RU2782833C1 - Method for determining polymorphism of genetic markers of dairy productivity of cattle - Google Patents
Method for determining polymorphism of genetic markers of dairy productivity of cattle Download PDFInfo
- Publication number
- RU2782833C1 RU2782833C1 RU2022103615A RU2022103615A RU2782833C1 RU 2782833 C1 RU2782833 C1 RU 2782833C1 RU 2022103615 A RU2022103615 A RU 2022103615A RU 2022103615 A RU2022103615 A RU 2022103615A RU 2782833 C1 RU2782833 C1 RU 2782833C1
- Authority
- RU
- Russia
- Prior art keywords
- gene
- restriction
- cattle
- prolactin
- milk
- Prior art date
Links
- 230000002068 genetic Effects 0.000 title claims abstract description 25
- 241000283690 Bos taurus Species 0.000 title claims abstract description 23
- 235000013365 dairy product Nutrition 0.000 title claims abstract description 14
- 102100002888 CSN3 Human genes 0.000 claims abstract description 40
- 108060001966 CSN3 Proteins 0.000 claims abstract description 40
- 102000002148 EC 2.3.1.20 Human genes 0.000 claims abstract description 37
- 108010001348 EC 2.3.1.20 Proteins 0.000 claims abstract description 37
- 102100010734 PRL Human genes 0.000 claims abstract description 30
- 229940097325 Prolactin Drugs 0.000 claims abstract description 30
- 108010057464 Prolactin Proteins 0.000 claims abstract description 30
- 102100008842 GH1 Human genes 0.000 claims abstract description 26
- 108010051696 Growth Hormone Proteins 0.000 claims abstract description 26
- 235000021246 κ-casein Nutrition 0.000 claims abstract description 25
- 230000001488 breeding Effects 0.000 claims abstract description 11
- 238000007894 restriction fragment length polymorphism technique Methods 0.000 claims abstract description 4
- 229920002287 Amplicon Polymers 0.000 claims description 45
- 230000003321 amplification Effects 0.000 claims description 12
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 12
- 238000004458 analytical method Methods 0.000 claims description 7
- 102000019632 Acyl transferases Human genes 0.000 claims 1
- 108091022082 Acyl transferases Proteins 0.000 claims 1
- 238000007400 DNA extraction Methods 0.000 claims 1
- 150000001982 diacylglycerols Chemical class 0.000 claims 1
- 229920003013 deoxyribonucleic acid Polymers 0.000 abstract description 18
- 239000005018 casein Substances 0.000 abstract 1
- 235000021240 caseins Nutrition 0.000 abstract 1
- 230000000694 effects Effects 0.000 abstract 1
- 239000000126 substance Substances 0.000 abstract 1
- 210000004080 Milk Anatomy 0.000 description 34
- 235000013336 milk Nutrition 0.000 description 34
- 239000008267 milk Substances 0.000 description 34
- 108091007521 restriction endonucleases Proteins 0.000 description 30
- 239000002773 nucleotide Substances 0.000 description 16
- 125000003729 nucleotide group Chemical group 0.000 description 16
- 238000004519 manufacturing process Methods 0.000 description 12
- 239000000203 mixture Substances 0.000 description 12
- 238000006467 substitution reaction Methods 0.000 description 9
- 238000001962 electrophoresis Methods 0.000 description 8
- 239000011541 reaction mixture Substances 0.000 description 8
- 239000000463 material Substances 0.000 description 7
- 108010042407 Endonucleases Proteins 0.000 description 6
- 102100005410 LINE-1 retrotransposable element ORF2 protein Human genes 0.000 description 6
- 235000021243 milk fat Nutrition 0.000 description 6
- 235000018102 proteins Nutrition 0.000 description 6
- 102000004169 proteins and genes Human genes 0.000 description 6
- 108090000623 proteins and genes Proteins 0.000 description 6
- 239000011543 agarose gel Substances 0.000 description 5
- 239000003550 marker Substances 0.000 description 5
- TWRXJAOTZQYOKJ-UHFFFAOYSA-L MgCl2 Chemical compound [Mg+2].[Cl-].[Cl-] TWRXJAOTZQYOKJ-UHFFFAOYSA-L 0.000 description 4
- 102000014171 Milk Proteins Human genes 0.000 description 4
- 108010011756 Milk Proteins Proteins 0.000 description 4
- 108010006785 Taq Polymerase Proteins 0.000 description 4
- 238000000137 annealing Methods 0.000 description 4
- 239000003153 chemical reaction reagent Substances 0.000 description 4
- 239000008367 deionised water Substances 0.000 description 4
- 239000000499 gel Substances 0.000 description 4
- 235000021239 milk protein Nutrition 0.000 description 4
- 239000002777 nucleoside Substances 0.000 description 4
- -1 nucleoside triphosphates Chemical class 0.000 description 4
- 229920002401 polyacrylamide Polymers 0.000 description 4
- 239000001226 triphosphate Substances 0.000 description 4
- 235000011178 triphosphate Nutrition 0.000 description 4
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 4
- 210000004369 Blood Anatomy 0.000 description 3
- 239000008280 blood Substances 0.000 description 3
- 102100010042 GHR Human genes 0.000 description 2
- 241001465754 Metazoa Species 0.000 description 2
- 102100002982 STAT5A Human genes 0.000 description 2
- 101710035401 STAT5A Proteins 0.000 description 2
- 230000015572 biosynthetic process Effects 0.000 description 2
- 238000005755 formation reaction Methods 0.000 description 2
- 239000000122 growth hormone Substances 0.000 description 2
- 230000006651 lactation Effects 0.000 description 2
- UXDDRFCJKNROTO-UHFFFAOYSA-N (±)-Glycerol 1,2-diacetate Chemical compound CC(=O)OCC(CO)OC(C)=O UXDDRFCJKNROTO-UHFFFAOYSA-N 0.000 description 1
- 238000007399 DNA isolation Methods 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 101700072606 OAC Proteins 0.000 description 1
- 229920004694 Pedigree® Polymers 0.000 description 1
- 238000007844 allele-specific PCR Methods 0.000 description 1
- 150000001413 amino acids Chemical class 0.000 description 1
- 230000000875 corresponding Effects 0.000 description 1
- 230000003247 decreasing Effects 0.000 description 1
- 235000019197 fats Nutrition 0.000 description 1
- 230000009027 insemination Effects 0.000 description 1
- 235000013372 meat Nutrition 0.000 description 1
- 238000003752 polymerase chain reaction Methods 0.000 description 1
- 238000010561 standard procedure Methods 0.000 description 1
Abstract
Description
Изобретение относится к сельскохозяйственной биотехнологии и молекулярной генетике и может быть использовано в селекции крупного рогатого скота молочного направления продуктивности, в частности, как способ определения генетического потенциала крупного рогатого скота по уровню удоя, массовой доли жира и белка в молоке с целью отбора телок, коров быков-производителей для племенных целей и подбора родительских пар в селекционной работе по совершенствованию молочных пород.The invention relates to agricultural biotechnology and molecular genetics and can be used in the selection of dairy cattle for productivity, in particular, as a method for determining the genetic potential of cattle in terms of milk yield, mass fraction of fat and protein in milk in order to select heifers, bull cows - producers for breeding purposes and selection of parent pairs in breeding work to improve dairy breeds.
Известен способ отбора телок с желательным уровнем удоя, содержанием белка и жира в молоке будущих лактации по родословным, общему развитию и экстерьеру, отбора быков-производителей - по показателям молочной продуктивности дочерей. Однако эти традиционные методы отбора животных малоэффективны, связаны с большими временными затратами и материальными издержками.There is a method of selecting heifers with the desired level of milk yield, protein and fat content in the milk of future lactation according to pedigrees, general development and exterior, selection of sires - in terms of milk productivity of daughters. However, these traditional methods of animal selection are ineffective, associated with large time and material costs.
Развитие молекулярно-генетических методов анализа, основанных на полимеразной цепной реакции ПЦР, сделало возможным создать новые маркерные системы, обеспечивающие определение генотипов животных непосредственно на уровне генетического материала клетки, на уровне ДНК, независимо от пола и возраста, сократить время анализа и повысить его точность.The development of molecular genetic analysis methods based on the PCR polymerase chain reaction has made it possible to create new marker systems that ensure the determination of animal genotypes directly at the level of the genetic material of the cell, at the DNA level, regardless of sex and age, reduce the time of analysis and increase its accuracy.
Существуют методы оценки генетического потенциала коров, которые основаны, как правило, на использовании одного генетического маркера. Например, жирномолочность оценивают по гену DGAT1 [1].There are methods for assessing the genetic potential of cows, which are usually based on the use of a single genetic marker. For example, milk fat content is estimated by the DGAT1 gene [1].
Генетический потенциал белковомолочности крупного рогатого скота определяют с помощью анализа полиморфизма гена каппа-казеина [2].The genetic potential of milk protein in cattle is determined by analyzing the polymorphism of the kappa-casein gene [2].
При оценке генетических возможностей коров относительно уровня удоя используют анализ полиморфизма генов пролактина [3], рецептора гормона роста GHR [4], гена белка STAT5A [5], однако такой подход является устаревшим и затратным.When assessing the genetic capabilities of cows in relation to the level of milk production, the analysis of polymorphism of the prolactin genes [3], the growth hormone receptor GHR [4], and the STAT5A protein gene [5] is used, but this approach is outdated and costly.
Более перспективны способы оценки генетического потенциала коров по показателям молочной продуктивности, учитывающие совместное влияние двух или нескольких генов, участвующих в формировании признака молочной продуктивности.More promising are methods for assessing the genetic potential of cows in terms of milk productivity, taking into account the combined influence of two or more genes involved in the formation of a trait of milk productivity.
В качестве прототипа выбран способ определения генетического потенциала крупного рогатого скота по качеству молока. Генетический потенциал крупного рогатого скота оценивают путем ДНК-тестирования ПЦР-ПДРФ метод генотипов животных по RsaI-маркеру гена пролактина и AluI-маркеру гена гормона роста и выявлении сопряженных генотипов по локусам пролактина и соматотропина - гормона роста, определяющих повышенное или пониженное содержание жира и белка в молоке, согласно разработанному перечню генотипов [6].As a prototype, a method for determining the genetic potential of cattle by the quality of milk was chosen. The genetic potential of cattle is assessed by DNA testing of the PCR-RFLP method of animal genotypes by the RsaI marker of the prolactin gene and the AluI marker of the growth hormone gene and the identification of conjugated genotypes by the loci of prolactin and somatotropin - growth hormone, which determine an increased or decreased content of fat and protein in milk, according to the developed list of genotypes [6].
Задача изобретения - создание способа характеризующегося повышенной эффективностью определения генетического потенциала по параметрам молочной продуктивности крупного рогатого скота для выявления перспективных животных, до начала оценки животного по лактации в молочном скотоводстве и племенной работе, значительно сокращающего временные и экономические затраты.The objective of the invention is to create a method characterized by increased efficiency for determining the genetic potential in terms of dairy productivity of cattle to identify promising animals, before the animal is evaluated for lactation in dairy cattle breeding and breeding, significantly reducing time and economic costs.
Сущность изобретения - способ использования тест-систем, основанных на HindIII-изменчивости гена каппа казеина, EaeI-изменчивости гена диацилглицерол О-ацилтрансферазы, AluI изменчивости гена соматотропина и RsaI - изменчивости гена пролактина, для выявления генотипов, ассоциированных с параметрами молочной продуктивности и определения генетического потенциала крупного рогатого скота по уровню удоя, содержания жира и белка в молоке, которые могут широко использованы при селекции молочных пород.The essence of the invention is a method of using test systems based on the HindIII variability of the kappa casein gene, EaeI variability of the diacylglycerol O-acyltransferase gene, AluI variability of the somatotropin gene and RsaI - variability of the prolactin gene, to identify genotypes associated with parameters of milk production and determine the genetic potential of cattle in terms of milk yield, fat and protein content in milk, which can be widely used in the selection of dairy breeds.
Использование в предлагаемом способе генов каппа-казеина, диацилглицерол О-ацилтрансферазы, пролактина и соматотропина, участвующих в формировании молочной продуктивности, более эффективно по сравнению с прототипом отражает генетический потенциал молочной продуктивности крупного рогатого скота.Use in the proposed method genes kappa-casein, diacylglycerol O-acyltransferase, prolactin and somatotropin involved in the formation of milk productivity, more effectively than the prototype reflects the genetic potential of dairy productivity of cattle.
HindIII - рестрикционный полиморфизм гена каппа-казеина обусловлен заменой А-С возникающей в 13100 нуклеотиде гена аллель А - IDGenBank AY380228 в 13105 нуклеотиде гена аллель В - IDGenBank AY3 80229, что обусловлено сайтом рестрикции при наличии такого полиморфизма. EaeI - рестрикционный полиморфизм гена диацилглицерол О-ацилтрансферазы обусловлен заменой GC-AA возникающей в 115, 116 нуклеотиде гена аллель К - IDGenBank JQ 897353 в 115,116 нуклеотиде гена аллель А - IDGenBank JQ897351, что обусловлено сайтом рестрикции при наличии такого полиморфизма. AluI - рестрикционный полиморфизм гена соматотропина гормона роста обусловлен заменой C-G возникающей в 46 нуклеотиде гена аллель L - IDGenBank МТ108894 в 46 нуклеотиде гена аллель V - IDGenBank МТ108895, что обусловлено сайтом рестрикции при наличии такого полиморфизма. RsaI рестрикционный полиморфизм гена пролактина обусловлен заменой A-G возникающей в 473 нуклеотиде гена аллель А - IDGenBank ХМ027524256 в 447 нуклеотиде гена аллель В - IDGenBank ВС 148124, что обусловлено сайтом рестрикции при наличии такого полиморфизма. Такой нуклеотидный полиморфизм характеризуется заменой соответствующих аминокислот, что и проявляется в различиях значений молочной продуктивности коров.HindIII - restriction polymorphism of the kappa-casein gene is caused by the A-C substitution arising in the 13100 nucleotide of the allele A gene - IDGenBank AY380228 in the 13105 nucleotide of the allele B gene - IDGenBank AY3 80229, which is due to the restriction site in the presence of such a polymorphism. EaeI - restriction polymorphism of the diacylglycerol O-acyltransferase gene is caused by the replacement of GC-AA occurring at 115, 116 nucleotides of the allele K gene - IDGenBank JQ 897353 in 115,116 nucleotides of the allele A gene - IDGenBank JQ897351, which is due to the restriction site in the presence of such a polymorphism. AluI - restriction polymorphism of the growth hormone somatotropin gene is caused by the C-G replacement of the L allele - IDGenBank МТ108894 in the 46 nucleotide of the gene allele V - IDGenBank МТ108895, which occurs in the 46 nucleotide of the gene, which is due to the restriction site in the presence of such a polymorphism. The RsaI restriction polymorphism of the prolactin gene is caused by the A-G substitution arising in the 473 nucleotide of the gene allele A - IDGenBank XM027524256 in the 447 nucleotide of the allele B gene - IDGenBank BC 148124, which is due to the restriction site in the presence of such a polymorphism. Such nucleotide polymorphism is characterized by the replacement of the corresponding amino acids, which is manifested in the differences in the values of milk production of cows.
Способ основан на ПЦР анализируемых генов с последующим рестрикционным анализом продуктов амплификации, метод ПЦР-ПДРФ и включает в себя выделение ДНК, амплификацию генов пролактина, соматотропина, диацилглицерол О-ацилтрансферазы и каппа-казеина с использованием специфичных праймеров, рестрикционный анализ полученных ампликонов RsaI-, AluI-, EaeI- и HindIII-эндонуклеазами, соответственно, установление генотипов по каждому гену:The method is based on PCR of the analyzed genes with subsequent restriction analysis of amplification products, the PCR-RFLP method and includes DNA isolation, amplification of prolactin, somatotropin, diacylglycerol O-acyltransferase and kappa-casein genes using specific primers, restriction analysis of the obtained amplicons RsaI-, AluI-, EaeI- and HindIII-endonucleases, respectively, the establishment of genotypes for each gene:
- продукты рестрикции ампликона гена пролактина молекулярной массой 61 и 98 п.н. свидетельствуют о наличии аллельного варианта ВВ рестриктаза RsaI определила сайт рестрикции и расщепила все имеющиеся ампликоны, продукты рестрикции ампликона гена пролактина молекулярной массой 61 и 98 п.н. в совокупности с исходным ампликонов молекулярной массой 159 п.н. свидетельствуют о наличии аллельного варианта АВ рестриктаза RsaI определила сайт рестрикции и расщепила часть ампликонов, где есть сайт рестрикции, ампликоны с нуклеотидной заменой характеризовались отсутствием сайта рестрикции и остались в исходном состоянии, наличие после рестрикции лишь фрагмента ДНК молекулярной массой 159 п.н. свидетельствуют о наличии аллельного варианта АА ампликоны с нуклеотидной заменой характеризовались отсутствием сайта рестрикции и остались в исходном состоянии;- restriction products of the prolactin gene amplicon with a molecular weight of 61 and 98 bp. indicate the presence of an allelic variant of the BB restriction enzyme RsaI determined the restriction site and cleaved all available amplicons, restriction products of the prolactin gene amplicon with a molecular weight of 61 and 98 bp. in combination with the original amplicons with a molecular weight of 159 bp. indicate the presence of an allelic variant of the AB restriction enzyme RsaI determined the restriction site and cleaved a part of the amplicons where there is a restriction site; indicate the presence of the AA allelic variant; amplicons with nucleotide substitution were characterized by the absence of a restriction site and remained in their original state;
- продукты рестрикции ампликона гена каппа-казеина молекулярной массой 62 и 69 п.н. свидетельствуют о наличии аллельного варианта ВВ рестриктаза Hindlll определила сайт рестрикции и расщепила все имеющиеся ампликоны, продукты рестрикции ампликона гена пролактина молекулярной массой 62 и 69 п.н. в совокупности с исходным ампликонов молекулярной массой 131 п.н. свидетельствуют о наличии аллельного варианта АВ рестриктаза HindIII определила сайт рестрикции и расщепила часть ампликонов, где есть сайт рестрикции, ампликоны с нуклеотидной заменой характеризовались отсутствием сайта рестрикции и остались в исходном состоянии, наличие после рестрикции лишь фрагмента ДНК молекулярной массой 131 п.н. свидетельствуют о наличии аллельного варианта АА ампликоны с нуклеотидной заменой характеризовались отсутствием сайта рестрикции и остались в исходном состоянии;- restriction products of the kappa-casein gene amplicon with a molecular weight of 62 and 69 bp. indicate the presence of an allelic variant of the BB restriction enzyme Hindll determined the restriction site and cleaved all available amplicons, restriction products of the prolactin gene amplicon with a molecular weight of 62 and 69 bp. in combination with the original amplicons with a molecular weight of 131 bp. indicate the presence of an allelic variant of the AV restriction enzyme HindIII determined the restriction site and cleaved part of the amplicons, where there is a restriction site, amplicons with nucleotide substitution were characterized by the absence of a restriction site and remained in their original state; indicate the presence of the AA allelic variant; amplicons with nucleotide substitution were characterized by the absence of a restriction site and remained in their original state;
- продукты рестрикции ампликона гена диацилглицерол О-ацилтрансферазы молекулярной массой 84 и 163 п.н. свидетельствуют о наличии аллельного варианта КК рестриктаза EaeI определила сайт рестрикции и расщепила все имеющиеся ампликоны, продукты рестрикции ампликона гена пролактина молекулярной массой 84 и 163 п.н. в совокупности с исходным ампликонов молекулярной массой 247 п.н. свидетельствуют о наличии аллельного варианта АК рестриктаза EaeI определила сайт рестрикции и расщепила часть ампликонов, где есть сайт рестрикции, ампликоны с нуклеотидной заменой характеризовались отсутствием сайта рестрикции и остались в исходном состоянии, наличие после рестрикции лишь фрагмента ДНК молекулярной массой 247 п.н. свидетельствуют о наличии аллельного варианта АА ампликоны с нуклеотидной заменой характеризовались отсутствием сайта рестрикции и остались в исходном состоянии;- restriction products of the diacylglycerol O-acyltransferase gene amplicon with a molecular weight of 84 and 163 bp. indicate the presence of an allelic variant of the CC restriction endonuclease EaeI determined the restriction site and cleaved all available amplicons, restriction products of the prolactin gene amplicon with a molecular weight of 84 and 163 bp. in combination with the original amplicons with a molecular weight of 247 bp. indicate the presence of an allelic variant of the AK restriction enzyme EaeI determined the restriction site and cleaved part of the amplicons, where there is a restriction site, amplicons with nucleotide substitution were characterized by the absence of a restriction site and remained in their original state, the presence after restriction of only a DNA fragment with a molecular weight of 247 bp. indicate the presence of the AA allelic variant; amplicons with nucleotide substitution were characterized by the absence of a restriction site and remained in their original state;
продукты рестрикции ампликона гена соматотропина молекулярной массой 39 и 142 п.н. свидетельствуют о наличии аллельного варианта LL рестриктаза AluI определила сайт рестрикции и расщепила все имеющиеся ампликоны, продукты рестрикции ампликона гена пролактина молекулярной массой 39 и 142 п.н. в совокупности с исходным ампликонов молекулярной массой 181 п.н. свидетельствуют о наличии аллельного варианта LV рестриктаза AluI определила сайт рестрикции и расщепила часть ампликонов, где есть сайт рестрикции, ампликоны с нуклеотидной заменой характеризовались отсутствием сайта рестрикции и остались в исходном состоянии, наличие после рестрикции лишь фрагмента ДНК молекулярной массой 181 п.н. свидетельствуют о наличии аллельного варианта VV ампликоны с нуклеотидной заменой характеризовались отсутствием сайта рестрикции и остались в исходном состоянии.restriction products of the somatotropin gene amplicon with a molecular weight of 39 and 142 bp. indicate the presence of an allelic variant of the LL restriction enzyme AluI determined the restriction site and cleaved all available amplicons, restriction products of the prolactin gene amplicon with a molecular weight of 39 and 142 bp. in combination with the original amplicons with a molecular weight of 181 bp. indicate the presence of the allelic variant of the LV restriction enzyme AluI determined the restriction site and cleaved part of the amplicons, where there is a restriction site, amplicons with nucleotide substitution were characterized by the absence of a restriction site and remained in their original state, the presence after restriction of only a DNA fragment with a molecular weight of 181 bp. indicate the presence of the allelic variant of VV amplicons with nucleotide substitution were characterized by the absence of a restriction site and remained in their original state.
При анализе продуктивных качеств крупного рогатого скота учитываются следующие показатели:When analyzing the productive qualities of cattle, the following indicators are taken into account:
- генотип АА гена пролактина указывает на высокий потенциал по количеству получаемого молока, генотип ВВ гена пролактина указывает на высокий потенциал белковомолочности и жирномолочности, генотип АВ характеризует средний потенциал молочной продуктивности;- the AA genotype of the prolactin gene indicates a high potential in terms of the amount of milk received, the BB genotype of the prolactin gene indicates a high potential for milk protein and milk fat, the AB genotype characterizes the average potential of milk production;
- генотип LL гена соматотропина указывает на высокий потенциал по количеству получаемого молока, генотип VV гена соматотропина указывает на высокий потенциал жирномолочности, генотип LV гена соматотропина характеризует средний потенциал молочной продуктивности;- the LL genotype of the somatotropin gene indicates a high potential for the amount of milk produced, the VV genotype of the somatotropin gene indicates a high potential for fat milk, the LV genotype of the somatotropin gene characterizes the average potential of milk production;
- генотип КК гена диацилглицерол О-ацилтрансферазы указывает на высокий потенциал жирномолочности, генотип АА гена диацилглицерол О-ацилтрансферазы указывает на высокий потенциал уровня удоя, но низкий потенциал жирномолочности, генотип АК характеризует средний потенциал молочной продуктивности;- the CC genotype of the diacylglycerol O-acyltransferase gene indicates a high potential for milk fat, the AA genotype of the diacylglycerol O-acyltransferase gene indicates a high potential for milk yield, but a low potential for milk fat, the AK genotype characterizes the average potential of milk production;
- генотип АА гена каппа-казеина указывает на низкий потенциал белковомолочности, генотип ВВ гена каппа-казеина указывает на высокий потенциал белковомолочности, генотип АВ характеризует средний потенциал молочной продуктивности.- the AA genotype of the kappa-casein gene indicates a low milk protein potential, the BB genotype of the kappa-casein gene indicates a high milk protein potential, the AB genotype characterizes the average potential of milk production.
Способ осуществляют следующим образом.The method is carried out as follows.
1. Выделяют ДНК из образцов крови 200 мкл животного с применением набора реагентов «ДНК сорб-В» (ЦНИИ Эпидемиологии, Москва) или любым другим стандартным методом. Возможно использование иных образцов, содержащих ДНК.1. DNA is isolated from 200 µl animal blood samples using the DNA sorb-B reagent kit (Central Research Institute of Epidemiology, Moscow) or any other standard method. It is possible to use other samples containing DNA.
2. Амплификацию выполняют, используя реакционную смесь для следующего состава на одну пробу: деионизированная вода 11 мкл; 10-кратный ПЦР-буфер 2,5 мкл; смесь нуклеозид трифосфатов 2,5 мМ 2,5 мкл; раствор MgCl2 25 мМ 2,5 мкл; праймеры 10 пкМ по 0,5 мкл; Taq ДНК-полимераза (5Е/мкл) 0,5 мкл (специфичные праймеры для гена PRL: FPPRL 5'- GCTTGATTCTTGGGTTGCTGC -3' и RPPRL 5'-CAAATATCATCTCCATGCCTTCCA -3'; для гена GH: FPGH 5'-AAGGACCTGGAGGAAGGCATC -3' и RPGH 5'-TCTCCGTCTTATGCAGGTCCTTC -3'; для гена DGAT1: FPDGAT 5'-TGCCACTTGCCTCGGGACC -3' и RPDGAT 5'- CACAGGGTGGGGGCGAA -3'; для гена CSN3: FPCAS 5'- CATTGCTAGTGGTGAGCCTACAAGTA -3' и RPCAS 5'- CAGTTGAAGTAACTTGGACTGTGTTGAT -3'); ДНК исследуемого образца 5 мкл. Общий объем реакционной смеси составляет 25 мкл. Программа для амплификации должна быть следующей: 1. 95°С 5 мин 1 цикл; 2. 94°С 30 с, отжиг праймеров 30 с. (56,6°С для гена PRL, 55,9°С для гена GH, 57,2°С для гена DGAT1, 55,9°С для гена CSN3), 72°С 30 с. 42 цикла; 3. 72°С 10 мин 1 цикл.2. Amplification is performed using the reaction mixture for the following composition per sample: deionized water 11 µl; 10x PCR buffer 2.5 µl; a mixture of nucleoside triphosphates 2.5 mM 2.5 µl; MgCl 2 solution 25 mM 2.5 µl; primers 10 pcM, 0.5 µl; Taq DNA polymerase (5U/µl) 0.5 µl (specific primers for the PRL gene: FPPRL 5'- GCTTGATTCTTGGGTTGCTGC -3' and RPPRL 5'-CAAATATCATCTCCATGCCTTCCA -3'; for the GH gene: FPGH 5'-AAGGACCTGGAGGAAGGCATC -3' and RPGH 5'-TCTCCGTCTTATGCAGGTCCTTC -3'; for the DGAT1 gene: FPDGAT 5'-TGCCACTTGCCTCGGGACC -3' and RPDGAT 5'- CACAGGGTGGGGGCGAA -3'; for the CSN3 gene: FPCAS 5'- CATTGCTAGTGGTGAGCCTACAAGTA -3' and RPCAS 5'- CAGTTGATTGATTGACTTG -3'); DNA of the test sample 5 µl. The total volume of the reaction mixture is 25 μl. The program for amplification should be as follows: 1. 95°C 5 min 1 cycle; 2. 94°C for 30 s, primer annealing for 30 s. (56.6°C for the PRL gene, 55.9°C for the GH gene, 57.2°C for the DGAT1 gene, 55.9°C for the CSN3 gene), 72°C 30 s. 42 cycles; 3. 72°C 10 min 1 cycle.
Праймеры для специфической амплификации представлены в таблице 1.Primers for specific amplification are presented in Table 1.
Размер полученных фрагментов определяют методом электрофореза в 3% агарозном геле.The size of the obtained fragments is determined by electrophoresis in 3% agarose gel.
3. Проводят рестрикцию амплифицированного фрагмента гена PRL эндонуклеазой рестрикции RsaI, гена GH эндонуклеазой рестрикции AluI, гена DGAT1 эндонуклеазой рестрикции EaeI, гена CSN3 эндонуклеазой рестрикции Hindlll, в стандартных условиях.3. Restriction of the amplified PRL gene fragment by restriction endonuclease RsaI, GH gene by restriction endonuclease AluI, DGAT1 gene by restriction endonuclease EaeI, CSN3 gene by restriction endonuclease Hindlll are carried out under standard conditions.
4. Размер полученных рестрикционных фрагментов определяют методом электрофореза в 3%-ном агарозном геле, либо в 12%-ном полиакриламидном геле.4. The size of the obtained restriction fragments is determined by electrophoresis in a 3% agarose gel, or in a 12% polyacrylamide gel.
5. Определяют генотипы по каждому гену (согласно табл.2)5. Determine the genotypes for each gene (according to Table 2)
6. Сравнивают выявленные у животных генотипы с генотипами, определяющими молочную продуктивность, согласно данным приведенным выше описание способа.6. The genotypes identified in animals are compared with the genotypes that determine milk production, according to the data given above, the description of the method.
7. Принимают решение о целесообразности использования животного с данным генотипом в молочном производстве и селекционной работе.7. They make a decision on the advisability of using an animal with this genotype in dairy production and breeding work.
Пример 1. Данным способом был проведен анализ одного образца от теленка двухнедельного возраста черно-пестрой породы. Определены генотипы животного по отдельным локусам (пролактина (PRL), соматотропина (GH), диацилглицерол О-ацилтрансферазы (DGAT1) и каппа-казеина (CSN3)), сформировано заключение о дальнейшем использовании теленка.Example 1. In this way, one sample was analyzed from a two-week-old Black-and-White calf. The genotypes of the animal were determined for individual loci (prolactin (PRL), somatotropin (GH), diacylglycerol O-acyltransferase (DGAT1) and kappa-casein (CSN3)), a conclusion was made on the further use of the calf.
Выделили ДНК из образца крови 200 мкл животного с применением набора реагентов «ДНК сорб-В» (ЦНИИ Эпидемиологии, Москва).DNA was isolated from a 200 µl animal blood sample using the DNA sorb-B reagent kit (Central Research Institute of Epidemiology, Moscow).
Выполнили амплификацию, используя реакционную смесь для следующего состава на одну пробу: деионизированная вода 11 мкл; 10-кратный ПЦР-буфер 2,5 мкл; смесь нуклеозид трифосфатов 2,5 мМ 2,5 мкл; раствор MgCl2 25 мМ 2,5 мкл; праймеры 10 пкМ по 0,5 мкл; Taq ДНК-полимераза (5Е/мкл) 0,5 мкл; ДНК исследуемого образца 5 мкл. Общий объем реакционной смеси составляет 25 мкл. Программа для амплификации была следующей: 1. 95°С 5 мин 1 цикл; 2. 94°С 30 с, отжиг праймеров 30 с. (56,6°С для гена PRL, 55,9°С для гена GH, 57,2°С для гена DGAT1, 55,9°С для гена CSN3), 72°С 30 с. 42 цикла; 3. 72°С 10 мин 1 цикл.Amplification was performed using the reaction mixture for the following composition per sample: deionized water 11 μl; 10x PCR buffer 2.5 µl; a mixture of nucleoside triphosphates 2.5 mM 2.5 µl; MgCl 2 solution 25 mM 2.5 µl; primers 10 pcM, 0.5 µl; Taq DNA polymerase (5U/µl) 0.5 µl; DNA of the test sample 5 µl. The total volume of the reaction mixture is 25 μl. The program for amplification was as follows: 1. 95°C 5 min 1 cycle; 2. 94°C for 30 s, primer annealing for 30 s. (56.6°C for the PRL gene, 55.9°C for the GH gene, 57.2°C for the DGAT1 gene, 55.9°C for the CSN3 gene), 72°C 30 s. 42 cycles; 3. 72°C 10 min 1 cycle.
По результатам электрофореза в 3% агарозном геле установили наличие следующих ампликонов: ген пролактина около 160 п.н.; ген соматотропина около 180 п.н.; ген диацилглицерол О-ацилтрансферазы около 250 п.н.; ген каппа-казеина около 130 п.н.According to the results of electrophoresis in 3% agarose gel, the presence of the following amplicons was established: the prolactin gene, about 160 bp; somatotropin gene about 180 bp; gene diacylglycerol O-acyltransferase about 250 bp; kappa-casein gene about 130 bp
Провели рестрикцию амплифицированного фрагмента гена PRL эндонуклеазой рестрикции RsaI, гена GH эндонуклеазой рестрикции AluI, гена DGAT1 эндонуклеазой рестрикции EaeI, гена CSN3 эндонуклеазой рестрикции Hindlll, в стандартных условиях.Restriction of the amplified PRL gene fragment with restriction endonuclease RsaI, GH gene with restriction endonuclease AluI, DGAT1 gene with restriction endonuclease EaeI, and CSN3 gene with restriction endonuclease Hindlll were carried out under standard conditions.
Размеры полученных рестрикционных фрагментов определили методом электрофореза в 12%-ном полиакриламидном геле, которые составляли:The sizes of the obtained restriction fragments were determined by electrophoresis in 12% polyacrylamide gel, which were:
- рестрикции ампликона гена пролактина эндонуклеазой RsaI характеризовалась паттернами молекулярной массой 61 и 98 п.н.;- restriction of the prolactin gene amplicon by RsaI endonuclease was characterized by patterns of molecular weights of 61 and 98 bp;
- рестрикции ампликона гена соматотропина эндонуклеазой AluI характеризовалась паттернами молекулярной массой 39, 142 и 181 п.н.;- restriction of the somatotropin gene amplicon by endonuclease AluI was characterized by patterns of molecular weight of 39, 142 and 181 bp;
- рестрикции ампликона гена диацилглицерол О-ацилтрансферазы эндонуклеазой рестрикции EaeI характеризовалась паттерном молекулярной массой 247 п.н.;- restriction of the amplicon of the gene diacylglycerol O-acyltransferase by restriction endonuclease EaeI was characterized by a pattern with a molecular weight of 247 bp;
рестрикции ампликона гена каппа-казеина эндонуклеазой рестрикции Hindlll характеризовалась паттерном молекулярной массой 131 п.н.restriction of the kappa-casein gene amplicon by the restriction endonuclease Hindll was characterized by a pattern with a molecular weight of 131 bp.
Следовательно, генотип исследуемого животного составило по гену пролактина ВВ, по гену соматотропина VL, по гену диацилглицерол О-ацилтрансферазы АА и по гену каппа-казеина АА, что является признаком не высокой молочной продуктивности, рекомендуется данное животное содержать только для дальнейшего откорма и реализации на мясо.Therefore, the genotype of the studied animal was according to the prolactin BB gene, the somatotropin VL gene, the AA diacylglycerol O-acyltransferase gene and the AA kappa-casein gene, which is a sign of low milk productivity, it is recommended that this animal be kept only for further fattening and sale on meat.
Пример 2. Данным способом был проведен анализ одного образца от теленка месячного возраста черно-пестрой породы. Определены генотипы животного по отдельным локусам (пролактина (PRL), соматотропина (GH), диацилглицерол О-ацилтрансферазы (DGAT1) и каппа-казеина (CSN3)), сформировано заключение о дальнейшем использовании теленка.Example 2. In this way, one sample was analyzed from a calf of one month of age of the Black-and-White breed. The genotypes of the animal were determined for individual loci (prolactin (PRL), somatotropin (GH), diacylglycerol O-acyltransferase (DGAT1) and kappa-casein (CSN3)), a conclusion was made on the further use of the calf.
Выделили ДНК из образца крови 200 мкл животного с применением набора реагентов «ДНК сорб-В» (ЦНИИ Эпидемиологии, Москва).DNA was isolated from a 200 µl animal blood sample using the DNA sorb-B reagent kit (Central Research Institute of Epidemiology, Moscow).
Выполнили амплификацию, используя реакционную смесь для следующего состава на одну пробу: деионизированная вода 11 мкл; 10-кратный ПЦР-буфер 2,5 мкл; смесь нуклеозид трифосфатов 2,5 мМ 2,5 мкл; раствор MgCl2 25 мМ 2,5 мкл; праймеры 10 пкМ по 0,5 мкл; Taq ДНК-полимераза (5Е/мкл) 0,5 мкл; ДНК исследуемого образца 5 мкл. Общий объем реакционной смеси составляет 25 мкл. Программа для амплификации была следующей: 1. 95°С 5 мин 1 цикл; 2. 94°С 30 с, отжиг праймеров 30 с. (56,6°С для гена PRL, 55,9°С для гена GH, 57,2°С для гена DGAT1, 55,9°С для гена CSN3), 72°С 30 с. 42 цикла; 3. 72°С 10 мин 1 цикл.Amplification was performed using the reaction mixture for the following composition per sample: deionized water 11 μl; 10x PCR buffer 2.5 µl; a mixture of nucleoside triphosphates 2.5 mM 2.5 µl; MgCl 2 solution 25 mM 2.5 µl; primers 10 pcM, 0.5 µl; Taq DNA polymerase (5U/µl) 0.5 µl; DNA of the test sample 5 µl. The total volume of the reaction mixture is 25 μl. The program for amplification was as follows: 1. 95°C 5 min 1 cycle; 2. 94°C for 30 s, primer annealing for 30 s. (56.6°C for the PRL gene, 55.9°C for the GH gene, 57.2°C for the DGAT1 gene, 55.9°C for the CSN3 gene), 72°C 30 s. 42 cycles; 3. 72°C 10 min 1 cycle.
По результатам электрофореза в 3% агарозном геле установили наличие следующих ампликонов: ген пролактина около 160 п.н.; ген соматотропина около 180 п.н.; ген диацилглицерол О-ацилтрансферазы около 250 п.н.; ген каппа-казеина около 130 п.н.According to the results of electrophoresis in 3% agarose gel, the presence of the following amplicons was established: the prolactin gene, about 160 bp; somatotropin gene about 180 bp; gene diacylglycerol O-acyltransferase about 250 bp; kappa-casein gene about 130 bp
Провели рестрикцию амплифицированного фрагмента гена PRL эндонуклеазой рестрикции RsaI, гена GH эндонуклеазой рестрикции AluI, гена DGAT1 эндонуклеазой рестрикции EaeI, гена CSN3 эндонуклеазой рестрикции Hindlll, в стандартных условиях.Restriction of the amplified PRL gene fragment with restriction endonuclease RsaI, GH gene with restriction endonuclease AluI, DGAT1 gene with restriction endonuclease EaeI, and CSN3 gene with restriction endonuclease Hindlll were carried out under standard conditions.
Размеры полученных рестрикционных фрагментов определили методом электрофореза в 12%-ном полиакриламидном геле, которые составляли:The sizes of the obtained restriction fragments were determined by electrophoresis in 12% polyacrylamide gel, which were:
- рестрикции ампликона гена пролактина эндонуклеазой RsaI характеризовалась паттерном молекулярной массой 159 п.н.;- restriction of the prolactin gene amplicon by RsaI endonuclease was characterized by a pattern with a molecular weight of 159 bp;
- рестрикции ампликона гена соматотропина эндонуклеазой AluI характеризовалась паттернами молекулярной массой 39 и 142 п.н.;- restriction of the somatotropin gene amplicon by endonuclease AluI was characterized by patterns of molecular weight of 39 and 142 bp;
- рестрикции ампликона гена диацилглицерол О-ацилтрансферазы эндонуклеазой рестрикции EaeI характеризовалась паттернами молекулярной массой 84 и 163 п.н.;- restriction of the amplicon of the gene diacylglycerol O-acyltransferase by restriction endonuclease EaeI was characterized by patterns of molecular weight of 84 and 163 bp;
рестрикции ампликона гена каппа-казеина эндонуклеазой рестрикции Hindlll характеризовалась паттернами молекулярной массой 62 и 69 п.н.restriction of the kappa-casein gene amplicon by restriction endonuclease Hindll was characterized by patterns of molecular weights of 62 and 69 bp.
Следовательно, генотип исследуемого животного составило по гену пролактина АА, по гену соматотропина LL, по гену диацилглицерол О-ацилтрансферазы КК и по гену каппа-казеина ВВ, что является признаком хорошей молочной продуктивности, рекомендуется данное животное разводить для повышения качества молока, и получения потомства с высоким потенциалом по белковомолочности и жирномолочности.Therefore, the genotype of the studied animal was the prolactin AA gene, the somatotropin LL gene, the diacylglycerol O-acyltransferase gene KK and the kappa-casein gene BB, which is a sign of good milk productivity, it is recommended that this animal be bred to improve the quality of milk and produce offspring with a high potential for protein and milk fat.
Пример 3. Данным способом был проведен анализ одного образца семенного материала, применяемого для осеменения коров. Определены генотипы животного по отдельным локусам (пролактина (PRL), соматотропина (GH), диацилглицерол О-ацилтрансферазы (DGAT1) и каппа-казеина (CSN3)), сформировано заключение о дальнейшем использовании семенного материала.Example 3. This method was used to analyze one sample of seed material used for insemination of cows. Animal genotypes were determined for individual loci (prolactin (PRL), somatotropin (GH), diacylglycerol O-acyltransferase (DGAT1) and kappa-casein (CSN3)), a conclusion was made on the further use of seed material.
Выделили ДНК из образца с применением набора реагентов «ДНК сорб-В» (ЦНИИ Эпидемиологии, Москва).DNA was isolated from the sample using the DNA sorb-B reagent kit (Central Research Institute of Epidemiology, Moscow).
Выполнили амплификацию, используя реакционную смесь для следующего состава (на одну пробу): деионизированная вода 11 мкл; 10-кратный ПЦР-буфер 2,5 мкл; смесь нуклеозид трифосфатов 2,5 мМ 2,5 мкл; раствор MgCl2 25 мМ 2,5 мкл; праймеры 10 пкМ по 0,5 мкл; Taq ДНК-полимераза (5Е/мкл) 0,5 мкл; ДНК исследуемого образца 5 мкл. Общий объем реакционной смеси составляет 25 мкл. Программа для амплификации была следующей: 1. 95°С 5 мин 1 цикл; 2. 94°С 30 с, отжиг праймеров 30 с. (56,6°С для гена PRL, 55,9°С для гена GH, 57,2°С для гена DGAT1, 55,9°С для гена CSN3), 72°С 30 с. 42 цикла; 3. 72°С 10 мин 1 цикл.Performed amplification using the reaction mixture for the following composition (per sample): deionized water 11 μl; 10x PCR buffer 2.5 µl; a mixture of nucleoside triphosphates 2.5 mM 2.5 μl; MgCl 2 solution 25 mM 2.5 µl; primers 10 pcM, 0.5 µl; Taq DNA polymerase (5U/µl) 0.5 µl; DNA of the test sample 5 µl. The total volume of the reaction mixture is 25 μl. The program for amplification was as follows: 1. 95°C 5 min 1 cycle; 2. 94°C for 30 s, primer annealing for 30 s. (56.6°C for the PRL gene, 55.9°C for the GH gene, 57.2°C for the DGAT1 gene, 55.9°C for the CSN3 gene), 72°C 30 s. 42 cycles; 3. 72°C 10 min 1 cycle.
По результатам электрофореза в 3% агарозном геле установили наличие следующих ампликонов: ген пролактина около 160 п.н.; ген соматотропина около 180 п.н.; ген диацилглицерол О-ацилтрансферазы около 250 п.н.; ген каппа-казеина около 130 п.н.According to the results of electrophoresis in 3% agarose gel, the presence of the following amplicons was established: the prolactin gene, about 160 bp; somatotropin gene about 180 bp; gene diacylglycerol O-acyltransferase about 250 bp; kappa-casein gene about 130 bp
Провели рестрикцию амплифицированного фрагмента гена PRL эндонуклеазой рестрикции RsaI, гена GH эндонуклеазой рестрикции AluI, гена DGAT1 эндонуклеазой рестрикции EaeI, гена CSN3 эндонуклеазой рестрикции Hindlll, в стандартных условиях.Restriction of the amplified PRL gene fragment with restriction endonuclease RsaI, GH gene with restriction endonuclease AluI, DGAT1 gene with restriction endonuclease EaeI, and CSN3 gene with restriction endonuclease Hindlll were carried out under standard conditions.
Размеры полученных рестрикционных фрагментов определили методом электрофореза в 12%-ном полиакриламидном геле, которые составляли:The sizes of the obtained restriction fragments were determined by electrophoresis in 12% polyacrylamide gel, which were:
- рестрикции ампликона гена пролактина эндонуклеазой RsaI характеризовалась паттернами молекулярной массой 61, 98 и 159 п.н.;- restriction of the prolactin gene amplicon by RsaI endonuclease was characterized by patterns of molecular weights of 61, 98 and 159 bp;
- рестрикции ампликона гена соматотропина эндонуклеазой AluI характеризовалась паттернами молекулярной массой 39 и 142 п.н.;- restriction of the somatotropin gene amplicon by endonuclease AluI was characterized by patterns of molecular weight of 39 and 142 bp;
- рестрикции ампликона гена диацилглицерол О-ацилтрансферазы эндонуклеазой рестрикции EaeI характеризовалась паттерном молекулярной массой 247 п.н.;- restriction of the amplicon of the gene diacylglycerol O-acyltransferase by restriction endonuclease EaeI was characterized by a pattern with a molecular weight of 247 bp;
рестрикции ампликона гена каппа-казеина эндонуклеазой рестрикции Hindlll характеризовалась паттернами молекулярной массой 62, 69 и 131 п.н.restriction of the kappa-casein gene amplicon by restriction endonuclease Hindll was characterized by patterns of molecular weights of 62, 69, and 131 bp.
Следовательно, генотип исследуемого животного составило по гену пролактина АВ, по гену соматотропина LL, по гену диацилглицерол О-ацилтрансферазы АА и по гену каппа-казеина АВ, что является признаком средней молочной продуктивности по удою, массовой доли белка и рекомендуется данный семенной материал заменить на материал с высоким потенциалом молочной продуктивности, и осеменять коров обновленным семенным материалом (желательный аллель по гену PRL В, по гену GH V, по гену DGAT1 К и по гену CSN3 В).Therefore, the genotype of the studied animal was according to the prolactin AB gene, the somatotropin LL gene, the AA diacylglycerol O-acyltransferase gene and the AB kappa-casein gene, which is a sign of average milk productivity in terms of milk yield, mass fraction of protein, and it is recommended to replace this seed material with material with a high potential for milk production, and inseminate cows with updated seed material (desirable allele for the PRL B gene, for the GH V gene, for the DGAT1 K gene and for the CSN3 B gene).
В результате практических исследований, направленных на апробацию разработанного способа определения полиморфизма генетических маркеров молочной продуктивности крупного рогатого скота, нами был получен обеспечиваемый предложенным способом технический результат, выраженный в специфичности разработанных праймеров по генам CSN3, DGAT1, PRL, GH и эффективной идентификации искомых генотипов.As a result of practical studies aimed at testing the developed method for determining the polymorphism of genetic markers of dairy productivity in cattle, we obtained the technical result provided by the proposed method, expressed in the specificity of the developed primers for the CSN3, DGAT1, PRL, GH genes and effective identification of the desired genotypes.
Следовательно, они пригодны для использования в селекционно-племенной работе с молочным скотом в качестве генетических маркеров.Therefore, they are suitable for use in breeding and breeding work with dairy cattle as genetic markers.
Список использованной литературыList of used literature
1. R U2668829 С2, 2.10.2018 Усольцев К.В. и др. Способ проведения аллель-специфичной ПЦР для генотипирования крупного рогатого скота по аллельным вариантам АА, КК и АК гена фермента диацетил-глицерин О-ацетилтрансферазы для определения наследуемости жирномолочности.1. R U2668829 C2, 2.10.2018 Usoltsev K.V. et al. A method for allele-specific PCR for genotyping cattle according to allelic variants of AA, CC and AA of the gene for the enzyme diacetyl-glycerol O-acetyltransferase to determine the heritability of milk fat.
2. Мартина Милухова, Михал Габор, Юрай Цандрак, Анна Траковицка, Кристина Цандракова. Ассоциация HindIII-полиморфизма гена каппа-казеина с выходом молока, жира и белка у голштинской породы крупного рогатого скота. АктаБиохим Пол. 2018; 65(3): 403-407; Сулимова Г.Э., Абани Азари М., Ростамзаде Ж., Мохаммад Абани М.Р., Лазебный О.Э. Аллельный полиморфизм гена каппа-казеина (CSN3) у российских пород крупного рогатого скота и его информативность как генетического маркера. Генетика. 2007 г., январь; 43(1): 88-95.2. Martina Miluchova, Michal Gabor, Juraj Tsandrak, Anna Trakovitska, Kristina Tsandrakova. Association of the HindIII-polymorphism of the kappa-casein gene with the yield of milk, fat and protein in Holstein cattle. ActaBiochem Paul. 2018; 65(3): 403-407; Sulimova G.E., Abani Azari M., Rostamzade J., Mohammad Abani M.R., Lazebny O.E. Allelic polymorphism of the kappa-casein gene (CSN3) in Russian breeds of cattle and its informative value as a genetic marker. Genetics. January 2007; 43(1): 88-95.
3. Удина И.Г., Туркова CO., Костюченко М.В., Лебедева Л.А., Сулимова Г.Е. Полиморфизм гена пролактина крупного рогатого скота: микросателлиты, PSR-RFLP. Генетика. 2001 апрель; 37(4): 511-516.3. Udina I.G., Turkova CO., Kostyuchenko M.V., Lebedeva L.A., Sulimova G.E. Polymorphism of the bovine prolactin gene: microsatellites, PSR-RFLP. Genetics. April 2001; 37(4): 511-516.
4. Кобаноглу О., Кул Э., Гуркан Э.К., Абачи С.Х., Чанкая С. Определение ассоциации полиморфизмов генов GHR/AluI с признаками молочной продуктивности у голштинского и джерсейского скота, выращиваемого в Турции. Арх Аним Порода. 2021 23 сентября; 64(2): 417-424.4. Kobanoglu O., Kul E., Gurkan E.K., Abachi S.Kh., Cankaya S. Determination of the association of GHR/AluI gene polymorphisms with milk production traits in Holstein and Jersey cattle raised in Turkey. Arch Anim Breed. 2021 September 23; 64(2): 417-424.
5. Хэ С, Чу М.С, Цяо Л., Хэ Дж.Н., Ван П.К., Фэн Т., Ди Р., Цао Г.Л., Фанг Л., Ан Ю.Ф. Полиморфизмы гена STAT5A и их связь с признаками молочной продуктивности у коров голштинской породы. МолБиолРесп.2012 март; 39(3): 2901-2907.5. He X, Chu M.S., Qiao L., He J.N., Wang P.K., Feng T., Di R., Cao G.L., Fang L., An Yu.F. Polymorphisms of the STAT5A gene and their relationship with the signs of milk production in Holstein cows. MolBiolResp.2012 March; 39(3): 2901-2907.
6. RU 2317704 C1, 06.06.2006, Сулимова Галина Ефимовна и др. Способ определения генетического потенциала крупного рогатого скота по качеству молока.6. RU 2317704 C1, 06.06.2006, Sulimova Galina Efimovna et al. A method for determining the genetic potential of cattle by milk quality.
Claims (1)
Publications (1)
| Publication Number | Publication Date |
|---|---|
| RU2782833C1 true RU2782833C1 (en) | 2022-11-03 |
Family
ID=
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2688336C2 (en) * | 2017-11-17 | 2019-05-21 | Федеральное Государственное бюджетное научное учреждение Всероссийский научно-исследовательский институт мясного скотоводства | Method for determination of genetic potential of dairy products of meat heifers of beef cattle |
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2688336C2 (en) * | 2017-11-17 | 2019-05-21 | Федеральное Государственное бюджетное научное учреждение Всероссийский научно-исследовательский институт мясного скотоводства | Method for determination of genetic potential of dairy products of meat heifers of beef cattle |
Non-Patent Citations (1)
| Title |
|---|
| Singh U. et al. Molecular markers and their applications in cattle genetic research: A review //Biomarkers and Genomic medicine. - 2014. - Т. 6. - No. 2. - С. 49-58. Weller J. I., Kashi Y., Soller M. Power of daughter and granddaughter designs for determining linkage between marker loci and quantitative trait loci in dairy cattle //Journal of dairy science. - 1990. - Т. 73. - No. 9. - С. 2525-2537. Hayes B. J. et al. Invited review: Genomic selection in dairy cattle: Progress and challenges //Journal of dairy science. - 2009. - Т. 92. - No. 2. - С. 433-443. * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9856531B2 (en) | Methods and compositions for genetically detecting improved milk production traits in cattle | |
| CN109929935B (en) | Method for identifying pig backfat thickness based on rs80995809 locus genotyping and application thereof | |
| Bonakdar et al. | IGF-I gene polymorphism, but not its blood concentration, is associated with milk fat and protein in Holstein dairy cows | |
| KR101595011B1 (en) | Novel SNP marker for discriminating number of nipple of Pig and use thereof | |
| US20150044681A1 (en) | Method to predict the pattern of locomotion in horses | |
| AU2020104123A4 (en) | An SNP Molecular Marker for Screening and/or Detecting Bovine Cell Viability | |
| Mauriæ et al. | Effect of DGAT1, FASN and PRL genes on milk production and milk composition traits in Simmental and crossbred Holstein cattle | |
| CN112941198B (en) | SNP marker for detecting pig eye muscle area and application thereof | |
| Trakovicka et al. | The impact of diacylglycerol O-acyltransferase 1 gene polymorphism on carcass traits in cattle | |
| US20110054246A1 (en) | Whole genome scan to discover quantitative trai loci (qtl) affecting growth, body composition, and reproduction in maternal pig lines | |
| RU2782833C1 (en) | Method for determining polymorphism of genetic markers of dairy productivity of cattle | |
| CN114921568B (en) | SNP molecular marker related to Qinchuan cattle body ruler and meat quality traits and application thereof | |
| US8003328B2 (en) | Bovine polymorphisms and methods of predicting bovine traits | |
| KR102019997B1 (en) | Composition for predicting meat quality of pork and method for simple and rapid predicting of meat quality using thereof | |
| US8647819B2 (en) | Association of the progesterone receptor with fertility | |
| CN113699248A (en) | SNP molecular marker related to pig backfat thickness and application thereof | |
| CN113736890A (en) | SNP molecular marker related to Jian' er number and survival rate and application thereof | |
| RU2787249C1 (en) | Method for applying dna testing by the diacylglycerol o-acyltransferase 1 (dgat1) gene for preserving the gene pool of cattle of the belarus red breed group | |
| CN117051128B (en) | NARS2 gene molecular marker related to pork quality traits and application thereof | |
| CN105886639A (en) | SNP (single-nucleotide polymorphism) sites related to thawed stud bull frozen semen activity and deformity rate and application thereof | |
| KR100615803B1 (en) | ACADM DNA DNA Detection of DNA mutation in the porcine ACADM promoter region and their application as DNA markers for the early selection of pigs having high intramuscular fat content | |
| Muhaghegh-Dolatabady et al. | Association of TG-repeats in the 5’-flanking region of bovine growth hormone receptor (GHR) gene with milk production traits and somatic cell count in Holstein cattle | |
| CN114250307A (en) | Molecular marker for evaluating day age of pigs with weight of 100kg and application thereof | |
| CN115851975A (en) | SNP molecular marker related to pig body length and application thereof | |
| KR101457919B1 (en) | SNP marker associated to meat quality according to variation, and method for identification of high quality pigs using same |