CN110964851B

CN110964851B - Application of histone modification enzyme gene SETD8 in resisting DNA virus

Info

Publication number: CN110964851B
Application number: CN201911299233.5A
Authority: CN
Inventors: 吴旻; 陈林; 杨晨
Original assignee: Wuhan University WHU
Current assignee: Wuhan University WHU
Priority date: 2019-12-17
Filing date: 2019-12-17
Publication date: 2021-08-03
Anticipated expiration: 2039-12-17
Also published as: CN110964851A

Abstract

The invention discloses an application of a histone modification enzyme gene SETD8 in resisting DNA viruses. The invention determines the relation between the SETD8 gene and DNA virus infection, which can be used as a therapeutic target of DNA virus infection, can be used for antagonizing DNA virus infection by inhibiting SETD8, and can be used for treating DNA infection by inhibiting UNC 0379. The invention mainly discusses that (1) the inhibition of SETD8 expression can inhibit the expression and replication of the DAN virus. (2) Overexpression of SETD8 facilitates expression and replication of DNA viruses. (3) The small molecule inhibitor UNC0379 of SETD8 can inhibit DNA virus infection. The invention provides an effective new way for treating DNA virus infection.

Description

Application of histone modification enzyme gene SETD8 in resisting DNA virus

Technical Field

The invention belongs to the field of gene functions and application, and particularly relates to application of a histone modification enzyme gene SETD8 in DNA virus resistance.

Background

DNA virus infection is a significant threat to human health, with HSV becoming more and more serious. Herpes Simplex Virus (HSV) belongs to the family of herpesviridae and is an enveloped, thread-bound DNA double-stranded virus. They are widely found in nature, and are divided into three subfamilies of α, β and γ according to physicochemical and biological characteristics, with more than 100 kinds. HSV belongs to the sub-family alphaae and comprises two types, HSV-1 and HSV-2. HSV-1 primarily infects the skin and mucous membranes of the mouth, eyes, lips, and the central nervous system, with a small number of genital infections; HSV-2 is commonly associated with external genital infections, neonatal infections, and is rarely seen in oral lesions. These infections cause a number of clinical symptoms, such as lesions and ulcerations at the site of infection, neurological disorders, newborn deformities, etc. Statistically, 80-90% of the population have been infected with HSV, a large proportion of which results in latent infection. For the treatment of the drug, the current clinical common use is the antidotes such as vidarabine, acyclovir and the like, but the effect is general; the problems of drug resistance, incomplete removal, relapse and the like often occur.

Human Cytomegalovirus (HCMV) is the largest genomic member of the herpes virus family and encodes over 200 proteins. The HCMV infection host range is narrow, human is taken as the host, and no animal model of infection exists. HCMV is characterized by slow cracking, replication and proliferation, long period and formation of nuclear inclusion body, and has the characteristics of triggering the generation of nuclear and cytoplasmic inclusion bodies and cell swelling (giant cells), thereby being named. HCMV infection is relatively extensive in China, the HCMV antibody positive rate of general population is about 86-96%, and the HCMV antibody positive rate of pregnant women can reach about 95%. HCMV has the biological property of latency-activation and persists for life once infected. Although HCMV infection occurs at a high rate, HCMV is less pathogenic and is not significantly pathogenic to immunocompromised individuals. HCMV replication in the body does not always represent a disease process, and HCMV infection in infants, fetuses and individuals is susceptible to disseminated disease or single organ damage when the immunity is low. Thus, primary cytomegalovirus infections occur in infants and immunodeficient populations.

Mouse Cytomegalovirus (MCMV) is one of the earliest cytomegaloviruses isolated and propagated in cell culture. MCMV infection in mouse populations, the pathogenic process at the time of acute infection, latency, and the stimulatory process after immunosuppression, blood transfusion, or tissue transplantation, are similar to HCMV infection in humans, and MCMV is the earliest virus found to be non-tumorigenic under immunosuppressive conditions. This phenomenon of the virus, which can initiate the process under certain conditions, has been emphasized as a model for the study of human infections.

H4K20me1 was one of the earliest identified histone modifications, and was also the major methylation modification of the N-terminal tail of histone H4. In 2002, SETD8, also called PR-Set7, was first screened and identified as histone H4 twenty-second lysine monomethylation methyltransferase by a biochemical separation method; and has strict specificity for catalyzing monomethylation, and does not catalyze di-methylation and trimethylation. Although there is still the possibility that other proteins catalyze the regulation of H4K20 methylation, Setd8 is considered to be the most important protein that regulates the methylation function of H4K 20. There are also many studies of small molecule inhibitors against SETD8. Among them, UNC0379, which is used and studied herein, acts through a mechanism that competitively inhibits the substrate and has good specificity without inhibiting other methyltransferases.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides the application of a histone modification enzyme gene SETD8 in treating DNA virus infection. The purpose is to determine the correlation between the SEYD8 gene and DNA virus infection, provide a target gene for the treatment of DNA virus infection, further apply the SETD8 gene to the prevention or treatment of DNA virus infection, and apply an inhibitor thereof to screening or preparing medicaments for protecting or preventing DNA virus infection. The invention mainly discusses that (1) the inhibition of SETD8 expression can inhibit the expression and replication of the DAN virus. (2) Overexpression of SETD8 promotes expression of DNA viruses. (3) The small molecule inhibitor UNC0379 of SETD8 can inhibit DNA virus infection.

In order to achieve the above object, the present invention provides an application of a histone modification enzyme gene SETD8 in resisting DNA virus, which is characterized in that: the SETD8 gene is used as a therapeutic target of DNA virus infection, and an inhibitor thereof is used for screening or preparing medicaments for protecting or preventing the DNA virus infection.

Preferably, the inhibitor is a small molecule inhibitor UNCO379 of SETD8, and the small molecule inhibitor UNCO379 has an anti-DNA virus effect and can be used as a medicine for treating DNA virus infection.

Furthermore, the SETD8 can be inhibited to resist DNA virus infection, and has anti-infection effect on herpes simplex virus HSV-1, human cytomegalovirus HCMV and mouse cytomegalovirus MCMV.

Furthermore, overexpression of SETD8 can promote expression of herpes simplex virus HSV-1.

Subsequently, the small molecule inhibitor UNC0379 with SETD8 enzyme activity can inhibit the infection of DNA virus: in mouse embryonic fibroblast MEF and human foreskin fibroblast HFF, the replication of HSV-1 virus is inhibited after the treatment of UNC 0379; the replication of MCMV virus was inhibited after treatment with UNC0379 in murine embryonic fibroblasts MEF; in human foreskin fibroblasts HFF, HCMV virus replication was inhibited after treatment with UNC 0379.

Drawings

FIG. 1: the expression and replication experiment of herpes simplex virus HSV-1 infected cells can be inhibited by knocking down SETD8 in U2OS cells.

In the figure: siRNA knockdown of SETD8 in human osteosarcoma cell line U2OS, mRNA extraction 48 hours later, reverse transcription The expression level of SETD8 was tested for post-cDNA.

FIG. 2: the expression and replication experiment of herpes simplex virus HSV-1 infected cells can be inhibited by knocking down SETD8 in U2OS cells.

In the figure: SETD8 knockdown using siRNA in human osteosarcoma cell line U2OS, inoculated 48 hours later with HSV-1, MOI ═ Collecting cells after 1 and 10 hours, extracting mRNA, carrying out reverse transcription to obtain cDNA, and detecting the expression level of HSV-1 late gene US 11.

FIG. 3: the expression and replication experiment of herpes simplex virus HSV-1 infected cells can be inhibited by knocking down SETD8 in U2OS cells.

In the figure: SETD8 knockdown using siRNA in human osteosarcoma cell line U2OS, inoculated 48 hours later with HSV-1, MOI ═ Collecting cells after 1 and 10 hours, extracting genome DNA, and detecting the genome level of HSV-1 by qPCR.

FIG. 4: overexpression of SETD8 in U2OS cells promoted infection with HSV-1.

In the figure: overexpression of SETD8 in U2OS cells, inoculation of HSV-1 at 48 hours, MOI of 1, and harvesting of cells at 10 hours mRNA is extracted and reverse transcribed into cDNA, and then the expression level of HSV-1 late gene US11 is detected.

FIG. 5: UNC0379 was tested against HSV-1 in MEF cells.

In the figure: MEF cells were infected with HSV-1, MOI 1, then treated with 5 μ MUNC0379 for 10 hours and the cells were extracted Genomic DNA of cells, genomic levels of HSV-1 were determined by qPCR.

FIG. 6: UNC0379 was tested against HSV-1 in HFF cells.

In the figure: HFF cells were infected with HSV-1, MOI 1, and then treated with 5 μ MUNC0379 for 10 hours to extract fine cells Genomic DNA of cells, genomic levels of HSV-1 were determined by qPCR.

FIG. 7: UNC0379 was tested against HCMV in HFF cells.

In the figure: infecting HFF cells with HCMV, MOI 1, and treating the cells with 5 μ MUNC0379 for 3 days, and extracting the cells Genomic DNA, genomic levels of HCMV were detected using qPCR.

FIG. 8: UNC0379 was tested against MCMV in MEF cells.

In the figure: MEF cells were infected with MCMV with MOI 1, and then treated with 5. mu. MUNC0379 for 3 days to extract cells Genomic DNA, genomic levels of MCMV were detected using qPCR.

Detailed Description

The present invention will be described in further detail with reference to the following examples and accompanying drawings.

Example 1: expression level and genome level detection of HSV-1, HCMV and MCVM

1. Design of primers

Primers for detecting virus expression and genome level are designed according to genome sequences and coding sequences of herpes simplex virus I HSV-1, HCMV and MCMV in NCBI. This example selects a late gene of HSV, US11, as a reference for the transcriptional level of the HSV-1 gene.

1) PCR amplification primer for US11 gene

An upstream primer: CTTCAGATGGCTTCGAGATCGTAG, the sequence of which is shown in SEQ ID NO. 1;

a downstream primer: TGTTTACTTAAAAGGCGTGCCGT, the sequence of which is shown in SEQ ID NO. 2;

2) HSV-1 genome PCR amplification primer

An upstream primer: CTTCAGATGGCTTCGAGATCGTAG, the sequence of which is shown in SEQ ID NO. 3;

a downstream primer: TGTTTACTTAAAAGGCGTGCCGT, the sequence of which is shown in SEQ ID NO. 4;

3) HCMV genome PCR amplification primer

An upstream primer: ACGACACCGTAGACCTGACC, the sequence of which is shown in SEQ ID NO. 5;

a downstream primer: AAAGAGGTGCAGTCCGCTAA, the sequence of which is shown in SEQ ID NO. 6;

4) MCMV genome PCR amplification primer

An upstream primer: GTGCGTTCTTCGTGGAGC, the sequence of which is shown in SEQ ID NO. 7;

a downstream primer: CGCCTTTGTCTACGGTGT, the sequence of which is shown in SEQ ID NO. 8;

2. RNA extraction and reversion to cDNA

In this example, RNA in cells was extracted using a cellular RNA extraction kit from Probenomyl, and the RNA in cells was extracted using the kit according to the instructions and stored in a refrigerator at-80 ℃. In this example, RNA was reversely synthesized into cDNA using a reverse transcription kit of TOYOBO, the specific system is shown in Table 2-1:

tables 2-5 reverse transcription of Mix1

Tables 2-6 reverse transcription of Mix2

After total RNA is extracted, reverse transcription Mix1 is prepared according to the table; note that the amount can be adjusted according to the concentration of the extracted RNA, and about 1. mu.g of the total mass is taken as a reference, and ddH is changed correspondingly₂Volume of O. Placing the prepared Mix1 on a 72 ℃ dry thermostat for 2min, adding Mix2, uniformly mixing, and reacting on a PCR instrument: the cDNA was stored at minus 80 ℃ for 5min at 42 ℃ for 1 hour and 95 ℃.

3. Extraction of genomic DNA from cells

In this example, DNA in cells was extracted using a tissue cell DNA extraction kit from Tiangen corporation, and genomic DNA in cells was extracted using the kit according to the instructions and stored in a refrigerator at-80 ℃.

4. qPCR detection of cDNA and genomic DNA

This example used the qPCR kit of nuozoken to detect cDNA and genomic DNA by the following steps: a new 384 well plate was prepared, 5. mu.l of 2 XqPCR MIX, 3. mu.l of primers at 5. mu.M concentration, 3. mu.l of cDNA or genomic DNA template were added to each well, qPCR cover plates were covered, centrifuged at 1500rpm for 2min, and qPCR detection was performed on a Bio-rad qPCR instrument. The procedure is as follows: pre-denaturation at 95 ℃ for 5min, cycle program 95 ℃ 10s, 55 ℃ 30s, 72 ℃ 30 s.

Example 2: the knock-down of SETD8 in U2OS cells can inhibit the expression and replication of herpes simplex virus HSV-1 infected cells

1. Designing a siRAN

siRNA was designed based on the coding sequence of SETD8 in NCBI, siNC being a negative control not directed against any gene. Then synthesized in Gima Gene.

1) sequence of sisetdt 8.1: 5 'CGAAGGAGCUCCAGGAAGAUU 3', the sequence of which is shown in SEQ ID NO. 9;

2) sequence of sisetdt 8.2: 5 'CCAUGAAGUCCGAGGAACAUU 3', the sequence of which is shown in SEQ ID NO. 10;

3) sequence of sisetdt 8.3: 5 'GCAACAGAAUCGCAAACUUUU 3', the sequence of which is shown in SEQ ID NO. 11;

4) sequence of sisetdt 8.4: 5 'GCAAACUUACGGAUUUCUAUU 3', the sequence of which is shown in SEQ ID NO. 12;

2. subculturing osteosarcoma cell U2OS cell

Taking U2OS cells with good growth state, discarding the culture medium, washing twice with PBS, digesting with 0.25% pancreatin, inoculating 1 x 10^6 cells into a 10cm pore plate, adding 1640 culture medium, culturing in an incubator at 37 ℃, and subculturing once every two days.

3. Liposome method for transfecting cells

(1) Well-grown U2OS cells were subcultured the first day on U2OS cells, and the cells were seeded in a six-well plate in a culture volume of 2ml and starting cell amount of 2X 10⁵One cell/well, incubated in an incubator at 37 ℃ for 12 hours.

(2) The medium was discarded, washed with PBS, and 800. mu.l of Opti-MEM medium was added to each well.

(3) The 200. mu.L of Opti-MEM medium was divided into two EP tubes on average, and 2. mu.L of lipofectamine 2000 was added to one tube of Opti-MEM medium, and 1. mu.g of siRNA was added to the other tube of Opti-MEM medium, and the mixture was mixed well and left for 20 minutes.

(4) After 20 minutes, the transfection reagent was directly added to the freshly transferred cells, the plates were gently mixed, incubated at 37 ℃ for 6 hours, the Opti-MEM medium was discarded, washed with PBS, 2ml of DMEM medium was added, and the cells were incubated in an incubator for 48 hours.

4. Viral infection and detection

(1) HSV-1 virus was inoculated into six-well plates at MOI of 1, mixed well and incubated at 37 ℃ for 1 hour.

(2) The old medium in the six-well plate was discarded, washed once with PBS, added with 2ml of DMEM medium, pushed well and placed in a 37 ℃ incubator for 10 hours.

(3) Extracting mRNA of cells according to the instruction of an RNA extraction kit, reversing the mRNA into cDNA, and detecting the HSV-1 expression level of the virus by qPCR (quantitative polymerase chain reaction) by adopting a specific primer; or extracting the genome of the cell according to the instruction of the genome DNA extraction kit, and detecting the level of the virus genome DNA by qPCR (quantitative polymerase chain reaction) by adopting a specific primer.

Example 3: overexpression of SETD8 in U2OS cells promotes HSV-1 infection

1. Construction of pcDNA5-Flag-SETD5 plasmid by recombinant method

(1) Recombinant primers were designed based on the pcDNA5-Flag vector sequence and the coding sequence of SETD8 in the NCBI database.

Design of SETD8 primer

Forward:

GCGGATCCACTAGTCCAGTAATGGCTAGAGGCAGGAAGATGTC, the sequence of which is shown in SEQ ID NO. 13;

Reverse:

ATATCTGCAGAATTCCACCATTAATGCTTCAGCCACGGGT, the sequence of which is shown in SEQ ID NO. 14;

b design pcDNA5-Flag vector primer

Forward TGGTGGAATTCTGCAGATATC, the sequence of which is shown in SEQ ID NO. 15;

CACTGGACTAGTGGATCCGCC, the sequence of which is shown in SEQ ID NO. 16;

(2) PCR amplification produced a recombinant SETD8 fragment and a recombinant pcDNA5-Flag fragment.

PCR was performed using the cDNA extracted in example 4 as a template and the designed SETD8 primer to generate a recombinant SETD8 fragment. Taking pcDNA5-Flag plasmid as a template, and carrying out PCR according to a designed pcDNA5-Flag vector primer to generate a recombinant pcDNA5-Flag fragment.

The amplification system is as follows:

the amplification conditions were:

(3) recombination was carried out using a recombination kit from Vazyme.

The reaction system is as follows:

the reaction was carried out on a PCR instrument at 37 ℃ for 30 minutes.

(4) Conversion coating plate

Mu.l of DH 5. alpha. competent cells were added to the recombinant product, mixed well, left on ice for 30 minutes, heat-treated at 42 ℃ for 90 seconds, and then applied to an ampicillin-resistant plate by the plate-coating method. The culture was carried out in an incubator at 37 ℃ for 12 hours.

(5) Amplification of single colonies

Colonies growing on the plates were picked and inoculated into tubes containing 3ml of LB medium, ampicillin resistance, and shaken at 220rpm for 12 hours at 37 ℃.

(6) Small upgraded granule

The bacteria liquid is collected by centrifugation at 12000rpm of a centrifuge, and plasmids are extracted by using a plasmid miniextraction kit of Tiangen company according to the operation of a specification.

(7) The plasmid is sent to a sequencing company for sequencing, the sequence sequenced by the prohibitiaceae company is compared with the SETD8 coding sequence in NCBI, and the constructed pcDNA5-Flag-SETD8 plasmid is successfully constructed if the sequences are the same.

2. Transfection, viral infection and detection

The constructed pcDNA5-Flag-SETD8 plasmid was transfected by lipofectamin2000 transfection method in example 2, no-load pcDNA5-Flag was used as a control, HSV-1 was inoculated and cultured at 37 ℃ for 10 hours, mRNA of cells was extracted according to the instruction of RNA extraction kit, and after reversing to cDNA, virus HSV-1 expression level was detected by qPCR using specific primers.

Example 4: anti-HSV-1 effect of UNC0379 in HFF cells:

(1) well-grown HFF cells were subcultured the first day, and the cells were seeded in a six-well plate in a culture volume of 2ml and starting cell amount of 2X 10⁵One cell/well, incubated in an incubator at 37 ℃ for 24 hours.

(2) Inoculating HSV-1 virus with MOI of 1, mixing, and infecting at 37 deg.C for 1 hr.

(3) The old medium in the six-well plate was discarded, washed once with PBS, 2ml of the medium was added, UNC0379 was added to the experimental wells to a final concentration of 5. mu.M, the same volume of the medium was added to the control wells, and the wells were incubated in an incubator at 37 ℃ for 10 hours.

(4) Extracting genome of the cell according to the genome DNA extraction kit specification, and detecting the virus genome DNA level by using qPCR (quantitative polymerase chain reaction) by using a specific primer, or extracting mRNA (messenger ribonucleic acid) of the cell according to the RNA extraction kit specification, reversing the mRNA into cDNA, and detecting the virus expression level by using qPCR by using the specific primer.

Example 5: UNC0379 has effect of resisting Human Cytomegalovirus (HCMV) in HFF cells

(1) Taking well-grown HFF cells, secondThe cells were subcultured one day and seeded in six-well plates in a culture volume of 2ml and starting cell amount of 2X 10⁵One cell/well, incubated in an incubator at 37 ℃ for 24 hours.

(2) HCMV virus was inoculated with MOI 1, mixed well and placed in a 37 ℃ incubator to infect for 1 hour.

(3) The old medium in the six-well plate was discarded, PBS was washed once, 2ml of DMEM medium was added, UNC0379 was added to the experimental wells to a final concentration of 5. mu.M, the same volume of medium was added to the control wells, and the wells were incubated in an incubator at 37 ℃ for 3 days.

(4) Extracting the genome of the cell according to the genome DNA extraction kit specification, detecting the virus genome DNA level by qPCR by adopting a specific primer, and detecting the virus expression level by qPCR by adopting the specific primer.

Example 6: UNC0379 has effect of resisting human cytomegalovirus MCMV in MEF cells

(1) The well-grown MEF cells were subcultured the first day and seeded in six-well plates in a culture volume of 2ml with a starting cell amount of 2X 10⁵One cell/well, incubated in an incubator at 37 ℃ for 24 hours.

(2) MCMV virus was inoculated, MOI 1, and the mixture was homogenized and incubated at 37 ℃ for 1 hour.

Extracting the genome of the cell according to the genome DNA extraction kit specification, and detecting the virus genome DNA level by qPCR by adopting a specific primer.

Appendix

Sequence listing

<110> Wuhan university

<120> application of histone modification enzyme gene SETD8 in resisting DNA virus

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 24

<212> DNA

<213> human herpesvirus type I (human herpesvirus 1)

<400> 1

cttcagatgg cttcgagatc gtag 24

<210> 2

<211> 23

<212> DNA

<213> human herpesvirus type I (human herpesvirus 1)

<400> 2

tgtttactta aaaggcgtgc cgt 23

<210> 3

<211> 24

<212> DNA

<213> human herpesvirus type I (human herpesvirus 1)

<400> 3

cttcagatgg cttcgagatc gtac 24

<210> 4

<211> 23

<212> DNA

<213> human herpesvirus type I (human herpesvirus 1)

<400> 4

tgtttactta aaaggcgtgc cgt 23

<210> 5

<211> 20

<212> DNA

<213> Human cytomegalovirus (Human cytomegavirus)

<400> 5

acgacaccgt agacctgacc 20

<210> 6

<211> 20

<212> DNA

<213> Human cytomegalovirus (Human cytomegavirus)

<400> 6

aaagaggtgc agtccgctaa 20

<210> 7

<211> 18

<212> DNA

<213> Murine cytomegalovirus (Murine cytomegavirus)

<400> 7

gtgcgttctt cgtccagc 18

<210> 8

<211> 18

<212> DNA

<213> Murine cytomegalovirus (Murine cytomegavirus)

<400> 8

cgcctttgtc tacggtgt 18

<210> 9

<211> 18

<212> DNA

<213> human (Homo sapiens)

<400> 9

cgaaggagcc caggaaga 18

<210> 10

<211> 21

<212> RNA

<213> human (Homo sapiens)

<400> 10

ccaugaaguc cgaggaacau u 21

<210> 11

<211> 21

<212> RNA

<213> human (Homo sapiens)

<400> 11

gcaacagaau cgcaaacuuu u 21

<210> 12

<211> 21

<212> RNA

<213> human (Homo sapiens)

<400> 12

gcaaacuuac ggauuucuau u 21

<210> 13

<211> 44

<212> DNA

<213> human (Homo sapiens)

<400> 13

gcggatccac tagtcccagt aatggctaga ggcaggaaga tgtc 44

<210> 14

<211> 40

<212> DNA

<213> human (Homo sapiens)

<400> 14

atatctgcag aattccacca ttaatgcttc agccacgggt 40

<210> 15

<211> 21

<212> DNA

<213> Escherichia coli (Escherichia coli)

<400> 15

tggtggaatt ctgcagatat c 21

<210> 16

<211> 21

<212> DNA

<213> Escherichia coli (Escherichia coli)

<400> 16

cactggacta gtggatccgc c 21

Claims

1. The application of a histone modification enzyme gene SETD8 as a therapeutic target in preparing anti-DNA virus medicaments is characterized in that: the SETD8 gene is used as a therapeutic target of DNA virus infection, and an inhibitor thereof is used for preparing a medicament for protecting or preventing the DNA virus infection;

the DNA virus is herpes simplex virus HSV-1, human cytomegalovirus HCMV or mouse cytomegalovirus MCMV;

the inhibitor of the SETD8 gene is a small molecule inhibitor UNCO 379.