10 -0.77888 0.0035 237456_at - - -0.77558 0.0085 216127_at PDIA2 Family A protein disulfide isomerase member 2 -0.76924 0.0049 207977_s_a t DPT dermatopontin -0.76077 0.0065 224510_s_a t CLPB CLPB caseinolytic peptidase B, homologue (E. coli) -0.75625 0.006 208267_at TRPV5 Transient potential cation channel receptor, subfamily V, member 5 -0.73228 0.0091 221868_at PAIP2B Protein 2B interacting with poly(A)-binding protein -0.7284 1.10E-06 1559439_s_at C21orf58 Open reading frame 58 on chromosome 21 -0.7256 0.0051 1552960_at LRRC15 Protein 15 containing leucine-rich repeats -0.72214 0.0049 204413_at TRAF2 Factor 2 associated with the TNF receptor -0.69678 0.0039 213888_s_at TRAF3IP3 Protein 3 interacting with TRAF3 -0.69063 0.0043 1553945_at GPHB5 Glycoprotein hormone beta 5 -0.67838 0.0003 221312_at GLP2R Glucagon-like peptide 2 receptor -0.67682 0.0097 1554783_s_at ARHGEF2 Rho/Rac Guanine Nucleotide Exchange Factor 2 (GEF) -0.67352 0.0005 205567_at CHST1 carbohydrate (keratan sulfate Gal-6) sulfotransferase 1 -0.67335 0.0009 232473_at PRPF18 PRP18 pre-mRNA processing factor 18, homologue (S. cerevisiae) -0.66869 0.0064 1565583_at LOC100291336 Hypothetical protein LOC100291336 -0.66137 0.0086 243638_at - - -0.65654 0.0041 208608_s_at SNTB1 Syntrophin beta 1 (major component 1 of dystrophin-associated protein A1, 59kDa) -0.65372 0.005 1556202_at SRGAP2 Protein 2 activating SLIT-ROBO Rho GTPase -0.64525 0.0034 206266_at GPLD1 Glycosylphosphatidylinositol-specific phospholipase D1 -0.64321 0.0015 234659_at - - -0.63414 0.007 204708_at MAPK4 Mitogen-activated protein kinase 4 -0.633 0.0045 236604_at BAHCC1 Containing BAH domain and supercoil, 1 -0.63262 0.0083 242129_at SIN3B SIN3 homologue B, transcription regulator (yeast) -0.63025 0.0018 233029_at OBSCN obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF -0.62959 0.0049 203398_s_at GALNT3 UDP-N-acetyl-alpha-D-galactosaminepolypeptide N-
acetylgalactosaminyl transferase 3 (GalNAc-T3) -0.62709 0.0016 242701_at TBRG1 Transforming growth factor regulator 1 beta -0.62074 0.0032 235083_at LOC151009 hypothetical LOC151009 -0.61926 0.004 206372_at MYF6 Myogenic factor 6 (herculin) -0.6146 0.0018 1567611_at - - -0.61369 0.0061 236252_at - - -0.61329 0.0041 206286_s_at TDGF1//TDGF3 Growth factor 1 derived from teratocarcinoma /// Growth factor 3 derived from teratocarcinoma pseudogene -0.61123 0.0012 1563263_at PLCG2 Phospholipase C, gamma 2
(phosphatidylinositol-specific) -0.60753 0.0003 214742_at AZI1 Inducible by 5-azacytidine, 1 -0.60464 0.0089 244656_at RASL10B RAS-like, family 10, member B -0.6032 0.0072 1555665_at - - -0.59953 0.0088 224291_at CACNG6 Gamma subunit 6 voltage-gated calcium channel -0.59548 0.0068 235616_at TSHZ2 teashirt zinc finger homeobox 2 -0.59219 0.0037 237461_at NLRP7 Protein 7 of the NLR family containing a pyrine domain -0.58969 0.0068 223693_s_at RADIL Ras-associated DIL-domain protein -0.58969 0.0052 208454_s_at PGCP Plasma glutamate carboxypeptidase -0.58916 0.001 216426_at TCEB1 Transcription elongation factor B (SII), polypeptide 1 (15kDa, elongin C) -0.58852 0.002

Table 3A.
Reduced expression of nNOS, iNOS, and eNOS in HSV+ATK samples in Affymetrix Gen Array assay; NOS1=nNOS, NOS2=iNOS, NOS3=eNOS Probe Set_ID Pub ID Symbol ATA HSV HSV+ATA p ATA value p value of HSV p value HSV+ATA 240911_at AI733341 NOS1 1.02 1.71 1.5 0.872 0.009 0.024 207310_s_at U31466 NOS1 1 2.79 1.67 0.981 0.003 0.033 AF049656 - NOS2 -1.03 2.05 1.72 0.706 0.002 0.007 205581_s_at NM_000603 NOS3 1.24 2.45 1.94 0.234 0.005 0.013

Table 3B.
Decreased expression of iNOS in HSV+ATK samples in Jak-Stat RT-PCR Microarray (SABiosciences (QIAGEN)) RT2 catalog Pub ID Symbol ATA HSV HSV+ATA p ATA value p value of HSV p value HSV+ATA 240911_at AI733341 NOS1 1.02 1.71 1.5 0.872 0.009 0.024

Claims (5)

1. A method for producing recombinant adeno-associated virus (rAAV) virions, which includes cultivating the recombinant herpes simplex virus (rHSV) in a cell culture that contains aurine tricarboxylic acid and fetal calf serum, where rHSV is cultivated in 293 or Vero cells, where aurine tricarboxylic acid is present at a concentration of 10 -60 μM and where auryntricarboxylic acid is present in an amount that increases the yield of the herpes virus, and where the cultured recombinant herpes simplex virus is used to obtain recombinant adeno-associated virus virions. 2. The method for producing rAAV virions according to claim 1, wherein the cultured recombinant herpes simplex virus is an rHSV vector with a helper function. 3. A method for producing rAAV virions according to claim 1 or 2, wherein the rHSV is replication deficient. 4. A method for producing rAAV virions according to any one of claims 1 to 3, wherein rHSV is a recombinant mutant strain of HSV-1. 5. A method for producing rAAV virions according to claim 4, wherein the recombinant mutant HSV-1 strain is HSV1 strain d27-1.

Images