RU2774821C2 - iRNA COMPOSITIONS FOR ANGIOPOIETIN-LIKE 3 (ANGPTL3) PROTEIN AND THEIR APPLICATION METHODS - Google Patents

Abstract

FIELD: biotechnology; medicine.

SUBSTANCE: present invention relates to the field of biotechnology and medicine, in particular to a conjugate and a pharmaceutical composition for the inhibition of ANGPTL3 expression, as well as a method for the inhibition of ANGPTL3 expression and a method for the treatment of lipid metabolism disorders. The conjugate includes double-stranded ribonucleic acid (hereinafter – dsRNA) and ligand. In this case, all nucleotides of a sense strand and all nucleotides of an antisense strand of dsRNA are modified nucleotides, and ligand contains N-acetyl galactosamine (GalNAc) derivative.

EFFECT: present invention allows for the expansion of the arsenal of means for the inhibition of ANGPTL3 expression.

15 cl, 7 dwg, 16 tbl, 4 ex

Description

Related Applications

This application claims priority to U.S. Provisional Application No. 61/499620 filed June 21, 2011 and U.S. Provisional Application No. 61/638288 filed April 25, 2012, the contents of each of which are hereby incorporated by reference in their entirety. .

Sequence list

The present application contains a sequence listing that was filed in ASCII format via EFS-Web and is thus incorporated by reference in its entirety. The specified ASCII copy, created on July 11, 2012, is named 12130100.txt and is 444346 bits in size.

State of the art prior to the invention

Angiopoietin-like protein 3 (ANGPTL3) is a member of a family of angiopoietin-like secreted factors that regulate lipid metabolism and are predominantly expressed in the liver (Koishi R. et al., (2002) Nat. Genet., 30(2): 151- 157). ANGPTL3 dually inhibits the catalytic activity of lipoprotein lipase (LPL), which catalyzes the hydrolysis of triglycerides, and endothelial lipase (EL), which hydrolyzes high-density lipoprotein (HDL) phospholipids. In hypolipidemic KK/Snk mice, even obese, downregulation of ANGPTL3 has a protective effect against hyperlipidemia and atherosclerosis by promoting triglyceride clearance (Ando et al., (2003) J. Lipid Res., 44:1216-1223). In humans, plasma concentrations of ANGPTL3 positively correlate with plasma levels of HDL cholesterol and HDL phospholipids (Shimamura et al., (2007) Arterioscler. Thromb. Vasc. Biol., 27:366-372).

Lipid metabolism disorders can lead to elevated serum lipid levels such as triglycerides and/or cholesterol. Elevated serum lipid levels are closely associated with high blood pressure, cardiovascular disease, diabetes and other pathological conditions. Hypertriglyceridemia is an example of a lipid metabolic disorder characterized by high levels of triglycerides in the blood. Their association with atherosclerosis has been established, even in the absence of high cholesterol levels (hypercholesterolemia). When triglyceride concentrations are excessive (ie, greater than 1000 mg/dl or 12 mmol/l), hypertriglyceridemia can also lead to pancreatitis. Hyperlipidemia is another example of a lipid metabolic disorder characterized by elevated levels of any or all lipids and/or lipoproteins in the blood. Currently available treatments for lipid metabolism disorders, including diet, exercise and statin treatment, and other drugs are not always effective. Thus, there is a need in the art for alternative treatments for individuals with disorders of lipid metabolism.

The essence of the invention

The present invention relates to mRNA compositions that cause RNA inducible silencing complex (RISC) mediated cleavage of RNA transcripts of the ANGPL3 gene. The ANGPL3 gene may be within a cell, such as a cell in an individual, such as a human. The present invention also relates to methods of using the mRNA compositions of the invention to inhibit ANGPL3 gene expression and/or to treat an individual who will benefit from inhibition or reduction of ANGPL3 gene expression, for example, an individual suffering from or susceptible to impaired lipid metabolism, such as an individual, suffering from or susceptible to hyperlipidemia or hypertriglyceridemia.

Thus, in one aspect, the present invention relates to double-stranded ribonucleic acids (dsRNA) for inhibiting the expression of ANGPTL3. The dsRNAs contain a sense strand and an antisense strand, where the sense strand contains at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:1, and the antisense strand contains at least 15 contiguous nucleotides differing by no more than than 3 nucleotides from the nucleotide sequence of SEQ ID NO:5.

In another aspect, the present invention relates to double-stranded ribonucleic acids (dsRNA) for inhibiting the expression of ANGPTL3. dsRNA contains a sense strand and an antisense strand, where the antisense strand contains a complementarity region that contains at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any of the antisense sequences listed in Tables 2, 3, 7, 8, 9 and ten.

In one embodiment, the sense and antisense strands comprise sequences selected from the group consisting of AD-53063.1, AD-53001.1, AD-53015.1, AD-52986.1, AD-52981.1, AD-52953.1, AD-53024.1, AD-53033.1, AD-53030.1, AD-53080.1, AD-53073.1, AD-53132.1, AD-52983.1, AD-52954.1, AD-52961.1, AD-52994.1, AD-52970.1, AD-53075.1, AD-53147.1, AD-53077.1 from Table 7 and 8.

In certain embodiments, the implementation of the dsRNA contains at least one modified nucleotide. In one embodiment, at least one of the modified nucleotides is selected from the group consisting of a 2'-O-methyl modified nucleotide, a nucleotide containing a 5'-thiophosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative or a bisdecylamide group of dodecanoic acid. . In another embodiment, the modified nucleotide is selected from the group consisting of 2'-deoxy-2-fluoro-modified nucleotide, 2'-deoxy-modified nucleotide, closed nucleotide, nucleotide with nitrogenous bases removed, 2'-amino-modified nucleotide, 2'-alkyl modified nucleotide, morpholine a nucleotide, a phosphoramidate, and a nucleotide containing a non-natural base.

The dsRNA complementarity region may be at least 17 nucleotides in length, 19 to 21 nucleotides, or 19 nucleotides.

In one embodiment, each dsRNA strand is no more than 30 nucleotides in length.

At least one dsRNA strand may contain a 3′ overhang of at least 1 nucleotide or at least 2 nucleotides.

In certain embodiments, the dsRNA further comprises a ligand. In one embodiment, the ligand is conjugated to the 3' end of the dsRNA sense strand.

In some embodiments, the ligand is one or more N-acetylgalactosamine (GalNAc) derivatives linked via a divalent or trivalent branched linker. In specific embodiments, the ligand is

In some embodiments, the RNAi agent is conjugated to a ligand as shown in the following scheme

In some embodiments, the RNAi agent further comprises at least one thiophosphate or methylphosphonate internucleotide bond. In some embodiments, the thiophosphate or methylphosphonate internucleotide bond is at the 3' end of one strand. In some embodiments, the strand is an antisense strand. In other embodiments, the strand is a sense strand.

In one embodiment, the dsRNA complementarity region consists of one of the antisense sequences from Tables 2, 3, 7, 8, 9, and 10.

In another embodiment, the dsRNA contains a sense strand consisting of a sense strand sequence selected from the sequences in Tables 2, 3, 7, 8, 9, and 10 and an antisense strand consisting of an antisense strand sequence selected from the sequences in Tables 2, 3, 7, 8, 9 and 10.

In another aspect, the present invention relates to a cell, for example, a hepatocyte, containing the dsRNA of the invention.

In yet another aspect, the present invention relates to a vector encoding at least one strand of dsRNA, wherein the dsRNA contains a region complementary to at least a region of an mRNA encoding ANGPTL3, where the dsRNA is 30 base pairs or less in length, and wherein the dsRNA is directed to cleave the mRNA . The length of the complementarity region may be at least 15 nucleotides, or 19 to 21 nucleotides.

In a further aspect, the present invention relates to a cell comprising a vector encoding at least one dsRNA strand, wherein the dsRNA contains a region complementary to at least a region of an mRNA encoding ANGPTL3, where the dsRNA is 30 base pairs or less in length, and where the dsRNA is directed to mRNA cleavage.

In one aspect, the present invention relates to a pharmaceutical composition containing a dsRNA or a vector of the invention for inhibiting ANGPTL3 gene expression.

In one embodiment, the pharmaceutical composition contains a lipid formulation, such as an MC3, SNALP, or XTC formulation.

In another aspect, the present invention relates to methods for inhibiting the expression of ANGPTL3 in a cell. The methods include contacting a cell with a dsRNA or vector of the invention and maintaining the cell in production for a period of time sufficient to obtain degradation of the ANGPTL3 gene mRNA transcript, thereby inhibiting expression of the ANGPTL3 gene in the cell.

The cell may be in an individual, such as a human individual, eg, a human individual with a lipid metabolism disorder, eg, hyperlipidemia or hypertriglyceridemia.

In one embodiment of the methods of the invention, ANGPTL3 expression is inhibited by at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%. , at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

In another aspect, the present invention relates to methods of treating a subject with a disorder that would benefit from a reduction in the expression of ANGPTL3, for example, a lipid metabolism disorder such as hyperlipidemia or hypertriglyceridemia. The methods include administering to a subject a therapeutically effective amount of a dsRNA or a vector of the invention, thereby treating the subject.

The disorder may be a lipid metabolism disorder such as hyperlipidemia or hypertriglyceridemia.

In one embodiment, administration of dsRNA to an individual causes a decrease in serum lipids, triglycerides, cholesterol and/or free fatty acids and/or a decrease in ANGPTL3 protein accumulation. In one embodiment, administration of dsRNA to an individual causes a reduction in LDL-C, HDL-C, VLDL-C, IDL-C, and/or total cholesterol.

In one embodiment, the dsRNA is administered at a dose of about 0.01 mg/kg to about 10 mg/kg, such as about 0.05 mg/kg to about 5 mg/kg, about 0.05 mg/kg to about up to 10 mg/kg, approximately 0.1 mg/kg to approximately 5 mg/kg, approximately 0.1 mg/kg to approximately 10 mg/kg, approximately 0.2 mg/kg to approximately 5 mg/kg , from about 0.2 mg/kg to about 10 mg/kg, from about 0.3 mg/kg to about 5 mg/kg, from about 0.3 mg/kg to about 10 mg/kg, from about 0, 4 mg/kg to approximately 5 mg/kg, approximately 0.4 mg/kg to approximately 10 mg/kg, approximately 0.5 mg/kg to approximately 5 mg/kg, approximately 0.5 mg/kg approximately up to 10 mg/kg, approximately 1 mg/kg to approximately 5 mg/kg, approximately 1 mg/kg to approximately 10 mg/kg, approximately 1.5 mg/kg to approximately 5 mg/kg, approximately 1 .5 mg/kg up to approximately 10 mg/kg, approximately 2 mg/kg to approximately 2.5 mg/kg, approximately 2 mg/kg to approximately 10 mg/kg, approximately 3 mg/kg to approximately 5 mg/kg, approximately 3 mg/kg kg to about 10 mg/kg, about 3.5 mg/kg to about 5 mg/kg, about 4 mg/kg to about 5 mg/kg, about 4.5 mg/kg to about 5 mg/kg , approximately 4 mg/kg to approximately 10 mg/kg, approximately 4.5 mg/kg to approximately 10 mg/kg, approximately 5 mg/kg to approximately 10 mg/kg, approximately 5.5 mg/kg to about 10 mg/kg, from about 6 mg/kg to about 10 mg/kg, from about 6.5 mg/kg to about 10 mg/kg, from about 7 mg/kg to about 10 mg/kg, from about 7.5 mg/kg to about 10 mg/kg, about 8 mg/kg to about 10 mg/kg, about 8.5 mg/kg to about 10 mg/kg, about 9 mg/kg to about 10 mg/kg or approx. positively from 9.5 mg/kg to approximately 10 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

For example, dsRNA can be administered at a dose of about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0, 2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1, 5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2, 8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8, 1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9, 4, 9.5, 9.6, 9.7, 9.8, 9.9 or about 10 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

In another embodiment, the dsRNA is administered at a dose of about 0.5 to about 50 mg/kg, about 0.75 to about 50 mg/kg, about 1 to about 50 mg/kg, about 1.5 to about 50 mg/kg, about 2 to about 50 mg/kg, about 2.5 to about 50 mg/kg, about 3 to about 50 mg/kg, about 3.5 to about 50 mg/kg, about 4 to about 50 mg/kg, about 4.5 to about 50 mg/kg, about 5 to about 50 mg/kg, about 7.5 to about 50 mg/kg, about 10 to about 50 mg/kg kg, about 15 to about 50 mg/kg, about 20 to about 50 mg/kg, about 25 to about 50 mg/kg, about 30 to about 50 mg/kg, about 35 to about 50 mg/kg kg, about 40 to about 50 mg/kg, about 45 to about 50 mg/kg, about 0.5 to about 45 mg/kg, about 0.75 to about 45 mg/kg, about 1 to about 45 mg/mg, about 1.5 to about 45 mg/kg, about 2 to about 45 mg/kg, about 2.5 to about 45 mg/kg, about 3 to about 45 mg/kg, about 3.5 to about 45 mg/kg, about 4 to about 45 mg/kg, about 4.5 to about 45 mg/kg, about 5 to about 45 mg/kg, about 7.5 to about 45 mg/kg, about 10 to about 45 mg /kg, about 15 to about 45 mg/kg, about 20 to about 45 mg/kg, about 25 to about 45 mg/kg, about 30 to about 45 mg/kg, about 35 to about 45 mg /kg, approximately 40 to approximately 45 mg/kg, approximately 0.5 approx. up to 40 mg/kg, approximately 0.75 to approximately 40 mg/kg, approximately 1 to approximately 40 mg/mg, approximately 1.5 to approximately 40 mg/kg, approximately 2 to approximately 40 mg/kg , about 2.5 to about 40 mg/kg, about 3 to about 40 mg/kg, about 3.5 to about 40 mg/kg, about 4 to about 40 mg/kg, about 4.5 up to about 40 mg/kg, about 5 to about 40 mg/kg, about 7.5 to about 40 mg/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg, about 20 to about 40 mg/kg, about 25 to about 40 mg/kg, about 30 to about 40 mg/kg, about 35 to about 40 mg/kg, about 0.5 to about 30 mg/kg , about 0.75 to about 30 mg/kg, about 1 to about 30 mg/m g, about 1.5 to about 30 mg/kg, about 2 to about 30 mg/kg, about 2.5 to about 30 mg/kg, about 3 to about 30 mg/kg, about 3, 5 to about 30 mg/kg, about 4 to about 30 mg/kg, about 4.5 to about 30 mg/kg, about 5 to about 30 mg/kg, about 7.5 to about 30 mg/kg kg, about 10 to about 30 mg/kg, about 15 to about 30 mg/kg, about 20 to about 30 mg/kg, about 25 to about 30 mg/kg, about 0.5 to about 20 mg/kg, about 0.75 to about 20 mg/kg, about 1 to about 20 mg/mg, about 1.5 to about 20 mg/kg, about 2 to about 20 mg/kg, about 2.5 to about 20 mg/kg, about 3 to about 20 mg/kg, about 3.5 to about 20 mg/kg, about 4 to about 20 mg/kg, about 4.5 to about 20 mg/kg, about 5 to about 20 mg/kg, about 7.5 to about 20 mg/kg, about 10 to about 20 mg/kg, or about 15 to about 20 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

For example, individuals can be administered a therapeutic amount of mRNA, such as about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4, 1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5, 4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6, 7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14, 5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or approximately 50 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

In another aspect, the present invention relates to methods for inhibiting the expression of ANGPTL3 in an individual. The methods include administering to the subject a therapeutically effective amount of the dsRNA or vector of the invention, thereby inhibiting the expression of ANGPTL3 in the subject.

In yet another aspect, the invention relates to kits for carrying out the methods of the invention. In one aspect, the invention provides a kit for carrying out a method for inhibiting ANGPTL3 gene expression in a cell by contacting the cell with a double-stranded RNAi agent in an amount effective to inhibit ANGPTL3 expression in the cell. The kit contains the RNAi agent and instructions for use and optionally devices for administering the RNAi agent to an individual.

Brief description of the drawings

Figure 1 is a schematic of the experimental method used for the in vivo tests described in Example 2.

Figure 2, panel A is a graph showing the measured levels of ANGPTL3 protein in WT mice after treatment with the specified mRNA or control. Figure 2, panel B is a graph showing the measured levels of ANGPTL3 protein in ob/ob mice after treatment with the specified mRNA or control.

Figure 3, panel A is a graph showing the measured levels of LDL-c in WT mice after treatment with the specified mRNA or control. Figure 3, panel B is a graph showing the measured levels of LDL-c in ob/ob mice after treatment with the specified mRNA or control.

Figure 4, panel A is a graph showing the measured levels of triglycerides in WT mice after treatment with the specified mRNA or control. Figure 4, panel B is a graph showing the measured levels of triglycerides in ob/ob mice after treatment with the specified mRNA or control.

Figure 5, panel A is a graph showing the measured levels of total cholesterol (TC) in WT mice after treatment with the specified mRNA or control. Figure 5, panel B is a graph showing the measured levels of total cholesterol (TC) in ob/ob mice after treatment with the specified mRNA or control.

Figure 6, panel A is a graph showing the measured levels of HDL-c in WT mice after treatment with the specified mRNA or control. Figure 6, panel B is a graph showing the measured levels of HDL-c in ob/ob mice after treatment with the specified mRNA or control.

Figure 7 is a graph showing measured levels of ANGPTL3 protein in human PCS transgenic mice after treatment with a single dose of the indicated mRNA or control.

Detailed description of the invention

The present invention relates to mRNA compositions that affect RNA inducible silencing complex (RISC) mediated cleavage of RNA transcripts of the ANGPTL3 gene. The ANGPTL3 gene may be in a cell, for example a cell in an individual, such as a human. The present invention also relates to methods of using mRNA compositions of the invention to inhibit ANGPTL3 gene expression and/or to treat an individual with a disorder that would benefit from inhibition or reduction of ANGPTL3 gene expression, for example, a lipid metabolism disorder such as hyperlipidemia or hypertriglyceridemia.

The mRNAs of the invention comprise an RNA strand (antisense strand) containing a region that is approximately 30 nucleotides or less in length, e.g. -24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26 , 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27,19-26, 19-25, 19 -24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23 , 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides, which is essentially complementary to at least a portion of the ANGPTL3 mRNA transcript. The use of these mRNAs provides targeted degradation of the mRNA of the ANGPTL3 gene in mammals. In particular, very low doses of ANGPTL3 mRNA can specifically and efficiently mediate RNA interference (RNAi) leading to significant inhibition of ANGPTL3 gene expression. Using cell-based assays, the present inventors have demonstrated that mRNAs directed to ANGPTL3 can mediate RNAi resulting in significant inhibition of ANGPTL3 gene expression. Thus, methods and compositions containing these mRNAs are useful in treating an individual who would benefit from a reduction in ANGPTL3 protein levels and/or activity, such as an individual with a lipid metabolic disorder such as hyperlipidemia or hypertriglyceridemia.

The following detailed description describes how to make and use compositions containing mRNA to inhibit expression of the ANGPTL3 gene, and describes compositions and methods for treating individuals with diseases and disorders that would benefit from inhibition and/or reduction of expression of this gene.

I. Definitions

In order for the present invention to be more understandable, certain terms are first defined. In addition, it should be noted that when a value or range of values of a parameter is listed, it should be understood that values and ranges intermediate to the listed values are also part of the present invention.

The singular forms are used herein to refer to one or more than one (i.e., at least one) grammatical entity of that form. By way of example, "element" means one element or more than one element, such as a collection of elements.

The term "including" is used herein to refer to and is used interchangeably with the phrase "including as non-limiting examples". The term "or" is used herein to refer to and is used interchangeably with the term "and/or" unless the context clearly dictates otherwise.

The term "ANGPTL3" refers to an angiopoietin 3-like protein containing an amino acid sequence from any vertebrate or mammalian source, including but not limited to human, ruminant, chicken, rodent, mouse, rat, pig, sheep, primate , monkey and guinea pig unless otherwise noted. The term also refers to fragments and variants of native ANGPTL3 that retain at least one in vivo or in vitro activity of native ANGPTL3. The term includes full-length full-length forms of the ANGPTL3 precursor, as well as mature forms resulting from post-translational cleavage of the signal peptide and forms resulting from proteolytic processing of the fibrinogen-like domain. The human ANGPTL3 mRNA transcript sequence can be found, for example, at GeneBank GI accession number: 41327750 (NM_014495.2; SEQ ID NO:1). The theoretically calculated rhesus monkey ANGPTL3 mRNA sequence can be found, for example, at GeneBank GI accession number: 297278846 (XM_001086114.2; SEQ ID NO:2). The mouse ANGPTL3 mRNA sequence can be found, for example, at GeneBank GI accession number: 142388354 (NM_013913.3; SEQ ID NO:3). The rat ANGPTL3 mRNA sequence can be found, for example, at GeneBank GI accession number: 68163568 (NM_001025065.1; SEQ ID NO:4).

The term "ANGPTL3" as used herein also refers to a specific polypeptide expressed in a cell by variants of the natural DNA sequence of the ANGPTL3 gene, such as a single nucleotide polymorphism in the ANGPTL3 gene. Many SNPs have been identified in the ANGPTL3 gene and can be found, for example, NCBI dbSNP (see, for example, www.ncbi.nlm.nih.gov/snp). Неограничивающие примеры SNP в гене ANGPTL3 можно найти по номерам доступа NCBI dbSNP rs193064039, rs192778191, rs192764027, rs192528948, rs191931953, rs191293319, rs191171206, rs191145608, rs191086880, rs191012841 или rs190255403.

As used herein, "target sequence" refers to the contiguous portion of the nucleotide sequence of an mRNA molecule generated during transcription of the ANGPTL3 gene, including mRNA that is the product of RNA processing of a primary transcription product. In one embodiment, the target sequence region is at least long enough to serve as a substrate for mRNA-directed cleavage at or near the nucleotide sequence region of the mRNA molecule generated during transcription of the ANGPTL3 gene.

The length of the target sequence may be from about 9-36 nucleotides, for example, about 15-30 nucleotides. For example, the target sequence may be approximately 15-30 nucleotides long, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, , 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18 -22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21 , 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21 -29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23 or 21-22 nucleotides. Ranges and lengths intermediate to the listed ranges and lengths are also intended to be part of the present invention.

As used herein, the term "strand containing a sequence" refers to an oligonucleotide containing a chain of nucleotides that is described by a sequence specified using standard nucleotide nomenclature.

Each "G", "C", "A", "T", and "U" generally refers to a nucleotide that contains guanine, cytosine, adenine, thymidine, and uracil as base, respectively. However, it should be understood that the term "ribonucleotide" or "nucleotide" may also refer to a modified nucleotide, as further detailed below, or a substituent group. The person skilled in the art is well aware that guanine, cytosine, adenine and uracil can be replaced by other groups essentially without changing the base pairing properties of an oligonucleotide containing a nucleotide containing such a substitution group. For example, without limitation, a nucleotide containing inosine as its base may pair with nucleotides containing adenine, cytosine, or uracil. Thus, nucleotides containing uracil, guanine or adenine can be replaced in the dsRNA nucleotide sequences of the invention with a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively, to form G-U ambiguous base pairs with the target mRNA. Sequences containing such substituent groups are suitable for the compositions and methods of the invention.

The terms "mRNA", "RNAi means", "mRNA means", "RNA interference means", as used interchangeably in the present description, refer to an agent that contains RNA, as this term is defined in the present description, and which mediates targeted cleavage RNA transcript via the RNA-induced silencing complex (RISC) pathway. The mRNA directs the specific degradation of the mRNA sequence through a process known as RNA interference (RNAi). The mRNA modulates, eg, inhibits, the expression of ANGPTL3 in a cell, eg, in a cell in an individual, such as a mammalian individual.

In one embodiment, the RNAi agent of the invention comprises a single stranded RNA that interacts with a target RNA sequence, such as the ANGPTL3 target mRNA sequence, to direct cleavage of the target RNA. Without being limited by theory, long double-stranded RNA introduced into cells is cleaved into siRNA by a type III endonuclease known as Dicer (Sharp et al., Genes Dev., 2001, 15:485). Dicer, a ribonuclease III-like enzyme, processes dsRNA to form small interfering RNAs 19-23 bp in length with characteristic two pairs of sticky 3' ends (Bernstein et al., (2001) Nature, 409:363). The siRNA is then introduced into an RNA-inducible silencing complex (RISC) where one or more helicases unwind the double-stranded siRNA, allowing the complementary antisense strand to perform target recognition (Nykanen et al., (2001) Cell, 107:309). After binding to the appropriate target mRNA, one or more endonucleases in RISC cleave the target, inducing silencing (Elbashir et al., (2001) Genes Dev., 15:188). Thus, in one aspect, the invention relates to a single-stranded RNA (siRNA) generated in a cell that promotes the formation of a RISC complex by causing target gene silencing, i. ANGPTL3 gene. Thus, the term "miRNA" is also used herein to refer to RNAi as described above.

In another aspect, the RNAi agent is a single stranded antisense RNA molecule. The antisense RNA molecule is complementary to the sequence in the target mRNA. Antisense RNA can inhibit translation in a stoichiometric manner by base-pairing with mRNA and physically interfering with the translation mechanism, see Dias N. et al., (2002) Mol. Cancer Ther., 1:347-355. A single stranded antisense RNA molecule may be from about 13 to about 30 nucleotides in length and contain a sequence that is complementary to the target sequence. For example, a single stranded antisense RNA molecule may contain a sequence that is at least about 13, 14, 15, 16, 17, 18, 19, 20 or more contiguous nucleotides from one of the antisense sequences in Tables 2, 3, 7, 8, 9 and 10.

In another embodiment, "mRNA" for use in the compositions and methods of the invention is double-stranded RNA, and is referred to herein as "double-stranded RNAi agent", "dsRNA molecule", "dsRNA agent" or "dsRNA" . The term "dsRNA" refers to a complex of ribonucleic acid molecules having a duplex structure containing two antiparallel and substantially complementary nucleic acid strands, referred to as having "sense" and "antisense" orientations with respect to the target RNA, i. ANGPTL3 gene. In some embodiments, double-stranded RNA (dsRNA) initiates degradation of a target RNA, such as mRNA, through a post-transcriptional gene silencing mechanism, referred to herein as RNA interference or RNAi.

The length of the duplex region can be any that allows specific degradation of the desired target RNA via the RISC pathway and can be in the range of about 9 to 36 bp, e.g., about 15-30 bp in length, e.g., about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 base pairs in length, such as approximately 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15 -20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22 , 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19 -20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29 , 21-28, 21-27, 21-26, 21-25, 21-24, 21-23 or 21-22 base pairs in length. Ranges and lengths intermediate to the listed ranges and lengths are also intended to be part of the present invention.

The two strands forming the duplex structure may be different portions of the same larger RNA molecule, or they may be separate RNA molecules. When two strands are one larger molecule and thus are linked by a continuous chain of nucleotides between the 3' end of one strand and the 5' end of the corresponding other strand, forming a duplex structure, the connecting strand of RNA is referred to as a "hairpin loop". The hairpin loop may contain at least one unpaired nucleotide. In some embodiments, the hairpin loop may comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least at least 10, at least 20, at least 23 or more unpaired nucleotides.

When two substantially complementary dsRNA strands are contained in separate RNA molecules, these molecules may not necessarily be covalently linked. When two strands are covalently linked by a different continuous chain of nucleotides between the 3' end of one strand and the 5' end of the corresponding other strand, forming a duplex structure, the connecting structure is referred to as a "linker". RNA chains may contain the same or different numbers of nucleotides. The maximum base pair is the number of nucleotides in the shortest dsRNA strand minus any sticky ends that are in duplex. In addition to the duplex structure, the RNAi may contain one or more nucleotide sticky ends.

As used herein, the term "nucleotide sticky end" refers to at least one unpaired nucleotide that protrudes from the duplex structure of an mRNA, eg, dsRNA. For example, when the 3' end of one dsRNA strand extends beyond the 5' end of another strand, or vice versa, there is a nucleotide overhang. The dsRNA may comprise an overhang of at least one nucleotide, alternatively the overhang may comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more. The nucleotide sticky end may comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside. The sticky end(s) may be on the sense strand, the antisense strand, or any combination thereof. In addition, the sticky end nucleotide(s) may be at the 5' end, 3' end, or both ends of any antisense or sense dsRNA strand.

In one embodiment, the dsRNA antisense strand contains 1-10 nucleotides, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, a sticky end at the 3' end and/or 5' -end. In one embodiment, the dsRNA sense strand contains 1-10 nucleotides, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, a sticky end at the 3'-end and/or 5'- end. In another embodiment, one or more nucleotides at the sticky end are replaced with a nucleoside thiophosphate.

The terms "blunt" or "blunt end" as used herein with respect to dsRNA means that there are no unpaired nucleotides or nucleotide analogs at that end of the dsRNA, i. is not a nucleotide sticky end. One or both ends of the dsRNA may be blunt. When both ends of a dsRNA are blunt, the dsRNA is said to contain blunt ends. For clarity, a "blunt-ended" dsRNA is a dsRNA that is blunt at both ends, i. does not contain nucleotide sticky ends at either end of the molecule. Most often, such a molecule is double-stranded throughout its entire length.

The term "antisense strand" or "guide strand" refers to a strand of an mRNA, eg dsRNA, that contains a region that is substantially complementary to a target sequence, eg ANGPTL3 mRNA. As used herein, the term "region of complementarity" refers to a region in an antisense strand that is substantially complementary to a sequence, eg, a target sequence, eg, the ANGPTL3 nucleotide sequence, as defined herein. When the site of complementarity is not fully complementary to the target sequence, mismatches may be in the outer or terminal regions of the molecule. Typically, the most tolerable mismatches are found at the terminal regions, for example, at 5, 4, 3, or 2 nucleotides of the 5' and/or 3' end of the mRNA.

The term "sense strand" or "follower strand", as used herein, refers to an mRNA strand that contains a region that is substantially complementary to the antisense strand, as the term is defined herein.

As used herein, and unless otherwise indicated, the term "complementary", when used to describe a first nucleotide sequence with respect to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize and form a duplex structure under specified conditions. with an oligonucleotide or polynucleotide containing a second nucleotide sequence, as understood by the skilled person. Such conditions, for example, may be stringent conditions, where stringent conditions may include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. for 12-16 hours followed by rinsing (see e.g. , "Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions may be used, such as those appropriate to physiological conditions that may be found within the body. One skilled in the art may determine the set of conditions most appropriate for testing the complementarity of the two sequences according to the final application of the hybridized nucleotides.

Complementary sequences in mRNA, such as dsRNA, as described herein, include the base pairing of an oligonucleotide or polynucleotide containing a first nucleotide sequence with an oligonucleotide or polynucleotide containing a second nucleotide sequence, along the entire length of one or both nucleotide sequences. Such sequences may be referred to as "fully complementary" to each other throughout the present specification. However, when a first sequence is referred to as "substantially complementary" to a second sequence herein, the two sequences may be fully complementary, or they may hybridize to form one or more, but generally not more than 5, 4, 3, or 2 mismatched base pairs, for a duplex of up to 30 base pairs, while retaining the ability to hybridize under conditions most appropriate to their end use, such as inhibition of gene expression via the RISC pathway. However, when two oligonucleotides are designed to form one or more single-stranded sticky ends upon hybridization, such sticky ends should not be considered as inconsistencies in terms of determining complementarity. For example, a dsRNA containing one 21 nucleotide long oligonucleotide and another 23 nucleotide long oligonucleotide, where the longer oligonucleotide contains a 21 nucleotide sequence that is fully complementary to the shorter oligonucleotide, may also be referred to as "fully complementary" for the purposes described herein.

"Complementary" sequences, as used herein, may also contain or be formed entirely from non-Watson-Crick base pairs and/or base pairs formed from non-natural and modified nucleotides, provided that the above requirements regarding their ability to hybridize are met. . Such non-Watson-Crick base pairs include, but are not limited to, G:U ambiguous or Hoogsteen base pairings.

The terms "complementary", "fully complementary" and "substantially complementary" in the present description can be used in relation to the matching of pairs between the sense strand and the antisense strand of the dsRNA, or between the antisense strand of the mRNA agent and the target sequence, as will be understood from the context of their use. .

As used herein, a polynucleotide that is "substantially complementary to at least a portion" of messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to an adjacent region of an mRNA of interest (eg, an mRNA encoding ANGPTL3). For example, a polynucleotide is complementary to at least a portion of an ANGPTL3 mRNA if the sequence is substantially complementary to a contiguous region of the mRNA encoding ANGPTL3.

Typically, the majority of the nucleotides in each strand are ribonucleotides, but as detailed herein, each or both strands may also contain one or more non-ribonucleotides, such as a deoxyribonucleotide and/or a modified nucleotide. In addition, "mRNA" may contain ribonucleotides with chemical modifications. Such modifications may include all types of modifications described in the present description or known in this field. Any such modifications as used in the mRNA molecule are included in the term "mRNA" for purposes of description and claims.

The term "inhibition" as used herein is used interchangeably with "down", "silencing", "downregulation", "suppression" and other similar terms, and includes any level of inhibition.

The phrase "inhibition of ANGPTL3 expression" as used herein includes inhibition of the expression of any ANGPTL3 gene (such as, for example, mouse ANGPTL3 gene, rat ANGPTL3 gene, monkey ANGPTL3 gene, or human ANGPTL3 gene), as well as variants or mutants of the ANGPTL3 gene, which encodes the ANGPTL3 protein.

"Inhibition of ANGPTL3 gene expression" includes any level of inhibition of the ANGPTL3 gene, such as at least partial inhibition of ANGPTL3 gene expression, such as inhibition of at least about 5%, at least about 10%, at least about 15%, at least at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about positively 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

ANGPTL3 gene expression can be assessed based on the level of any variable associated with ANGPTL3 gene expression, such as ANGPTL3 mRNA level or ANGPTL3 protein level. ANGPTL3 expression can also be assessed indirectly based on serum lipid, triglyceride, cholesterol (including LDL-C, HDL-C, VLDL-C, IDL-C and total cholesterol) or free fatty acid levels. Inhibition can be assessed as a decrease in the absolute or relative level of one or more of these variables compared to the control level. The control level can be any type of control level that is used in this field, for example, the background level before dosing or the level determined in a similar individual, cell or sample that has not been treated or treated with a control (such as, for example, control buffer only or agent-inactivating control).

In one embodiment, at least partial suppression of ANGPTL3 gene expression is measured by a decrease in the amount of ANGPTL3 mRNA that can be isolated from or detected in the first cell or group of cells in which the ANGPTL3 gene is transcribed and that has been or has been treated such that expression the ANGPTL3 gene is inhibited compared to a second cell or group of cells essentially identical to the first cell or group of cells, but which has not been or has not been so treated (control cells). The degree of inhibition can be expressed as follows:

The phrase "bringing a cell into contact with an RNAi agent" such as dsRNA, as used herein, includes bringing the cell into contact by any means possible. Contacting a cell with an RNAi agent includes bringing the cell into contact in vitro with the mRNA or bringing the cell into contact in vivo with the mRNA. Bringing into contact can be carried out directly or indirectly. Thus, for example, the RNAi agent can be brought into physical contact with the cell by individually conducting the method, or alternatively, the RNAi agent can be brought into a state that causes or facilitates that it then comes into contact with the cell.

Bringing the cell into contact in vitro can be done, for example, by incubating the cell with an RNAi agent. Bringing the cell into contact in vivo can be done, for example, by injecting the RNAi agent into or near the tissue where the cell is located, or by injecting the RNAi agent into another area, such as the bloodstream or subcutaneous space, such that the agent then enters the tissue. , where the cell with which it is necessary to contact is localized. For example, the RNAi agent may contain and/or be associated with a ligand, such as GalNAc3, that directs the RNAi agent to a site of interest, such as the liver. Combinations of in vitro and in vivo contacting methods are also possible. For example, a cell can also be contacted in vitro with an RNAi agent and then transplanted into an individual.

In one embodiment, contacting a cell with an mRNA includes "introducing" or "delivering the mRNA into the cell" by facilitating or causing uptake or uptake by the cell. The uptake or uptake of mRNA can occur through diffusion or active cellular processes without assistance or through aids or devices. The introduction of mRNA into a cell can be carried out in vitro and/or in vivo . For example, for in vivo administration, mRNA can be injected into a region of tissue or administered systemically. In vivo delivery can also be carried out by a beta-glucan-based delivery system, such as those described in US Pat. In vitro administration to cells includes methods known in the art such as electroporation and lipofection. Additional approaches are described herein below and/or are known in the art.

The term "SNALP" refers to a stable nucleic acid-lipid particle. SNALP is a lipid vesicle covering an interior water-reduced region containing a nucleic acid such as an mRNA or a plasmid from which the mRNA is transcribed. SNALPs are described, for example, in US Patent Application Publication No. 20060240093, 20070135372 and International Application No. WO 2009082817, thus the entire contents of which are incorporated herein by reference. Examples of "SNALP" formulations are described below.

As used herein, an "individual" is an animal, such as a mammal, including a primate (such as a human, a non-human primate, such as a monkey and a chimpanzee), a non-primate mammal (such as a cow, a pig, a camel, a llama , horse, goat, rabbit, sheep, hamster, guinea pig, cat, dog, rat, mouse, horse, and whale), or a bird (such as a duck or goose). In one embodiment, the subject is a human, such as a human being treated for or being evaluated for a disease, disorder, or condition that would benefit from reduced expression of ANGPTL3; a person at risk for a disease, disorder, or condition that would benefit from reduced expression of ANGPTL3; a human with a disease, disorder, or condition that would benefit from decreased expression of ANGPTL3; and/or a human treated for a disease, disorder, or condition that would benefit from decreased expression of ANGPTL3, as described herein. As used herein, the terms "treatment" or "treatment" refer to a beneficial or desired outcome, including such as lowering triglyceride levels in an individual. The terms "treatment" or "treatment" also include, but are not limited to, alleviation or amelioration of one or more symptoms of a lipid metabolic disorder, such as, for example, reduction in the size of eruptive xanthomas. "Treatment" may also mean extended life expectancy compared to life expectancy. life expectancy if untreated.

By "lower" in relation to a disease marker or symptom is meant a statistically significant reduction in that level. The reduction may be, for example, at least 10%, at least 20%, at least 30%, at least 40% or more, and preferably reaches a level accepted in the normal range in an individual without such a violation. As used herein, "prophylaxis" or "prophylactic" when used in relation to a disease, disorder, or condition that is beneficially affected by a reduction in ANGPTL3 gene expression, refers to reducing the likelihood that an individual will develop a symptom associated with such disease. , disorder, or condition, such as high triglyceride levels or eruptive xanthoma. The likelihood of developing high triglyceride levels or eruptive xanthoma is reduced, for example, when an individual exposed to one or more risk factors for high triglycerides or eruptive xanthoma does not develop high triglyceride levels or eruptive xanthoma, or develops high triglyceride levels or eruptive xanthoma with lesser severity relative to the population exposed to similar risk factors and not receiving treatment as described herein. Absence of development of a disease, disorder, or condition, or reduction in the development of a symptom associated with such disease, disorder, or condition (e.g., at least about 10% on a clinically accepted scale for such disease or disorder), or delayed symptoms (e.g., a day , weeks, months or years) is considered effective prophylaxis.

As used herein, the term "serum lipid" refers to any major lipid found in the blood. Serum lipids may be present in the blood in free form or as part of a protein complex, such as a lipoprotein complex. Non-limiting examples of serum lipids may include triglycerides and cholesterol such as total cholesterol (TG), low density lipoprotein cholesterol (LDL-C), high density lipoprotein cholesterol (HDL-C), very low density lipoprotein cholesterol (VLDL-C) and cholesterol medium density lipoprotein (IDL-C).

As used herein, "disorder of lipid metabolism" refers to any disorder associated with or caused by a disorder of lipid metabolism. For example, this term includes any disorder, disease, or condition that can lead to hyperlipidemia, or a condition characterized by an abnormal increase in the levels of any or all lipids and/or lipoproteins in the blood. This term refers to an inherited disorder, such as familial hypertriglyceridemia, or an acquired disorder, such as a disorder acquired through diet or certain medications. Иллюстративные нарушения метаболизма липидов включают, но не ограничиваются ими, атеросклероз, дислипидемию, гипертриглицеридемию (включая индуцированную лекарственными средствами гипертриглицеридемию, индуцированную диуретиками гипертриглицеридемию, индуцированную алкоголем гипертриглицеридемию, индуцированную β-адренергическими блокаторами гипертриглицеридемию, индуцированную эстрогеном гипертриглицеридемию, индуцированную глюкокортикоидами гипертриглицеридемию, индуцированную ретиноидами гипертриглицеридемию, cimetidine-induced hypertriglyceridemia and familial hypertriglyceridemia), hypertriglyceridemia-associated acute pancreatitis, chylomicron syndrome, familial chylomicronemia, ApoE deficiency or resistance, LPL deficiency or decreased activity, hyperlipidemia (including familial combined hyperlipidemia), hypercholesterolemia, hypercholesterolemia-associated gout, xanthomatosis (subcutaneous cholesterol deposits).

Cardiovascular diseases associated with disorders of lipid metabolism are also referred to as "disorders of lipid metabolism" as defined herein. These diseases may include coronary artery disease (also called coronary artery disease), inflammation associated with coronary artery disease, restenosis, peripheral vascular disease, and stroke.

Weight-related disorders are also referred to as "lipid metabolism disorders" as defined herein. Such disorders may include obesity, the metabolic syndrome, including the independent components of the metabolic syndrome (eg, generalized obesity, FBG/prediabetes/diabetes, hypercholesterolemia, hypertriglyceridemia, and hypertension), hypothyroidism, uremia, and other conditions associated with weight gain (including rapid weight gain) , weight loss, maintenance of weight loss, or the risk of weight gain after weight loss.

Blood sugar disorders are further referred to as "lipid metabolism disorders" as defined herein. Such disorders may include diabetes, hypertension, and polycystic ovary syndrome associated with insulin resistance. Other exemplary disorders of lipid metabolism may also include kidney transplantation, nephrotic syndrome, Itsenko-Cushing's syndrome, acromegaly, systemic lupus erythematosus, dysglobulinemia, lipodystrophy, type I glycogenosis, and Addison's disease.

A "therapeutically effective amount" as used herein is meant to include an amount of an RNAi agent that, when administered to an individual with a lipid metabolism disorder, is sufficient to effectively treat a disease (e.g., reduce, ameliorate, or maintain an existing disease, or one or several symptoms of the disease). The "therapeutically effective amount" may vary depending on the RNAi agent, how the agent is administered, disease and its severity and history, age, weight, family history, gene set, types of prior or concomitant treatments, if any, and other individual characteristics of the person being treated. individual.

A "prophylactically effective amount" as used herein is meant to include an amount of an mRNA agent that, when administered to an individual with a lipid metabolism disorder, is sufficient to prevent or ameliorate a disease condition, or one or more symptoms of a disease. Improvement of the disease state includes slowing down the course of the disease or reducing the severity of the disease that develops later. The "prophylactically effective amount" may vary depending on the mRNA, how the agent is administered, disease risk and history, age, weight, family history, gene set, types of prior or concomitant treatments, if any, and other individual characteristics of the patient being treated.

A "therapeutically effective amount" or "prophylactically effective amount" also includes an amount of an RNAi agent that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment. The mRNA used in the methods of the present invention can be administered in sufficient amounts to obtain an appropriate benefit/risk ratio applicable to such treatment.

The phrase "pharmaceutically acceptable" is used herein to refer to those compounds, substances, compositions and/or dosage forms that are medically suitable for use in contact with tissues of human and animal individuals without undue toxicity, irritation, allergic response or other problem or complication according to the appropriate benefit/risk ratio.

The phrase "pharmaceutically acceptable carrier" as used herein means a pharmaceutically acceptable substance, composition, or carrier such as a liquid or solid excipient, diluent, excipient, facilitator (e.g., lubricant, talc, magnesium, calcium, or zinc stearate). or stearic acid), or a solvent encapsulating substance involved in the transfer or transport of the target compound from one organ or body part to another organ or body part. Each carrier must be "acceptable" in the sense that it is compatible with the other ingredients of the formulation and not harmful to the individual being treated. Some examples of substances that can serve as pharmaceutically acceptable carriers include: (1) sugars such as lactose, glucose and sucrose, (2) starches such as corn starch and potato starch, (3) cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose and cellulose acetate, (4) powdered tragacanth, (5) malt, (6) gelatin, (7) lubricants such as magnesium stearate, sodium lauryl sulfate and talc, (8) excipients such as cocoa butter and waxes for suppositories, (9) oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil, (10) glycols such as propylene glycol, (11) polyols such as glycerin, sorbitol , mannitol and polyethylene glycol, (12) esters such as ethyl oleate and ethyl daurate, (13) agar, (14) buffering agents such as magnesium hydroxide and aluminum hydroxide, (15) alginic acid, (16) pyrogen-free water, (17) ) isotonic saline p, (18) Ringer's solution, (19) ethanol, (20) pH buffered solutions, (21) polyesters, polycarbonates and/or polyanhydrides; (22) excipients such as polypeptides and amino acids, (23) serum component such as serum albumin, HDL and LDL, and (22) other non-toxic compatible substances used in pharmaceutical formulations.

The term "sample" as used herein includes a collection of similar fluids, cells, or tissues secreted from an individual, as well as fluids, cells, or tissues contained in an individual. Examples of biological fluids include blood, serum and serous fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs, or localized areas. For example, samples can be obtained from specific organs, parts of organs, or fluids or cells in those organs. In certain embodiments, samples can be obtained from the liver (eg, the entire liver, or certain segments of the liver, or certain types of cells in the liver, such as, for example, hepatocytes). In some embodiments, "subject-derived sample" refers to blood or plasma obtained from an individual.

II. mRNA according to the invention

Described in the present description is an mRNA that inhibits the expression of the ANGPTL3 gene. In one embodiment, the mRNA agent comprises double-stranded ribonucleic acid (dsRNA) molecules for inhibiting ANGPTL3 gene expression in a cell, such as a cell in an individual, such as a mammal, such as a human, with a lipid metabolic disorder, such as familial hyperlipidemia. The dsRNA contains an antisense strand containing a complementarity region that is complementary to at least a portion of the mRNA generated upon expression of the ANGPTL3 gene. The length of the complementarity region is about 30 nucleotides or less (eg, about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, or 18 nucleotides or less). When contacted with a cell expressing the ANGPTL3 gene, the mRNA inhibits the expression of the ANGPTL3 gene (e.g., the human, primate, non-primate, or avian ANGPTL3 gene) by at least about 10% as analyzed, for example, by PCR or by the branched DNA (bDNA) method. , or a protein-based method such as immunofluorescence assay using, for example, Western blotting or flow cytometric methods.

The dsRNA contains two RNA strands that are complementary and hybridize to form a duplex structure under the conditions under which the dsRNA will be used. One strand of dsRNA (antisense strand) contains a complementarity region that is substantially complementary, and generally fully complementary, to the target sequence. The target sequence can be derived from an mRNA sequence generated during expression of the ANGPTL3 gene. The other strand (the sense strand) contains a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions. As described elsewhere herein, and as is known in the art, complementary dsRNA sequences may also be contained as self-complementary regions of a single nucleic acid molecule, rather than being in separate oligonucleotides.

As a rule, the length of the duplex structure is from 15 to 30 base pairs, for example, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15- 21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19- 21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23 or 21-22 base pairs. Ranges and lengths intermediate to the listed ranges and lengths are also intended to be part of the present invention.

Similarly, the complementarity region of the target sequence is 15 to 30 nucleotides in length, e.g. -21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23 , 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19 -21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30 , 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23 or 21-22 nucleotides. Ranges and lengths intermediate to the listed ranges and lengths are also intended to be part of the present invention.

In some embodiments, the dsRNA is about 15 to about 20 nucleotides in length, or about 25 to about 30 nucleotides in length. Typically, the dsRNA is long enough to serve as a substrate for the Dicer enzyme. For example, it is well known in the art that dsRNAs longer than about 21-23 nucleotides can serve as substrates for Dicer. As a rule, the specialist also understands that the site of RNA, which is the target for cleavage, is most often a section of a larger RNA molecule, often an mRNA molecule. Where appropriate, a "part" of a target mRNA is a contiguous target mRNA sequence of sufficient length to be a substrate for RNAi directed cleavage (ie, cleavage by the RISC pathway).

The person skilled in the art will also appreciate that the duplex region is the first functional region of the dsRNA, e.g., the duplex region is about 9 to about 36 base pairs, e.g., about 10-36, 11-36, 12-36, 13-36, 14- 36, 15-36, 9-35, 10-35, 11-35, 12-35, 13-35, 14-35, 15-35, 9-34, 10-34, 11-34, 12-34, 13-34, 14-34, 15-34, 9-33, 10-33, 11-33, 12-33, 13-33, 14-33, 15-33, 9-32, 10-32, 11- 32, 12-32, 13-32, 14-32, 15-32, 9-31, 10-31, 11-31, 12-31, 13-32, 14-31, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15- 17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20- 28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23 or 21-22 bp. Thus, in one embodiment, provided that it is processed to a functional duplex, e.g., 15-30 base pairs, which directs cleavage of the desired RNA, the RNA molecule or complex of RNA molecules containing a duplex region of more than 30 base pairs is dsRNA. Thus, one of skill in the art will generally appreciate that, in one embodiment, the miRNA is dsRNA. In another embodiment, the dsRNA is not a naturally occurring miRNA. In another embodiment, an mRNA agent suitable for directing ANGPTL3 expression is not generated in the target cell by cleavage of the larger dsRNA.

The dsRNA as described herein may further comprise one or more single stranded nucleotide sticky ends, eg 1, 2, 3 or 4 nucleotides. dsRNAs containing at least one nucleotide sticky end may have surprisingly superior inhibitory properties relative to their blunt-end counterparts. The nucleotide sticky end may comprise or consist of a nucleotide/nucleoside analog containing a deoxynucleotide/nucleoside. The sticky end(s) may be on the sense strand, the antisense strand, or any combination thereof. In addition, the sticky end nucleotide(s) may be at the 5' end, 3' end, or both ends of the antisense or sense strand of the dsRNA.

dsRNA can be synthesized by standard methods known in the art, as discussed further below, for example, using an automatic DNA synthesizer such as those commercially available, for example, from Biosearch, Applied Biosystems, Inc.

The mRNA compounds of the invention can be prepared in a two-step process. First, the individual strands of the double-stranded RNA molecule are prepared separately. Then the chains of components are connected. Individual strands of the siRNA compound can be prepared using liquid phase or solid phase organic synthesis, or both. Organic synthesis provides the advantage that oligonucleotide strands containing unnatural or modified nucleotides can be readily prepared. The single strand oligonucleotides of the invention can be prepared using liquid phase or solid phase organic synthesis, or both.

In one aspect, the dsRNA of the invention comprises at least two nucleotide sequences, a sense sequence and an antisense sequence. The sense strand is selected from the group of sequences provided in Tables 2, 3, 7, 8, 9 and 10 and the corresponding antisense strand of the sense strand is selected from the group of sequences from Tables 2, 3, 7, 8, 9 and 10. In this aspect, one of the two sequences is complementary to the other of the two sequences, wherein one of the sequences is substantially complementary to the mRNA sequence generated by expression of the ANGPTL3 gene. Thus, in this aspect, the dsRNA contains two oligonucleotides, where one oligonucleotide is described as the sense strand in Tables 2, 3, 7, 8, 9, and 10, and the second oligonucleotide is described as the corresponding antisense strand of the sense strand in Tables 2, 3, 7, 8, 9, and 10. In one embodiment, substantially complementary dsRNA sequences are contained in separate oligonucleotides. In another embodiment, substantially complementary dsRNA sequences are contained in a single oligonucleotide.

It is well known to the skilled artisan that dsRNAs with a duplex structure of approximately 20-23 base pairs, e.g. 21 base pairs, are recognized as being particularly effective in inducing RNA interference (Elbashir et al., (2001) EMBO J., 20:6877-6888 ). However, other shorter or longer RNA duplex structures have also been found to be effective (Chu and Rana, (2007) RNA, 14:1714-1719; Kim et al., (2005) Nat. Biotech, 23:222-226 ). In the embodiments described above, due to the nature of the oligonucleotide sequences provided in Tables 2, 3, 7, 8, 9, and 10, dsRNAs as described herein may comprise at least one strand of at least 21 nucleotides in length. It can reasonably be expected that shorter duplexes containing one of the sequences in Tables 2, 3, 7, 8, 9, and 10 minus only a few nucleotides at one or both ends can be similarly effective compared to the dsRNAs described above. . Thus, dsRNAs containing a sequence of at least 15, 16, 17, 18, 19, 20 or more contiguous nucleotides derived from one of the sequences in Tables 2, 3, 7, 8, 9, and 10 and differing in its ability to inhibit ANGPTL3 gene expression by no more than about 5%, 10%, 15%, 20%, 25%, or 30% of the inhibition of a dsRNA containing the full sequence is within the scope of the present invention.

In addition, the RNAs provided in Tables 2, 3, 7, 8, 9 and 10 identify the region(s) in the ANGPTL3 transcript that is susceptible to RISC-mediated cleavage. Thus, the present invention further relates to mRNAs that are directed to one of these sites. As used herein, an mRNA is said to be directed to a specific site on an RNA transcript if the mRNA promotes cleavage of the transcript in any region within that specific site. Such mRNA typically contains at least about 15 contiguous nucleotides from one of the sequences provided in Tables 2, 3, 7, 8, 9, and 10 associated with additional nucleotide sequences taken from the region adjacent to the selected sequence in the gene. ANGPTL3.

While the target sequence is typically about 15-30 nucleotides in length, there is wide variation in the suitability of particular sequences within this range for targeted cleavage of any given target RNA. The various software packages and manuals referred to herein provide guidance on identifying optimal target sequences for any given target gene, and an empirical approach can also be applied in which a "window" or "mask" of a given size (as a non-limiting example 21 nucleotides) literally or figuratively (including, for example, computer simulations) are placed on a target RNA sequence to identify sequences in the size range that can serve as target sequences. By gradually moving the sequence window one nucleotide above or below the starting position of the target sequence, the next potential target sequence can be identified, until a complete set of sequences is identified for that chosen target size. By this method, combined with the general synthesis and testing of identifiable sequences (by assays as described herein or as known in the art) to identify those sequences that function optimally, it is possible to identify those RNA sequences that, when exposed to an mRNA agent, mediate better expression inhibition. target gene. Thus, while the sequences identified, for example in Tables 2, 3, 7, 8, 9, and 10, are effective target sequences, it is envisaged that further optimization of inhibition efficiency can be obtained by incremental "window walking" one nucleotide above or below these sequences to identify sequences with equivalent or better inhibition characteristics.

In addition, it is contemplated that for any identified sequence, for example, in tables 2, 3, 7, 8, 9, and 10, additional optimization can be obtained by systematically adding or removing nucleotides to obtain longer or shorter sequences, and testing these resulting sequences by "walking" a larger or smaller window above or below the target RNA from that point. In addition, the combination of this approach of generating new candidate targets with testing the effectiveness of mRNA based on these target sequences in an inhibition assay, as is known in the art and/or as described herein, can lead to further improvements in inhibition efficiency. Moreover, such optimized sequences can be adjusted, for example, by introducing modified nucleotides as described herein or as known in the art, addition or changes to the cohesive end, or other modifications as known in the art and/or discussed herein, to further optimize the molecule as an expression inhibitor (e.g., increase serum stability or circulating half-life, increase thermal stability, increase transmembrane delivery, targeted delivery to a specific location or cell type, increase interaction with silencing pathway enzymes, increase release from endosomes).

An mRNA as described herein may contain one or more mismatches with the target sequence. In one embodiment, the mRNA as described herein contains no more than 3 mismatches. If the antisense mRNA strand contains mismatches with the target sequence, preferably the mismatch region is not located in the center of the complementarity region. If the antisense mRNA strand contains mismatches with the target sequence, it is preferred that the mismatch be limited to the last 5 nucleotides at the 5' or 3' end of the complementarity region. For example, for a 23 bp mRNA agent, the strand that is complementary to the ANGPTL3 gene region typically does not contain any mismatch in the central 13 bp. The methods described herein or known in the art can be used to determine whether an mRNA containing a mismatch with a target sequence is effective in inhibiting ANGPTL3 gene expression. Consideration of the efficiency factor of mRNA with mismatches for inhibiting ANGPTL3 gene expression is important, in particular, if a particular region of complementarity in the ANGPTL3 gene is known to contain polymorphic sequence variants in the population.

III. Modified mRNA according to the invention

In one embodiment, the RNA mRNA of the invention, such as dsRNA, is chemically modified to improve stability or other beneficial characteristics. Nucleic acids of the invention can be synthesized and/or modified by methods generally recognized in the art, such as those described in "Current protocols in nucleic acid chemistry", Beaucage S.L. et al., (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated by reference in its entirety. Modifications include, for example, end modifications, eg, 5' end modifications (phosphorylation, conjugation, inverted bonds) or 3' end modifications (conjugation, DNA nucleotides, inverted bonds, etc.); base modifications, eg substitution with stabilizing bases, destabilizing bases or bases that pair with a wide range of partners, base deletions (nucleotides with nitrogenous bases removed) or conjugated bases; sugar modifications (eg, at the 2'-position or 4'-position) or sugar substitution, and/or backbone modifications, including modification or replacement of phosphodiester linkages. Specific examples of mRNA compounds useful in the embodiments described herein include, but are not limited to, RNAs containing modified backbones or non-natural internucleoside bonds. RNAs containing modified scaffolds include, among others, those that do not contain a phosphorus atom in the scaffold. For the purposes of this specification, and as is sometimes pointed out in the art, modified RNAs that do not contain a phosphorus atom in their internucleoside backbone can also be considered oligonucleosides. In some embodiments, the modified mRNA contains a phosphorus atom in its internucleoside backbone.

Modified RNA backbones contain, for example, thiophosphates, chiral thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, including 3'-aminophosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters and boranophosphates containing normal 3'-5'-bonds, their 2'-5'-linked analogs and analogs having reverse polarity, where adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2 '-5' with 5'-2'. It also contains various salts, mixed salts and free acid forms.

Representative U.S. patents that describe the preparation of the above phosphorus-containing bonds include, but are not limited to, U.S. Patent Nos. 3,687,808; 4,469,863; 5453496, 5455233, 5466677, 5476925, 5519126, 5536821, 5541316, 5550111, 5563253, 5571799, 5587361, 5625050, 6028188, 6124445, 6160109, 6169170, 6172209, 6239265, 6277603, 6326199, 6346614, 6444423, 6531590, 6534639, 6608035, 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816;

Modified RNA backbones that do not contain a phosphorus atom have backbones that are formed by short chain alkyl or cycloalkyl internucleoside bonds, mixed heteroatoms and alkyl or cycloalkyl internucleoside bonds, or one or more short chain heteroatomic or heterocyclic internucleoside bonds. These include scaffolds containing morpholino bonds (formed in part from a nucleoside sugar moiety); siloxane frameworks; sulfide, sulfoxide and sulfone frameworks; foracetyl and thioformacetyl backbones; methyleneformacetyl and thioformacetyl backbones; alkene-containing frameworks; sulfamate frameworks; methyleneimine and methylenehydrazine backbones; sulfonate and sulfonamide scaffolds; amide frameworks and others containing mixed component parts of N, O, S and CH ₂ .

Репрезентативные патенты США, в которых описано получение указанных выше олигонуклеозидов, включают, но не ограничиваются ими, патенты США №№ 5034506, 5166315, 5185444, 5214134, 5216141, 5235033, 564562, 5264564, 5405938, 5434257, 5466677, 5470967, 5489677, 5541307 , 5561225, 5596086, 5602240, 5608046, 5610289, 5618704, 5623070, 5663312, 5633360, 5677437 and 5677439, thus the entire content of each of which is incorporated herein by reference.

In other embodiments, the use of suitable RNA mimetics in mRNA is contemplated, in which the sugar and the internucleoside bond, i.e. the skeleton of nucleotide units are replaced with new groups. The core units are retained for hybridization with the appropriate target nucleic acid compound. One such oligomeric compound, an RNA mimetic, which has been shown to have excellent hybridization properties, is referred to as a nucleic acid peptide (PNA). In PNA compounds, the RNA sugar backbone is replaced by an amide-containing backbone, in particular an aminoethylglycine backbone. The nucleic bases are retained and are linked directly or indirectly to the aza nitrogens of the amide moiety of the backbone. Representative US patents that describe the preparation of PNA compounds include, but are not limited to, US Pat. Additional PNA compounds suitable for use in the mRNA of the invention are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

Some embodiments of the invention relate to RNA with thiophosphate backbones and oligonucleosides with heteroatomic backbones, and in particular -CH ₂ -NH-CH ₂ -, -CH ₂ -N(CH ₃ )-O-CH ₂ - [known as framework methylene (methylimino) or MMI], -CH ₂ -ON(CH ₃ )-CH ₂ -, -CH ₂ -N(CH ₃ )-N(CH ₃ )-CH ₂ - and -N(CH ₃ )- CH ₂ -CH ₂ - [wherein the native phosphodiester backbone is represented as -OPO-CH ₂ -] of the aforementioned US Pat. No. 5,489,677 and the amide backbones of the aforementioned US Pat. U.S. Patent No. 5,034,506.

Modified RNAs may also contain one or more substituted sugar groups. mRNA, for example, dsRNA according to the present description may contain one of the following elements in the 2'-position: OH, F, O-, S- or N-alkyl; O-, S- or N-alkenyl; O-, S- or N-alkynyl, or O-alkyl-O-alkyl, where alkyl, alkenyl and alkynyl may be substituted or unsubstituted with C ₁ -C ₁₀ alkyl or C ₂ -C ₁₀ alkenyl and alkynyl. Illustrative suitable modifications include O[(CH ₂ ) _n O] _m CH ₃ , O(CH ₂ ) _n OCH ₃ , O(CH ₂ ) _n NH ₂ , O(CH ₂ ) _n CH ₃ , O(CH ₂ ) _n ONH ₂ and O(CH ₂ ) _n ON[(CH ₂ ) _n CH ₃ )] ₂ , where n and m are from 1 to about 10. In other embodiments, the dsRNAs contain one of the following elements in the 2' position: C ₁ -C ₁₀ lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH ₃ , OCN, Cl, Br, CN, CF ₃ , OCF ₃ , SOCH ₃ , SO ₂ CH ₃ , ONO ₂ , NO ₂ , N ₃ , NH ₂ , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, cleavable RNA group, reporter group, intercalator, group for improving the pharmacokinetic properties of mRNA or a group for improving the pharmacodynamic properties of mRNA and other substituents, having similar properties. In some embodiments, the modification comprises 2'-methoxyethoxy (2'-O-CH ₂ CH ₂ OCH ₃ , also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim Acta, 1995, 78:486-504), i.e. an alkoxy-alkoxy group. Another illustrative modification is 2'-dimethylaminooxyethoxy, i. an O(CH ₂ ) ₂ ON(CH ₃ ) ₂ group, also known as 2'-DMAOE as described in the examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e. 2'-O-CH ₂ -O-CH ₂ -N(CH ₂ ) ₂ .

Other modifications include 2'-methoxy (2-OCH ₃ ), 2'-aminopropoxy (2'-OCH ₂ CH ₂ CH ₂ NH ₂ ) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions in the mRNA RNA, in particular at the 3' position of the sugar at the 3' nucleotide, or at the 2'-5' linked dsRNAs and the 5' position at the 5' nucleotide. mRNAs can also contain sugar mimetics such as cyclobutyl groups instead of pentofuranosyl sugar. Representative U.S. patents that describe the preparation of such modified sugar structures include, but are not limited to, U.S. Patent Nos. 4,981,957; 5,118,800; 5,319,080; 5610300, 5627053, 5639873, 5646265, 5658873, 5670633 and 5700920, some of which have in common with the present application of the owner. Thus, the entire content of each of the above patents is incorporated into the present description by reference.

mRNAs may also contain modifications or substitutions of the nucleobase (often referred to in the art simply as "base"). As used herein, "unmodified" or "natural" nucleobases include the purine bases: adenine (A) and guanine (G), and the pyrimidine bases: thymine (T), cytosine (C), and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halogenuracil and 5-halogencytosine, 5-propynyluracil and 5-propynylcytosine, 6-azouracil, 6-azocytosine and 6-azothymine, 5- uracil (pseudouracil), 4-thiouracil, 8-halogen-, 8-amino-, 8-thiol-, 8-thioalkyl-, 8-hydroxyl- and other 8-substituted adenines and guanines, 5-halogen-, in particular, 5-bromo-, 5-trifluoromethyl- and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine. Additional nucleobases include those described in US Pat. No. 3,687,808, such as those described in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn P. ed. Wiley-VCH, 2008; such as those described in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz J.L, ed. John Wiley & Sons, 1990, such as those described by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and such as those described by Sanghvi Y.S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke S.T. and Lebleu B., Ed., CRC Press, 1993. Some of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. It has been demonstrated that 5-methylcytosine substitutions increase the stability of the nucleic acid duplex by 0.6-1.2°C (Sanghvi Y.S., Crooke S.T. and Lebleu B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp 276-278) and are exemplary base substitutions, even more particularly in combination with 2'-O-methoxyethyl sugar modifications.

Representative U.S. patents that describe the preparation of certain modified nucleobases noted above, as well as other modified nucleobases, include, but are not limited to, U.S. Patents Nos. 5459255, 5484908, 5502177, 5525711, 5552540, 5587469, 5594121, 5596091, 5614617, 5681941, 5750692, 6015886, 6147200, 6166197, 6222025, 6235887, 6380368, 6528640, 6639062, 6617438, 7045610, 7427672 и 7495088, полное содержание каждого из which, therefore, is incorporated into the present description by reference.

RNA mRNA can also be modified to contain one or more closed nucleic acids (LNAs). A closed nucleic acid is a nucleotide containing a modified ribose group, in which the ribose group contains an additional bond connecting the 2' and 4' carbon atoms. This structure effectively "closes" the ribose in the 3'-terminal structural conformation. It has been demonstrated that the addition of gated nucleic acids to miRNAs increases the stability of miRNAs in serum and reduces off-target effects (Elmen J. et al., (2005) Nucleic Acids Research, 33(1):439-447; Mook O.R. et al., (2007 ) Mol. Canc Ther., 6(3):833-843; Grunweller? A. et al., (2003) Nucleic Acids Research, 31(12):3185-3193).

Representative US patents that describe the production of closed nucleic acid nucleotides include, but are not limited to, the following US Patent Nos. description by reference.

Potentially stabilizing modifications at the ends of the RNA molecule may include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp -NHAc), thymidine-2'-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyluridine-3'-phosphate, inverted base dT (idT), and others A description of such a modification can be found in PCT Publication No. WO 2011/005861.

IV. ligand-conjugated mRNA

Another RNA mRNA modification of the invention includes chemically linking to RNA one or more ligands, groups or conjugates that increase the activity, cellular distribution, or cellular uptake of the mRNA. Such groups include, but are not limited to, lipid groups such as the cholesterol group (Letsinger et al., (1989) Proc. Natl. Acid. Sci. USA, 86: 6553-6556), cholic acid (Manoharan et al., (1994) Biorg. Med. Chem. Let., 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., (1992) Ann. N.Y. Acad. Sci., 660:306-309 ; Manoharan et al., (1993) Biorg. Med. Chem. Let., 3:2765-2770), thiocholesterol (Oberhauser et al., (1992) Nucl. Acids Res., 20:533-538), aliphatic chain , for example, dodecanediol or undecyl residues (Saison-Behmoaras et al., (1991) EMBO J., 10:1111-1118; Kabanov et al., (1990) FEBS Lett., 259:327-330; Svinarchuk et al. , (1993) Biochimie, 75:49-54), a phospholipid such as dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654; Shea et al., (1990) Nucl. Acids Res., 18:3777-3783), polyamine or polyethylene glycol chain (Manoharan et al., (1995) Nucleosides & Nucleo tides, 14:969-973) or adamantanoacetic acid (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654), palmityl group (Mishra et al., (1995) Biochim. Biophys. Acta, 1264:229-237) or an octadecylamine or hexylaminocarbonyloxycholesterol group (Crooke et al., (1996) J. Pharmacol. Exp. Ther., 277:923-937).

In one embodiment, the ligand alters the distribution, targeting, or half-life of the mRNA agent into which it is administered. In preferred embodiments, the ligand provides an increase in affinity for a selected target, e.g., molecule, cell, or cell type, compartment, e.g., cell or organ compartment, tissue, organ, or body site, for example, compared to a compound without such ligand. Preferred ligands do not participate in duplex pairing in the duplex nucleic acid.

Ligands may include naturally occurring substances such as a protein (eg, human serum albumin (HSA), low density lipoprotein (LDL), or globulin), carbohydrate (eg, dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine or hyaluronic acid) or lipid. The ligand may also be a recombinant or synthetic molecule such as a synthetic polymer, eg a synthetic polyamino acid. Examples of polyamino acids include polyamino acid, which is polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-coglycolide) copolymer, divinyl ether-maleic anhydride copolymer, copolymer N-(2-hydroxypropyl)methacrylamide (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymers, or polyphosphazine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimeric polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, polyamine quaternary salt, or alpha-helical peptide.

The ligands may also contain targeting groups, eg, a cell or tissue targeting agent, eg, a lectin, glycoprotein, lipid, or protein, eg, an antibody, that binds to a specific cell type, such as kidney cells. The directing group can be thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose, polyvalent fucose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, lipid, cholesterol, steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.

Other examples of ligands include dyes, intercalators (eg acridines), crosslinkers (eg psoralen, mitomycin C), porphyrins (TPPC4, texapirin, sapphirin), polycyclic aromatic hydrocarbons (eg phenazine, dihydrophenazine), artificial endonucleases (eg EDTA ), lipophilic molecules, e.g. cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, bomeol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl or phenoxazine) and peptide conjugates (e.g. antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (eg PEG-40K), MPEG, [MPEG] ₂ , polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (eg biotin), transport facilitators/ absorption (eg, aspirin, vitamin E, folic acid), synthetic ribonucleases (eg, imidazole, bisimidazole, histamine, imidazole casters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.

Ligands can be proteins, eg glycoproteins or peptides, eg molecules having a particular affinity for coligands, or antibodies, eg an antibody that binds to a particular cell type, such as a liver cell. Ligands may also include hormones and hormone receptors. They may also include non-peptidic compounds such as lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose or polyvalent fucose. The ligand may be, for example, a lipopolysaccharide, a p38 MAP kinase activator, or an NF-κB activator.

The ligand can be a substance, such as a drug, that can increase the uptake of the mRNA agent into the cell, for example, by destroying the cytoskeleton of the cell, for example, by destroying microtubules, microfilaments, and/or intermediate filaments of the cell. The drug may be, for example, a taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swincholide A, indanocin or myoservin.

In some embodiments, a ligand attached to an mRNA as described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophilic substances, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEGs, vitamins, and so on. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, and the like. It is also known that oligonucleotides that contain a number of thiophosphate bonds bind to whey protein, thus short oligonucleotides, e.g., oligonucleotides of approximately 5 bases, 10 bases, 15 bases, or 20 bases, containing many thiophosphate bonds in the backbone are also suitable for of the present invention as ligands (eg PK modulating ligands). In addition, aptamers that bind to serum components (eg, serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.

The ligand-conjugated oligonucleotides of the invention can be synthesized using an oligonucleotide that carries a terminal reactive functional group, such as that obtained by attaching a linker molecule to the oligonucleotide (described above). This reactive oligonucleotide can directly interact with commercially available ligands, ligands that are synthesized to carry any of a number of protective groups, or ligands that have a linker group attached to them.

The oligonucleotides used in the conjugates of the present invention can be prepared in a suitable manner and by conventional well known solid phase synthesis techniques. Equipment for such synthesis is sold by several vendors, including, for example, Applied Biosystems (Foster City, Calif.). Additionally or alternatively, any other means known in the art may be used for such synthesis. It is also known that similar techniques are used to prepare other oligonucleotides such as thiophosphates and alkylated derivatives.

In ligand-conjugated oligonucleotides and a ligand molecule bearing the sequence-specific linked nucleosides of the present invention, oligonucleotides and oligonucleosides can be synthesized on a suitable DNA synthesizer using standard nucleotide or nucleoside precursors or nucleotide or nucleoside conjugate precursors that already bear a linker group, ligand precursors. a nucleotide or nucleoside conjugate that already carries a ligand molecule or building blocks that carry a non-nucleoside ligand.

When using nucleotide-conjugate precursors that already carry a linker group, sequence-specific linked nucleosides are typically synthesized and then the ligand molecule is reacted with the linker group to form a ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the present invention are synthesized on an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates along with standard phosphoramidites and custom phosphoramidites that are commercially available and commonly used in oligonucleotide synthesis.

A. Lipid conjugates

In one embodiment, the ligand or conjugate is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule preferably binds to a serum protein, such as human serum albumin (HSA). The HSA-binding ligand promotes distribution of the conjugate to the target tissue, eg non-renal target tissue of the body. For example, the target tissue may be the liver, including parenchymal liver cells. Other molecules that can bind to HSA can also be used as ligands. For example, Neproxin or Aspirin can be used. The lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport to the target cell or cell membrane, and/or (c) can be used to regulate serum protein binding, for example, HSA.

A lipid-based ligand can be used to inhibit, for example, control the binding of a conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA with greater force is less likely to be directed to the kidneys and thus less likely to be excreted from the body. A lipid or lipid-based ligand that binds to HSA with less force can be used to target delivery of the conjugate to the kidneys.

In a preferred embodiment, the lipid-based ligand binds to HSA. Preferably, it binds to HSA with sufficient affinity such that the conjugate preferentially distributes to non-renal tissue. However, it is preferred that the affinity is not so strong that binding to the HSA of the ligand could become irreversible.

In another preferred embodiment, the lipid-based ligand binds weakly or not at all to HSA, such that the conjugate is preferably distributed in the kidney. You can also use other groups that are directed to kidney cells, instead of or in addition to the lipid-based ligand.

In another aspect, the ligand is a molecule, such as a vitamin, that is taken up by a target cell, such as a proliferating cell. They are particularly useful in the treatment of disorders characterized by unwanted cell proliferation, eg of the malignant or benign type, eg of malignant cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include vitamin B, such as folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients taken up by target cells, such as liver cells. Also included are HSA and low density lipoprotein (LDL).

B. Cell Penetrating Agents

In another aspect, the ligand is a cell-penetrating agent, preferably a helical cell-penetrating agent. Preferably, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia . If the agent is a peptide, it can be modified to include a peptidomimetic, inverted isomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. The helical agent is preferably an alpha helical agent which preferably contains a lipophilic and lipophobic phase.

The ligand may be a peptide or a peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a specific three-dimensional structure similar to a natural peptide. Binding of the peptide and peptidomimetics to mRNA agents can affect the pharmacokinetic distribution of the mRNA, such as increasing cellular recognition and uptake. The length of the peptide or peptidomimetic molecule can be about 5-50 amino acids, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 amino acids.

The peptide or peptidomimetic may be, for example, a cell-penetrating peptide, a cationic peptide, an amphipathic peptide, or a hydrophobic peptide (eg, consisting predominantly of Tyr, Trp or Phe). The peptide molecule may be a dendrimeric peptide, a conformationally restricted peptide, or a cross-linked peptide. In another alternative, the peptide molecule may contain a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS containing peptide is an RFGF containing the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO:13). An RFGF analog (e.g., the amino acid sequence AALLPVLLAAP (SEQ ID NO:10) containing a hydrophobic MTS can also be a guide group. The peptide molecule can be a "transport" peptide that can transport large polar molecules, including peptides, oligonucleotides, and protein through cell membranes . , such as a peptide determined from a phage display library or a one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). built-in monomer unit for cell binding, are arginine-glycine-aspartic acid (RGD)-peptide or and an RGD simulator. The length of the peptide molecule may range from about 5 amino acids to about 40 amino acids. Peptide molecules may contain such a structural modification to increase stability or direct conformational properties. You can use any of the structural modifications described below.

The RGD peptide for use in the compositions and methods of the invention may be linear or cyclic and may be modified, for example by being glycosylated or methylated, to facilitate targeted delivery to a particular tissue(s). RGD-containing peptides and peptidomimetics may contain D-amino acids as well as synthetic RGD mimics. In addition to RGD, other groups that target the integrin ligand can be used. Preferred conjugates of such a ligand are directed to PECAM-1 or VEGF.

A "cell-penetrating peptide" is capable of entering a cell, for example, a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. The microbial cell-penetrating peptide can be, for example, an α-helical linear peptide (eg, LL-37 or ceropin P1), a disulfide bond-containing peptide (eg, α-defensin, β-defensin, or bactenecin), or a peptide containing only one or two dominant amino acids (eg PR-39 or indolicidin). The cell-penetrating peptide may also contain a cellular intranuclear localization signal (NLS). For example, the cell-penetrating peptide can be a bicomponent amphipathic peptide such as MPG, which is derived from the gp41 fusion peptide domain of HIV-1 and the NLS of the SV40 large T antigen (Simeoni et al., Nucl. Acids Res., 31:2717- 2724, 2003).

C. Carbohydrate conjugates

In some embodiments of the compositions and methods of the invention, the mRNA oligonucleotide further comprises a carbohydrate. Carbohydrate-conjugated mRNA is preferred for in vivo delivery of nucleic acids as well as compositions suitable for in vivo therapeutic use as described herein. As used herein, "carbohydrate" refers to a compound that is a carbohydrate per se, consisting of one or more monosaccharide units containing at least 6 carbon atoms (which may be linear, branched or cyclic) with an oxygen atom, nitrogen or sulfur bonded to each carbon atom, or a compound containing as part of it a carbohydrate group consisting of one or more monosaccharide units, each containing at least six carbon atoms (which may be linear, branched or cyclic), with an oxygen, nitrogen, or sulfur atom attached to each carbon atom. Representative carbohydrates include sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8 or 9 monosaccharide units) and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums. Specific monosaccharides include C5 or more (eg C5, C6, C7 or C8) sugars; di- and trisaccharides include sugars containing two or three monosaccharide units (eg C5, C6, C7 or C8).

In one embodiment, the carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide. In one embodiment, the monosaccharide is N-acetylgalactosamine, such as

In another embodiment, the carbohydrate conjugate for use in the compositions and methods of the invention is selected from the group consisting of:

Another representative carbohydrate conjugate for use in the embodiments described herein includes, but is not limited to,

where one of X or Y is an oligonucleotide, the other is hydrogen.

In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator and/or a cell-penetrating peptide.

D. Linkers

In some embodiments, the conjugate or ligand described herein can be linked to the mRNA oligonucleotide by various linkers, which may or may not be cleavable.

The term "linker" or "linker group" means an organic group that connects two parts of the connection, for example, covalently links the two parts of the connection. Linkers typically contain a direct bond or atom such as oxygen or sulfur, a link such as NR8, C(O), C(O)NH, SO, SO ₂ , SO ₂ NH or a chain of atoms such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl , алкиларилалкенил, алкиларилалкинил, алкениларилалкил, алкениларилалкенил, алкениларилалкинил, алкиниларилалкил, алкиниларилалкенил, алкиниларилалкинил, алкилгетероарилалкил, алкилгетероарилалкенил, алкилгетероарилалкинил, алкенилгетероарилалкил, алкенилгетероарилалкенил, алкенилгетероарилалкинил, алкинилгетероарилалкил, алкинилгетероарилалкенил, алкинилгетероарилалкинил, алкилгетероциклилалкил, алкилгетероциклилалкенил, алкилгетероциклилалкинил, алкенилгетероциклил alkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, _{alkynylheterocyclylalkyl} , alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylheteroaryl, where one or more methylenes may be interrupted or terminated in SO, S(8, S2) , C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocycle; where R8 is hydrogen, acyl, aliphatic or substituted aliphatic. In one embodiment, the linker is about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17 , 8-17, 6-16, 7-17 or 8-16 atoms.

A cleavable linker group is a linker group that is reasonably stable outside of a cell, but which, upon entry into the target cell, cleaves to release two pieces that the linker holds together. In a preferred embodiment, the cleavable linker group is cleaved at least about 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times times faster in the target cell or under the first reference condition (which may, for example, be chosen to mimic or provide intracellular conditions) than in the individual's blood or under the second reference condition (which may, for example, be chosen to mimic or provide conditions found in blood or serum).

Cleavable linker groups are sensitive to cleavable agents such as pH, redox potential or the presence of destructive molecules. In general, disintegrating agents are the most abundant or found at higher levels or with high activities in cells than in serum or blood. Examples of such destructive agents include: a redox agent that is selected for specific substrates or that does not have substrate specificity, including, for example, oxidizing or reducing enzymes or reducing agents, such as mercaptans contained in cells, which can destroy cleavable in redox conditions of the linker group by recovery; esterases; endosomes or agents that can create an acidic environment, such as those that result in a pH of five or less; enzymes that can hydrolyze or degrade the acid-cleavable linker group, acting as the base acid, peptidases (which may be substrate specific), and phosphatases.

A cleavable linker group, such as a disulfide bond, may be pH sensitive. The human serum pH is 7.4, while the average intracellular pH is slightly lower in the range of approximately 7.1-7.3. Endosomes have a more acidic pH in the range of 5.5-6.0 and lysosomes have an even more acidic pH of about 5.0. Some linkers contain a cleavable linker group that cleaves at a preferred pH, thus releasing the cationic lipid from the ligand within the cell or in the desired cell compartment.

The linker may contain a cleavable linker group that is cleavable by a particular enzyme. The type of cleavable linker group introduced into the linker may depend on the cell to which targeted delivery is desired. For example, a liver-targeted ligand can be linked to a cationic lipid via a linker that contains an ester group. High levels of esterases are observed in liver cells, and thus the linker will be cleaved more efficiently in liver cells than in cell types that do not show high levels of esterases. Other cell types rich in esterases include lung, renal cortex, and testis cells.

Linkers that contain peptide bonds can be used for targeted delivery to high peptidase cell types such as liver cells and synoviocytes.

In general, the suitability of a candidate cleavable linker group can be assessed by testing the ability of a destructive agent (or condition) to cleave the candidate linker group. In addition, it is also desirable to test a candidate cleavable linker group for its ability to resist cleavage in the blood or upon contact with other non-target tissues. Thus, it is possible to determine the relative susceptibility to degradation between the first and second condition, where the first is chosen to be indicative of degradation in the target cell and the second is chosen to be indicative of degradation in other tissues or body fluids, e.g., blood or serum. Evaluations can be carried out in cell-free systems, in cells, in cell cultures, in organs or tissue cultures, or in animals. It may be useful to make preliminary assessments under cell-free or culture conditions and confirm through additional animal assessments. In preferred embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions, selected to mimic intracellular conditions) compared to blood or serum (or in vitro conditions selected to mimic extracellular conditions).

i. Redox cleavable linker groups

In one embodiment, the cleavable linker group is a redox-cleavable linker group that is cleavable upon reduction or oxidation. An example of a reductively cleavable linker group is a disulfide linker group (-SS-). To determine whether a candidate cleavable linker group is a suitable "reductively cleavable linker group" or, for example, suitable for use with a particular mRNA group and a particular targeting agent, the methods described herein can be considered. For example, a candidate can be assessed by incubation with dithiothreitol (DTT) or other reducing agent using reagents known in the art that mimic the rate of degradation seen in a cell, eg a target cell. Candidates can also be evaluated under conditions that are chosen to mimic blood or serum conditions. In one embodiment, candidate compounds are cleaved no more than about 10% in the blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in a cell (or under in vitro conditions, selected to simulate intracellular conditions) compared to blood (or in vitro conditions selected to simulate extracellular conditions). The rate of degradation of candidate compounds can be determined by standard enzyme kinetic assays under conditions chosen to mimic the intracellular environment and compared to conditions chosen to mimic the extracellular environment.

ii. Cleavable phosphate-based linker groups

In another embodiment, the cleavable linker contains a cleavable phosphate-based linker group. The cleavable phosphate-based linker group is cleaved by agents that degrade or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells is enzymes such as phosphatases in cells. Examples of phosphate-based linker groups are -O-P(O)(ORk)-O-, -O-P(S)(ORk)-O-, -O-P(S)(SRk)-O-, -S-P(O)( ORk)-O-, -O-P(O)(ORk)-S-, -S-P(O)(ORk)-S-, -O-P(S)(ORk)-S-, -S-P(S)(ORk) -O-, -O-P(O)(Rk)-O-, -O-P(S)(Rk)-O-, -S-P(O)(Rk)-O-, -S-P(S)(Rk)-O -, -S-P(O)(Rk)-S-, -O-P(S)(Rk)-S-. Preferred embodiments are -O-P(O)(OH)-O-, -O-P(S)(OH)-O-, -O-P(S)(SH)-O-, -S-P(O)(OH)- O-, -O-P(O)(OH)-S-, -S-P(O)(OH)-S-, -O-P(S)(OH)-S-, -S-P(S)(OH)-O- , -O-P(O)(H)-O-, -O-P(S)(H)-O-, -S-P(O)(H)-O-, -S-P(S)(H)-O-, - S-P(O)(H)-S-, -O-P(S)(H)-S-. A preferred embodiment is -O-P(O)(OH)-O-. These candidates can be evaluated in ways similar to those described above.

iii. Acid cleavable linker groups

In another embodiment, the cleavable linker contains an acid cleavable linker group. An acid-cleavable linker group is a linker group that is cleavable under acidic conditions. In preferred embodiments, the acid cleavable linker groups are cleavable in an acidic medium at a pH of about 6.5 or less (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0 or less), or by means such as enzymes that can act as a basic acid. In the cell, particular low pH organelles, such as endosomes and lysosomes, can provide a scavenging environment for acid-cleavable linker groups. Examples of acid-cleavable linker groups include, but are not limited to, hydrazones, esters, and esters of amino acids. The acid cleavable groups may have the general formula -C=NN-, C(O)O or -OC(O). A preferred embodiment is when the carbon attached to the oxygen of the ester (alkoxy group) is an aryl group, a substituted alkyl group, or a tertiary alkyl group such as dimethylpentyl or tert -butyl. These candidates can be evaluated in ways similar to those described above.

iv. Ester based linker groups

In another embodiment, the cleavable linker contains a cleavable ester linker group. The cleavable ester linker group is cleaved in cells by enzymes such as esterases and amidases. Examples of cleavable ester linker groups include, but are not limited to, alkylene esters, alkenylene, and alkynylene groups. Cleavable ester linker groups have the general formula -C(O)O- or -OC(O)-. These candidates can be evaluated in ways similar to those described above.

v. Peptide Based Cleavable Groups

In yet another embodiment, the cleavable linker contains a peptide-based cleavable linker group. The cleavable peptide-based linker group is cleaved in the cell by enzymes such as peptidases and proteases. Cleavable peptide linker groups are peptide bonds formed between amino acids to form oligopeptides (eg, dipeptides, tripeptides, etc.) and polypeptides. Cleavable groups based on the peptide do not include the amide group (-C(O)NH-). The amide group may be formed between any alkylene, alkenylene or alkynylene. A peptide bond is a particular type of amide bond formed between amino acids to form peptides and proteins. A peptide-based cleavable group is generally limited to a peptide bond (ie, an amide bond) formed between amino acids to form peptides and proteins, and does not include the entire amide functional group. Cleavable peptide-based linker groups have the general formula -NHCHRAC(O)NHCHRBC(O)-, where RA and RB are the R groups of two adjacent amino acids. These candidates can be evaluated in ways similar to those described above.

In one embodiment, the mRNA of the invention is conjugated to a carbohydrate via a linker. Non-limiting examples of mRNA carbohydrate-linker conjugates of the compositions and methods of the invention include, but are not limited to,

(Formula XXX), where one of X or Y is an oligonucleotide, the other is hydrogen.

In certain embodiments of the compositions and methods of the invention, the ligand is one or more GalNAc (N-acetylgalactosamine) derivatives connected via a divalent or trivalent branched linker.

In one embodiment, the dsRNA of the invention is conjugated to a divalent or trivalent branched linker selected from the group of structures represented in any of formulas (XXXI)-(XXXIV):

where:

q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C are independently for each occurrence 0-20, and where the repeating unit may be the same or different;

^P2A , ^P2B , ^P3A , ^P3B , ^P4A , ^P4B , ^P5A , ^P5B , ^P5C , ^T2A , ^T2B , ^T3A , ^T3B , ^T4A , ^T4B , ^T4A , ^T5B , T ^5C each independently for each case does not contain, represent CO, NH, O, S, OC(O), NHC(O), CH ₂ , CH ₂ NH or CH ₂ O;

Q ^2A , Q ^2B , Q ^3A , Q ^3B , Q ^4A , Q ^4B , Q ^5A , Q ^5B , Q ^5C each independently for each occurrence are alkylene, substituted alkylene, where one or more methylenes may be interrupted or terminated one or more of O, S, S(O), SO ₂ , N(R ^N ), C(R')=C(R"), C=C or C(O);

R ^2A , R ^2B , R ^3A , R ^3B , R ^4A , R ^4B , R ^5A , R ^5B , R ^5C each independently for each case is NH, O, S, CH ₂ , C(O)O , C(O)NH, NHCH(R ^a )C(O), -C(O)-CH(R ^a )-NH-, CO,

L ^2A , L ^2B , L ^3A , L ^3B , L ^4A , L ^4B , L ^5A , L ^5B and L ^5C are a ligand, i.e. each independently for each occurrence is a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide or polysaccharide, and R ^a is H or an amino acid side chain. Trivalent GalNAc conjugated derivatives are particularly suitable for use with RNAi agents for target gene inhibition, such as those of formula XXXV:

Formula XXXV

where L ^5A , L ^5B and L ^5C represent a monosaccharide such as a derivative of GalNAc.

Examples of suitable divalent and trivalent branched linker groups conjugating GalNAc derivatives include, but are not limited to, the structures listed above as formulas II_VII, XI, X and XIII.

Репрезентативные патенты США, в которых описано получение конъюгатов РНК включают, но не ограничиваются ими, патенты США №№ 4828979, 4948882, 5218105, 5525465, 5541313, 5545730, 5552538, 5578717, 5580731, 5591584, 5109124, 5118802, 5138045, 5414077, 5486603 , 5512439, 5578718, 5608046, 4587044, 4605735, 4667025, 4762779, 4789737, 4824941, 4835263, 4876335, 4904582, 4958013, 5082830, 5112963, 5214136, 5082830, 5112963, 5214136, 5245022, 5254469, 5258506, 5262536, 5272250, 5292873 , 5317098, 5371241, 5391723, 5416203, 5451463, 5510475, 5512667, 5514785, 5565552, 5567810, 5574142, 5585481, 5587371, 5595726, 5597696, 5599923, 5599928 и 5688941, 6294664, 6320017, 6576752, 6783931, 6900297, 7037646, 8106022 , the full content of each of which is thus incorporated into the present description by reference.

It is not necessary that all positions in a given compound be equally modified, and in fact more than one of the above modifications may be introduced into a single compound or even a single nucleoside in an mRNA. The present invention also relates to mRNA compounds that are chimeric compounds.

"Chimeric" mRNA compounds or "chimeras" in the context of the present invention are mRNA compounds, preferably dsRNAs, which contain two or more chemically distinct regions, each consisting of at least one monomeric unit, i.e. nucleotide in the case of a dsRNA connection. Such mRNAs typically contain at least one site where the RNA is modified in such a way as to provide, with increased resistance of the mRNA to nuclease degradation, increased cellular uptake and/or increased binding affinity for the target nucleic acid. The additional mRNA region can serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H thus leads to cleavage of the target RNA, thus greatly increasing the efficiency of mRNA inhibition of gene expression. Thus, comparable results can often be obtained for shorter mRNAs when chimeric dsRNAs are used, compared to thiophosphate deoxy-dsRNAs hybridizing to the same target site. Cleavage of the target RNA can be conventionally detected by gel electrophoresis, and if necessary by associated nucleic acid hybridization methods known in the art.

In certain cases, RNA mRNA can be modified with a non-ligand group. Many non-ligand molecules have been conjugated to mRNA to increase activity, cellular distribution, or cellular uptake of the mRNA, and methods for such conjugations are available in the scientific literature. Such non-ligand groups included lipid groups such as cholesterol (Kubo T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), thioether, e.g. ., Ann. N. Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), phospholipid, e.g. Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleot ides, 1995, 14:969) or adamantanoacetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), palmityl group (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229) or an octadecylamine or hexylaminocarbonyloxycholesterol group (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative US patents that describe the preparation of such RNA conjugates are listed above. Representative conjugation protocols involve the synthesis of an RNA carrying an amino linker at one or more positions in the sequence. The amino group is then reacted with a molecule conjugated using appropriate binding or activating reagents. The conjugation reaction can be carried out with the RNA still bound to the solid support or after liquid phase digestion of the RNA. Pure conjugate is generally obtained by HPLC purification of the RNA conjugate.

IV. Delivery of mRNA according to the invention

Delivery of an mRNA of the invention into a cell, eg, a cell of an individual, such as a human individual (eg, an individual in need, such as an individual with impaired lipid metabolism), can be accomplished in a number of different ways. For example, delivery can be carried out by bringing the cell into contact with the mRNA of the invention in vitro or in vivo . In vivo delivery can also be carried out directly by administering a composition containing an mRNA, eg dsRNA, to an individual. Alternatively, in vivo delivery may be mediated by the introduction of one or more vectors that encode and direct mRNA expression. These alternatives are further described below.

In general, any method for delivering a nucleic acid molecule ( in vitro or in vivo ) can be adapted for use with the mRNA of the invention (see, for example, Akhtar S. and Julian RL, (1992) Trends Cell. Biol., 2(5): 139-144 and WO94/02595, which are incorporated herein by reference in their entirety). For in vivo delivery, factors to be considered for delivery of an mRNA molecule include, for example, the biological stability of the delivered molecule, the avoidance of non-specific effects, and the accumulation of the delivered molecule in the target tissue. The non-specific effects of the mRNA can be minimized by local administration, for example, by injection or implantation into tissue, or by topical administration of the drug. Local administration to the treatment site maximizes the local concentration of the agent, limits exposure of the agent to systemic tissues that may otherwise damage the agent or which may destroy the agent, and it provides a lower total dose of the mRNA molecule that must be administered. Several studies have demonstrated successful "knockdown" of gene products upon local administration of mRNA. For example, intraocular delivery of VEGF dsRNA via intravitreal injection in cynomolgus monkeys (Tolentino MJ et al., (2004) Retina, 24:132-138) and subretinal injections in mice (Reich SJ et al., (2003) Mol. Vis., 9:210-216) prevent neovascularization in an experimental model associated with age-related macular degeneration. In addition, direct intratumoral injection of dsRNA in mice reduces tumor volume (Pille J. et al., (2005) Mol. Ther., 11:267-274) and can increase the survival of tumor-bearing mice (Kim WJ et al., (2006 ) Mol. Ther., 14:343-350; Li S. et al., (2007) Mol. Ther., 15:515-523). Successful RNAi has also been demonstrated when locally delivered to the CNS by direct injection (Dorn G. et al., (2004) Nucleic Acids, 32:c49; Tan PH et al., (2005) Gene Ther., 12:59-66 ; Makimura H. et al., (2002) BMC Neurosci. 3:18; Shishkina GT et al., (2004) Neuroscience, 129:521-528; Thakker ER et al., (2004) Proc. Natl. Acad. Sci. USA, 101:17270-17275; Akaneya Y., et al., (2005) J. Neurophysiol., 93:594-602) and to the lungs via intranasal administration (Howard KA et al., (2006) Mol. Ther., 14:476-484; Zhang X. et al., (2004) J. Biol. Chem., 279:10677-10684; Bitko V. et al., (2005) Nat. Med., 11:50 -55). For systemic administration of mRNA to treat a disease, the RNA can be modified or alternatively delivered using a drug delivery system; both modes act by preventing the rapid degradation of dsRNA by endo- and exonucleases in vivo . The RNA modification or pharmaceutical carrier can also provide targeted delivery of the mRNA composition to the target tissue and prevent unwanted off-target effects. mRNA molecules can be modified by chemical conjugation with lipophilic groups such as cholesterol to increase cellular uptake and prevent degradation. For example, anti-apoB mRNA conjugated to a lipophilic cholesterol group was systemically injected into mice and knocked down apoB mRNA in the liver and small intestine (Soutschek J. et al., (2004) Nature, 432:173-178) . Aptamer mRNA conjugation has been shown to inhibit tumor growth and mediate tumor regression in a mouse prostate cancer model (McNamara JO et al., (2006) Nat. Biotechnol., 24:1005-1015). In an alternative embodiment, the mRNA can be delivered using drug delivery systems such as a nanoparticle, dendrimer, polymer, liposomes, or cationic delivery system. Positively charged cationic delivery systems facilitate the binding of the mRNA (negatively charged) molecule and also enhance interactions on the negatively charged cell membrane, ensuring efficient uptake of the mRNA into the cell. Cationic lipids, dendrimers, or polymers can be associated with mRNA or induced to form vesicles or micelles (see, for example, Kim SH et al., (2008) Journal of Controlled Release, 129(2): 107-116), which are placed mRNA. The formation of vesicles or micelles further prevents mRNA degradation upon systemic administration. Methods for preparing and introducing cationic mRNA complexes are well known to those skilled in the art (see e.g. Sorensen DR et al., (2003) J. Mol. Biol., 327:761-766; Verma UN et al., (2003) Clin Cancer Res., 9:1291-1300; Arnold AS et al., (2007) J. Hypertens., 25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems suitable for systemic delivery of mRNA include DOTAP (Sorensen DR et al., (2003), supra; Verma UN et al., (2003), supra), oligofectamine, "particulate nucleic acid- lipid" (Zimmermann TS et al., (2006) Nature, 441:111-114), cardiolipin (Chien PY et al., (2005) Cancer Gene Ther., 12:321-328; Pal A. et al., (2005) Int. J. Oncol., 26:1087-1091), polyethyleneimine (Bonnet ME. et al., (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner A. (2006) J. Biomed. Biotechnol., 71659), Arg-Gly-Asp (RGD) peptides (Liu S. (2006) Mol. Pharm., 3:472-487) and polyamidoamines (Tomalia DA et al., (2007) Biochem. Soc. Trans ., 35:61-67; Yoo H. et al., (1999) Pharm. Res., 16:1799-1804). In some embodiments, the mRNA is complexed with a cyclodextrin for systemic administration. Methods of administration and pharmaceutical compositions of mRNA and cyclodextrins can be found in US patent No. 7427605, which is fully incorporated into the present description by reference.

A. Vector encoded mRNAs of the invention

mRNA directed to the ANGPTL3 gene can be expressed from a transcription unit inserted into DNA or RNA vectors (see, for example, Couture A. et al., TIG. (1996), 12:5-10; Skillrn A. et al., PCT International Publication No. WO 00/22113, Conrad, PCT International Publication No. WO 00/22114 and Conrad, US Pat. No. 6,054,299). Expression can be transient (on the order of hours to weeks) or permanent (weeks to months or more), depending on the particular construct used and the target tissue or cell type. Such transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector. The transgene can also be designed to be heritable as an extrachromosomal plasmid (Gassman et al., (1995) Proc. Natl. Acad. Sci. USA, 92:1292).

The individual mRNA strand or strands can be transcribed from a promoter on an expression vector. When it is necessary to express two separate strands to produce, for example, dsRNA, two separate expression vectors can be introduced together (eg, by transfection or infection) into the target cell. Alternatively, each individual strand of dsRNA can be transcribed with promoters that are both located on the same expression plasmid. In one embodiment, the dsRNA is expressed as inverted repeat polynucleotides linked by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure.

The mRNA expression vectors are typically DNA plasmids or viral vectors. To obtain recombinant mRNA expression constructs as described herein, expression vectors compatible with eukaryotic cells, preferably expression vectors compatible with vertebrate cells, can be used. Eukaryotic cell-based expression vectors are well known in the art and are available from a number of commercial sources. Typically, such vectors, provided that they contain suitable restriction sites for insertion of the desired nucleic acid segment. Delivery of mRNA expression vectors can be systemic, such as by intravenous or intramuscular administration, by injection into target cells explanted from a patient followed by reintroduction into the patient, or by any other means that provides introduction into the desired target cell.

Plasmids for mRNA expression can be transfected into target cells as a complex with cationic lipid carriers (eg oligofectamine) or non-cationic lipid carriers (eg Transit-TKO™). Also, the present invention contemplates many lipid transfections for mRNA-mediated knockdown directed to different regions of the target RNA for a week or more. Successful introduction of vectors into host cells can be monitored by various known methods. For example, transient transfection can be detected using a reporter such as a fluorescent marker such as green fluorescent protein (GFP). Stable transfection of cells ex vivo can be achieved using markers that confer resistance to specific environmental factors (e.g. antibiotics and drugs) in the transfected cell, such as resistance to hygromycin B.

Viral vector systems that can be used in the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors, (b) retroviral vectors, including but not limited to lentiviral vectors, Moloney leukemia virus mice, etc., (c) adeno-associated viral vectors, (d) herpes simplex virus vectors, (e) SV 40 vectors, (f) polyoma virus vectors, (g) papilloma virus vectors, ( h) vectors based on picornavirus, (i) vectors based on a poxvirus such as orthopoxvirus, e.g. helper or adenovirus with a truncated genome. Viruses with a replication defect may also be preferred. Various vectors are integrated or not integrated into the genome of cells. If desired, the constructs may contain viral sequences for transfection. Alternatively, the construct can be introduced into vectors capable of episomal replication, such as the EPV and EBV vectors. Recombinant mRNA expression constructs generally require regulatory elements such as promoters, enhancers, etc. to ensure the expression of mRNA in target cells. Other aspects to consider for vectors and constructs are further described below.

Vectors suitable for mRNA delivery contain regulatory elements (promoter, enhancer, etc.) sufficient to express the mRNA in the desired target cell or tissue. Regulatory elements can be selected to provide constitutive or regulated/induced expression.

mRNA expression can be precisely regulated, for example, using an inducible regulatory sequence that is sensitive to certain physiological regulators, such as circulating glucose levels or hormones (Docherty et al., 1994, FASEB J., 8:20-24). Such inducible expression systems suitable for regulating dsRNA expression in cells or mammals include, for example, regulation by ecdysone, estrogen, progesterone, tetracycline, dimerization chemical inducers, and isopropyl-beta-D1-thiogalactopyranoside (IPTG). The person skilled in the art can select an appropriate regulatory/promoter sequence depending on the intended use of the mRNA transgene.

You can use viral vectors that contain nucleic acid sequences encoding mRNA. For example, a retroviral vector can be used (see Miller et al., (1993) Meth. Enzymol., 217:581-599). Such retroviral vectors contain the components necessary for proper packaging of the viral genome and integration into the DNA of the host cell. The mRNA-encoding nucleic acid sequences are cloned into one or more vectors that facilitate delivery of the nucleic acid to a patient. More information on retroviral vectors can be found, for example, in Boesen et al., Biotherapy, 6:291-302 (1994), who describe the use of a retroviral vector to deliver the mdr1 gene in hematopoietic stem cells to produce stem cells that are more resistant to chemotherapy. . Other references illustrating the use of retroviral vectors in gene therapy are Clowes et al., (1994) J. Clin. Invest., 93:644-651; Kiem et al., (1994) Blood, 83:1467-1473; Salmons and Gunzberg, (1993) Human Gene Therapy, 4:129-141 and Grossman and Wilson, (1993) Curr. Opin. in Genetics and Devel., 3:110-114. Lentiviral vectors contemplated for use include, for example, the HIV-based vectors described in US Pat.

Adenoviruses are also contemplated for use in delivering mRNAs of the invention. Adenoviruses are particularly attractive carriers, for example, for delivering genes to airway epithelial tissue. Adenoviruses naturally infect airway epithelial tissue when they cause mild illness. Other targets for adenovirus-based delivery systems are the liver, central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being able to infect non-dividing cells. Kozarsky and Wilson, (1993) Current Opinion in Genetics and Development, 3:499-503 provide an overview of adenovirus-based gene therapy. Bout et al., (1994) Human Gene Therapy, 5:3-10 demonstrated the use of adenoviral vectors to transfer genes to the airway epithelial tissue of rhesus monkeys. Other uses of adenoviruses in gene therapy can be found in Rosenfeld et al., (1991) Science, 252:431-434; Rosenfeld et al., (1992) Cell, 68:143-155; Mastrangeli et al., (1993) J. Clin. Invest., 91:225-234; in PCT Publication WO94/12649 and Wang et al., (1995) Gene Therapy 2:775-783. A suitable AV vector for mRNA expression of the invention, a method for constructing a recombinant AV vector, and a method for delivering the vector to target cells are described in Xia H. et al., (2002), Nat. Biotech., 20:1006-1010.

Adeno-associated virus (AAV) vectors can also be used to deliver the mRNA of the invention (Walsh et al., (1993) Proc. Soc. Exp. Biol. Med., 204:289-300, US Pat. No. 5,436,146). In one embodiment, the mRNA can be expressed as two separate complementary single stranded RNA molecules from a recombinant AAV vector containing, for example, the U6 or H1 RNA promoter or the cytomegalovirus (CMV) promoter. Suitable AAV-based vectors for dsRNA expression of the invention, methods for constructing a recombinant AV vector, and methods for delivering vectors to target cells are described in Samulski R. et al., (1987), J. Virol., 61: 3096-3101; Fisher K.J. et al., (1996), J. Virol, 70: 520-532; Samulski R. et al., (1989), J. Virol., 63: 3822-3826; in US patent No. 5252479; US patent No. 5139941; International Patent Application No. WO 94/13788 and International Patent Application No. WO 93/24641, the full disclosure of which is incorporated herein by reference.

Another viral vector suitable for delivering an mRNA of the invention is a poxvirus such as vaccinia virus, e.g. attenuated vaccinia virus such as modified Ankara virus (MVA) or NYVAC, avian pox virus such as avian pox-diphtheria or canarypox .

If necessary, the tropism of viral vectors can be modified by pseudotyping the vectors with coat proteins or other surface antigens from other viruses, or by replacing different viral capsid proteins. For example, lentiviral vectors can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like. AAV-based vectors can be modified for targeted delivery to different cells by constructing vectors to express different capsid protein serotypes, see e.g. Rabinowitz J. E. et al., (2002), J. Virol., 76:791-801, for a full description which is included in the present description by reference.

The vector pharmaceutical preparation may contain the vector in a suitable diluent or may contain a sustained release matrix into which the gene delivery vehicle is immersed. Alternatively, when the complete gene delivery vector can be obtained intact from recombinant cells, such as retroviral vectors, the pharmaceutical preparation may contain one or more cells that produce the gene delivery system.

V. Pharmaceutical Compositions of the Invention

The present invention also relates to pharmaceutical compositions and compositions that contain mRNA according to the invention. In one of the embodiments in the present description disclosed pharmaceutical compositions containing mRNA, as described in the present description, and a pharmaceutically acceptable carrier. Pharmaceutical compositions containing mRNA are useful in the treatment of a disease or disorder associated with the expression or activity of the ANGPTL3 gene, for example, lipid metabolism disorders such as hypertriglyceridemia.

Such pharmaceutical compositions are formulated depending on the mode of delivery. One example is compositions that are formulated for systemic administration via parenteral delivery, for example via intravenous (IV) or subcutaneous delivery. Another example is compositions that are formulated for direct delivery to the liver, for example, by infusion into the liver, such as continuous infusion using a pump.

Pharmaceutical compositions of the invention may be administered at doses sufficient to inhibit expression of the ANGPTL3 gene. Typically, a suitable dose of mRNA of the invention is in the range of about 0.001 to about 200.0 milligrams per kilogram of recipient body weight per day, typically in the range of about 1 to 50 mg per kilogram of body weight per day. For example, dsRNA can be administered at about 0.01 mg/kg, about 0.05 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 1.5 mg/kg, about 2 mg/kg, about 3 mg/kg, approximately 10 mg/kg, approximately 20 mg/kg, approximately 30 mg/kg, approximately 40 mg/kg or approximately 50 mg/kg in a single dose.

For example, dsRNA can be administered at a dose of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5, 1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6, 4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7, 7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

In another embodiment, the dsRNA is administered at a dose of about 0.1 to about 50 mg/kg, about 0.25 to about 50 mg/kg, about 0.5 to about 50 mg/kg, about 0.75 to about up to 50 mg/kg, from about 1 to about 50 mg/kg, from about 1.5 to about 50 mg/mg, from about 2 to about 50 mg/kg, from about 2.5 to about 50 mg/kg, about 3 to about 50 mg/kg, about 3.5 to about 50 mg/kg, about 4 to about 50 mg/kg, about 4.5 to about 50 mg/kg, about 5 to about 50 mg/kg, about 7.5 to about 50 mg/kg, about 10 to about 50 mg/kg, about 15 to about 50 mg/kg, about 20 to about 50 mg/kg, about 25 about up to 50 mg/kg, approximately 30 to approximately 50 mg/kg, approximately 35 to about 50 mg/kg, about 40 to about 50 mg/kg, about 45 to about 50 mg/kg, about 0.1 to about 45 mg/kg, about 0.25 to about 45 mg/kg, about 0.5 to about 45 mg/kg, about 0.75 to about 45 mg/kg, about 1 to about 45 mg/mg, about 1.5 to about 45 mg/kg, about 2 to about 45 mg/kg, about 2.5 to about 45 mg/kg, about 3 to about 45 mg/kg, about 3.5 to about 45 mg/kg, about 4 to about 45 mg/kg, about 4.5 to about 45 mg/kg, about 5 to about 45 mg/kg, about 7.5 to about 45 mg/kg, about 10 to about 45 mg/kg, about 15 to about 45 mg/kg, about 20 to about 45 mg/kg, from about 25 app up to 45 mg/kg, about 30 to about 45 mg/kg, about 35 to about 45 mg/kg, about 40 to about 45 mg/kg, about 0.1 to about 40 mg/kg, about 0.25 to about 40 mg/kg, about 0.5 to about 40 mg/kg, about 0.75 to about 40 mg/kg, about 1 to about 40 mg/mg, about 1.5 up to about 40 mg/kg, about 2 to about 40 mg/kg, about 2.5 to about 40 mg/kg, about 3 to about 40 mg/kg, about 3.5 to about 40 mg/kg , about 4 to about 40 mg/kg, about 4.5 to about 40 mg/kg, about 5 to about 40 mg/kg, about 7.5 to about 40 mg/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg, about 20 to about 40 mg/kg, about 25 to about 40 mg/kg, about 30 to about 40 mg/kg, about 35 to about 40 mg/kg, about 0.1 to about 30 mg/kg, about 0 ,25 to about 30 mg/kg, about 0.5 to about 30 mg/kg, about 0.75 to about 30 mg/kg, about 1 to about 30 mg/mg, about 1.5 to about 30 mg/kg, about 2 to about 30 mg/kg, about 2.5 to about 30 mg/kg, about 3 to about 30 mg/kg, about 3.5 to about 30 mg/kg, about 4 to about 30 mg/kg, about 4.5 to about 30 mg/kg, about 5 to about 30 mg/kg, about 7.5 to about 30 mg/kg, about 10 to about 30 mg /kg, about 15 to about 30 mg/kg, about 20 to about 30 mg/kg, approx. about 25 to about 30 mg/kg, about 0.1 to about 20 mg/kg, about 0.25 to about 20 mg/kg, about 0.5 to about 20 mg/kg, about 0, 75 to about 20 mg/kg, about 1 to about 20 mg/mg, about 1.5 to about 20 mg/kg, about 2 to about 20 mg/kg, about 2.5 to about 20 mg/kg kg, about 3 to about 20 mg/kg, about 3.5 to about 20 mg/kg, about 4 to about 20 mg/kg, about 4.5 to about 20 mg/kg, about 5 about up to 20 mg/kg, from about 7.5 to about 20 mg/kg, from about 10 to about 20 mg/kg, or from about 15 to about 20 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

For example, dsRNA can be administered at a dose of about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0, 2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1, 5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2, 8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8, 1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9, 4, 9.5, 9.6, 9.7, 9.8, 9.9 or about 10 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

In another embodiment, the dsRNA is administered at a dose of about 0.5 to about 50 mg/kg, about 0.75 to about 50 mg/kg, about 1 to about 50 mg/mg, about 1.5 to about 50 mg/kg, about 2 to about 50 mg/kg, about 2.5 to about 50 mg/kg, about 3 to about 50 mg/kg, about 3.5 to about 50 mg/kg, about 4 to about 50 mg/kg, about 4.5 to about 50 mg/kg, about 5 to about 50 mg/kg, about 7.5 to about 50 mg/kg, about 10 to about 50 mg/kg kg, about 15 to about 50 mg/kg, about 20 to about 50 mg/kg, about 25 to about 50 mg/kg, about 30 to about 50 mg/kg, about 35 to about 50 mg/kg kg, about 40 to about 50 mg/kg, about 45 to about 50 mg/kg, about 0.5 to about 45 mg/kg, about 0.75 to about 45 mg/kg, about 1 to about 45 mg/mg, about 1.5 to about 45 mg/kg, about 2 to about 45 mg/kg, about 2.5 to about 45 mg/kg, about 3 to about 45 mg/kg, about 3.5 to about 45 mg/kg, about 4 to about 45 mg/kg, about 4.5 to about 45 mg/kg, about 5 to about 45 mg/kg, about 7.5 to about 45 mg/kg, about 10 to about 45 mg /kg, about 15 to about 45 mg/kg, about 20 to about 45 mg/kg, about 25 to about 45 mg/kg, about 30 to about 45 mg/kg, about 35 to about 45 mg /kg, approximately 40 to approximately 45 mg/kg, approximately 0.5 approx. up to 40 mg/kg, approximately 0.75 to approximately 40 mg/kg, approximately 1 to approximately 40 mg/mg, approximately 1.5 to approximately 40 mg/kg, approximately 2 to approximately 40 mg/kg , about 2.5 to about 40 mg/kg, about 3 to about 40 mg/kg, about 3.5 to about 40 mg/kg, about 4 to about 40 mg/kg, about 4.5 up to about 40 mg/kg, about 5 to about 40 mg/kg, about 7.5 to about 40 mg/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg, about 20 to about 40 mg/kg, about 25 to about 40 mg/kg, about 30 to about 40 mg/kg, about 35 to about 40 mg/kg, about 0.5 to about 30 mg/kg , about 0.75 to about 30 mg/kg, about 1 to about 30 mg/m g, about 1.5 to about 30 mg/kg, about 2 to about 30 mg/kg, about 2.5 to about 30 mg/kg, about 3 to about 30 mg/kg, about 3, 5 to about 30 mg/kg, about 4 to about 30 mg/kg, about 4.5 to about 30 mg/kg, about 5 to about 30 mg/kg, about 7.5 to about 30 mg/kg kg, about 10 to about 30 mg/kg, about 15 to about 30 mg/kg, about 20 to about 30 mg/kg, about 25 to about 30 mg/kg, about 0.5 to about 20 mg/kg, about 0.75 to about 20 mg/kg, about 1 to about 20 mg/mg, about 1.5 to about 20 mg/kg, about 2 to about 20 mg/kg, about 2.5 to about 20 mg/kg, about 3 to about 20 mg/kg, about 3.5 to about 20 mg/kg, about 4 to about 20 mg/kg, about 4.5 to about 20 mg/kg, about 5 to about 20 mg/kg, about 7.5 to about 20 mg/kg, about 10 to about 20 mg/kg, or about 15 to about 20 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

For example, individuals can be administered a therapeutic amount of mRNA, such as about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4, 1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5, 4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6, 7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14, 5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or approximately 50 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

The pharmaceutical composition may be administered once a day, or the mRNA may be administered in two, three or more divided doses at appropriate intervals throughout the day, or even using continuous infusion or delivery via a controlled release formulation. In this case, the mRNA contained in each portion of the dose should be correspondingly less to obtain a total daily dosage. The dosage unit can also be formulated for delivery over several days, for example using conventional sustained release formulations that provide sustained release of the mRNA over several days. Sustained release formulations are well known in the art and are particularly useful for delivering agents to a specific site, such as those that can be used with the agents of the present invention. In this embodiment, the dosage unit contains the appropriate totality of the daily dose.

The effect of a single dose on ANGPTL3 levels can be prolonged, such that subsequent doses are administered at no more than 3, 4, or 5 day intervals, or at no more than 1, 2, 3, or 4 week intervals.

One of skill in the art will recognize that certain factors may affect the dosage and time required to effectively treat an individual, including, but not limited to, the severity of the disease or disorder, previous treatments, the general health and/or age of the individual, and others present. diseases. In addition, treatment of an individual with a therapeutically effective amount of the composition may include a single treatment or a series of treatments. Estimates of effective dosing and in vivo half-life for individual mRNAs included in the invention can be made by conventional methods or based on in vivo testing using an appropriate animal model, as described elsewhere in the present description.

Advances in mouse genetics have given rise to a number of mouse models for the study of various human diseases, such as disorders of lipid metabolism, which are beneficially affected by downregulation of ANGPTL3. Such models can be used to test mRNA in vivo as well as to determine a therapeutically effective dose. Suitable mouse models are known in the art and include, for example, an obese (ob/ob) mouse carrying a mutation in the obesity (ob) gene (Wiegman et al., (2003) Diabetes, 52:1081-1089); a mouse carrying a homozygous LDL receptor knockout (LDLR -/- mouse; Ishibashi et al., (1993) J. Clin. Invest., 92(2):883-893); diet-induced atherosclerosis mouse model (Ishida et al., (1991) J. Lipid. Res., 32:559-568) and heterozygous lipoprotein lipase knockout mouse model (Weistock et al., (1995) J. Clin. Invest ., 96(6):2555-2568).

The pharmaceutical compositions of the present invention may be administered in a variety of ways depending on whether systemic or topical treatment is desired and the site to be treated. Administration can be topical (eg via a transdermal patch), pulmonary, eg via inhalation or insufflation of powders or aerosols, including via a nebulizer, intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, subcutaneous, eg via an implanted device, or intracranial, eg via intraparenchymal, intrathecal or intraventricular administration.

The mRNA can be delivered in such a way as to provide targeted delivery to a specific tissue, such as the liver (eg, liver hepatocytes).

Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Optional or desirable may be conventional pharmaceutical carriers, aqueous, powdered or oily bases, thickeners, and the like. Coated condoms, gloves, and the like may also be suitable. Suitable topical formulations include those in which the mRNA of the invention is in admixture with a topical delivery vehicle such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents, and surfactants. Suitable lipids and liposomes include neutral (eg dioleoylphosphatidylethanolamine DOPE, dimyristoylphosphatidylcholine DMPC, distearoylphosphatidylcholine), negative (eg dimyristoylphosphatidylglycerol DMPG) and cationic (eg dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidylethanolamine DOTMA). The mRNA of the invention can be encapsulated in liposomes or can be complexed with them, in particular with cationic liposomes. Alternatively, the mRNA can be formulated as a complex with lipids, in particular cationic lipids. Suitable fatty acids and esters include, but are not limited to, arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl-1-monocaprate, 1-dodecylasecycloheptan-2-one, acylcarnitine, acylcholine or C _1-20 alkyl ester (eg isopropyl myristate IPM), monoglyceride, diglyceride or a pharmaceutically acceptable salt thereof. Local compounds are described in detail in US patent No. 6747014, included in the present description by reference.

A. mRNA compositions containing membrane molecular aggregates

mRNA for use in the compositions and methods of the invention can be formulated for delivery in a membrane molecular assembly, such as a liposome or micelle. As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, eg, one bilayer or multiple bilayers. Liposomes include unilamellar and multilamellar vesicles that contain a membrane formed from a lipophilic substance and an aqueous content. The aqueous portion contains the mRNA composition. The lipophilic substance separates the aqueous content from the aqueous environment, which generally does not contain the mRNA composition, although in some examples it may. Liposomes are useful for carrying and delivering active ingredients to the site of action. Because the liposome membrane is structurally similar to biological membranes, when the liposomes are applied to tissue, the liposome bilayer fuses with the cell membrane bilayer. As the fusion of the liposome and the cell progresses, the internal water content, which contains the mRNA, is delivered to the cell, where the mRNA can specifically bind to the target RNA and can mediate RNAi. In some cases, liposomes are also specifically targeted, for example, to target mRNA to specific cell types.

The liposome containing the RNAi agent can be prepared in various ways. In one example, the lipid component of the liposome is dissolved in a detergent so as to obtain micelles with a lipid component. For example, the lipid component may be an amphipathic cationic lipid or a lipid conjugate. The detergent may have a high critical micelle concentration and may be non-ionic. Exemplary detergents include cholate, CHAPS, octylglucoside, deoxycholate, and lauroylsarcosine. The RNAi agent preparation is then added to micelles that contain the lipid component. The cationic groups on the lipid interact with the RNAi agent and condense around the RNAi agent to form a liposome. After condensation, the detergent is removed, for example by dialysis, to obtain a liposomal preparation of the RNAi agent.

If necessary, a carrier compound that promotes condensation can be added during the condensation reaction, for example by controlled addition. For example, the carrier compound may be a polymer other than a nucleic acid (eg, spermine or spermidine). The pH can also be adjusted to support condensation.

Methods for preparing stable polynucleotide delivery vehicles that introduce a polynucleotide/cationic lipid complex as structural components of the delivery vehicle are further described, for example, in WO 96/37194, the entire content of which is incorporated herein by reference. The production of liposomes may also include one or more aspects of the exemplary methods described in Felgner P.L. et al., (1987) Proc. Natl. Acad. sci. USA 8:7413-7417; in US patent No. 4897355, US patent No. 5171678; in Bangham et al., (1965) M. Mol. Biol., 23:238; Olson et al., (1979) Biochim. Biophys. Acta, 557:9; Szoka et al., (1978) Proc. Natl. Acad. Sc. 75: 4194; Mayhew et al., (1984) Biochim. Biophys. Acta 775:169; Kim et al., (1983) Biochim. Biophys. Acta, 728:339 and Fukunaga et al., (1984) Endocrinol 115:757. Commonly used methods to obtain lipid aggregates of suitable size for use as delivery vehicles include sonication and freeze-thaw plus extrusion (see, for example, Mayer et al., (1986) Biochim. Biophys. Acta, 858:161. You can use microfluidization when comparable small (50 to 200 nm) and relatively uniform aggregates are desired (Mayhew et al., (1984) Biochim. Biophys. Acta, 775:169. These methods can be readily adapted to package RNAi agent preparations in liposomes.

Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes that interact with negatively charged nucleic acid molecules to form a stable complex. The positively charged nucleic acid/liposome complexes bind to the negatively charged cell surface and are internalized into the endosome. Due to the acidic pH in the endosome, liposomes are degraded, releasing their contents into the cytoplasm of the cell (Wang et al. (1987) Biochem. Biophys. Res. Commun., 147:980-985).

Liposomes that are pH sensitive or negatively charged capture nucleic acids better than complex with them. Due to the fact that nucleic acid and lipid have the same charge, repulsion occurs more often than complex formation. However, some nucleic acid is trapped in the aqueous content of such liposomes. pH-sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. Exogenous gene expression was detected in target cells (Zhou et al. (1992) Journal of Controlled Release, 19:269-274).

One of the main types of liposomal composition includes phospholipids other than natural phosphatidylcholine. Neutral liposomal compositions, for example, can be prepared from dimyristoylphosphatidylcholine (DMPC) or dipalmitoylphosphatidylcholine (DPPC). Anionic liposome formulations are typically prepared from dimyristoylphosphatidylglycerol, while anionic fusion-promoting liposomes are predominantly prepared from dioleoylphosphatidylethanolamine (DOPE). Another type of liposome composition is derived from phosphatidylcholine (PC), such as, for example, soy PC and egg PC. Another type is obtained from a mixture of phospholipid and/or phosphatidylcholine and/or cholesterol.

Examples of other methods for introducing liposomes into cells in vitro and in vivo include US patent No. 5283185, US patent No. 5171678, WO 94/00569, WO 93/24640, WO 91/16024, Felgner, (1994) J. Biol. Chem. 269:2550; Nabel, (1993) Proc. Natl. Acad. Sc. 90:11307; Nabel, (1992) Human Gene Ther., 3:649; Gershon, (1993) Biochem., 32:7143 and Strauss, (1992) EMBO J., 11:417.

Non-ionic liposomal systems have also been analyzed to determine their suitability for drug delivery to the skin, in particular systems containing a non-ionic surfactant and cholesterol. Non-ionic liposomal formulations containing Novasome ^TM I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome ^TM II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin A to the dermis of the skin of mice. The results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporine A in various skin layers (Hu et al., (1994) STPPharma. Sci., 4(6):466).

Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes containing one or more specialized lipids which, when incorporated into the liposomes, result in an increased lifetime in the bloodstream relative to liposomes not containing such lipids. specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid fraction of the liposome (A) contains one or more glycolipids, such as monosialoganglioside G _M1 , or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) group . Without wishing to be bound by any particular theory in the art, it is believed that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the increased circulatory half-life of these sterically stabilized liposomes results from reduced uptake into reticuloendothelial cells. systems (RES) (Allen et al., (1987) FEBS Letters, 223:42; Wu et al., (1993) Cancer Research, 53:3765).

Various liposomes containing one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. NY Acad. Sci., (1987), 507:64) described the ability of monosialoganglioside G _M1 , galactocerebroside sulfate, and phosphatidylinositol to improve the blood half-life of liposomes. These findings have been interpreted by Gabizon et al. (Proc. Natl. Acad. Sci. USA, (1988), 85:6949). US Pat. No. 4,837,028 and WO 88/04924, both to Allen et al., describe liposomes containing (1) sphingomyelin and (2) G _M1 ganglioside or galactocerebroside sulfate ester. US Pat. No. 5,543,152 (Webb et al.) describes liposomes containing sphingomyelin. Liposomes containing 1,2-sn-dimyristoylphosphatidylcholine are described in WO 97/13499 (Lim et al.).

In one embodiment, cationic liposomes are used. Cationic liposomes have the advantage of being able to fuse with the cell membrane. Non-cationic liposomes, despite being unable to fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver RNAi agents to macrophages.

Additional advantages of liposomes include: liposomes derived from natural phospholipids are biocompatible and biodegradable, a wide range of water-soluble and lipid-soluble drugs can be incorporated into liposomes, liposomes can protect encapsulated RNAi agents in their internal compartments from metabolism and degradation (Rosoff, in "Pharmaceutical Dosage Forms", Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important factors to consider when formulating liposomes are the surface charge of the lipids, the size of the vesicles, and the water volume of the liposomes.

A positively charged synthetic cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) can be used to prepare small liposomes that spontaneously interact with nucleic acid to form lipid-nucleic acid complexes. acid that are capable of fusing with negatively charged lipids of cell membranes of tissue culture cells, resulting in the delivery of an RNAi agent (for a description of DOTMA and its use with DNA, see, for example, Felgner P. L. et al., (1987) Proc. Natl. Acad. Sci USA 8:7413-7417 and US Pat. No. 4,897,355).

The DOTMA analog 1,2-bis(oleyloxy)-3-(trimethylammonium)propane (DOTAP) can be used in combination with a phospholipid to produce DNA-complexing vesicles. Lipofectin ^TM (Bethesda Research Laboratories, Gaithersburg, Md.) is an effective agent for delivering highly anionic nucleic acids into living tissue culture cells that contain positively charged DOTMA liposomes that spontaneously interact with negatively charged polynucleotides to form complexes. When sufficiently positively charged liposomes are used, the resulting charge on the resulting complexes is also positive. The positively charged complexes thus obtained spontaneously attach to negatively charged cell surfaces, fuse with the plasma membrane, and efficiently deliver functional nucleic acids, for example, to tissue culture cells. Another commercially available cationic lipid, 1,2-bis(oleyloxy)-3,3-(trimethylammonium)propane ("DOTAP") (Boehringer Mannheim, Indianapolis, Ind.) differs from DOTMA in that the oleyl groups are linked by ester bonds rather than simple ether bonds.

Other cationic lipid-based compounds described include those conjugated to various moieties, including, for example, carboxyspermine, which is conjugated to one of two types of lipids, and include compounds such as 5-carboxyspermylglycine dioctaoleylamide ("DOGS") (Transfectam™, Promega , Madison, Wisconsin) and dipalmitoylphosphatidylethanolamine 5-carboxyspermylamide ("DPPES") (see, for example, US Pat. No. 5,171,678).

Another cationic lipid conjugate includes lipid-cholesterol derivatization ("DC-Chol"), which can be formulated into liposomes in combination with DOPE (see, Gao X. and Huang L., (1991) Biochim. Biophys. Res. Commun., 179:280). Lipopolylysin obtained by conjugation of polylysine with DOPE has been reported to be effective for transfection in the presence of serum (Zhou X. et al., (1991) Biochim. Biophys. Acta, 1065:8). For certain cell lines, these liposomes containing conjugated cationic lipids are said to exhibit lower toxicity and provide more efficient transfection than formulations containing DOTMA. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, California) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Maryland). Other cationic lipids suitable for delivery of oligonucleotides are described in WO 98/39359 and WO 96/37194.

Liposomal formulations are particularly suitable for topical administration, liposomes provide several advantages over other formulations. Such advantages include reduced side effects associated with high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer the RNAi agent to the skin. In some embodiments, liposomes are used to deliver the RNAi agent to epidermal cells, as well as to enhance the penetration of the RNAi agent into dermal tissues, such as the skin. For example, liposomes can be applied topically. Local delivery of drugs formulated as liposomes to the skin has been documented (see, for example, Weiner et al., (1992) Journal of Drug Targeting, vol. 2,405-410 and du Plessis et al., (1992) Antiviral Research , 18:259-265; Mannino R. J. and Fould-Fogerite S., (1998) Biotechniques, 6:682-690; Itani T. et al., (1987) Gene, 56:267-276; Nicolau C. et al. ., (1987) Meth. Enzymol., 149:157-176; Straubinger R. M. and Papahadjopoulos D., (1983) Meth. Enzymol., 101:512-527; Wang C. Y. and Huang L., (1987) Proc. Natl Acad. Sci. USA, 84:7851-7855).

Non-ionic liposomal systems have also been analyzed to determine their usefulness for drug delivery to the skin, in particular systems containing a non-ionic surfactant and cholesterol. Non-ionic liposomal formulations containing Novasome I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver the drug to the mouse skin dermis. Such RNAi agent formulations are useful in the treatment of a dermatological disorder.

Liposomes that contain mRNA can be made highly deformable. This deformability can allow liposomes to penetrate through a pore that is smaller than the average radius of the liposome. For example, transfersomes are a type of deformable liposomes. Transfersomes can be prepared by adding interface activators, typically surfactants, to a standard liposomal formulation. Transfersomes that contain an RNAi agent can be delivered, for example, subcutaneously via infection to deliver the RNAi agent to keratinocytes in the skin. To pass through intact mammalian skin, lipid vesicles must pass through a series of small pores, each less than 50 nm in diameter, under the influence of a suitable transdermal gradient. In addition, due to lipid properties, such transfersomes can be self-optimizing (adapted to the shape of the pores, for example, in the skin), self-healing and can repeatedly reach their targets without fragmentation and are often self-loading.

Other formulations suitable for the present invention are described in US Provisional Applications Serial Nos. 61/018616 filed January 2, 2008; 61/018611, registered on January 2, 2008; 61/039748, registered March 26, 2008; 61/047087 filed April 22, 2008 and 61/051528 filed May 8, 2008. Application No. PCT/US2007/080331, filed October 3, 2007, also describes formulations that are suitable for the present invention.

Transfersomes are yet another type of liposomes and are highly deformable lipid aggregates that are attractive candidates for drug delivery vehicles. Transfersomes can be described as lipid droplets that are so highly deformable that they can easily penetrate through pores that are smaller than a drop. Transfersomes are adaptable to the environment in which they are used, eg they are self-optimizing (adapted to the shape of pores in eg skin), self-healing and can repeatedly reach their targets without fragmentation and are often self-loading. To obtain a transfersome, it is necessary to add surface interface activators, typically surfactants, to a standard liposomal formulation. Transfersomes were used to deliver serum albumin to the skin. Transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

Surfactants find wide use in formulations such as emulsions (including microemulsions) and liposomes. The most common way to classify and rank the properties of many different types of surfactants, both natural and synthetic, is by using the hydrophilic/lipophilic balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means of categorizing various surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285) .

If the surfactant molecule is not ionized, it is classified as a non-ionic surfactant. Non-ionic surfactants find wide use in pharmaceutical and cosmetic products and are applicable over a wide pH range. Typically, their HLB values range from about 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Also included in this class are nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers. Polyoxyethylene based surfactants are the best known members of the class of non-ionic surfactants.

If a surfactant molecule carries a negative charge when dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, amino acid acylamides, sulfuric acid esters such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the class of anionic surfactants are alkyl sulfates and soaps.

If a surfactant molecule carries a positive charge when dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. Quaternary ammonium salts are the most used members of this class.

If the surfactant molecule has the ability to carry a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkyl amides, N-alkyl betaines, and phospholipids.

The use of surfactants in drug products, formulations and emulsions has been described (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

mRNA for use in the methods of the invention can also be provided as micellar formulations. "Micelles" are defined herein as a specific type of molecular aggregate in which amphipathic molecules are arranged in a spherical structure such that all of the hydrophobic portions of the molecules are directed inwards, leaving the hydrophilic portions in contact with the surrounding aqueous phase. If the environment is hydrophobic, there is a reverse arrangement.

Mixed micellar formulations suitable for transdermal membrane delivery can be prepared by mixing an aqueous solution of the siRNA formulation, a C ₈ -C ₂₂ alkali metal alkyl sulfate, and a micelle-forming compound. Exemplary micelle-forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleates, monolaurates, borage oil, evening primrose oil, menthol, trihydroxyoxocholanylglycine and their pharmaceutically acceptable salts, glycerol, polyglycerol, lysine, polylysine, triolein, polyoxyethylene ethers and analogues, polydocanol alkyl ethers and analogues, chenodeoxycholate, deoxycholate and mixtures thereof. The micelle-forming compounds can be added simultaneously or after the addition of the alkali metal alkyl sulfate. Mixed micelles are obtained by essentially any type of mixing of the ingredients, but with intensive mixing to ensure a smaller size of the micelles.

In one method, a first micellar composition is prepared that contains an siRNA composition and at least an alkali metal alkyl sulfate. The first micellar composition is then mixed with at least three micelle-forming compounds to form a mixed micellar composition. In another method, a micellar composition is prepared by mixing the siRNA composition, alkali metal alkyl sulfate, and at least one of the micelle-forming compounds, followed by the addition of the remaining micelle-forming compounds with vigorous stirring.

Phenol and/or meta -cresol can be added to the mixed micellar composition to stabilize the formulation and protect against bacterial growth. Alternatively, phenol and/or meta -cresol can be added together with the micelle-forming ingredients. It is also possible to add an isotonicizing agent, such as glycerol, after the formation of the mixed micellar composition.

To deliver the micellar formulation as a spray, the formulation can be placed in an aerosol dispenser and the dispenser filled with propellant. The propellant, which is under pressure, is contained in liquid form in a dispenser. The ratios of the ingredients are adjusted so that the aqueous phase and the propellant phase become one, i. there is one phase. If there are two phases, it is necessary to shake the dispenser before dispensing a part of the contents, for example through a dosing valve. The metered dose of the pharmaceutical agent is pushed through the metering valve in the form of a fine spray.

Propellants may include hydrogen-containing chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl ether, and diethyl ether. In certain embodiments, HFA 134a (1,1,1,2-tetrafluoroethane) can be used.

Specific concentrations of the main ingredients can be determined by relatively simple experimentation. For absorption through the oral cavity, it is often desirable to increase, for example, at least two or three times the dose for direct injection or administration through the gastrointestinal tract.

B. Nucleic acid-lipid particles

mRNA, for example, dsRNA according to the invention can be completely encapsulated in a lipid composition, for example, to obtain SPLP, pSPLP, SNALP or other nucleic acid-lipid particles. As used herein, the term "SNALP" refers to a stable nucleic acid-lipid particle, including SPLP. As used herein, the term "SPLP" refers to a nucleic acid-lipid particle containing plasmid DNA encapsulated in a lipid vesicle. SNALP and SPLP typically contain a cationic lipid, a non-cationic lipid, and a lipid that prevents particle aggregation (eg, a PEG-lipid conjugate). SNALP and SPLP are extremely suitable for system applications because they exhibit an increased lifetime in the bloodstream after intravenous (IV) injection and accumulate in distal sites (eg, sites physically separated from the injection site). SPLPs include "pSPLPs" which include an encapsulated condensing agent-nucleic acid complex as described in PCT Publication No. WO 00/03683. The particles of the present invention typically have an average diameter of from about 50 nm to about 150 nm, typically from about 60 nm to about 130 nm, typically from about 70 nm to about 110 nm, typically from about 70 nm to about 90 nm and are essentially non-toxic. In addition, nucleic acids, when contained in the nucleic acid-lipid particles of the present invention, are resistant to nuclease degradation in aqueous solution. Nucleic acid-lipid particles and a method for their preparation are described, for example, in US Pat.

In one embodiment, the ratio of lipid to drug (w/w ratio) (e.g., ratio of lipid to dsRNA) is in the range of about 1:1 to about 50:1, about 1:1 to about 25:1 , from about 3:1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1. It is contemplated that ranges intermediate to those listed above are also part of the invention.

The cationic lipid may be, for example, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(I-(2,3-dioleyloxy) propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3- dioleyloxypropylamine (DODMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP ), 1,2-dilinoleyloxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-dilinoleyloxy-3-morpholinopropane (DLin-MA), 1,2-dilinoleyl-3-dimethylaminopropane (DLinDAP), 1, 2-dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-linoleyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA. Cl), 1,2-dilinoleyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2-dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ) or 3-(N,N-dilinoleylamino )-1,2-pr opanediol (DLinAP), 3-(N,N-dioleylamino)-1,2-propanediol (DOAP), 1,2-dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogues thereof, (3aR,5s,6aS) -N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), ( 6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (MC3), 1,1'-(2-(4-(2-( (2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol (Tech G1) or a mixture thereof. The cationic lipid may contain from about 20 mole % to about 50 mole %, or about 40 mole %, of the total lipid contained in the particle.

In another embodiment, the compound 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane can be used to prepare lipid miRNA nanoparticles. The synthesis of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane is described in US Provisional Patent Application No. 61/107998, registered October 23, 2008, which is incorporated herein by reference.

In one embodiment, the siRNA lipid particle contains 40% 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane: 10% DSPC: 40% cholesterol: 10% PEG-C-DOMG (mole percent) with particle size 63.0±20 nm and miRNA/lipid ratio 0.027.

The ionizable/noncationic lipid may be an anionic lipid or a neutral lipid, including but not limited to distearoylphosphatidylcholine (DSPC), dioleylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleylphosphatidylethanolamine (DOPE) , palmitoyloleylphosphatidylcholine (POPC), palmitoyloleylphosphatidylethanolamine (POPE), dioleylphosphatidylethanolamine-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphatidylethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), 16-O- monomethyl-PE, 16-O-dimethyl-PE, 18-1-trans-PE, 1-stearoyl-2-oleyl-phosphatidiethanolamine (SOPE), cholesterol, or a mixture thereof. The non-cationic lipid may comprise from about 5 mole % to about 90 mole %, about 10 mole %, or about 58 mole %, if cholesterol is present, of the total lipid contained in the particle.

The conjugated lipid that inhibits particle aggregation can be, for example, a polyethylene glycol (PEG) lipid, including but not limited to PEG diacylglycerol (DAG), PEG dialkyloxypropyl (DAA), PEG phospholipid, PEG ceramide (Cer), or a mixture thereof. . The PEG-DAA conjugate may be, for example, PEG-dilauryloxypropyl (Ci ₂ ), PEG-dimyristyloxypropyl (Ci ₄ ), PEG-dipalmityloxypropyl (Ci ₆ ), or PEG-distearyloxypropyl (Ci ₉ ). The conjugated lipid that prevents aggregation of the particles can be from 0 mole % to about 20 mole % or about 2 mole % of the total lipid contained in the particle.

In some embodiments, the nucleic acid-lipid particle further comprises cholesterol, eg, from about 10 mole % to about 60 mole %, or about 48 mole %, of the total lipid contained in the particle.

In one embodiment, lipidoid ND98-4HC1 (MM 1487) (see US patent application No. 12/056230, registered March 26, 2008, incorporated herein by reference), cholesterol (Sigma-Aldrich) and PEG-ceramide can be used. C16 (Avanti Polar Lipids) to obtain lipid-dsRNA nanoparticles (i.e. LNP01 particles). Stock solutions of each in ethanol can be prepared as follows: ND98 133 mg/ml, cholesterol 25 mg/ml, PEG-ceramide C16 100 mg/ml. The stock solutions of ND98, cholesterol and PEG-ceramide C16 can then be combined, for example, in a molar ratio of 42:48:10. The combined lipid solution can be mixed with aqueous dsRNA (eg in sodium acetate pH 5) such that the final ethanol concentration is approximately 35-45% and the final sodium acetate concentration is approximately 100-300 mM. Lipid-dsRNA nanoparticles tend to form spontaneously upon agitation. Depending on the desired particle size distribution, the resulting mixture of nanoparticles can be extruded through a polycarbonate membrane (eg, 100 nm cutoff) using, for example, a thermal drum extruder such as a Lipex extruder (Northern Lipids, Inc.). In some cases, the extrusion step may be omitted. Removal of ethanol and simultaneous exchange of buffer can be followed, for example, by dialysis or tangential flow filtration. The buffer can be changed to e.g. phosphate buffered saline (PBS) at about pH 7, e.g. about pH 6.9, about pH 7.0, about pH 7.1, about pH 7.2, about pH 7.3 or approximately pH 7.4.

LNP01 formulations are described, for example, in International Application Publication No. WO 2008/042973, thus incorporated by reference.

Additional exemplary lipid-dsRNA formulations are described in the table below.

Ionizable/cationic lipid Cationic lipid/non-cationic lipid/cholesterol/PEG-lipid conjugate lipid:siRNA ratio SNALP-1 1,2-dilenoleyloxy-N,N-dimethylaminopropane (DLinDMA) DLinDMA/DPPC/cholesterol/PEG-cDMA
(57.1/7.1/34.4/1.4)
lipid:siRNA ~ 7:1 2-XTC 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (XTC) XTC/DPPC/cholesterol/PEG-cDMA 57.1/7.1/34.4/1.4
lipid:siRNA ~ 7:1 LNP05 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (XTC) XTC/DSPC/cholesterol/PEG-DMG
57.5/7.5/31.5/3.5
lipid:siRNA ~ 6:1 LNP06 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (XTC) XTC/DSPC/cholesterol/PEG-DMG
57.5/7.5/31.5/3.5
lipid:siRNA ~ 11:1 LNP07 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (XTC) XTC/DSPC/cholesterol/PEG-DMG
60/7.5/31/1.5,
lipid:siRNA ~ 6:1 LNP08 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (XTC) XTC/DSPC/cholesterol/PEG-DMG
60/7.5/31/1.5,
lipid:siRNA ~ 11:1 LNP09 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (XTC) XTC/DSPC/Cholesterol/PEG-DMG
50/10/38.5/1.5
lipid:siRNA 10:1 LNP10 (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5- amine (ALN100) ALN100/DSPC/cholesterol/PEG-DMG
50/10/38.5/1.5
lipid:siRNA 10:1 LNP11 (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (MC3) MC-3/DSPC/cholesterol/PEG-
DMG
50/10/38.5/1.5
lipid:siRNA 10:1 LNP12 1,1'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)-ethyl)(2-hydroxydodecyl)amino)-ethyl)piperazin-1-yl)ethylazanediyl)-didodecane -2-ol (Tech G1) Tech G1/DSPC/cholesterol/PEG-DMG
50/10/38.5/1.5
lipid:siRNA 10:1 LNP13 XTC XTC/DSPC/Chol/PEG-DMG 50/10/38.5/1.5
lipid:siRNA: 33:1 LNP14 MC3 MC3/DSPC/Chol/PEG-DMG
40/15/40/5
lipid:miRNA: 11:1 LNP15 MC3 MC3/DSPC/Chol/PEG-
DSG/GalNAc-PEG-DSG
50/10/35/4.5/0.5
lipid:miRNA: 11:1 LNP16 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/38.5/1.5
lipid:miRNA: 7:1 LNP17 MC3 MC3/DSPC/Chol/PEG-DSG 50/10/38.5/1.5
lipid:miRNA: 10:1 LNP18 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/38.5/1.5
lipid:miRNA: 12:1 LNP19 MC3 MC3/DSPC/Chol/PEG-DMG
50/10/35/5
lipid:miRNA: 8:1 LNP20 MC3 MC3/DSPC/Chol/PEG-DPG 50/10/38.5/1.5
lipid:miRNA: 10:1 LNP21 C12-200 C12-200/DSPC/Chol/PEG-DSG 50/10/38.5/1.5
lipid:miRNA: 7:1 LNP22 XTC XTC/DSPC/Chol/PEG-DSG 50/10/38.5/1.5
lipid:miRNA: 10:1 DSPC: distearoylphosphatidylcholine
DPPC: dipalmitoylphosphatidylcholine
PEG-DMG: PEG-didimyristoylglycerol (C14-PEG or PEG-C14) (PEG with an average molecular weight of 2000)
PEG-DSG: PEG-distyrylglycerol (C18-PEG or PEG-C18) (PEG with an average molecular weight of 2000)
PEG-cDMA: PEG-carbamoyl-1,2-dimyristyloxypropylamine (PEG 2000 average molecular weight)
SNALP (1,2-dilenoleyloxy-N,N-dimethylaminopropane (DLinDMA)) containing the formulations described in International Publication No. WO2009/127060, filed April 15, 2009, thus incorporated by reference.

XTC containing the formulations described in, for example, US provisional application serial no. filed June 10, 2009, US Provisional Application Serial No. 61/228373 filed July 24, 2009, US Provisional Application Serial No. 61/239686 filed September 3, 2009 and International Application No. PCT/US2010/022614 filed 29 January 2010, which are hereby incorporated by reference.

MC3 containing the formulations described in, for example, US Publication No. 2010/0324120, filed June 10, 2010, the entire contents of which are hereby incorporated by reference.

ALNY-100 containing the compositions described, for example, in international patent application number PCT/US09/63933, registered November 10, 2009, thus incorporated by reference.

C12-200 containing the formulations described in U.S. Provisional Application Serial No. 61/175770 filed May 5, 2009 and International Application No. PCT/US10/33777 filed May 5, 2010, which are hereby incorporated by reference.

Synthesis of ionizable/cationic lipids

Any of the compounds, eg, cationic lipids and the like, used in the nucleic acid-lipid particles of the invention can be prepared by known organic synthetic methods, including those described in more detail in the examples. All substituents are as defined below, unless otherwise indicated.

"Alkyl" means a straight chain or branched, non-cyclic or cyclic, saturated aliphatic hydrocarbon containing from 1 to 24 carbon atoms. Representative straight chain saturated alkyls include methyl, ethyl, n- propyl, n -butyl, n- pentyl, n- hexyl and the like, while saturated branched alkyls include isopropyl, sec -butyl, isobutyl, t -butyl, isopentyl, etc. Representative saturated cyclic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and the like, while unsaturated cyclic alkyls include cyclopentenyl and cyclohexenyl and the like.

"Alkenyl" means alkyl, as defined above, containing at least one double bond between adjacent carbon atoms. Alkenyls include cis and trans isomers. Representative straight chain and branched alkenyls include ethyleneyl, propylene, 1-butenyl, 2-butenyl, isobutylenyl, 1-pentenyl, 2-pentenyl, 3-methyl-1-butenyl, 2-methyl-2-butenyl, 2,3- dimethyl-2-butenyl; and the like.

"Alkynyl" means any alkyl or alkenyl, as defined above, which additionally contains at least one triple bond between adjacent carbon atoms. Representative straight chain and branched alkynyls include acetylenyl, propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, 2-pentynyl, 3-methyl-1-butynyl, and the like.

"Acyl" means any alkyl, alkenyl, or alkynyl wherein the carbon at the attachment point is replaced by an oxo group, as defined below. For example, -C(=O)alkyl, -C(=O)alkenyl, and -C(=O)alkynyl are acyl groups.

"Heterocycle" means a 5-7 membered monocyclic or 7-10 membered bicyclic, heterocyclic ring which is saturated, unsaturated or aromatic and which contains 1 to 2 heteroatoms independently selected from nitrogen, oxygen and sulfur, and where the heteroatoms nitrogen and sulfur may be optionally oxidized, and the nitrogen heteroatom may be optionally quaternized, including bicyclic rings in which any of the above heterocycles is fused to a benzene ring. The heterocycle may be attached through any heteroatom or carbon atom. Heterocycles include heteroaryls as defined below. The heterocycles include morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl, piperisinyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyridinyl, tetrahydroprimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, tetrahydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, and the like.

The terms "optionally substituted alkyl", "optionally substituted alkenyl", "optionally substituted alkynyl", "optionally substituted acyl" and "optionally substituted heterocycle" mean that upon substitution, at least one hydrogen atom is replaced by a substituent. In the case of the oxo substituent (=O), two hydrogen atoms are substituted. In this regard, substituents include oxo, halogen, heterocycle, -CN, -ORx, -NRxRy, -NRxC(=O)Ry, -NRxSO ₂ Ry, -C(=O)Rx, -C(=O)ORx, -C(=O)NRxRy, -SOnRx and -SONNRxRy, where n is 0, 1 or 2, Rx and Ry are the same or different and independently represent hydrogen, alkyl or heterocycle, and each of the specified alkyl and heterocyclic substituents can optionally be substituted with one or more of oxo, halogen, -OH, -CN, alkyl, -ORx, heterocycle, -NRxRy, -NRxC(=O)Ry, -NRxSO ₂ Ry, -C(=O)Rx, -C(= O)ORx, -C(=O)NRxRy, -SOnRx and -SOnNRxRy.

"Halogen" means fluorine, chlorine, bromine and iodine.

In some embodiments, the methods of the invention may require the use of protecting groups. The method of protecting groups is well known to those skilled in the art (see, for example, Protective Groups in Organic Synthesis, Green T.W. et al., Wiley-Interscience, New York City, 1999). Briefly, protecting groups in the context of the present invention are any group that reduces or eliminates the undesirable reactivity of a functional group. A protecting group can be added to a functional group to mask its reactivity during certain reactions and then removed to reveal the original functional group. In some embodiments, an "alcohol protecting group" is used. An "alcohol protecting group" is any group that reduces or eliminates the undesirable reactivity of an alcohol functional group. Protecting groups can be added and removed by methods well known in the art.

Synthesis of formula A

In some embodiments, the nucleic acid-lipid particles of the invention are formulated using a cationic lipid of Formula A:

where R1 and R2 are independently alkyl, alkenyl or alkynyl, each may be optionally substituted, and R3 and R4 are independently lower alkyl, or R3 and R4 may be taken together to form an optionally substituted heterocyclic ring. In some embodiments, the cationic lipid is XTC (2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane). Generally, the lipid of formula A above can be prepared by the following Reaction Schemes 1 or 2, where all substituents are as defined above, unless otherwise indicated.

Scheme 1

Lipid A, where R1 and R2 are independently alkyl, alkenyl, or alkynyl, each may be optionally substituted, and R3 and R4 are independently lower alkyl, or R3 and R4 may be taken together to form an optionally substituted heterocyclic ring, may be prepared in according to scheme 1. Ketone 1 and bromide 2 can be purchased or obtained by methods known to experts in this field. Reactions 1 and 2 give ketal 3. Treatment of ketal 3 with amine 4 gives lipids of formula A. Lipids of formula A can be converted to the corresponding ammonium salt with an organic salt of formula 5, where X is an anionic counterion selected from halogen, hydroxide, phosphate, sulfate, or etc.

Scheme 2

Alternatively, starting material ketone 1 can be prepared according to Scheme 2. Grignard 6 and cyanide 7 can be purchased or prepared by methods known to those skilled in the art. Reactions 6 and 7 yield ketone 1. The conversion of ketone 1 to the corresponding formula A lipids is as described in Scheme 1.

Synthesis MC3

Preparation of DLin-M-C3-DMA (i.e. (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate) was as follows indicated below. Solution of (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-ol (0.53 g), 4-N,N-dimethylaminobutyric acid hydrochloride (0.51 g), 4 -N,N-dimethylaminopyridine (0.61 g) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (0.53 g) in dichloromethane (5 ml) were stirred at room temperature overnight. The solution was washed with dilute hydrochloric acid followed by dilution with aqueous sodium bicarbonate. The organic fractions were dried over anhydrous magnesium sulfate, filtered and the solvent was removed in a rotary vacuum evaporator. The residue was passed through a silica gel (20 g) column using a 1-5% methanol/dichloromethane elution gradient. Fractions containing the purified product were combined and the solvent was removed to give a colorless oil (0.54 g).

Synthesis of ALNY-100

The synthesis of ketal 519 [ALNY-100] was performed using the following scheme

Synthesis 515

To a stirred suspension of LiAlH ₄ (3.74 g, 0.09852 mol) in 200 ml anhydrous THF in two-necked RBF (1 L) was slowly added a solution of 514 (10 g, 0.04926 mol) in 70 ml THF at 0ºC under nitrogen atmosphere . After the addition, the reaction mixture was warmed to room temperature and then heated to reflux for 4 hours. The progress of the reaction was monitored by TLC. After completion of the reaction (TLC), the mixture was cooled to 0° C. and quenched by carefully adding saturated Na ₂ SO ₄ solution. The reaction mixture was stirred for 4 hours at room temperature and filtered. The residue was washed well with THF. The filtrate and washed fractions were mixed and diluted with 400 ml of dioxane and 26 ml of concentrated HCl, and stirred for 20 minutes at room temperature. The volatiles were stirred in vacuo to give the hydrochloride salt 515 as a white solid. Yield: 7.12 g ¹ H-NMR (DMSO, 400 MHz): δ=9.34 (broad, 2H), 5.68 (s, 2H), 3.74 (m, 1H), 2.66 -2.60 (m, 2H), 2.50-2.45 (m, 5H).

Synthesis 516

To a stirred solution of compound 515 in 100 ml dry DCM in 250 ml double-necked RBF was added NEt ₃ (37.2 ml, 0.2669 mol) and cooled to 0° C. under nitrogen. After slow addition of N-(benzyloxy-carbonyloxy)-succinimide (20 g, 0.08007 mol) in 50 ml dry DCM, the reaction mixture was allowed to warm to room temperature. After completion of the reaction (2-3 hours TLC), the mixture was washed successively with 1N. HCl solution (1×100 ml) and saturated NaHCO ₃ solution (1×50 ml). The organic layer was then dried over Na ₂ SO ₄ anhydride and the solvent was evaporated to give a crude substance, which was purified by silica gel column chromatography to give 516 as a viscous mass. Yield: 11 g (89%). ¹ H-NMR (CDCl ₃ , 400 MHz): δ = 7.36-7.27 (m, 5H), 5.69 (s, 2H), 5.12 (s, 2H), 4.96 (broad , 1H) 2.74 (s, 3H), 2.60 (m, 2H), 2.30-2.25 (m, 2H). LC-MS [M+H] -232.3 (96.94%).

Synthesis of 517A and 517B

Cyclopentene 516 (5 g, 0.02164 mol) was dissolved in a solution of 220 ml of acetone and water (10:1) in single neck 500 ml of RBF, and N-methylmorpholine-N-oxide (7.6 g, 0.06492 mol) was added to it. ) followed by the addition of 4.2 ml of a 7.6% solution of OsO ₄ (0.275 g, 0.00108 mol) in tert -butanol at room temperature. After completion of the reaction (~3 hours), the mixture was quenched by adding solid Na ₂ SO ₃ and the resulting mixture was stirred for 1.5 hours at room temperature. The reaction mixture was diluted with DCM (300 ml) and washed with water (2×100 ml) followed by saturated NaHCO ₃ solution (1×50 ml), water (1×30 ml) and finally with brine (1×50 ml) . The organic phase was dried over Na ₂ SO ₄ anhydride and the solvent was removed in vacuo. Purification of the crude material by silica gel column chromatography gave a mixture of diastereomers, which was separated by preparative HPLC. Yield: - 6 g crude 517A - peak-1 (white solid), 5.13 g (96%). ¹ H-NMR (DMSO, 400 MHz): δ=7.39-7.31 (m, 5H), 5.04 (s, 2H), 4.78-4.73 (m, 1H), 4, 48-4.47 (d, 2H), 3.94-3.93 (m, 2H), 2.71 (s, 3H), 1.72-1.67 (m, 4H). LC-MS - [M+H]-266.3, [M+NH4+]-283.5 present, HPLC-97.86%. Stereochemistry confirmed by X-ray.

Synthesis 518

In a manner analogous to that described for the synthesis of compound 505, compound 518 (1.2 g, 41%) was obtained as a colorless oil. ¹ H-NMR (CDCl ₃ , 400 MHz): δ= 7.35-7.33 (m, 4H), 7.30-7.27 (m, 1H), 5.37-5.27 (m, 8H), 5.12 (s, 2H), 4.75 (m, 1H), 4.58-4.57 (m, 2H), 2.78-2.74 (m, 7H), 2.06 -2.00(m, 8H), 1.96-1.91(m, 2H), 1.62(m, 4H), 1.48(m, 2H), 1.37-1.25(wide m, 36H), 0.87 (m, 6H). HPLC-98.65%.

General method for the synthesis of compound 519

A solution of compound 518 (1 eq.) in hexane (15 ml) was added dropwise to an ice-cold solution of LAH in THF (1M, 2 eq.). After the addition, the mixture was heated at 40° C. for 0.5 hours, then cooled again in a water bath. The mixture was thoroughly hydrolysed with saturated aqueous Na ₂ SO ₄ , then filtered through celite and reconstituted to an oil. Column chromatography gave pure 519 (1.3 g, 68%) which was obtained as a colorless oil. ¹³ C-NMR δ = 130.2, 130.1 (x2), 127.9 (x3), 112.3, 79.3, 64.4, 44.7, 38.3, 35.4, 31, 5, 29.9 (x2), 29.7, 29.6 (x2), 29.5 (x3), 29.3 (x2), 27.2 (x3), 25.6, 24.5, 23 .3, 226, 14.1; Electrospray MS (+ve): The molecular weight of C ₄₄ H ₈₀ NO ₂ (M+H)+ calculated as 654.6 was found to be 654.6.

Compositions obtained by standard or non-extrusion processes can be characterized in a similar way. For example, compositions were typically characterized by visual observation. They should be whitish, clear solutions containing no aggregates or sediment. The particle size and particle size distribution of lipid nanoparticles can be measured by light scattering using, for example, Malvern Zetasizer Nano ZS (Malvern, USA). The particle size should be approximately 20-300 nm, such as 40-100 nm. The particle size distribution must be uniform. The concentration of total dsRNA in the formulation as well as the captured fraction was assessed by dye exclusion assay. The formulated dsRNA sample can be incubated with an RNA-binding dye such as Ribogreen (Molecular Probes) in the presence or absence of a surfactant degrading formulation such as 0.5% Triton-X100. The total dsRNA in the composition can be determined from the signal from the sample containing the surfactant against a standard curve. The captured fraction is determined by subtracting the "free" dsRNA content (as measured by the signal in the absence of surfactant) from the total dsRNA content. The percentage of captured dsRNA is typically >85%. For the SNALP formulation, the particle size is at least 30 nm, at least 40 nm, at least 50 nm, at least 60 nm, at least 70 nm, at least 80 nm, at least 90 nm, at least at least 100 nm, at least 110 nm and at least 120 nm. A suitable range is generally at least about 50 nm to about 110 nm, from at least about 60 nm to about 100 nm, or from at least about 80 nm to about 90 nm.

Compositions and formulations for oral administration include powders or granules, microparticles, nanoparticles, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or mini-tablets. Thickening agents, flavoring agents, diluents, emulsifiers, dispersing agents or binding agents may be desirable. In some embodiments, oral formulations are those in which the dsRNA of the invention is administered in combination with one or more surfactant absorption enhancers and chelators. Suitable surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Suitable bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydrofusidate and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl-1-monocaprate , 1-dodecylasecycloheptan-2-one, acylcarnitine, acylcholine or monoglyceride, diglyceride or a pharmaceutically acceptable salt (eg sodium) thereof. In some embodiments, absorption enhancer combinations are used, such as fatty acids/salts in combination with bile acids/salts. One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA. Additional absorption enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-ethyl ether. The dsRNAs of the invention can be delivered orally, in granular form, including sprayable dry particles, or as complexes to form micro- or nanoparticles. dsRNA complexing agents include polyamino acids, polyimines, polyacrylates, polyalkyl acrylates, polyoxethanes, polyalkyl cyanoacrylates, cationic gelatins, albumins, starches, acrylates, polyethylene glycols (PEG) and starches, polyalkyl cyanoacrylates, DEAE-derivatized polyimines, pollulans, celluloses, and starches . Suitable complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE), polyaminostyrene (e.g., p-amino-), poly(methylcyanoacrylate), poly(ethylcyanoacrylate) , poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcyanoacrylate), DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethyl acrylate, polyhexyl acrylate, poly(D,L-lactic acid), poly(DL-lactic-glycolic acid) copolymer (PLGA), alginate and polyethylene glycol (PEG). Oral dsRNA formulations and their preparation are detailed in US Pat. No. 6,887,906, US Publication No. 20030027780 and US Pat.

Compositions and formulations for parenteral, intraparenchymal (to the brain), intrathecal, intraventricular or intrahepatic administration may contain sterile aqueous solutions, which may also contain buffers, diluents and other suitable additives such as, but not limited to, absorption enhancers, compounds carriers and other pharmaceutically acceptable carriers or excipients.

Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and formulations containing liposomes. Such compositions can be prepared from various components, which include, but are not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semi-solids. Particularly preferred are formulations that target the liver in the treatment of liver diseases such as hepatic carcinoma.

The pharmaceutical compositions of the present invention, which can be conveniently provided in unit dosage form, can be prepared by conventional methods well known in the pharmaceutical industry. Such methods include the step of bringing into interaction the active ingredients with the pharmaceutical carrier(s) or excipient(s). Typically, formulations are prepared by uniformly and uniformly bringing the active ingredients into contact with liquid carriers or finely divided solid carriers, or both, and then shaping the product as necessary.

The compositions of the present invention can be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may additionally contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

C. Additional formulations

i. emulsions

The compositions of the present invention can be prepared and formulated as emulsions. Emulsions are typically heterogeneous systems of one liquid dispersed in another in the form of droplets typically larger than 0.1 µm in diameter (see, e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; ^Idson , in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc. , New York, NY, volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 2, p. 335; Higuchi et al ., in Remington's Pharmaceutical Sciences, Mack Publishing Co. , Easton, Pa., 1985, p. 301). Emulsions are often two-phase systems containing two immiscible liquid phases thoroughly mixed and dispersed in each other. Typically, emulsions may be of the water-in-oil (W/O) or oil-in-water (O/W) type. When the aqueous phase is thoroughly crushed and dispersed as fine droplets throughout the volume of the oil phase, the resulting composition is referred to as a water-in-oil (w/o) emulsion. Alternatively, when the oil phase is thoroughly crushed and dispersed as fine droplets in the bulk of the aqueous phase, the resulting composition is referred to as an oil-in-water (o/w) emulsion. Emulsions may contain additional components in addition to the dispersible phases and the active drug, which may be present as a solution in an aqueous phase, an oil phase, or by itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, colorants and antioxidants may also be included in the emulsions as needed. Pharmaceutical emulsions can also be multiple emulsions that consist of more than two phases, such as, for example, in the case of oil-in-water-in-oil (o/w/m) and water-in-oil-in-oil emulsions. water (w / m / w). Such complex formulations often provide certain advantages that simple double emulsions do not provide. Multiple emulsions in which the individual oil droplets of the o/w emulsion contain small drops of water are o/w emulsions. Similarly, the system of oil droplets enclosed in water globules stabilized in the oil continuous phase is an o/w/o emulsion.

Emulsions are characterized by little or no thermodynamic stability. Often the dispersible or discontinuous phase of the emulsion is well dispersed in the external or continuous phase and maintained in this form by means of emulsifiers or the viscosity of the composition. Any of the emulsion phases may be semi-solid or solid, as is the case for emulsion-type bases for ointments and creams. Other means of stabilizing emulsions include the use of emulsifiers, which can be added to any phase of the emulsion. Emulsifiers can be broadly classified into four categories: synthetic surfactants, natural emulsifiers, absorbent bases, and finely divided solids (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; ^Idson , in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY , volume 1, p.199).

Synthetic surfactants, also known as surfactants, have found wide application in the preparation of emulsions and are described in the literature (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ^ed .), New York, NY; Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York , NY, volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, NY, 1988, volume 1, p.199). Surfactants are generally amphiphilic and contain a hydrophilic and a hydrophobic part. The ratio of the hydrophilic to hydrophobic component of a surfactant is referred to as the hydrophilic/lipophilic balance (HLB) and is an important tool for categorizing and selecting surfactants for formulations. Surfactants can be classified into different classes depending on the nature of the hydrophilic group: non-ionic, anionic, cationic and amphoteric (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC ., 2004, Lippincott Williams & Wilkins (8th ^ed .), New York, NY Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 285).

Natural emulsifiers used in emulsion formulations include lanolin, beeswax, phospholipids, lecithin, and gum arabic. Absorbent bases such as anhydrous lanolin and hydrophilic petrolatum have hydrophilic properties so that they can absorb water to form w/o emulsions while retaining their semi-solid consistency. Finely divided solids have also been used as good emulsifiers, particularly in combination with surfactants and in viscous formulations. These include polar inorganic solids such as heavy metal hydroxides, non-swelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminosilicate, pigments, and non-polar solids such as carbon or glyceryl tristearate.

A number of non-emulsifying substances may also be present in emulsion formulations and contribute to the properties of the emulsions. They include fats, oils, waxes, fatty acids, fatty alcohols, fatty acid esters, humectants, hydrophilic colloids, preservatives, and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

Hydrophilic colloids or hydrocolloids include natural gums and synthetic polymers such as polysaccharides (for example, gum arabic, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethyl cellulose and carboxypropyl cellulose), and synthetic polymers (for example, carbomers, cellulose ethers and carboxyvinyl polymers). They disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong intersurface films around the dispersed droplet phase and increasing the viscosity of the outer phase.

Because emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols, and phospholipids that can easily support microbial growth, preservatives are often included in these formulations. Commonly used preservatives incorporated into emulsion formulations include methylparaben, propylparaben, quaternary ammonium salts, benzalkonium chloride, p -hydroxybenzoic acid esters, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. The antioxidants used can be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulphite, and antioxidant synergists such as citric acid, tartaric acid and lecithin.

The use of emulsion formulations via the dermal, oral and parenteral routes and methods for their preparation are described in the literature (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams. & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p.199) . Emulsion formulations for oral delivery have been widely used due to their ease of preparation, as well as efficiency in terms of absorption and bioavailability (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ^ed .), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1 , p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199). Mineral oil laxatives, oil-soluble vitamins, and high-fat nutritional preparations are among the substances commonly administered orally as O/V emulsions.

ii. Microemulsions

In one embodiment of the present invention, mRNA and nucleic acid compositions are formulated as microemulsions. A microemulsion can be defined as a system of water, oil, and an amphiphile that is one optically isotropic and thermodynamically stable liquid solution (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC ., 2004, Lippincott Williams & Wilkins (8th ^ed .), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245). Typically, microemulsions are systems that are prepared by first dispersing an oil in an aqueous solution of a surfactant and then adding a sufficient amount of a fourth component, mainly an intermediate chain length alcohol, to form a clear system. Thus, microemulsions are also described as thermodynamically stable, isotropically transparent dispersions of two immiscible liquids that are stabilized by intersurface films of surface active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed. , 1989, VCH Publishers, New York, pages 185-215). Microemulsions are conventionally prepared with a combination of three to five components which include oil, water, surfactant, co-surfactant and electrolyte. Regardless of the type of water-in-oil (w/o) or oil-in-water (o/w), the microemulsion depends on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules. substances (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).

Extensive study of the phenomenological approach using phase diagrams has led to a deep knowledge of the person skilled in the art, how to formulate microemulsions (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004 , Lippincott Williams & Wilkins (8th ^ed .), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 335). Compared to conventional emulsions, microemulsions provide the advantage of solubilizing water-insoluble drugs into thermodynamically stable droplets that form spontaneously.

Surfactants used to form microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310) , hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750) alone or in combination with auxiliary surfactants. The co-surfactant, typically a short chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase interfacial fluidity by penetrating the surfactant film and thus creating a disordered film due to the free space formed between surfactant molecules. However, microemulsions can be prepared without the use of co-surfactants, and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase can typically be, but is not limited to, water, aqueous drug solution, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and ethylene glycol derivatives. The oil phase may contain, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono-, di- and trilicerides, polyoxyethylated esters of glycerol and fatty acids, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.

Microemulsions are of particular interest in terms of drug solubilization and enhanced drug absorption. To increase the oral bioavailability of drugs, including peptides, microemulsions based on lipids (o/w and/m) have been proposed (see, for example, US patents Nos. Ritschel, Meth Find Exp Clin Pharmacol 1993 13 205). Microemulsions provide the benefits of improved drug solubilization, protection of the drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced changes in membrane fluidity and permeability, ease of preparation, ease of oral administration compared to solid dosage forms, improved clinical activity, and reduced toxicity (see, e.g., US Pat. -143). Often, microemulsions can form spontaneously when their components are brought into contact at ambient temperature. They can be particularly effective in formulating thermolabile drugs, peptides, or mRNAs. Microemulsions are also effective for transdermal delivery of active ingredients in both cosmetic and pharmaceutical applications. The microemulsion compositions and formulations of the present invention are expected to promote increased systemic absorption of mRNA and nucleic acids from the gastrointestinal tract as well as improve local cellular uptake of mRNA and nucleic acids.

The microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), labrasol and absorption enhancers to improve formulation properties and enhance absorption of the mRNA and nucleic acids of the present invention. The absorption enhancers used in the microemulsions of the present invention can be classified into one of five broad categories: surfactants, fatty acids, bile salts, chelating agents, and non-chelating surfactants (Lee et al. ., critical review in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above.

iii. microparticles

The RNAi agent of the invention can be incorporated into a particle, eg a microparticle. Microparticles can be obtained by spray drying, and can also be obtained by other methods, including lyophilization, evaporation, drying in a fluidized bed, vacuum drying, or a combination of these methods.

iv. Penetration enhancers

In one embodiment, the present invention uses various penetration enhancers to ensure efficient delivery of nucleic acids, in particular mRNAs, to the skin of animals. Most drugs are found in solution in ionized and non-ionized forms. However, as a rule, only lipid-soluble or lipophilic drugs readily pass through cell membranes. It has been discovered that even non-lipophilic drugs can pass through cell membranes if the membrane to be passed is treated with a permeation enhancer. In addition to facilitating the diffusion of non-lipophilic drugs across cell membranes, permeation enhancers also increase the permeability of lipophilic drugs.

Penetration enhancers can be classified as belonging to one of five major categories, ie. surfactants, fatty acids, bile salts, chelating agents and non-chelating surfactants (see, e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al ., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Each of the above classes of penetration enhancers is described in more detail below.

Surfactants (or "surfactants") are chemical compounds that, when dissolved in an aqueous solution, reduce the surface tension of the solution, or the interfacial tension between the aqueous solution and another liquid, resulting in increased mucosal absorption of the mRNA . In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (see, for example, Malmsten M., Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., critical review in Therapeutic Drug Carrier Systems, 1991, p. 92) and perfluorochemical emulsions such as FC-43 (Takahashi et al., J. Pharm. Pharmacol ., 1988, 40, 252).

Various fatty acids and their derivatives that act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate , monoolein (1-monooleyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol-1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C _1-20 alkyl esters (for example, methyl, isopropyl and t -butyl) and their mono- and diglycerides (i.e. oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (see e.g. Touitou E. et al., Enhancement in Drug Delivery, CRC Press, Danvers, MA, 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92; Muranishi Critical Review in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; E1 Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).

The physiological role of bile includes facilitating the dispersion and absorption of lipids and fat-soluble vitamins (see, e.g., Malmsten M., Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Brunton, Chapter 38 in Goodman &Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. ^934-935 ). Various natural bile salts and their synthetic derivatives act as penetration enhancers. Thus, the term "bile salts" includes any natural components of bile, as well as any synthetic derivatives thereof. Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydrofusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene -9-Lauryl Ether (POE) (see e.g. Malmsten M., Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., critical review in Therapeutic Drug Carrier Systems, 1991 , page 92; ^Swinyard , Chapter 39 in Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi critical review in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).

Chelating agents, as used in the context of the present invention, can be defined as compounds that remove metal ions from solution by forming complexes with them, resulting in increased mucosal absorption of mRNA. With respect to their use as penetration enhancers in the present invention, chelating agents have the additional advantage that they serve as DNase inhibitors, ie. most of the characterized DNA nucleases require a divalent metal ion for catalysis and thus can be inhibited by chelating agents (Jarrett J., Chromatogr., 1993, 618, 315-339). Suitable chelating agents include, but are not limited to, disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate, and homovanylate), N-acyl derivatives of collagen, laureth-9, and N-aminoacyl derivatives of beta-diketones. (enamines) (see, for example, Katdare A. et al., Excipient development for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers, MA, 2006; Lee et al., critical review in Therapeutic Drug Carrier Systems, 1991 , page 92; Muranishi, critical review in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).

As used herein, penetration enhancing compounds that are neither chelators nor surfactants can be defined as compounds that exhibit little activity as chelators or as surfactants, but which nonetheless however, increase the absorption of mRNA through the mucosa of the digestive tract (see, for example, Muranishi, critical review in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers includes, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacycloalkanone derivatives (Lee et al., critical review in Therapeutic Drug Carrier Systems, 1991, page 92) and non-steroidal anti-inflammatory drugs such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).

Agents that enhance mRNA uptake at the cellular level can also be referred to as pharmaceutical and other compositions of the present invention. For example, cationic lipids such as lipofectin (Junichi et al., US Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules such as polylysine (Lollo et al., PCT application WO 97/30731) are also known to enhance cellular uptake dsRNA. Examples of commercially available transfection reagents, among others, include, for example, Lipofectamine™ (Invitrogen; Carlsbad, CA), Lipofectamine 2000™ (Invitrogen; Carlsbad, CA), 293fectin™ (Invitrogen; Carlsbad, CA), Cellfectin™ (Invitrogen; Carlsbad , CA), DMRIE-C™ (Invitrogen; Carlsbad, CA), FreeStyle™ MAX (Invitrogen; Carlsbad, CA), Lipofectamine™ 2000 CD (Invitrogen; Carlsbad, CA), Lipofectamine™ (Invitrogen; Carlsbad, CA), RNAiMAX (Invitrogen; Carlsbad, CA), Oligofectamine™ (Invitrogen; Carlsbad, CA), Optifect™ (Invitrogen; Carlsbad, CA), X-tremeGENE Q2 transfection reagent (Roche; Grenzacherstrasse, Switzerland), DOTAP liposomal transfection reagent (Grenzacherstrasse , Switzerland), DOSPER liposomal transfection reagent (Grenzacherstrasse, Switzerland) or Fugene (Grenzacherstrasse, Switzerland), Transfectam® reagent (Promega; Madison, WI), TransFast™ transfection reagent (Promega; Madison, WI), Tfx™- reagent 20 (Promega; Madison, WI), Tfx™-50 reagent (Promega; Madison, WI), DreamFect™ (OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences; Marseille, France), TransPass ^a D1 transfection reagent (New England Biolabs; Ipswich, MA, USA), LyoVec™/LipoGen™ ( Invitrogen; San Diego, CA, USA), PerFectin transfection reagent (Genlantis; San Diego, CA, USA), NeuroPORTER transfection reagent (Genlantis; San Diego, CA, USA), GenePORTER transfection reagent (Genlantis; San Diego, CA, USA), GenePORTER 2 transfection reagent (Genlantis; San Diego, CA, USA), Cytofectin transfection reagent (Genlantis; San Diego, CA, USA), BaculoPORTER transfection reagent (Genlantis; San Diego, CA, USA) , TroganPORTER™ transfection reagent (Genlantis; San Diego, CA, USA), RiboFect (Bioline; Taunton, MA, USA), PlasFect (Bioline; Taunton, MA, USA), UniFECTOR (B-Bridge International; Mountain View, CA , USA), SureFECTOR (B-Bridge International; Mountain View, CA, USA), or HiFect™ (B-Bridge International, Mountain View, CA, USA).

Other agents may be used to enhance the penetration of the nucleic acids to be introduced, including glycols such as ethylene glycol and propylene glycol, pyrroles such as 2-pyrrole, azones and terpenes such as limonene and menthone.

v. carriers

Certain compositions of the present invention also contain carrier compounds. As used herein, a "carrier compound" or "carrier" may refer to a nucleic acid or analogue thereof that is inert (i.e., has no biological activity per se) but is recognized as a nucleic acid by in vivo processes. which reduce the bioavailability of a nucleic acid having biological activity, for example, by degrading the biologically active nucleic acid or accelerating its removal from the bloodstream. Co-administration of a nucleic acid and a carrier compound, usually in excess of the latter substance, can result in a significant reduction in the amount of nucleic acid found in the liver, kidneys, or other reservoirs outside the circulation, presumably due to competition between the carrier compound and the nucleic acid for a common receptor . For example, the yield of partially thiophosphate dsRNA in liver tissue can be reduced when it is co-administered with polyinosinic acid, dextran sulfate, polycytidinic acid, or 4-acetamido-4'-isothiocyananostylbene-2,2-disulfonic acid (Miyao et al., DsRNA Res Dev., 1995, 5, 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183).

vi. Excipients

In contrast to a carrier compound, a "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable diluent, suspending agent, or any other pharmacologically inert vehicle for delivery of one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected based on the intended route of administration so as to provide the desired volume, consistency, etc. when combined with nucleic acid and other components of this pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binders (e.g., pregelatinized corn starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.), bulking agents (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.), lubricants (e.g. magnesium stearate, talc, silicon dioxide, colloidal silicon dioxide, stearic acid, metal stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc. .d.), disintegrants (eg starch, sodium starch glycolate, etc.) and wetting agents (eg sodium lauryl sulfate, etc.).

Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration that do not adversely interact with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, saline solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, and the like.

Formulations for topical administration of nucleic acids may contain sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of nucleic acids in liquid or solid oil bases. Solutions may also contain buffers, diluents, and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not interact adversely with nucleic acids may be used.

Suitable pharmaceutically acceptable excipients include, but are not limited to, water, saline solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, and the like.

vii. Other components

The compositions of the present invention may additionally contain other auxiliary components commonly used in pharmaceutical compositions at their application levels established in this field. Thus, for example, the compositions may contain additional compatible pharmaceutically active substances, such as, for example, antipruritic agents, astringents, local anesthetics or anti-inflammatory agents, or may contain additional substances, such as colorants, flavors, preservatives, antioxidants, opacifiers. agents, thickeners and stabilizers useful in the physical formulation of various dosage forms of the compositions of the present invention. However, such substances, when added, should not adversely affect the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with adjuvants such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, osmotic salts, buffers, colorants, flavors and/or fragrances, and the like. that do not interact adversely with the nucleic acid(s) of the formulation.

Aqueous suspensions may contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

In some embodiments, the pharmaceutical compositions of the invention comprise (a) one or more mRNA compounds and (b) one or more agents that function by a mechanism other than RNAi and that are useful in the treatment of a lipid metabolic disorder. Examples of such agents include, but are not limited to, an anti-inflammatory agent, an anti-obesity agent, an antiviral agent, and/or an antifibrotic agent. In addition, other substances commonly used for liver protection, such as silymarin, can also be used in combination with mRNA as described herein. Other agents useful in the treatment of liver disorders include telbivudine, entecavir, and protease inhibitors such as telaprevir and others, as described in, for example, Tung et al. et al., US Publication No. 2004/0127488.

The toxicity and therapeutic efficacy of each compound can be determined by standard pharmaceutical methods in cell cultures or experimental animals, for example, to determine LD ₅₀ (lethal dose in 50% of the population) and ED ₅₀ (therapeutically effective dose in 50% of the population). The ratio of doses of toxic effects to therapeutic effects is a therapeutic index, and it can be expressed as the ratio LD ₅₀ /ED ₅₀ . Compounds that have high therapeutic indices are preferred.

Data obtained from cell culture assays and animal studies can be used to determine the dosage range for use in humans. Dosing of the compositions of the invention described herein is generally in the range of circulating concentrations that include the ED ₅₀ , with little or no toxicity. Dosage may vary within this range depending on the dosage form used and the route of administration used. For any compound used in the methods of the invention, a therapeutically effective dose may initially be determined based on cell culture assays. The dose can be adjusted in animal models by obtaining a range of circulating plasma concentrations of the compound or target sequence polypeptide product if desired (e.g., obtaining reduced concentrations of the polypeptide) that includes an IC ₅₀ (i.e., the concentration of test compound at which half-maximal inhibition is obtained symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses for humans. Plasma levels can be measured, for example, by high performance liquid chromatography.

In addition to their administration as indicated above, the mRNA of the invention may be administered in combination with other known agents effective in the treatment of pathological processes mediated by ANGPTL3 expression. In any case, the physician may adjust the amount and timing of mRNA administration based on results observed using standard efficacy values known in the art or described herein.

VI. Methods of the invention

The present invention also relates to methods of using an mRNA of the invention and/or a composition containing an mRNA of the invention to reduce and/or inhibit the expression of ANGPTL3 in a cell. The methods include bringing the cell into contact with the dsRNA of the invention and maintaining the cell for a period of time sufficient to obtain degradation of the ANGPTL3 gene mRNA transcript, thereby inhibiting the expression of the ANGPTL3 gene in the cell. The reduction in gene expression can be assessed by any methods known in the art. For example, a decrease in ANGPTL3 expression can be determined by determining the level of expression of ANGPTL3 mRNA by methods known to a person skilled in the art, for example, Northern blotting, quantitative real-time PCR, determining the level of ANGPTL3 protein by methods known to a person skilled in the art, such as Western -blotting, immunological methods. The decrease in ANGPTL3 expression can also be assessed indirectly by measuring the decrease in the biological activity of ANGPTL3, for example, the decrease in serum lipids, triglycerides, cholesterol and/or free fatty acids.

In the methods of the invention, the cell may be brought into contact in vitro or in vivo , i.e. the cell may be in the individual.

A cell suitable for treatment with the methods of the invention may be any cell that expresses the ANGPTL3 gene. A cell suitable for use in the methods of the invention may be a mammalian cell, e.g., a primate cell (such as a human cell or a non-human primate cell, e.g. pig cage, camel cage, llama cage, horse cage, goat cage, rabbit cage, sheep cage, hamster cage, guinea pig cage, cat cage, dog cage, rat cage, mouse cage, lion cage, tiger cage, bear cage, or buffalo cage ), a bird's cage (for example, a duck's cage or a goose's cage), or a whale's cage. In one embodiment, the cell is a human cell, such as a human liver cell.

Expression of ANGPTL3 in a cell is inhibited by at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or approximately 100%.

The in vivo methods of the invention may include administering to an individual a composition comprising an mRNA, wherein the mRNA comprises a nucleotide sequence that is complementary to at least a portion of the RNA transcript of the mammalian ANGPTL3 gene to be treated. When the organism to be treated is a mammal, such as a human, the composition can be administered by any method known in the art, including, but not limited to, oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal) , intravenous, intramuscular, subcutaneous, transdermal, through the respiratory tract (aerosol), nasal, rectal and local (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by intravenous infusion or injection. In certain embodiments, the compositions are administered by subcutaneous injection.

In some embodiments, the implementation of the introduction is carried out by injection with delayed absorption. Sustained absorption injection can release mRNA in a consistent manner over a long period of time. Thus, depot injection may reduce the frequency of dosing required to obtain the desired effect, such as the desired inhibition of ANGPTL3, or a therapeutic or prophylactic effect. Sustained absorption injection may also provide more uniform serum concentrations. Sustained absorption injections may include subcutaneous injections or intramuscular injections. In preferred embodiments, the depot injection is a subcutaneous injection.

In some embodiments, the implementation of the introduction is carried out by means of a pump. The pump may be an external pump or a surgically implanted pump. In certain embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. The infusion pump can be used for intravenous, subcutaneous, arterial, or epidural infusions. In preferred embodiments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers the mRNA to the liver.

The route of administration can be selected depending on whether local or systemic treatment is desired and depending on the area to be treated. The method and site of administration can be selected to enhance targeted delivery.

In one aspect, the present invention also provides methods for inhibiting expression of the ANGPTL3 gene in a mammal. The methods include administering to a mammal a composition containing a dsRNA that is directed to the ANGPTL3 gene in a mammalian cell and maintaining the mammal for a period of time sufficient to obtain degradation of the ANGPTL3 gene mRNA transcript, thereby inhibiting expression of the ANGPTL3 gene in the cell. The reduction in gene expression can be assessed by any methods known in this field, and methods, for example, quantitative real-time PCR, described in the present description. The decrease in protein production can be assessed by any methods known in this field, and methods, for example, ELISA, described in the present description. In one embodiment, the liver punch biopsy sample serves as tissue material to observe a decrease in ANGPTL3 gene and/or protein expression.

The present invention further relates to methods of treating an individual in need thereof. The methods of treatment of the invention comprise administering an mRNA of the invention to an individual, e.g., an individual who would benefit from the reduction and/or inhibition of ANGPTL3 expression, in a therapeutically effective amount of an mRNA directed to the ANGPTL3 gene or a pharmaceutical composition comprising an mRNA directed to the ANGPTL3 gene .

The mRNA of the invention can be administered as "free mRNA". Free mRNA is administered in the absence of a pharmaceutical composition. Naked mRNA may be in a suitable buffer solution. The buffer solution may contain acetate, citrate, prolamine, carbonate or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing mRNA can be adjusted so that it is suitable for administration to the individual.

Alternatively, the mRNA of the invention may be administered as a pharmaceutical composition, such as a dsRNA liposomal formulation.

Individuals that will benefit from the reduction and/or inhibition of ANGPTL3 gene expression are individuals with a lipid metabolism disorder, for example, an inherited lipid metabolism disorder or an acquired lipid metabolism disorder. In one embodiment, the implementation of the individual with impaired lipid metabolism suffers from hyperlipidemia. In another embodiment, an individual with impaired lipid metabolism suffers from hypertriglyceridemia. Treatment for an individual who would benefit from the reduction and/or inhibition of ANGPTL3 gene expression includes therapeutic treatment (eg, the individual has eruptive xanthomas) and prophylactic treatment (eg, the individual does not have eruptive xanthomas or the individual may be at risk of developing eruptive xanthomas).

The invention further relates to methods of using an mRNA or a pharmaceutical composition thereof, for example, for the treatment of an individual who will benefit from the reduction and/or inhibition of ANGPTL3 expression, for example, an individual with impaired lipid metabolism, in combination with other pharmaceuticals and/or other therapeutic agents. methods, for example, with known pharmaceutical agents and/or known therapeutic methods, such as, for example, methods that are currently used to treat these disorders. For example, in certain embodiments, an mRNA directed to ANGPTL3 is administered in combination with, for example, an agent useful in the treatment of a lipid metabolic disorder, as described elsewhere herein. For example, additional agents suitable for treating an individual who would benefit from a reduction in ANGPTL3 expression, eg, an individual with impaired lipid metabolism, may include agents that lower one or more serum lipids. Non-limiting examples of such agents may include inhibitors of cholesterol synthesis, such as HMG-CoA reductase inhibitors, such as statins. Statins may include atorvastatin (Lipitor), fluvastatin (Lescol), lovastatin (Mevacor), extended release lovastatin (Altoprev), pitavastatin (Livalo), pravastatin (Pravachol), rosuvastatin (Crestor), and simvastatin (Zocor). Other agents useful in the treatment of lipid metabolism disorders may include bile acid sequestrants such as cholestyramine and other resins, inhibitors of VLDL secretion such as niacin, lipophilic antioxidants such as probucol, acyl-CoA cholesterol acyltransferase inhibitors, farnesoid X receptor antagonists , sterol-regulating element-binding protein (SCAP) cleavage-activating protein activators, microsomal triglyceride transfer protein (MTP) inhibitors, ApoE-related peptide, and therapeutic antibodies against ANGPTL3. Additional therapeutic agents may also include agents that increase high-density lipoprotein (HDL) levels, such as cholesterol ester transfer protein (CETP) inhibitors. In addition, additional therapeutic agents may also include nutritional supplements, such as fish oil. mRNA and additional therapeutic agents can be administered simultaneously and/or in the same combination, for example, parenterally, or additional therapeutic agent can be administered as part of a separate composition or at separate time points and/or in other way known in this field or described in this description .

In one embodiment, the method includes administering a composition of the present disclosure so as to decrease expression of the target gene ANGPTL3, such as for about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24 hours, 28, 32 or approximately 36 hours. In one embodiment, expression of the ANGPTL3 target gene is reduced over an extended period of time, such as at least about two, three, four days or more, such as about one week, two weeks, three weeks, or four weeks or more. .

Preferably, mRNAs suitable for the methods and compositions of the present disclosure specifically target RNAs (primary or processed) of the ANGPTL3 target gene. Compositions and methods for inhibiting the expression of these genes using mRNA can be prepared and performed as described herein.

Administration of dsRNA by the methods of the invention may result in a reduction in the severity, signs, symptoms and/or markers of such a disease or disorder in a patient with impaired lipid metabolism. By "decrease" in this context is meant a statistically significant decrease in that level. The reduction may be, for example, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70 %, 75%, 80%, 85%, 90%, 95% or approximately 100%.

The effectiveness of treatment or prevention of a disease can be assessed, for example, by determining the progression of the disease, remission of the disease, the severity of symptoms, pain relief, quality of life, the dose of the drug required to maintain a therapeutic effect, the level of a marker of the disease, or any other measurable parameter corresponding to a given disease, for which treatment is carried out or for which prophylaxis is directed. One of skill in the art is well aware of how to monitor the effectiveness of treatment or prevention by measuring any of these parameters or any combination of parameters. For example, the effectiveness of the treatment of lipid metabolism disorders can be assessed, for example, by periodically monitoring one or more serum lipid levels. Comparison of the last indications with the initial indications serves as an indication to the doctor whether the treatment is effective. A person skilled in the art can monitor the effectiveness of treatment or prevention by measuring any of these parameters or any combination of parameters. With respect to the administration of an ANGPTL3-targeting mRNA or a pharmaceutical composition thereof, "effective against" a lipid metabolic disorder means that administration, in a clinically accepted manner, results in a beneficial effect in at least a statistically significant patient population, such as improvement in symptoms, recovery, reduction diseases, increased life expectancy, improved quality of life, or other effect generally recognized as positive by physicians treating lipid metabolism disorders and related factors.

A therapeutic or prophylactic effect is detected when a statistically significant improvement in one or more parameters of the disease status is observed, or by the absence of worsening or development of symptoms where they would otherwise be expected. For example, a favorable change of at least 10% in a measurable disease parameter, and preferably at least 20%, 30%, 40%, 50%, or more, may be indicative of treatment efficacy. The efficacy for a given drug of an mRNA or formulation of such a drug can also be evaluated using an animal model for a given disease, as is known in the art. In an animal model, treatment efficacy is confirmed when a statistically significant reduction in a marker or symptom is observed.

Alternatively, efficacy may be measured by reduction in disease severity as determined by one of skill in the art of diagnosis based on a clinically validated disease severity rating scale such as, for example, the Childe-Pugh grading system (sometimes the Childe-Turcott-Pugh grading system). Any positive change, leading, for example, to a decrease in the severity of the disease, measured using an appropriate scale, indicates adequate treatment using mRNA or mRNA composition, as described in the present description.

Individuals may be administered a therapeutic amount of dsRNA, such as from about 0.01 mg/kg to about 5 mg/kg, from about 0.01 mg/kg to about 10 mg/kg, from about 0.05 mg/kg to about 5 mg/kg, about 0.05 mg/kg to about 10 mg/kg, about 0.1 mg/kg to about 5 mg/kg, about 0.1 mg/kg to about 10 mg/kg, about 0.2 mg/kg to about 5 mg/kg, about 0.2 mg/kg to about 10 mg/kg, about 0.3 mg/kg to about 5 mg/kg, from about 0.3 mg /kg to about 10 mg/kg, about 0.4 mg/kg to about 5 mg/kg, about 0.4 mg/kg to about 10 mg/kg, about 0.5 mg/kg to about 5 mg/kg, approximately 0.5 mg/kg to approximately 10 mg/kg, approximately 1 mg/kg to approximately 5 mg/kg, approximately 1 mg/kg to approximately 10 mg/kg, approximately 1.5 mg/kg approx. o to 5 mg/kg, about 1.5 mg/kg to about 10 mg/kg, about 2 mg/kg to about 2.5 mg/kg, about 2 mg/kg to about 10 mg/kg , from about 3 mg/kg to about 5 mg/kg, from about 3 mg/kg to about 10 mg/kg, from about 3.5 mg/kg to about 5 mg/kg, from about 4 mg/kg to about 5 mg/kg, approximately 4.5 mg/kg to approximately 5 mg/kg, approximately 4 mg/kg to approximately 10 mg/kg, approximately 4.5 mg/kg to approximately 10 mg/kg, approximately 5 mg/kg to about 10 mg/kg, about 5.5 mg/kg to about 10 mg/kg, about 6 mg/kg to about 10 mg/kg, about 6.5 mg/kg to about 10 mg/kg, approximately 7 mg/kg to approximately 10 mg/kg, approximately 7.5 mg/kg to approximately 10 mg/kg, approximately 8 mg/kg to approximately 10 mg/kg, approximately 8.5 mg/kg approx. up to 10 mg/kg, from about 9 mg/kg to about 10 mg/kg, or from about 9.5 mg/kg to about 10 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

For example, dsRNA can be administered at a dose of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5, 1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6, 4, 6.5, 6.6,6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7, 7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

In other embodiments, for example, where a composition of the invention comprises dsRNA as described herein and N-acetylgalactosamine, a therapeutic amount of dsRNA may be administered to individuals, such as a dose of about 0.1 to about 50 mg/kg, about 0 25 to about 50 mg/kg, about 0.5 to about 50 mg/kg, about 0.75 to about 50 mg/kg, about 1 to about 50 mg/mg, about 1.5 to about 50 mg/kg, about 2 to about 50 mg/kg, about 2.5 to about 50 mg/kg, about 3 to about 50 mg/kg, about 3.5 to about 50 mg/kg, about 4 to about 50 mg/kg, about 4.5 to about 50 mg/kg, about 5 to about 50 mg/kg, about 7.5 to about 50 mg/kg, about 10 to about 50 mg /kg, from approx. 15 approx. but up to 50 mg/kg, about 20 to about 50 mg/kg, about 25 to about 50 mg/kg, about 30 to about 50 mg/kg, about 35 to about 50 mg/kg, about 40 up to approximately 50 mg/kg, approximately 45 to approximately 50 mg/kg, approximately 0.1 to approximately 45 mg/kg, approximately 0.25 to approximately 45 mg/kg, approximately 0.5 to approximately 45 mg /kg, about 0.75 to about 45 mg/kg, about 1 to about 45 mg/mg, about 1.5 to about 45 mg/kg, about 2 to about 45 mg/kg, about 2 .5 to about 45 mg/kg, about 3 to about 45 mg/kg, about 3.5 to about 45 mg/kg, about 4 to about 45 mg/kg, about 4.5 to about 45 mg /kg, about 5 to about 45 mg/kg, about 7.5 to about 45 mg/kg , about 10 to about 45 mg/kg, about 15 to about 45 mg/kg, about 20 to about 45 mg/kg, about 25 to about 45 mg/kg, about 30 to about 45 mg/kg , about 35 to about 45 mg/kg, about 40 to about 45 mg/kg, about 0.1 to about 40 mg/kg, about 0.25 to about 40 mg/kg, about 0.5 up to about 40 mg/kg, about 0.75 to about 40 mg/kg, about 1 to about 40 mg/mg, about 1.5 to about 40 mg/kg, about 2 to about 40 mg/kg , about 2.5 to about 40 mg/kg, about 3 to about 40 mg/kg, about 3.5 to about 40 mg/kg, about 4 to about 40 mg/kg, about 4.5 up to approximately 40 mg/kg, approximately 5 to approximately 40 mg/kg, approximately o 7.5 to about 40 mg/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg, about 20 to about 40 mg/kg, about 25 to about 40 mg/kg kg, about 30 to about 40 mg/kg, about 35 to about 40 mg/kg, about 0.1 to about 30 mg/kg, about 0.25 to about 30 mg/kg, about 0, 5 to about 30 mg/kg, about 0.75 to about 30 mg/kg, about 1 to about 30 mg/mg, about 1.5 to about 30 mg/kbp, about 2 up to about 30 mg/kg, about 2.5 to about 30 mg/kg, about 3 to about 30 mg/kg, about 3.5 to about 30 mg/kg, about 4 to about 30 mg/kg , approximately 4.5 to approximately 30 mg/kg, approximately 5 to approximately 30 mg/kg, approximately 7.5 p up to about 30 mg/kg, about 10 to about 30 mg/kg, about 15 to about 30 mg/kg, about 20 to about 30 mg/kg, about 0.1 to about 20 mg/kg, about 0.25 to about 20 mg/kg, about 0.5 to about 20 mg/kg, about 0.75 to about 20 mg/kg, about 1 to about 20 mg/mg, about 1.5 up to about 20 mg/kg, about 2 to about 20 mg/kg, about 2.5 to about 20 mg/kg, about 3 to about 20 mg/kg, about 3.5 to about 20 mg/kg , about 4 to about 20 mg/kg, about 4.5 to about 20 mg/kg, about 5 to about 20 mg/kg, about 7.5 to about 20 mg/kg, about 10 to about 20 mg/kg or about 15 to about 20 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

For example, individuals may be administered a therapeutic amount of dsRNA, such as about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6, 3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7, 6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8, 9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or approximately 50 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

mRNA can be administered by intravenous infusion over a period of time such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 , 23, 24 or approximately 25 minutes. Administration can be repeated, for example, on a regular basis, such as every other week (ie every two weeks) for one month, two months, three months, four months or more. After the initial treatment regimen, treatment may be less frequent. For example, after administration once every two weeks for three months, administration can be repeated once a month, for six months, or one year or more. The introduction of mRNA can reduce the levels of ANGPTL3, for example, in a cell, tissue, blood, urine or other part of the patient's body by at least about 5%, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 39, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or at least about 99% or more.

Before a full dose of mRNA is administered, patients may be given a lower dose, such as a 5% infusion response, and monitored for side effects such as an allergic reaction. In another example, the patient is monitored for undesirable immunostimulatory effects, such as increased levels of cytokines (eg, TNF-alpha or INF-alpha).

Alternatively, the mRNA can be administered subcutaneously, ie. via subcutaneous injection. One or more injections can be used to deliver the desired daily dose of mRNA to an individual. The injections may be repeated over a period of time such as 2, 3, 4, 5, 6, 7, 8, 9, 10 or 15 days. Administration can be repeated, for example, on a regular basis, such as every other week (ie every two weeks) for one month, two months, three months, four months or more. After the initial treatment regimen, treatment may be less frequent. In some embodiments, a single dose of mRNA is followed by monthly dosing. In some embodiments, dosing may include a multiple dose loading phase on subsequent days.

Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as generally understood by a person skilled in the art to which this invention belongs. While methods and materials similar or equivalent to those described herein may be used in the practice or testing of the mRNA and methods of the invention, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned in the present description are incorporated by reference in their entirety. In case of conflict, the present description, including definitions, shall govern. Moreover, the materials, methods, and examples are illustrative only and are not intended to be limiting.

EXAMPLES

Example 1 Synthesis of mRNA

Source of reagents

When the source of a reagent is not specifically stated herein, such reagent can be obtained from any supplier of molecular biology reagents in standard quality/purity for use in molecular biology.

transcripts

MiRNAs were constructed to identify miRNAs targeting the human ANGPTL3 transcript annotated in the NCBI gene database (http://www.ncbi.nlm.nih.gov/gene/) and the cynomolgus monkey ANGPTL3 transcript ( Macaca fascicularis hereinafter "cyno "), obtained by sequencing cDNA obtained from RNA from the liver. Sequencing of ANGPTL3 cyno mRNA was performed according to laboratory rules and the mRNA sequence is shown in SEQ ID NO:9.

The following transcripts from the NCBI collection were used in the construction: NM_014495.2 (SEQ ID NO:1) human, NM_013913.3 (SEQ ID NO:2) mouse. All siRNA duplexes were constructed that had 100% identity with the listed human and cyno transcripts. The subpopulation of miRNA duplexes described below also shared 100% identity with the mouse ( Mus musculus ) ANGPTL3 transcript found in the NCBI gene database.

siRNA construction, specificity and performance prediction

The theoretically calculated specificity of all possible 19-mer sequences was theoretically calculated for each sequence. Then, candidate 19-mer sequences were selected that lacked repeats longer than 7 nucleotides. These 977 candidate human/cyno miRNAs and a subset of 38 that also matched mouse ("candidate human/cyno/mouse miRNAs") were then used for complex searches against the human transcriptome (defined as the set of NM_ and XM_ records in the reference set). human NCBI sequences) using a comprehensive "brute force" algorithm implemented by the Python script "BruteForce.py". The transcript-oligo alignments were then interpreted by the script to obtain a score depending on the position and number of mismatches between the miRNA and any potential "irrelevant target" transcript. The "irrelevant target" score was weighted to highlight differences in the "seed" region of the siRNA at positions 2-9 from the 5' end of the molecule. For each oligo-transcript pair, a mismatch score was obtained from a brute-force search by summing the individual mismatch scores, mismatches at positions 2-9 were counted as 2.8, mismatches at cleavage site position 10-11 were counted as 1.2, and mismatches at cleavage sites 12-19 were counted as 1.0. Additionally, irrelevant target prediction was performed by comparing the frequency of heptamers and octomers derived from 3 different seed region derived hexamers of each oligo. Hexamers of positions 2-7 relative to the 5'-beginning were used to obtain 2 heptamers and one octomer. "Heptamer 1" was obtained by adding 3'-A to the hexamer, "heptamer 2" was obtained by adding 5'-A to the hexamer, an octomer was obtained by adding A to the 5'- and 3'-ends of the hexamer. The frequency of octomers and heptamers in the human 3'UTRome (defined as a transcriptome subsequence from the NCBI reference sequence database where the end of the "CDS" coding region is well defined) was precalculated. The octomer frequency was normalized to the heptamer frequency using the median value from the octomer frequency range. Then, "mirSeedScore" was calculated by calculating the sum of ((3×number of normalized octomers)+(2×number of heptamer 2)+(1×number of heptamer 1)).

Both siRNA strands were assigned a specificity category according to the calculated scores: a score of approximately 3 was defined as highly specific, 3 as specific, and 2.2 to 2.8 as moderately specific. Sorting was performed according to the specificity of the antisense strand. Duplexes were then selected from the human/cyno set with antisense oligos that lacked matches in the miRNA seed region, scored 3 or higher, less than 65% of total GC, no GC in the first position, 4 or more U or A in the seed region, and GC in the nineteenth position. Also selected were duplexes from the human/cyno/mouse set with antisense oligos scoring 2 or higher, less than 65% total GC, and no GC in the first position.

Selection of siRNA sequences

A total of 47 sense oligos and 47 antisense oligos derived from siRNAs from the human/cyno set were synthesized and duplexed. A total of 15 sense oligos and 15 antisense sequences derived from human/cyno/mouse siRNAs were synthesized and duplexed.

Synthesis of ANGPTL3 sequences

ANGPTL3 sequences were synthesized on a MerMade 192 synthesizer at a scale of 1 or 0.2 µmol. Single strands were synthesized with 2'O-methyl modifications for transfection based on in vitro screening. For use in free uptake screening assays, 3'-GalNAc conjugates were prepared with chemical 2'-F- and 2'-O-methyl modifications. In this design, the GalNAc group was placed at the 3' end of the sense strand. The antisense sequence was 23 nucleotides long and also contained chemical 2'-F- and 2'-O-methyl modifications with two thiophosphate bonds at the 3'-end.

For one set of 21-mer single chains and duplexes, the "Endolight" chemistries were used, as detailed below.

- All pyrimidines (cytosine and uridine) in the sense strand were modified with 2'-O-methylnucleotides (2'-O-methyl-C and 2'-O-methyl-U).

- In the antisense strand, pyrimidines adjacent (in the 5' direction) to the ribo-A nucleoside were replaced with their respective 2'-O-methyl nucleosides.

- Two base extensions of dTsdT were introduced at the 3' end of the sense and antisense sequences.

For GalNAc conjugated to the 21-mer sense and complementary 23-mer antisense sequences, separate strands were synthesized with 2'-F- and 2'-O-methyl modifications. The synthesis was carried out on a GalNAc-modified CPG support for the sense strand and a CPG modified with a universal support for the antisense sequence at a scale of 1 μmol. A sequence motif called TOFFEE was used in which the sense strand contained a trinucleotide 2'-F-modified motif at positions 9, 10, and 11, and a 2'-O-methyl-modified motif was introduced into the antisense strand at positions 11,12 and 13.

Synthesis, cleavage and deprotection

Solid support oligonucleotide synthesis using phosphoramidite chemistry was used in the synthesis of ANGPTL3 sequences. For 21-mer sequences from Endolight, deoxythymidine CPG was used as a solid support, while for GalNAc conjugates, a GalNAc-based solid support for the sense strand and a universal CPG for the antisense strand were used.

Synthesis of the above sequences was carried out on a scale of 1 or 0.2 μm in 96-well plates. Amidite solutions were prepared at a concentration of 0.1 M and ethylthiotetrazole (0.6 M in acetonitrile) was used as an activator.

The synthesized sequences were digested and deprotected in 96-well plates using methylamine in the first step and a fluoride reagent in the second step. For sequences containing GalNAc and 2'-F-nucleoside, the deprotection conditions were modified. The digested and deprotected sequences were pelleted using acetone:ethanol (80:20) and the pellets were resuspended in 0.2M sodium acetate buffer. Samples from each sequence were analyzed by LC-MS for identity confirmation, UV for quantitation, and selected sets of samples by IEX chromatography for purity.

Purification, desalination and annealing

ANGPTL3 sequences were precipitated and purified on an AKTA purification system using a Sephadex column. ANGPTL3 was performed at ambient temperature. Sample injection and collection was performed in 96-well plates with a well depth of 1.8 ml. A single peak was obtained in the eluent corresponding to the full length sequence. The ANGPTL3 sequences were analyzed for concentration (via UV measurement at A ₂₆₀ ) and purity (ion-exchange HPLC) after salt removal. Complementary single strands were then combined in a 1:1 stoichiometric ratio to obtain siRNA duplexes.

Example 2 Screening in vitro

Cell culture and transfection

Hep3B cells (ATCC, Manassas, VA) were grown to about confluent at 37° C. in 5% CO ₂ in RPMI (ATCC) supplemented with 10% FBS, streptomycin and glutamine (ATCC) before being removed from the plate by trypsinization. Transfection was performed by adding 14.8 µl of Opti-MEM plus 0.2 µl of Lipofectamine RNAiMax per well (Invitrogcn, Carlsbad CA. cat. no. 13778-150) to 5 µl of siRNA duplexes per well in a 96-well plate and incubated at room temperature in within 15 minutes. Then, 80 μl of complete growth medium without antibiotic containing ~2×10 ⁴ Hep3B cells was added to the siRNA mixture. Cells were incubated for 24 or 120 hours prior to RNA purification. Single dose experiments were performed at final duplex concentrations of 10 nM and 0.1 nM and dose-response experiments were performed at final duplex concentrations of 10, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, 0.0005, 0.0001, 0.00005, and 0.00001 nM unless otherwise noted.

Transfection with free uptake

In each well of a 96-well plate, 5 μl of each GalNac-conjugated siRNA in PBS was combined with 4×10 ⁴ freshly thawed cryopreserved cynomolgus monkey hepatocytes resuspended in 95 μl of In Vitro Gro CP medium (In Vitro Technologies - Celsis, Baltimore, MD) . The mixture was incubated for approximately 24 hours at 37ºC in an atmosphere of 5% CO ₂ . siRNAs were tested at final concentrations of 500 nM, 100 nM and 10 nM for efficacy in free uptake assays. For dose-response screening, final siRNA concentrations were 500 nM, 100 nM, 20 nM, 4 nM, 0.8 nM, 0.16 nM, 0.032 nM, and 0.0064 nM.

Total RNA isolation using the DYNABEADS mRNA isolation kit (Invitrogen, Lot # 610-12)

Cells were collected and lysed in 150 μl of lysis/binding buffer, then stirred for 5 minutes at 850 rpm using an Eppendorf thermomixer (mixing speed was the same throughout the process). A mixture of ten microliters of magnetic beads and 80 μl of lysis/binding buffer was added to a round bottom plate and mixed for 1 minute. The magnetic beads were held using a magnetic holder and the supernatant was removed without affecting the beads. After removal of the supernatant, lysed cells were added to the remaining beads and mixed for 5 minutes. After removal of the supernatant, the magnetic beads were washed 2 times with 150 μl of wash buffer A and stirred for 1 minute. The beads were again held and the supernatant removed. The beads were then washed with 150 μl of wash buffer B, retained and the supernatant discarded. The beads were then washed with 150 μl of elution buffer, retained, and the supernatant discarded. The granules were left to dry for 2 minutes. After drying, 50 μl of elution buffer was added and stirred for 5 minutes at 70°C. The pellets were kept on the magnet for 5 minutes. 40 μl of supernatant was removed and added to another 96-well plate.

cDNA synthesis using the ABI High capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, Cat # 4368813)

To 10 µl of total RNA was added an initial mixture of 2 µl of 10X buffer, 0.8 µl of 25X dNTP, 2 µl of random primers, 1 µl of reverse transcriptase, 1 µl of RNase inhibitor and 3.2 µl of H ₂ O per reaction. cDNA was generated using a Bio-Rad C-1000 or S-1000 thermal cycler (Hercules, CA) through the following steps: 25°C 10 min, 37°C 120 min, 85°C 5 s, 4°C storage.

Real time PRC

2 µl cDNA was added to a stock containing 0.5 µl TaqMan GAPDH probe (Applied Biosystems cat. no. 4326317E), 0.5 µl TaqMan ANGPTL probe (Applied Biosystems cat. no. Hs00205581_m1), and 5 µl Lightcycler 480 probe stock mix (Roche cat. 04887301001) per well in 50 384-well plates (Roche cat. no. 04887301001). Real-time PCR was performed on an ABI 7900HT real-time PCR system (Applied Biosystems) using ΔΔCt(RQ) analysis. Each duplex was tested in two independent transfections and each transfection was analyzed in duplicate unless otherwise noted in the summary tables.

To calculate relative fold change, real-time data were analyzed by the ΔΔCt method and normalized to assays performed on cells transfected with 10 nM AD-1955 or sham transfected cells. IC ₅₀ was calculated using a 4-parameter fitting model using XLFit and normalized to cells transfected with AD-1955 or native cells in a similar dose range, or their own lowest dose. The AD-1955 sequence used as a negative control targets luciferase and has the following sequence: sense: cuuAcGcuGAGuAcuucGAdTsdT (SEQ ID NO:14); antisense: UCGAAGuACUcAGCGuAAGdTsdT (SEQ ID NO:15).

Survival Screenings

Cell viability was measured on days 3 and 6 on HeLa and Hep3B cells after transfection with 10, 1, 0.5, 0.1, 0.05 nM siRNA. Cells were seeded at a density of 10,000 cells per well in 96-well plates. Each siRNA was analyzed in triplicate and the data were averaged. To evaluate loss of survival, siRNAs directed to PLK1 and AD-19200 were included as positive controls, and cells transfected with AD-1955 and under sham conditions were included as negative controls. PLK1 and AD-19200 result in a dose-dependent loss of survival. To measure survival after 3 or 6 days, 20 μl of CellTiter Blue (Promega) was added to each well of 96-well plates and incubated at 37ºC for 2 hours. The plates were then analyzed on a spectrophotometer (Molecular Devices) at 560 excitation/590 emission. Survival was expressed as the mean value of light units of transfections in three repetitions +/- standard deviation. Relative survival was assessed first by averaging transfections over triplicates and then normalizing to cells transfected under simulated conditions. Data are expressed as % viable cells.

Table 1: Abbreviations for nucleotide monomers used in the provision of nucleic acid sequences

It should be understood that these monomers, when contained in an oligonucleotide, are pairwise linked by 5'-3'-phosphodiester bonds.

Abbreviation Nucleotide(s) A adenosine C cytidine G guanosine T thymidine u uridine N any nucleotide (G, A, C, T or U) a 2'-O-methyladenosine c 2'-O-methylcytidine g 2'-O-methylguanosine u 2'-O-methyluridine dT 2'-deoxythymidine s thiophosphate bond

table 2
Unmodified sequences of sense and antisense strands of dsRNA ANGPTL3 Duplex ID The name of the semantic chain Semantic sequence (SEQ ID NO:16-77, respectively, in order of appearance) Position in NM_014495.2 Name of the antisense strand Antisense sequence (SEQ ID NO:78-139, respectively, in order of appearance) Position in NM_014495.2 AD-45939.1 A-96225.1 UAUUUGAUCAGUCUUUUUA 281-299 A-96226.1 UAAAAAGACUGAUCAAAUA 281-299 AD-45858.1 A-96149.1 GAGCAACUAACUAACUUAA 478-496 A-96150.1 UUAAGUUAGUUAGUUGCUC 478-496 AD-45869.1 A-96137.1 GGCCAAAUUAAUGACAUAU 247-265 A-96138.1 AUAUGUCAUUAAUUUGCC 247-265 AD-45884.1 A-96189.1 CGAAUUGAGUUGGAAGACU 1045-1063 A-96190.1 AGUCUUCCAACUCCAAUUCG 1045-1063 AD-45892.1 A-96129.1 CCUCCUUCAGUUGGGACAU 198-216 A-96130.1 AUGUCCCAACUGAAGGAGG 198-216 AD-45899.1 A-96147.1 CACUUGAACUCAACUCAAA 401-419 A-96148.1 UUUGAGUUGAGUUCAAGUG 401-419 AD-45915.1 A-96231.1 GUCCAUGGACAUUAAUUCA 890-908 A-96232.1 UGAAUUAAUGUCCAUGGAC 890-908 AD-45924.1 A-96219.1 AAUCAAGAUUUGCUAUGUU 152-170 A-96220.1 AACAUAGCAAAAUCUUGAUU 152-170 AD-45860.1 A-96181.1 CUAGAGAAGAUAUACUCCA 1000-1018 A-96182.1 UGGAGUAUAUCUUCUCUAG 1000-1018 AD-45870.1 A-96153.1 CUAACUAACUUAAUUCAAAA 484-502 A-96154.1 UUUGAAUUAAGUUAGUUAG 484-502 AD-45870.2 A-96153.2 CUAACUAACUUAAUUCAAAA 484-502 A-96154.2 UUUGAAUUAAGUUAGUUAG 484-502 AD-45877.1 A-96171.1 CAUUAAUUCAACAUCGAAU 899-917 A-96172.1 AUUCGAUGUUGAAUUAAUG 899-917 AD-45885.1 A-96205.1 CAAAAUGUUGAUCCAUCCA 1392-1410 A-96206.1 UGGAUGGAUCAACAUUUUG 1392-1410 AD-45893.1 A-96145.1 CAUAUAAACUACAAGUCAA 359-377 A-96146.1 UUGACUUGUAGUUUAUAUG 359-377 AD-45900.1 A-96163.1 GACCCAGCAACUCUCAAGU 839-857 A-96164.1 ACUUGAGAGUUGCUGGGUC 839-857 AD-45925.1 A-96235.1 GGUUGGGCCUAGAGAAGAU 992-1010 A-96236.1 AUCUUCUCUAGGCCCAACC 992-1010 AD-45861.1 A-96197.1 GUGUGGAGAAAACAACCUA 1272-1290 A-96198.1 UAGGUUGUUUUCUCCACAC 1272-1290 AD-45871.1 A-96169.1 GACAUUAAUUCAACAUCGA 897-915 A-96170.1 UCGAUGUUGAAUUAAUGUC 897-915 AD-45878.1 A-96187.1 CAUAGUGAAGCAAUCUAAU 1017-1035 A-96188.1 AUUAGAUUGCUUCACUAUG 1017-1035 AD-45886.1 A-96127.1 CUAUGUUAGACGAUGUAAAA 164-182 A-96128.1 UUUACAUCGUCUAAACAUAG 164-182 AD-45894.1 A-96161.1 CACAGAAAUUUCUCUAUCU 684-702 A-96162.1 AGAUAGAGAAAUUUCUGUG 684-702 AD-45901.1 A-96179.1 GUUGGGCCUAGAGAAGAUA 993-1011 A-96180.1 UAUCUUCUCUAGGCCCAAC 993-1011 AD-45909.1 A-96213.1 GCCAAAAUCAAGAUUUGCU 147-165 A-96214.1 AGCAAAUCUUGAUUUUGGC 147-165 AD-45934.1 A-96223.1 ACAUAUUUGAUCAGUCUUU 278-296 A-96224.1 AAAGACUGAUCAAAUAUGU 278-296 AD-45934.2 A-96223.2 ACAUAUUUGAUCAGUCUUU 278-296 A-96224.2 AAAGACUGAUCAAAUAUGU 278-296 AD-45863.1 A-96135.1 CUUAAAGACUUUGUCCAUA 220-238 A-96136.1 UAUGGACAAAGUCUUUAAG 220-238 AD-45872.1 A-96185.1 CCAUAGUGAAGCAAUCUAA 1016-1034 A-96186.1 UUAGAUUGCUUCACUAUGG 1016-1034 AD-45879.1 A-96203.1 CAACCAAAAUGUUGAUCCA 1388-1406 A-96204.1 UGGAUCAACAUUUUGGUUG 1388-1406 AD-45887.1 A-96143.1 CUACAUAUAAACUACAAGU 356-374 A-96144.1 ACUUGUAGUUUAUAUGUAG 356-374 AD-45895.1 A-96177.1 GGGAGGCUUGAUGGAGAAU 970-988 A-96178.1 AUUCUCCAUCCAAGCCUCCC 970-988 AD-45902.1 A-96195.1 GGUGUUUUCUACUUGGGAU 1188-1206 A-96196.1 AUCCCAAGUAGAAAACACC 1188-1206 AD-45910.1 A-96229.1 AAGAGCACCAAGAACUACU 711-729 A-96230.1 AGUAGUUCUUGGUGCUCUU 711-729 AD-45935.1 A-96239.1 UGGAGAAAAACAACCUAAAU 1275-1293 A-96240.1 AUUUAGGUUGUUUUCUCCA 1275-1293 AD-45864.1 A-96151.1 GCAACUAACUAACUUAAUU 480-498 A-96152.1 AAUUAGUUAGUUAGUUGC 480-498 AD-45873.1 A-96201.1 CAACCUAAAUGGUAAAUAU 1284-1302 A-96202.1 AUAUUUACCAUUUAGGUUG 1284-1302 AD-45880.1 A-96125.1 GCUAUGUUAGACGAUGUAA 163-181 A-96126.1 UUACAUCGUCUAACAUAGC 163-181 AD-45888.1 A-96159.1 CCCACAGAAAUUUCUCUAU 682-700 A-96160.1 AUAGAGAAAUUUCUGUGGG 682-700 AD-45896.1 A-96193.1 GAUUUGGUGUUUUCUACUU 1183-1201 A-96194.1 AAGUAGAAAACACCAAAUC 1183-1201 AD-45903.1 A-96211.1 CAGAGCCAAAAUCAAGAUU 143-161 A-96212.1 AAUCUUGAUUUUGGCUCUG 143-161 AD-45919.1 A-96217.1 AAAUCAAGAUUUGCUAUGU 151-169 A-96218.1 ACAUAGCAAAAUCUUGAUUU 151-169 AD-45865.1 A-96167.1 CAUGGACAUUAAUUCAACA 893-911 A-96168.1 UGUUGAAUUAAUGUCCAUG 893-911 AD-45874.1 A-96123.1 GAUUUGCUAUGUUAGACGA 158-176 A-96124.1 UCGUCUAACAUAGCAAAUC 158-176 AD-45881.1 A-96141.1 GAACUACAUAUAAACUACA 353-371 A-96142.1 UGUUUUAUAUGUAGUUC 353-371 AD-45889.1 A-96175.1 CGAAUAGAUGGAUCACAAAA 913-931 A-96176.1 UUUGUGAUCCAUCAUUCG 913-931 AD-45897.1 A-96209.1 CUUGUUAAAACUCUAAACU 1817-1835 A-96210.1 AGUUUAGAGUUUUAACAAG 1817-1835 AD-45904.1 A-96227.1 AUUUGAUCAGUCUUUUUAU 282-300 A-96228.1 AUAAAAAGACUGAUCAAAU 282-300 AD-45920.1 A-96233.1 UCCAUGGACAUUAAUUCAA 891-909 A-96234.1 UUGAAUUAAUGUCCAUGGA 891-909 AD-45856.1 A-96117.1 CACAAUUAAGCUCCUUCUU 57-75 A-96118.1 AAGAAGGAGCUUAAUUGUG 57-75 AD-45929.1 A-96221.1 CAACAUAUUUGAUCAGUCU 276-294 A-96222.1 AGACUGAUCAAAUAUGUUG 276-294 AD-45866.1 A-96183.1 CUCCAUAGUGAAGCAAUCU 1014-1032 A-96184.1 AGAUUGCUUCACUAUGGAG 1014-1032 AD-45875.1 A-96139.1 GCCAAAUUAAUGACAUAUU 248-266 A-96140.1 AAUAUGUCAUUAAUUUGGC 248-266 AD-45882.1 A-96157.1 CAACAGCAUAGUCAAAUAA 622-640 A-96158.1 UUAUUUGACUAUGCUGUUG 622-640 AD-45890.1 A-96191.1 GGAAAUCACGAAACCAACU 1105-1123 A-96192.1 AGUUGGUUUCGUGAUUUCC 1105-1123 AD-45898.1 A-96131.1 CAGUUGGGACAUGGUCUUA 205-223 A-96132.1 UAAGACCAUGUCCCAACUG 205-223 AD-45857.1 A-96133.1 GACAUGGUCUUAAAGACUU 212-230 A-96134.1 AAGUCUUUAAGACCAUGUC 212-230 AD-45930.1 A-96237.1 UGUGGAGAAAAACAACCUAA 1273-1291 A-96238.1 UUAGGUUGUUUUCUCCACA 1273-1291 AD-45867.1 A-96199.1 GUGGAGAAAACAACCUAAA 1274-1292 A-96200.1 UUUAGGUUGUUUUCUCCAC 1274-1292 AD-45876.1 A-96155.1 CCAACAGCAUAGUCAAAUA 621-639 A-96156.1 UAUUUGACUAUGCUGUUGG 621-639 AD-45883.1 A-96173.1 CAACAUCGAAUAGAUGGAU 907-925 A-96174.1 AUCCAUCUAUUCGAUGUUG 907-925 AD-45891.1 A-96207.1 GCAAAUUUAAAAGGCAAUA 1441-1459 A-96208.1 UAUUGCCUUUUAAAUUUGC 1441-1459 AD-45914.1 A-96215.1 CAAAAUCAAGAUUUGCUAU 149-167 A-96216.1 AUAGCAAAUCUUGAUUUUG 149-167 AD-15838.1 A-26242.1 AGAGCCAAAAUCAAGAUUU 144-162 A-26243.2 AAAUCUUGAUUUUGGCUCU 144-162

Table 3
Modified sequences of sense and antisense strands of dsRNA ANGPTL3 Duplex ID The name of the semantic oligo Semantic sequence (SEQ ID NO:140-201, respectively in order of appearance) Name of antisense oligo Antisense sequence (SEQ ID NO:202-263, respectively in order of appearance) AD-45939.1 A-96225.1 uAuuuGAucAGucuuuuuAdTsdT A-96226.1 uAAAAGACUGAUcAAAuAdTsdT AD-45858.1 A-96149.1 GAGcAAcuAAcuAAcuuAAdTsdT A-96150.1 UuAAGUuAGUuAGUUGCUCdTsdT AD-45869.1 A-96137.1 GGccAAAuuAAuGAcAuAudTsdT A-96138.1 AuAUGUcAUuAAUUUGGCCdTsdT AD-45884.1 A-96189.1 cGAAuuGAGuuGGAAGAcudTsdT A-96190.1 AGUCUUCcAACUcAAUUCGdTsdT AD-45892.1 A-96129.1 ccuccuucAGuuGGGAcAudTsdT A-96130.1 AUGUCCcAACUGAAGGAGGdTsdT AD-45899.1 A-96147.1 cAcuuGAAcucAAcucAAAdTsdT A-96148.1 UUUGAGUUGAGUUcAAGUGdTsdT AD-45915.1 A-96231.1 GuccAuGGAcAuuAAuucAdTsdT A-96232.1 UGAAUuAAUGUCcAUGGACdTsdT AD-45924.1 A-96219.1 AAucAAGAuuuGcuAuGuudTsdT A-96220.1 AAcAuAGcAAAUCUUGAUUdTsdT AD-45860.1 A-96181.1 cuAGAGAAGAuAuAcuccAdTsdT A-96182.1 UGGAGuAuAUCUUCUCuAGdTsdT AD-45870.1 A-96153.1 cuAAcuAAcuuAAuucAAAdTsdT A-96154.1 UUUGAAUuAAGUuAGUuAGdTsdT AD-45870.2 A-96153.2 cuAAcuAAcuuAAuucAAAdTsdT A-96154.2 UUUGAAUuAAGUuAGUuAGdTsdT AD-45877.1 A-96171.1 cAuuAAuucAAcAucGAAudTsdT A-96172.1 AUUCGAUGUUGAAUuAAUGdTsdT AD-45885.1 A-96205.1 cAAAAuGuuGAuccAuccAdTsdT A-96206.1 UGGAUGGAUcAAcAUUUUGdTsdT AD-45893.1 A-96145.1 cAuAuAAAcuAcAAGucAAdTsdT A-96146.1 UUGACUUGuAGUUuAuAUGdTsdT AD-45900.1 A-96163.1 GAcccAGcAAcucucAAGudTsdT A-96164.1 ACUUGAGAGUUGCUGGGUCdTsdT AD-45925.1 A-96235.1 GGuuGGGccuAGAGAAGAudTsdT A-96236.1 AUCUUCUCuAGGCCcAACCdTsdT AD-45861.1 A-96197.1 GuGuGGAGAAAAcAAccuAdTsdT A-96198.1 uAGGUUGUUUUCUCcAcACdTsdT AD-45871.1 A-96169.1 GAcAuuAAuucAAcAucGAdTsdT A-96170.1 UCGAUGUUGAAUuAAUGUCdTsdT AD-45878.1 A-96187.1 cAuAGuGAAGcAAucuAAudTsdT A-96188.1 AUuAGAUUGCUUcACuAUGdTsdT AD-45886.1 A-96127.1 cuAuGuuAGAcGAuGuAAAdTsdT A-96128.1 UUuAcAUCGUCuAAcAuAGdTsdT AD-45894.1 A-96161.1 cAcAGAAAAuuucucuAucudTsdT A-96162.1 AGAuAGAGAAAUUUCUGUGdTsdT AD-45901.1 A-96179.1 GuuGGGccuAGAGAAGAuAdTsdT A-96180.1 uAUCUUCUCuAGGCCcAACdTsdT AD-45909.1 A-96213.1 GccAAAAucAAGAuuuGcudTsdT A-96214.1 AGcAAAUCUUGAUUUUGGCdTsdT AD-45934.1 A-96223.1 AcAuAuuuGAucAGucuuudTsdT A-96224.1 AAAGACUGAUcAAAuAUGUdTsdT AD-45934.2 A-96223.2 AcAuAuuuGAucAGucuuudTsdT A-96224.2 AAAGACUGAUcAAAuAUGUdTsdT AD-45863.1 A-96135.1 cuuAAAGAcuuuGuccAuAdTsdT A-96136.1 uAUGGAcAAAGUCUuAAGdTsdT AD-45872.1 A-96185.1 ccAuAGuGAAGcAAucuAAdTsdT A-96186.1 UuAGAUUGCUUcACuAUGGdTsdT AD-45879.1 A-96203.1 cAAccAAAAuGuuGAuccAdTsdT A-96204.1 UGGAUcAAcAUUUUGGUUGdTsdT AD-45887.1 A-96143.1 cuAcAuAuAAAcuAcAAGudTsdT A-96144.1 ACUUGuAGUUuAuAUGuAGdTsdT AD-45895.1 A-96177.1 GGGAGGcuuGAuGGAGAAudTsdT A-96178.1 AUUCUCcAUcAAGCCUCCCdTsdT AD-45902.1 A-96195.1 GGuGuuuucuAcuuGGGAudTsdT A-96196.1 AUCCcAAGuAGAAAAcACCdTsdT AD-45910.1 A-96229.1 AAGAGcAccAAGAAcuAcudTsdT A-96230.1 AGuAGUUCUUGGUGCUCUUdTsdT AD-45935.1 A-96239.1 uGGAGAAAAcAAccuAAAudTsdT A-96240.1 AUUuAGGUUGUUUUCUCcAdTsdT AD-45864.1 A-96151.1 GcAAcuAAcuAAcuuAAuudTsdT A-96152.1 AAUuAAGUuAGUuAGUUGCdTsdT AD-45873.1 A-96201.1 cAAccuAAAuGGuAAAuAudTsdT A-96202.1 AuAUUuACcAUUuAGGUUGdTsdT AD-45880.1 A-96125.1 GcuAuGuuAGAcGAuGuAAdTsdT A-96126.1 UuAcAUCGUCuAAcAuAGCdTsdT AD-45888.1 A-96159.1 cccAcAGAAAAuuucucuAudTsdT A-96160.1 AuAGAGAAAUUUCUGUGGGdTsdT AD-45896.1 A-96193.1 GAuuuGGuGuuuucuAcuudTsdT A-96194.1 AAGuAGAAAAacACcAAAUCdTsdT AD-45903.1 A-96211.1 cAGAGccAAAAucAAGAuudTsdT A-96212.1 AAUCUUGAUUUUGGCUCUGdTsdT AD-45919.1 A-96217.1 AAAucAAGAuuuGcuAuGudTsdT A-96218.1 AcAuAGcAAAUCUUGAUUUdTsdT AD-45865.1 A-96167.1 cAuGGAcAuuAAuucAAcAdTsdT A-96168.1 UGUUGAAUuAAUGUCcAUGdTsdT AD-45874.1 A-96123.1 GAuuuGcuAuGuuAGAcGAdTsdT A-96124.1 UCGUCuAAcAuAGcAAAUCdTsdT AD-45881.1 A-96141.1 GAAcuAcAuAuAAAcuAcAdTsdT A-96142.1 UGuAGUUuAuAUGuAGUUCdTsdT AD-45889.1 A-96175.1 cGAAuAGAuGGAucAcAAAdTsdT A-96176.1 UUUGUGAUCcAUCuAUUCGdTsdT AD-45897.1 A-96209.1 cuuGuuAAAAcucuAAAcudTsdT A-96210.1 AGUUuAGAGUUUuAAcAAGdTsdT AD-45904.1 A-96227.1 AuuuGAucAGucuuuuuAudTsdT A-96228.1 AuAAAAAAGACUGAUcAAAUdTsdT AD-45920.1 A-96233.1 uccAuGGAcAuuAAuucAAdTsdT A-96234.1 UUGAAUuAAUGUCcAUGGAdTsdT AD-45856.1 A-96117.1 cAcAAuuAAGcuccuucuudTsdT A-96118.1 AAGAAGGAGCUuAAUUGUGdTsdT AD-45929.1 A-96221.1 cAAcAuAuuuGAucAGucudTsdT A-96222.1 AGACUGAUcAAAuAUGUUGdTsdT AD-45866.1 A-96183.1 cucAuAGuGAAGcAAucudTsdT A-96184.1 AGAUUGCUUcACuAUGGAGdTsdT AD-45875.1 A-96139.1 GccAAAuuAAuGAcAuAuudTsdT A-96140.1 AAuAUGUcAUuAAUUUGGCdTsdT AD-45882.1 A-96157.1 cAAcAGcAuAGucAAAuAAdTsdT A-96158.1 UuAUUUGACuAUGCUGUUGdTsdT AD-45890.1 A-96191.1 GGAAAucAcGAAAccAAcudTsdT A-96192.1 AGUUGGUUUCGUGAUUUCCdTsdT AD-45898.1 A-96131.1 cAGuuGGGAcAuGGucuuAdTsdT A-96132.1 uAAGACcAUGUCCcAACUGdTsdT AD-45857.1 A-96133.1 GAcAuGGucuuAAAGAcuudTsdT A-96134.1 AAGUCUUuAAGACcAUGUCdTsdT AD-45930.1 A-96237.1 uGuGGAGAAAAcAAccuAAdTsdT A-96238.1 UuAGGUUGUUUUCUCcAcAdTsdT AD-45867.1 A-96199.1 GuGGAGAAAAcAAccuAAAdTsdT A-96200.1 UUuAGGUUGUUUUCUCcACdTsdT AD-45876.1 A-96155.1 ccAAcAGcAuAGucAAAuAdTsdT A-96156.1 uAUUUGACuAUGCUGUUGGdTsdT AD-45883.1 A-96173.1 cAAcAucGAAuAGAuGGAudTsdT A-96174.1 AUCcAUCuAUUCGAUGUUGdTsdT AD-45891.1 A-96207.1 GcAAAuuuAAAAGGcAAuAdTsdT A-96208.1 uAUUGCCUUUuAAAUUUGCdTsdT AD-45914.1 A-96215.1 cAAAAucAAGAuuuGcuAudTsdT A-96216.1 AuAGcAAAUCUUGAUUUUGdTsdT AD-15838.1 A-26242.1 AGAGccAAAAucAAGAuuudTsdT A-26243.2 AAAUCUuGAUUUuGGCUCUdTsdT

Lowercase nucleotides (a, u, g, c) are 2'-O-methylnucleotides, s is a thiophosphate bond.

Table 4
Single dose screening results using ANGPTL3 dsRNA sequences
Experiments were performed using the modified oligonucleotide duplexes listed in Table 3. The sequence of AD-15838.2 is identical to that of AD-15838.1. Delivery of siRNA duplexes was performed using LNP. human Hep3B cells Duplex 10 nM 0.1 nM Standard off 10 nM Std. off, 0.1 nM AD-15838.2 0.09 0.66 0.008 0.030 AD-45856.1 0.32 0.91 0.026 0.032 AD-45857.1 2.46 1.07 0.140 0.044 AD-45858.1 0.10 0.74 0.010 0.070 AD-45860.1 0.02 0.47 0.002 0.097 AD-45861.1 0.03 0.68 0.004 0.062 AD-45863.1 1.42 0.95 0.145 0.126 AD-45864.1 0.02 0.17 0.002 0.045 AD-45865.1 0.32 0.93 0.022 0.062 AD-45866.1 0.10 0.92 0.010 0.041 AD-45867.1 0.04 0.61 0.000 0.048 AD-45869.1 0.45 1.08 0.028 0.081 AD-45870.1 0.01 0.10 0.003 0.010 AD-45871.1 0.05 0.57 0.006 0.071 AD-45872.1 0.07 0.71 0.007 0.034 AD-45873.1 0.02 0.23 0.001 0.011 AD-45874.1 0.08 0.75 0.013 0.049 AD-45875.1 0.13 0.82 0.017 0.040 AD-45876.1 0.03 0.54 0.000 0.013 AD-45877.1 0.06 0.47 0.002 0.025 AD-45878.1 0.02 0.44 0.002 0.031 AD-45879.1 0.03 0.35 0.003 0.023 AD-45880.1 0.49 1.00 0.039 0.088 AD-45881.1 0.20 0.90 0.019 0.095 AD-45882.1 0.20 0.95 0.012 0.086 AD-45883.1 0.16 0.98 0.011 0.058 AD-45884.1 0.09 0.94 0.003 0.044 AD-45885.1 0.22 0.91 0.020 0.145 AD-45886.1 0.04 0.40 0.008 0.080 AD-45887.1 0.03 0.35 0.002 0.057 AD-45888.1 0.05 0.80 0.006 0.042 AD-45889.1 0.31 0.91 0.013 0.052 AD-45890.1 0.06 0.90 0.001 0.047 AD-45891.1 0.06 0.82 0.007 0.034 AD-45892.1 1.01 1.09 0.033 0.211 AD-45893.1 0.04 0.58 0.002 0.046 AD-45894.1 0.04 0.59 0.003 0.024 AD-45895.1 0.84 1.00 0.047 0.047 AD-45896.1 0.84 0.98 0.032 0.095 AD-45897.1 0.36 0.61 0.032 0.053 AD-45898.1 0.98 1.09 0.021 0.117 AD-45899.1 0.04 0.59 0.005 0.095 AD-45900.1 0.06 0.80 0.005 0.091 AD-45901.1 0.33 0.94 0.025 0.096 AD-45902.1 0.24 1.03 0.010 0.079 AD-45903.1 0.74 1.02 0.003 0.092 AD-45904.1 0.39 0.87 0.010 0.010 AD-45909.1 0.04 0.73 0.008 0.013 AD-45910.1 1.08 1.01 0.037 0.089 AD-45914.1 0.52 0.99 0.018 0.071 AD-45915.1 0.06 0.48 0.004 0.046 AD-45919.1 0.67 0.98 0.048 0.064 AD-45920.1 0.61 1.00 0.031 0.038 AD-45924.1 0.09 0.67 0.005 0.012 AD-45925.1 0.13 0.90 0.008 0.100 AD-45929.1 0.02 0.42 0.001 0.083 AD-45930.1 0.05 0.63 0.005 0.052 AD-45934.1 0.04 0.41 0.001 0.062 AD-45935.1 0.08 0.76 0.006 0.058 AD-45939.1 0.23 0.82 0.030 0.028 AD-1955.1 0.93 0.93 0.068 0.073 AD-1955.1 0.94 1.01 0.028 0.113 AD-1955.1 1.00 1.02 0.032 0.065 AD-1955.1 1.15 1.06 0.053 0.019

Table 5
Dose-response screening results for the dsRNA sequence ANGPTL3
Experiments were performed using the modified oligonucleotide duplexes listed in Table 3. The sequence of AD-15838.2 is identical to that of AD-15838.1. IC ₅₀ Hep3B 24 hours 120 hours Duplex IC ₅₀ I (nM) IC ₅₀ II (nM) weighted IC ₅₀ (nM) IC ₅₀ I (nM) IC ₅₀ II (nM) weighted IC ₅₀ (nM) AD-15838.2 0.027 0.006 0.017 0.657 0.937 0.800 AD-45860.1 0.006 0.002 0.004 0.045 0.032 0.039 AD-45864.1 0.002 0.001 0.002 0.046 0.042 0.044 AD-45870.1 0.002 0.001 0.001 0.011 0.008 0.010 AD-45873.1 0.005 0.004 0.005 0.037 0.025 0.031 AD-45876.1 0.032 0.006 0.019 0.269 0.045 0.156 AD-45877.1 0.018 0.012 0.015 1.660 0.538 1.091 AD-45878.1 0.023 0.015 0.019 0.252 0.131 0.190 AD-45879.1 0.002 0.003 0.003 0.023 0.029 0.026 AD-45886.1 0.004 0.004 0.004 0.030 0.018 0.025 AD-45887.1 0.010 0.009 0.010 0.058 0.059 0.059 AD-45915.1 0.016 0.015 0.015 0.110 0.056 0.083 AD-45929.1 0.023 0.008 0.016 0.227 0.025 0.124 AD-45934.1 0.006 0.006 0.006 0.110 0.045 0.077

Table 6
Results of Cell Survival Screening Using Modified ANGPTL3 dsRNA Sequences
Experiments were performed using the modified oligonucleotide duplexes listed in Table 3. The sequence of AD-15838.2 is identical to that of AD-15838.1. Survival data is expressed as % viable cells relative to cells treated under simulated conditions. Day 3 HeLa Target Duplex Average 10 nM Average 1 nM Averaged 500 pM Average 100 pM Average 50 pM Standard deviation 10 nM Standard deviation 1 nM Standard deviation 500 pM Standard deviation 100 pM Standard deviation 50 pM ANGPTL3 AD-15838.2 37.34 58.67 70.92 89.86 94.98 9.45 12.28 15.06 22.37 18.23 ANGPTL3 AD-15838.2 29.13 48.99 63.18 79.21 94.47 1.62 5.56 4.34 11.15 11.31 ANGPTL3 AD-45860.1 67.10 75.49 77.93 86.57 90.51 6.99 12.93 6.39 6.97 3.57 ANGPTL3 AD-45864.1 99.13 96.95 86.77 89.20 84.36 7.90 7.22 12.60 4.85 6.87 ANGPTL3 AD-45870.1 82.36 97.02 95.33 95.67 92.27 8.07 5.12 7.97 7.05 10.29 ANGPTL3 AD-45873.1 67.96 90.01 90.60 94.20 103.63 11.26 22.61 15.92 22.92 16.97 ANGPTL3 AD-45876.1 64.00 76.71 80.21 81.71 91.23 6.60 13.94 10.15 10.81 13.89 ANGPTL3 AD-45877.1 79.55 77.33 79.98 91.96 93.46 1.66 9.80 8.73 16.63 11.41 ANGPTL3 AD-45878.1 81.95 78.22 78.74 87.93 85.03 15.37 22.72 22.59 30.84 40.04 ANGPTL3 AD-45878.1 66.83 70.71 82.14 82.80 83.14 17.48 6.49 6.86 19.92 21.15 ANGPTL3 AD-45879.1 37.56 45.55 59.28 76.35 78.38 3.50 7.96 19.73 34.33 33.99 ANGPTL3 AD-45886.1 72.75 57.90 64.51 81.92 82.89 14.73 12.64 11.78 25.60 23.14 ANGPTL3 AD-45887.1 38.01 53.91 59.31 76.44 85.73 0.58 10.81 6.27 11.12 10.92 ANGPTL3 AD-45915.1 48.06 52.17 67.90 95.45 100.77 8.13 15.15 29.11 32.49 38.79 ANGPTL3 AD-45929.1 29.27 44.58 52.87 76.45 88.03 4.17 9.67 14.49 31.74 28.82 ANGPTL3 AD-45934.1 68.20 64.11 76.92 79.57 92.11 15.79 11.25 19.99 26.08 26.30 (+) control AD-19200 41.09 85.94 95.13 101.29 96.60 9.99 25.31 24.56 32.26 26.35 (+) control AD-19200 23.99 72.76 86.51 108.10 111.13 5.35 34.52 29.24 35.99 31.88 (-)control AD-1955 89.65 99.87 94.59 104.04 105.10 4.57 5.94 4.19 5.78 7.46 (-)control AD-1955 104.74 99.78 105.79 109.19 108.08 10.94 7.74 11.12 7.91 10.30 (-)control imitation 100.00 6.92 (-)control imitation 100.00 9.85 (+) control PLK 10.66 26.65 46.16 92.42 98.78 1.70 8.65 13.47 22.99 23.48 (+) control PLK 10.74 11.41 17.33 61.02 86.59 3.39 2.61 1.49 27.42 37.31 Day 6 HeLa Target Duplex Average 10 nM Average 1 nM Averaged 500 pM Average 100 pM Average 50 pM Standard deviation 10 nM Standard deviation 1 nM Standard deviation 500 pM Standard deviation 100 pM Standard deviation 50 pM ANGPTL3 AD-15838.2 47.94 80.97 90.44 94.37 96.10 29.05 25.12 13.62 8.88 4.72 ANGPTL3 AD-15838.2 40.32 83.80 89.88 95.94 98.27 22.47 16.51 10.03 3.83 4.19 ANGPTL3 AD-45860.1 57.38 84.84 88.90 96.74 94.03 24.55 17.35 9.67 3.17 6.58 ANGPTL3 AD-45864.1 98.65 100.87 101.13 96.86 98.24 4.35 1.91 2.22 3.41 1.80 ANGPTL3 AD-45870.1 92.69 98.71 98.49 100.07 99.28 3.94 2.67 2.36 1.19 2.65 ANGPTL3 AD-45873.1 91.78 97.38 98.81 97.57 96.22 12.47 6.26 4.08 6.22 8.64 ANGPTL3 AD-45876.1 63.54 85.68 92.13 96.48 95.97 14.74 16.50 10.03 5.81 7.51 ANGPTL3 AD-45877.1 94.17 93.21 96.39 96.70 96.98 7.12 8.00 4.58 3.05 6.15 ANGPTL3 AD-45878.1 66.46 85.75 89.73 94.60 96.59 8.20 7.41 5.27 3.21 3.91 ANGPTL3 AD-45878.1 70.80 89.30 92.54 96.60 95.09 5.18 2.13 1.61 0.50 4.15 ANGPTL3 AD-45879.1 8.29 48.25 73.54 87.47 92.19 4.66 20.05 16.04 9.06 7.90 ANGPTL3 AD-45886.1 23.69 60.65 78.49 93.41 94.15 8.19 13.90 7.15 3.35 4.06 ANGPTL3 AD-45887.1 7.24 26.03 57.68 95.99 98.80 3.07 13.10 14.94 1.40 2.54 ANGPTL3 AD-45915.1 10.38 58.38 85.69 97.24 99.76 6.83 15.66 8.39 1.33 4.15 ANGPTL3 AD-45929.1 11.73 36.67 51.90 76.71 85.08 4.80 14.19 15.34 12.37 10.60 ANGPTL3 AD-45934.1 73.57 88.48 92.94 91.50 95.97 5.36 2.96 5.50 5.44 4.39 (+) control AD-19200 63.58 90.14 95.44 94.65 93.28 34.11 14.32 8.78 10.90 12.13 (+) control AD-19200 16.05 78.65 85.78 93.09 96.22 9.77 15.57 19.50 13.34 10.96 (-)control AD-1955 93.52 97.36 97.90 99.65 100.07 5.02 1.78 0.84 0.58 1.14 (-)control AD-1955 75.39 93.61 97.79 99.60 100.96 8.37 2.50 2.27 2.68 3.16 (-)control imitation 100.00 1.32 (-)control imitation 100.00 3.35 (+) control PLK 3.68 55.22 63.00 89.39 95.33 1.42 30.96 33.97 15.85 8.54 (+) control PLK 2.69 3.74 9.74 67.07 82.96 0.15 0.96 3.60 22.70 19.34 Day 3 Hep3B Target Duplex Average 10 nM Average 1 nM Averaged 500 pM Average 100 pM Average 50 pM Standard deviation 10 nM Standard deviation 1 nM Standard deviation 500 pM Standard deviation 100 pM Standard deviation 50 pM ANGPTL3 AD-15838.2 35.33 61.00 68.79 82.74 90.41 2.41 6.21 4.21 2.61 7.07 ANGPTL3 AD-15838.2 35.34 61.04 72.14 89.71 106.88 1.49 2.61 7.37 6.48 7.13 ANGPTL3 AD-45860.1 17.79 39.25 60.57 94.28 99.85 1.07 3.51 3.57 13.09 16.41 ANGPTL3 AD-45864.1 80.35 88.19 87.01 89.39 92.09 6.93 6.98 9.42 7.41 17.05 ANGPTL3 AD-45870.1 75.00 93.30 96.64 106.29 99.08 7.10 12.24 4.01 5.95 9.64 ANGPTL3 AD-45873.1 42.68 78.45 82.26 97.11 96.58 5.17 5.04 8.31 12.11 11.33 ANGPTL3 AD-45876.1 31.37 55.00 70.69 93.49 91.00 4.39 6.09 5.47 15.11 6.38 ANGPTL3 AD-45877.1 74.45 94.60 96.70 103.77 106.75 3.27 2.44 3.45 6.10 7.40 ANGPTL3 AD-45878.1 50.22 69.65 80.49 92.77 97.37 2.51 14.94 10.44 8.21 5.30 ANGPTL3 AD-45878.1 44.85 65.39 75.67 92.83 109.67 10.10 7.76 8.56 7.78 4.97 ANGPTL3 AD-45879.1 23.73 60.81 84.59 95.72 108.68 6.43 21.36 19.62 13.69 5.95 ANGPTL3 AD-45886.1 27.19 55.35 64.97 100.18 102.09 0.97 6.65 11.46 6.91 4.08 ANGPTL3 AD-45887.1 41.70 97.18 101.91 111.27 105.18 9.26 6.81 7.36 1.72 2.23 ANGPTL3 AD-45915.1 45.10 66.31 82.22 97.97 103.30 6.91 11.84 14.79 6.54 2.48 ANGPTL3 AD-45929.1 48.58 79.14 89.96 95.00 101.37 10.40 10.29 10.52 18.24 10.53 ANGPTL3 AD-45934.1 80.15 102.93 112.82 114.16 113.98 5.28 0.62 4.19 0.75 3.99 (+) control AD-19200 14.79 55.23 72.90 89.64 94.30 2.17 5.42 7.19 10.28 16.39 (+) control AD-19200 22.76 92.02 101.56 106.68 113.09 6.61 18.99 7.41 9.83 10.64 (-)control AD-1955 77.77 81.25 82.23 88.21 95.02 2.83 5.40 5.08 5.42 6.63 (-)control AD-1955 80.42 86.70 90.23 93.46 97.04 10.53 5.70 8.14 3.27 3.45 (-)control imitation 100.00 5.77 (-)control imitation 100.00 9.79 (+) control PLK 10.91 12.89 14.31 23.87 50.93 0.17 0.87 1.64 1.13 7.80 (+) control PLK 13.19 16.12 22.89 55.03 94.35 0.78 0.88 8.36 18.88 9.85

Day 6 Hep3B Target Duplex Average 10 nM Average 1 nM Averaged 500 pM Average 100 pM Average 50 pM Standard deviation 10 nM Standard deviation 1 nM Standard deviation 500 pM Standard deviation 100 pM Standard deviation 50 pM ANGPTL3 AD-15838.2 78.88 89.58 93.08 91.10 100.66 11.60 9.15 12.04 10.51 5.87 ANGPTL3 AD-15838.2 81.17 85.91 87.27 103.95 103.59 7.75 3.29 8.07 7.93 9.82 ANGPTL3 AD-45860.1 84.11 87.77 93.22 99.15 96.75 14.22 13.36 20.98 13.15 17.62 ANGPTL3 AD-45864.1 99.27 111.82 106.28 99.15 97.55 7.77 16.31 14.24 15.40 9.18 ANGPTL3 AD-45870.1 95.49 109.60 104.16 104.65 106.76 11.92 12.98 9.25 10.29 19.12 ANGPTL3 AD-45873.1 71.45 90.62 93.44 102.07 107.72 4.71 4.40 15.02 11.96 10.16 ANGPTL3 AD-45876.1 76.92 82.09 89.44 95.27 105.41 9.39 13.55 7.93 9.77 10.42 ANGPTL3 AD-45877.1 82.98 98.05 95.07 103.55 104.14 11.22 13.45 1.27 8.88 6.49 ANGPTL3 AD-45878.1 75.14 82.48 89.68 92.71 95.72 8.65 10.07 10.77 12.44 15.04 ANGPTL3 AD-45878.1 65.90 77.37 78.33 84.54 99.49 10.21 13.22 9.95 11.65 11.17 ANGPTL3 AD-45879.1 86.42 89.45 101.50 97.30 100.66 10.59 10.12 19.77 13.19 9.54 ANGPTL3 AD-45886.1 91.15 79.31 80.76 86.52 94.04 12.89 11.88 5.38 4.92 6.80 ANGPTL3 AD-45887.1 91.67 103.38 107.88 100.05 102.05 10.80 14.84 19.18 13.72 18.00 ANGPTL3 AD-45915.1 81.97 85.91 91.81 94.95 102.13 18.49 19.30 7.19 12.72 16.64 ANGPTL3 AD-45929.1 61.92 79.39 87.28 88.09 96.00 6.80 10.76 5.80 10.68 16.66 ANGPTL3 AD-45934.1 85.84 89.66 97.67 99.91 102.54 12.39 14.25 4.74 9.51 4.28 (+) control AD-19200 50.48 65.62 79.67 98.61 96.87 4.60 4.64 7.20 5.08 7.37 (+) control AD-19200 52.01 75.89 92.59 101.47 99.66 4.35 20.87 13.57 6.50 11.76 (-)control AD-1955 91.77 95.87 93.06 95.10 97.52 8.87 3.46 1.46 2.00 3.84 (-)control AD-1955 93.65 94.41 89.42 100.59 103.91 9.91 14.90 6.80 11.99 10.31 (-)control imitation 100.00 5.10 (-)control imitation 100.00 7.35 (+) control PLK 36.43 37.75 40.19 55.25 64.59 3.44 2.75 3.65 5.33 5.02 (+) control PLK 38.70 43.68 50.32 75.17 89.62 3.40 3.85 8.10 10.54 10.69

Table 7
Unmodified sequences of sense and antisense strands of dsRNA ANGPTL3 conjugated to GalNac Duplex ID The name of the semantic chain Semantic sequence (SEQ ID NO:264-448, respectively, in order of appearance) Position in NM_014495.2 Name of the antisense strand Antisense sequence (SEQ ID NO:449-633, respectively, in order of appearance) Position in NM_014495.2 AD-53063.1 A-108558.1 AAAGACAACAAACAUUAUAUUx 1066-1086 A-108559.1 AAUAUAAUGUUUGUUGUCUUUCC 1064-1086 AD-52965.1 A-108310.1 ACAAUUAAGCUCCUUCUUUUUx 58-78 A-108311.1 AAAAAGAAGGAGCUUAAUUGUGA 56-78 AD-53030.1 A-108410.1 UGUCACUUGAACUCAACUCAAX 398-418 A-108411.1 UUGAGUUGAGUUCAAGUGACAUA 396-418 AD-52953.1 A-108306.1 UCACAAUUAAGCUCCUUCUUUx 56-76 A-108307.1 AAAGAAGGAGCUUAAUUGUGAAC 54-76 AD-53001.1 A-108416.1 CUUGAACUCAACUCAAAAACUUx 403-423 A-108417.1 AAGUUUUGAGUUGAGUUCAAGUG 401-423 AD-53080.1 A-108548.1 CUCCAUAGUGAAGCAAUCUAAx 1014-1034 A-108549.1 UUAGAUUGCUUCACUAUGGAGUA 1012-1034 AD-52971.1 A-108312.1 CAAUUAAGCUCCUUCUUUUUAx 59-79 A-108313.1 UAAAAAGAAGGAGCUUAAUUGUG 57-79 AD-53071.1 A-108498.1 ACCCAGCAACUCUCAAGUUUUx 840-860 A-108499.1 AAAACUUGAGAGUUGCUGGGUCU 838-860 AD-53024.1 A-108408.1 GAAUAUGUCACUUGAACUCAAx 393-413 A-108409.1 UUGAGUUCAAGUGACAUAUUCUU 391-413 AD-52977.1 A-108314.1 AAUUAAGCUCCUUCUUUUUAUx 60-80 A-108315.1 AUAAAAAGAAGGAGCUUAAUUGU 58-80 AD-53064.1 A-108574.1 CAUUAUAUUGAAUAUUCUUUUx 1078-1098 A-108575.1 AAAAGAAUAUUCAAUAUAAUGUU 1076-1098 AD-53033.1 A-108458.1 ACUAACUAACUUAAUUCAAAAx 483-503 A-108459.1 UUUUGAAUUAAGUUAGUUAGUUG 481-503 AD-52954.1 A-108322.1 UUAUUGUUCCUCUAGUUAUUUx 77-97 A-108323.1 AAAUAACUAGAGGAACAAUAAAA 75-97 AD-53098.1 A-108554.1 CAUAGUGAAGCAAUCUAAUUAx 1017-1037 A-108555.1 UAAUUAGAUUGCUUCACUAUGGA 1015-1037 AD-53092.1 A-108552.1 CCAUAGUGAAGCAAUCUAAUUx 1016-1036 A-108553.1 AAUUAGAUUGCUUCACUAUGGAG 1014-1036 AD-53073.1 A-108530.1 GAUCACAAAACUUCAAUGAAAx 923-943 A-108531.1 UUUCAUUGAAGUUUUGUGAUCCA 921-943 AD-53132.1 A-108628.1 AUGGAAGGUUAUACUCUAUAAx 1364-1384 A-108629.1 UUAUAGAGUAUAAACCUUCCAUUU 1362-1384 AD-53086.1 A-108550.1 UCCAUAGUGAAGCAAUCUAAUx 1015-1035 A-108551.1 AUUAGAUUGCUUCACUAUGGAGU 1013-1035 AD-52961.1 A-108340.1 CUAUGUUAGACGAUGUAAAAAX 164-184 A-108341.1 UUUUUACAUCGUCUAACAUAGCA 162-184 AD-52983.1 A-108316.1 AUUAAGCUCCUUCUUUUUAUUx 61-81 A-108317.1 AAUAAAAAGAAGGAGCUUAAUUG 59-81 AD-53027.1 A-108456.1 AACUAACUAACUUAAUUCAAAX 482-502 A-108457.1 UUUGAAUUAAGUUAGUUAGUUGC 480-502 AD-52986.1 A-108364.1 GGCCAAAUUAAUGACAUAUUUx 247-267 A-108365.1 AAAUAUGUCAUUAAUUUGCCCU 245-267 AD-52989.1 A-108318.1 UUUUAUUGUUCCUCUAGUUAUx 75-95 A-108319.1 AUAACUAGAGGAACAAUAAAAAG 73-95 AD-52981.1 A-108378.1 ACAUAUUUGAUCAGUCUUUUx 278-298 A-108379.1 AAAAAGACUGAUCAAAUAUGUUG 276-298 AD-53077.1 A-108500.1 CCCAGCAACUCUCAAGUUUUUx 841-861 A-108501.1 AAAAACUUGAGAGUUGCUGGGUC 839-861 AD-53095.1 A-108506.1 CAGGUAGUCCAUGGACAUUAAx 884-904 A-108507.1 UUAAUGUCCAUGGACUACCUGAU 882-904 AD-52970.1 A-108390.1 ACUGAGAAGAACUACAUAUAAx 345-365 A-108391.1 UUAUAUGUAGUUCUUCUCAGUUC 343-365 AD-53015.1 A-108452.1 GAGCAACUAACUAACUUAAUUx 478-498 A-108453.1 AAUUAGUUAGUUAGUUGCUCUU 476-498 AD-53147.1 A-108618.1 AACAACCUAAAUGGUAAAUAUx 1282-1302 A-108619.1 AUAUUUACCAUUUAGGUUGUUUU 1280-1302 AD-53103.1 A-108540.1 CCUAGAGAAGAUAUACUCCAUx 999-1019 A-108541.1 AUGGAGUAUAUCUUCUCUAGGCC 997-1019 AD-52969.1 A-108374.1 CAACAUAUUUGAUCAGUCUUUx 276-296 A-108375.1 AAAGACUGAUCAAAUAUGUUGAG 274-296 AD-53075.1 A-108562.1 ACAACAAACAUUAUAUUGAAUx 1070-1090 A-108563.1 AUUCAAUAUAAUGUUUGUUGUCU 1068-1090 AD-52994.1 A-108398.1 ACAUAUAAACUACAAGUCAAx 358-378 A-108399.1 UUUGACUUGUAGUUUAUAUGUAG 356-378 AD-52960.1 A-108324.1 CUAGUUAUUUCCUCKCAGAAUUx 88-108 A-108325.1 AAUUCUGGAGGAAAAUAACUAGAG 86-108 AD-53003.1 A-108448.1 AAGAGCAACUAACUAACUUAAx 476-496 A-108449.1 UUAAGUUAGUUAGUUGCUCUUCU 474-496 AD-52995.1 A-108320.1 UUUAUUGUUCCUCUAGUUAUUx 76-96 A-108321.1 AAUAACUAGAGGAACAAUAAAAA 74-96 AD-53037.1 A-108428.1 CUCCUAGAAGAAAAAAUUCUAx 430-450 A-108429.1 UAGAAUUUUUUCUUCUAGGAGGC 428-450 AD-53087.1 A-108566.1 AACAAACAUUAUAUUGAAUAUx 1072-1092 A-108567.1 AUAUUCAAUAUAAUGUUUGUUGU 1070-1092 AD-53076.1 A-108578.1 GGAAAUCACGAAACCAACUAUx 1105-1125 A-108579.1 AUAGUUGGUUUCGUGAUUUCCCA 1103-1125 AD-52975.1 A-108376.1 AACAUAUUUGAUCAGUCUUUUx 277-297 A-108377.1 AAAAGACUGAUCAAAUAUGUUGA 275-297 AD-53138.1 A-108630.1 UGGAAGGUUAUACUCUAUAAAAx 1365-1385 A-108631.1 UUUAUAGAGUAUAAACCUUCCAUU 1363-1385 AD-53091.1 A-108536.1 GGAGAACUACAAAUAUGGUUUx 948-968 A-108537.1 AAACCAUAUUUGUAGUUCUCCA 946-968 AD-53124.1 A-108594.1 GAAAACAAAGAUUUGGUGUUUx 1174-1194 A-108595.1 AAACACCAAAUCUUUGUUUUCCG 1172-1194 AD-53125.1 A-108610.1 AGUGUGGAGAAAACAACCUAAx 1271-1291 A-108611.1 UUAGGUUGUUUUCUCCACACUCA 1269-1291 AD-53036.1 A-108412.1 GUCACUUGAACUCAACUCAAAx 399-419 A-108413.1 UUUGAGUUGAGUUCAAGUGACAU 397-419 AD-53061.1 A-108526.1 GAUGGAUCACAAAACUUCAAUx 919-939 A-108527.1 AUUGAAGUUUUGUGAUCCAUCUA 917-939 AD-53093.1 A-108568.1 ACAAACAUUAUAUUGAAUAUUx 1073-1093 A-108569.1 AAUAUUCAAUAUAAUGUUUGUUG 1071-1093 AD-53137.1 A-108614.1 UGUGGAGAAAAACAACCUAAAUx 1273-1293 A-108615.1 AUUUAGGUUGUUUUCUCCACACU 1271-1293 AD-52999.1 A-108384.1 AUCAGUCUUUUUAUGAUCUAUx 287-307 A-108385.1 AUAGAUCAUAAAAAGACUGAUCA 285-307 AD-53069.1 A-108560.1 GACAACAAACAUUAUAUUGAAx 1069-1089 A-108561.1 UUCAAUAUAAUGUUUGUUGUCUU 1067-1089 AD-53034.1 A-108474.1 CAACAGCAUAGUCAAAUAAAAx 622-642 A-108475.1 UUUUAUUUGACUAUGCUGUUGGU 620-642 AD-52976.1 A-108392.1 CUGAGAAGAACUACAUAUAAAAx 346-366 A-108393.1 UUUAUAUGUAGUUCUUCUCAGUU 344-366 AD-52996.1 A-108336.1 UGCUAUGUUAGACGAUGUAAAX 162-182 A-108337.1 UUUACAUCGUCUAAACAUAGCAAA 160-182 AD-53029.1 A-108488.1 AACCCACAGAAAUUUCUCUAUx 680-700 A-108489.1 AUAGAGAAAUUUCUGUGGGUUCU 678-700 AD-53020.1 A-108438.1 CUUCAACAAAAAGUGAAAUAUx 451-471 A-108439.1 AUAUUUCACUUUUUGUUGAAGUA 449-471 AD-53042.1 A-108414.1 UCACUUGAACUCAACUCAAAAAx 400-420 A-108415.1 UUUUGAGUUGAGUUCAAGUGACA 398-420 AD-53011.1 A-108482.1 CAUAGUCAAAUAAAAGAAAUAx 628-648 A-108483.1 UAUUUCUUUUAUUUGACUAUGCU 626-648 AD-52957.1 A-108370.1 CAAAAACUCAACAUAUUUGAUx 268-288 A-108371.1 AUCAAAUAUGUUGAGUUUUUGAA 266-288 AD-53008.1 A-108434.1 UACUUCAACAAAAAGUGAAAUx 449-469 A-108435.1 AUUUCACUUUUUGUUGAAGUAGA 447-469 AD-53065.1 A-108496.1 GACCCAGCAACUCUCAAGUUUx 839-859 A-108497.1 AAACUUGAGAGUUGCUGGGUCUG 837-859 AD-53115.1 A-108638.1 UUGAAUGAACUGAGGCAAAUUx 1427-1447 A-108639.1 AAUUUGCCUCAGUUCAUUCAAAG 1425-1447 AD-53012.1 A-108404.1 UAUAAACUACAAGUCAAAAAUx 361-381 A-108405.1 AUUUUUGACUUGUAGUUUAUAUG 359-381 AD-53004.1 A-108464.1 AAACAAGAUAAUAGCAUCAAAx 559-579 A-108465.1 UUUGAUGCUAUUAUCUUGUUUUU 557-579 AD-53021.1 A-108454.1 CAACUAACUAACUUAAUUCAAx 481-501 A-108455.1 UUGAAUUAAGUUAGUUAGUUGCU 479-501 AD-52955.1 A-108338.1 GCUAUGUUAGACGAUGUAAAAx 163-183 A-108339.1 UUUUACAUCGUCUAACAUAGCAA 161-183 AD-53119.1 A-108608.1 ACUUGGGAUCACAAAGCAAAAAx 1198-1218 A-108609.1 UUUUGCUUUGUGAUCCCAAGUAG 1196-1218 AD-52990.1 A-108334.1 UUGCUAUGUUAGACGAUGUAAx 161-181 A-108335.1 UUACAUCGUCUAACAUAGCAAAU 159-181 AD-52964.1 A-108388.1 AACUGAGAAGAACUACAUAUAX 344-364 A-108389.1 UAUAUGUAGUUCUUCUCAGUUCC 342-364 AD-52973.1 A-108344.1 GAUGUAAAAAUUUUAGCCAAUx 175-195 A-108345.1 AUUGGCUAAAAUUUUUACAUCGU 173-195 AD-53074.1 A-108546.1 ACUCCAUAGUGAAGCAAUCUAX 1013-1033 A-108547.1 UAGAUUGCUUCACUAUGGAGUAU 1011-1033 AD-53026.1 A-108440.1 UUCAACAAAAAGUGAAAUAUUx 452-472 A-108441.1 AAUAUUUCACUUUUUGUUGAAGU 450-472 AD-53062.1 A-108542.1 CUAGAGAAGAUAUACUCCAUAx 1000-1020 A-108543.1 UAUGGAGUAUAUCUUCUCUAGGC 998-1020 AD-53114.1 A-108622.1 CAACCUAAAUGGUAAAUAUAAx 1284-1304 A-108623.1 UUAUAUUUACCAUUUAGGUUGUU 1282-1304 AD-53082.1 A-108580.1 GAAAUCACGAAACCAACUAUAx 1106-1126 A-108581.1 UAUAGUUGGUUUCGUGAUUUCCC 1104-1126 AD-53035.1 A-108490.1 CCACAGAAAUUUCUCUAUCUUx 683-703 A-108491.1 AAGAUAGAGAAAUUUCUGUGGGU 681-703 AD-52978.1 A-108330.1 AAAUCAAGAUUUGCUAUGUUAx 151-171 A-108331.1 UAACAUAGCAAAUCUUGAUUUUG 149-171 AD-53084.1 A-108518.1 ACAUUAAUUCAACAUCGAAUAX 898-918 A-108519.1 UAUUCGAUGUUGAAUUAAUGUCC 896-918 AD-52972.1 A-108328.1 CCAGAGCCAAAAUCAAGAUUUx 142-162 A-108329.1 AAAUCUUGAUUUUGGCUCUGGAG 140-162 AD-53002.1 A-108432.1 CUACUUCAACAAAAAGUGAAAx 448-468 A-108433.1 UUUCACUUUUUGUUGAAGUAGAA 446-468 AD-53078.1 A-108516.1 GACAUUAAUUCAACAUCGAAUx 897-917 A-108517.1 AUUCGAUGUUGAAUUAAUGUCCA 895-917 AD-53072.1 A-108514.1 GGACAUUAAUUCAACAUCGAAx 896-916 A-108515.1 UUCGAUGUUGAAUUAAUGUCCAU 894-916 AD-53005.1 A-108480.1 GCAUAGUCAAAUAAAAGAAAUx 627-647 A-108481.1 AUUUCUUUUAUUUGACUAUGCUG 625-647 AD-53083.1 A-108502.1 CUCUCAAGUUUUUCAUGUCUAX 849-869 A-108503.1 UAGACAUGAAAAACUUGAGAGUU 847-869 AD-53102.1 A-108524.1 AUCGAAUAGAUGGAUCCAAAx 911-931 A-108525.1 UUUGUGAUCCAUCAUUCGAUGU 909-931 AD-53105.1 A-108572.1 ACAUUAUAUUGAAUAUUCUUUx 1077-1097 A-108573.1 AAAGAAUAUUCAAUAUAAUGUUU 1075-1097 AD-53090.1 A-108520.1 UUAAUUCAACAUCGAAUAGAUx 901-921 A-108521.1 AUCUAUUCGAUGUUGAAUUAAUG 899-921 AD-53010.1 A-108466.1 GAUAAUAGCAUCAAAGACCUUx 565-585 A-108467.1 AAGGUCUUUGAUGCUAUUAUCUU 563-585 AD-52998.1 A-108368.1 UGACAAUAUUUCAAAAACUCAAx 258-278 A-108369.1 UUGAGUUUUUGAAAUAUAUGUCAUU 256-278 AD-52992.1 A-108366.1 AAAUUAAUGACAUAUUUCAAx 251-271 A-108367.1 UUUGAAAUAUGUCAUUAAUUUGG 249-271 AD-53068.1 A-108544.1 GAAGAUAUACUCCAUAGUGAAx 1005-1025 A-108545.1 UUCACCUAUGGAGUAUAUCUUCUCUC 1003-1025 AD-53032.1 A-108442.1 AAUAUUUAGAAGAGCAACUAAx 467-487 A-108443.1 UUAGUUGCUCUUCUAAAUAUUUC 465-487 AD-52967.1 A-108342.1 CGAUGUAAAAAUUUUAGCCAAx 174-194 A-108343.1 UUGGCUAAAAUUUUUACAUCGUC 172-194 AD-53096.1 A-108522.1 UUCAACAUCGAAUAGAUGGAUX 905-925 A-108523.1 AUCCAUCUAUUCGAUGUUGAAUU 903-925 AD-53131.1 A-108612.1 GUGUGGAGAAAACAACCUAAAx 1272-1292 A-108613.1 UUUAGGUUGUUUUCUCCCACUCUC 1270-1292 AD-52963.1 A-108372.1 UCAACAUAUUUGAUCAGUCUUx 275-295 A-108373.1 AAGACUGAUCAAAUAUGUUGAGU 273-295 AD-53089.1 A-108504.1 UCAGGUAGUCCAUGGACAUUAx 883-903 A-108505.1 UAAUGUCCAUGGACUACCUGAUA 881-903 AD-53044.1 A-108446.1 UUUAGAAGAGCAACUAACUAAx 471-491 A-108447.1 UUAGUUAGUUGCUCUUCUAAAUA 469-491 AD-52988.1 A-108396.1 UACAUAUAAACUACAAGUCAAx 357-377 A-108397.1 UUGACUUGUAGUUUAUAUGUAGU 355-377 AD-53067.1 A-108528.1 GGAUCACAAAACUUCAAUGAAX 922-942 A-108529.1 UUCAUUGAAGUUUUGUGAUCCAU 920-942 AD-53009.1 A-108450.1 AGAGCAACUAACUAACUUAAUx 477-497 A-108451.1 AUUAAGUUAGUUAGUUGCUCUUC 475-497 AD-53022.1 A-108470.1 ACCAACAGCAAUAGUCAAAUAAx 620-640 A-108471.1 UUAUUUGACUAUGCUGUUGGUUU 618-640 AD-53016.1 A-108468.1 AACCAACAGCAUAGUCAAAUAx 619-639 A-108469.1 UAUUUGACUAUGCUGUUGGUUUA 617-639 AD-53007.1 A-108418.1 GAACUCAACUCAAAACUUGAAx 406-426 A-108419.1 UUCAAGUUUUGAGUUGAGUUCAA 404-426 AD-53148.1 A-108634.1 UACUCUAUAAAAUCAACCAAAx 1375-1395 A-108635.1 UUUGGUUGAUUUUAUAGAGUUAUA 1373-1395 AD-53040.1 A-108476.1 CAGCAUAGUCAAAUAAAAGAAx 625-645 A-108477.1 UUCUUUUAUUUGACUAUGCUGUU 623-645 AD-53041.1 A-108492.1 GAAAUAAGAAAUGUAAAAACAUx 748-768 A-108493.1 AUGUUUUACAUUUCUUAUUUCAU 746-768 AD-53039.1 A-108460.1 CUAACUAACUUAAUUCAAAAAUx 484-504 A-108461.1 AUUUUGAAUUAAGUUAGUUAGUU 482-504 AD-53139.1 A-108646.1 AUGAACUGAGGCAAAUUUAAAx 1431-1451 A-108647.1 UUUAAAUUUGCCUCAGUUCAUUC 1429-1451 AD-53144.1 A-108648.1 UGAACUGAGGCAAAUUUAAAAx 1432-1452 A-108649.1 UUUUAAAUUUGCCUCAGUUCAUU 1430-1452 AD-53142.1 A-108616.1 AAACAACCUAAAUGGUAAAUAX 1281-1301 A-108617.1 UAUUUACCAUUUAGGUUGUUUUC 1279-1301 AD-53108.1 A-108620.1 ACAACCUAAAUGGUAAAUAUAX 1283-1303 A-108621.1 UAUAUUUACCAUUUAGGUUGUUU 1281-1303 AD-53079.1 A-108532.1 AACGUGGGAGAACUACAAAUAx 942-962 A-108533.1 UAUUUGUAGUUCUCCCACGUUUC 940-962 AD-53133.1 A-108644.1 AAUGAACUGAGGCAAAUUUAAx 1430-1450 A-108645.1 UUAAAUUUGCCUCAGUUCAUUCA 1428-1450 AD-53104.1 A-108556.1 GUUGGAAGACUGGAAAGACAAAx 1053-1073 A-108557.1 UUGUCUUUCCAGUCUUCCAACUC 1051-1073 AD-53088.1 A-108582.1 UGGCAAUGUCCCCCAAUGCAAUx 1149-1169 A-108583.1 AUUGCAUUGGGGACAUUGCCAGU 1147-1169 AD-53101.1 A-108508.1 GGUAGUCCAUGGACAUUAAUUx 886-906 A-108509.1 AAUUAAUGUCCAUGGACUACCUG 884-906 AD-53000.1 A-108400.1 CAUAUAAACUACAAGUCAAAAx 359-379 A-108401.1 UUUUGACUUGUAGUUUAUAUGUA 357-379 AD-53112.1 A-108590.1 AAUCCCGGAAAACAAAGAUUUx 1167-1187 A-108591.1 AAAUCUUUGUUUUCCGGGAUUGC 1165-1187 AD-53107.1 A-108604.1 CUACUUGGGAUCACAAAGCAAx 1196-1216 A-108605.1 UUGCUUUGUGAUCCCAAGUAGAA 1194-1216 AD-53121.1 A-108640.1 UGAAUGAACUGAGGCAAAUUUx 1428-1448 A-108641.1 AAAUUUGCCUCAGUUCAUUCAAAA 1426-1448 AD-53046.1 A-108478.1 AGCAUAGUCAAAUAAAAGAAAx 626-646 A-108479.1 UUUCUUUUAUUUGACUAUGCUGU 624-646 AD-53038.1 A-108444.1 AUUUAGAAGAGCAACUAACUAx 470-490 A-108445.1 UAGUUAGUUGCUCUUCUAAAUAU 468-490 AD-53140.1 A-108662.1 AGGCAAAUUUAAAAGGCAAUAx 1439-1459 A-108663.1 UAUUGCCUUUUAAAUUUGCCUCA 1437-1459 AD-52987.1 A-108380.1 CAUAUUUGAUCAGUCUUUUUAx 279-299 A-108381.1 UAAAAAGACUGAUCAAAUAUGUU 277-299 AD-53130.1 A-108596.1 AAAACAAAGAUUUGGUGUUUUx 1175-1195 A-108597.1 AAAACACCAAAUCUUUGUUUUCC 1173-1195 AD-53106.1 A-108588.1 CAAUCCCGGAAAACAAAGAUUx 1166-1186 A-108589.1 AAUCUUUGUUUUCCGGGAUUGCA 1164-1186 AD-53081.1 A-108564.1 CAACAAACAUUAUAUUGAAUAX 1071-1091 A-108565.1 UAUUCAAUAUAAUGUUUGUUGUC 1069-1091 AD-53118.1 A-108592.1 GGAAAACAAAGAUUUGGUGUUx 1173-1193 A-108593.1 AACACCAAAUCUUUGUUUUCCGG 1171-1193 AD-53136.1 A-108598.1 ACAAAGAUUUGGUGUUUUCUAx 1178-1198 A-108599.1 UAGAAAACACCAAAUCUUUGUUU 1176-1198 AD-53127.1 A-108642.1 GAAUGAACUGAGGCAAAUUUAx 1429-1449 A-108643.1 UAAAUUUGCCUCAGUUCAUUCAA 1427-1449 AD-53066.1 A-108512.1 CCAUGGACAUUAAUUCAACAUx 892-912 A-108513.1 AUGUUGAAUUAAUGUCCAUGGAC 890-912 AD-53013.1 A-108420.1 AACUCAACUCAAAACUUGAAAx 407-427 A-108421.1 UUUCAAGUUUUGAGUUGAGUUCA 405-427 AD-52991.1 A-108350.1 CAGUUGGGACAUGGUCUUAAAx 205-225 A-108351.1 UUUAAGACCAUGUCCCAACUGAA 203-225 AD-53099.1 A-108570.1 AACAUUAUAUUGAAUAUUCUUx 1076-1096 A-108571.1 AAGAAUAUUCAAUAUAAUGUUUG 1074-1096 AD-52958.1 A-108386.1 ACCAGUGAAAAUCAAAGAAGAAx 316-336 A-108387.1 UUCUUCUUUGAUUUCACUGGUUU 314-336 AD-53097.1 A-108538.1 GUUGGGCCUAGAGAAGAUAUAx 993-1013 A-108539.1 UAUAUCUUCUCUAGGCCCAACCA 991-1013 AD-52966.1 A-108326.1 CUCCAGAGCCAAAAUCAAGAUx 140-160 A-108327.1 AUCUUGAUUUUGGCUCUGGAGAU 138-160 AD-53145.1 A-108664.1 GGCAAAUUUAAAAGGCAAUAAx 1440-1460 A-108665.1 UUAUUGCCUUUUAAAUUUGCCUC 1438-1460 AD-53113.1 A-108606.1 UACUUGGGAUCACAAAGCAAAx 1197-1217 A-108607.1 UUUGCUUUGUGAUCCCAAGUAGA 1195-1217 AD-52993.1 A-108382.1 GAUCAGUCUUUUUAUGAUCUAx 286-306 A-108383.1 UAGAUCAUAAAAAGACUGAUCAA 284-306 AD-53031.1 A-108426.1 GAAAGCCUCCUAGAAGAAAAAx 424-444 A-108427.1 UUUUUCUUCUAGGAGGCUUUCAA 422-444 AD-53017.1 A-108484.1 AGUCAAAUAAAAGAAAUAGAAx 631-651 A-108485.1 UUCUAUUUCUUUUAUUUGACUAU 629-651 AD-53143.1 A-108632.1 AUACUCUAUAAAAUCAACCAAx 1374-1394 A-108633.1 UUGGUUGAUUUUAUAGAGUAUAA 1372-1394 AD-53149.1 A-108650.1 GAACUGAGGCAAAUUUAAAAAx 1433-1453 A-108651.1 UUUUUAAAUUUGCCUCAGUUCAU 1431-1453_G21A AD-53059.1 A-108494.1 AGACCCAGCAACUCUCAAGUUx 838-858 A-108495.1 AACUUGAGAGUUGCUGGGUCUGA 836-858 AD-53006.1 A-108402.1 AUAUAAACUACAAGUCAAAAAx 360-380 A-108403.1 UUUUUGACUUGUAGUUUAUAUGU 358-380 AD-53025.1 A-108424.1 UGAAAGCCUCCUAGAAGAAAAx 423-443 A-108425.1 UUUUCUUCUAGGAGGCUUUCAAG 421-443 AD-53085.1 A-108534.1 GGGAGAACUACAAAUAUGGUUx 947-967 A-108535.1 AACCAUAUUUGUAGUUCUCCCAC 945-967 AD-52984.1 A-108332.1 AGAUUUGCUAUGUUAGACGAUx 157-177 A-108333.1 AUCGUCUAACAUAGCAAAUCUUG 155-177 AD-53023.1 A-108486.1 GAACCCACAGAAAUUUUCUCUAx 679-699 A-108487.1 UAGAGAAAUUUCUGUGGGUUCUU 677-699 AD-53014.1 A-108436.1 ACUUCAACAAAAAGUGAAAUAx 450-470 A-108437.1 UAUUUCACUUUUUGUUGAGUAG 448-470 AD-53060.1 A-108510.1 AGUCCAUGGACAUUAAUUCAAx 889-909 A-108511.1 UUGAAUUAAUGUCCAUGGACUAC 887-909 AD-53110.1 A-108652.1 AACUGAGGCAAAUUUAAAAAGAx 1434-1454 A-108653.1 UCUUUUAAAUUUGCCUCAGUUCA 1432-1454_G21A AD-52980.1 A-108362.1 GGGCCAAAUUAAUGACAUAUUx 246-266 A-108363.1 AAUAUGUCAUUAAUUUGGCCCUU 244-266 AD-53109.1 A-108636.1 AUCCAUCCAACAGAUUCAGAAx 1402-1422 A-108637.1 UUCUGAAUCUGUUGGAUGGAUCA 1400-1422 AD-53141.1 A-108600.1 AAGAUUUGGUGUUUUCUACUUx 1181-1201 A-108601.1 AAGUAGAAAACACCAAAUCUUUG 1179-1201 AD-53126.1 A-108626.1 GUCUCAAAAUGGAAGGUUAUAx 1356-1376 A-108627.1 UAUAACCUUCCAUUUUGAGACUU 1354-1376 AD-53116.1 A-108654.1 ACUGAGGCAAAUUUAAAAGGAx 1435-1455 A-108655.1 UCCUUUUAAAUUUGCCUCAGUUC 1433-1455_C21A AD-52997.1 A-108352.1 GGGACAUGGUCUUAAAGACUUx 210-230 A-108353.1 AAGUCUUUAAGACCAUGUCCCAAA 208-230 AD-53120.1 A-108624.1 AUGGUAAAUAUAACAAACCAAx 1292-1312 A-108625.1 UUGGUUUGUUAUAUUUACCAUUU 1290-1312 AD-53070.1 A-108576.1 GGGAAAUCACGAAAACCAACUAx 1104-1124 A-108577.1 UAGUUGGUUUCGUGAUUUCCCAA 1102-1124 AD-53028.1 A-108472.1 CCAACAGCAUAGUCAAAUAAAx 621-641 A-108473.1 UUUAUUUGACUAUGCUGUUGGUU 619-641 AD-53146.1 A-108602.1 UUUUCUACUUGGGAUCCAAAx 1192-1212 A-108603.1 UUUGUGAUCCCAAGUAGAAAACA 1190-1212 AD-52982.1 A-108394.1 AGAACUACAUAUAAACUACAAx 352-372 A-108395.1 UUGUAGUUUAUAUGUAGUUCUUC 350-372 AD-53111.1 A-108668.1 AGAGUAUGUGUAAAAAUCUGUx 1915-1935 A-108669.1 ACAGAUUUUUACACAUACUCUGU 1913-1935 AD-53045.1 A-108462.1 AAAACAAGAUAAUAGCAUCAAx 558-578 A-108463.1 UUGAUGCUAUUAUCUUGUUUUUC 556-578 AD-53123.1 A-108672.1 AGUAUGUGUAAAAAUCUGUAAx 1917-1937 A-108673.1 UUACAGAUUUUUACACAUACUCU 1915-1937 AD-53018.1 A-108406.1 AGUCAAAAAUGAAGAGGUAAAAx 372-392 A-108407.1 UUUACCUCUUCAUUUUUGACUUG 370-392 AD-52956.1 A-108354.1 GGACAUGGUCUUAAAGACUUUx 211-231 A-108355.1 AAAGUCUUUAAGACCAUGUCCCA 209-231 AD-53134.1 A-108660.1 GAGGCAAAUUUAAAAGGCAAUx 1438-1458 A-108661.1 AUUGCCUUUUAAAUUUGCCUCAG 1436-1458 AD-52968.1 A-108358.1 GUCUUAAAGACUUUGUCCAUAX 218-238 A-108359.1 UAUGGACAAAGUCUUUAAGACCA 216-238 AD-53122.1 A-108656.1 CUGAGGCAAAUUUAAAAGGCAX 1436-1456 A-108657.1 UGCCUUUUAAAUUUGCCUCAGUU 1434-1456 AD-53100.1 A-108586.1 GCAAUCCCGGAAAACAAAGAUx 1165-1185 A-108587.1 AUCUUUGUUUUCCGGGAUUGCAU 1163-1185 AD-53128.1 A-108658.1 UGAGGCAAAUUUAAAAGGCAAx 1437-1457 A-108659.1 UUGCCUUUUAAAUUUGCCUCAGU 1435-1457 AD-53043.1 A-108430.1 UCUACUUCAACAAAAAGUGAAX 447-467 A-108431.1 UUCACUUUUUGUUGAAGUAGAAU 445-467 AD-53135.1 A-108676.1 UAUGUGUAAAAAUCUGUAAUAx 1919-1939 A-108677.1 UAUUACAGAUUUUUACACAUACU 1917-1939 AD-53094.1 A-108584.1 AAUGCAAUCCCGGAAAACAAAx 1162-1182 A-108585.1 UUUGUUUUCCGGGAUUGCAUUGG 1160-1182 AD-53019.1 A-108422.1 CUUGAAAGCCUCCUAGAAGAAx 421-441 A-108423.1 UUCUUCUAGGAGGCUUUCAAGUU 419-441 AD-53129.1 A-108674.1 GUAUGUGUAAAAAUCUGUAAAUx 1918-1938 A-108675.1 AUUACAGAUUUUUACACAUACUC 1916-1938 AD-53150.1 A-108666.1 CAGAGUAUGUGUAAAAAUCUUx 1914-1934 A-108667.1 AAGAUUUUUACACAUACUCUGUG 1912-1934_G21U AD-53117.1 A-108670.1 GAGUAUGUGUAAAAAUCUGUAX 1916-1936 A-108671.1 UACAGAUUUUUACACAUACUCUG 1914-1936 AD-52985.1 A-108348.1 UCAGUUGGGACAUGGUCUUAAx 204-224 A-108349.1 UUAAGACCAUGUCCCAACUGAAG 202-224 AD-52962.1 A-108356.1 GGUCUUAAAGACUUUGUCCAUx 217-237 A-108357.1 AUGGACAAAGUCUUUAAGACAU 215-237 AD-52974.1 A-108360.1 UCUUAAAGACUUUGUCCAUAAx 219-239 A-108361.1 UUAUGGACAAAGUCUUUAAGAC 217-239 AD-52979.1 A-108346.1 UUCAGUUGGGACAUGGUCUUAx 203-223 A-108347.1 UAAGACCAUGUCCCAACUGAAGG 201-223 The symbol "x" means that the sequence contains a GalNac conjugate.

Table 8
Modified sequences of sense and antisense strands of dsRNA ANGPTL3 conjugated to GalNac Duplex ID The name of the semantic oligo Semantic sequence (SEQ ID NO:634-818, respectively, in order of appearance) Name of antisense oligo Antisense sequence (SEQ ID NO:819-1003, respectively, in order of appearance) AD-53063.1 A-108558.1 AfaAfgAfcAfaCfAfAfaCfaUfuAfuAfuUfL96 A-108559.1 aAfuAfuAfaUfgUfuugUfuGfuCfuUfusCfsc AD-52965.1 A-108310.1 AfcAfaUfuAfaGfCfUfcCfuUfcUfuUfuUfL96 A-108311.1 aAfaAfaGfaAfgGfagcUfuAfaUfuGfusGfsa AD-53030.1 A-108410.1 UfgUfcAfcUfuGfAfAfcUfcAfaCfuCfaAfL96 A-108411.1 uUfgAfgUfuGfaGfuucAfaGfuGfaCfasUfsa AD-52953.1 A-108306.1 UfcAfcAfaUfuAfAfGfcUfcCfuUfcUfuUfL96 A-108307.1 aAfaGfaAfgGfaGfcuuAfaUfuGfuGfasAfsc AD-53001.1 A-108416.1 CfuUfgAfaCfuCfAfAfcUfcAfaAfaCfuUfL96 A-108417.1 aAfgUfuUfuGfaGfuugAfgUfuCfaAfgsUfsg AD-53080.1 A-108548.1 CfuCfcAfuAfgUfGfAfaGfcAfaUfcUfaAfL96 A-108549.1 uUfaGfaUfuGfcUfucaCfuAfuGfgAfgsUfsa AD-52971.1 A-108312.1 CfaAfuUfaAfgCfUfCfcUfuCfuUfuUfuAfL96 A-108313.1 uAfaAfaAfgAfaGfgagCfuUfaAfuUfgsUfsg AD-53071.1 A-108498.1 AfcCfcAfgCfaAfCfUfcUfcAfaGfuUfuUfL96 A-108499.1 aAfaAfcUfuGfaGfaguUfgCfuGfgGfusCfsu AD-53024.1 A-108408.1 GfaAfuAfuGfuCfAfCfuUfgAfaCfuCfaAfL96 A-108409.1 uUfgAfgUfuCfaAfgugAfcAfuAfuUfcsUfsu AD-52977.1 A-108314.1 AfaUfuAfaGfcUfCfCfuUfcUfuUfuUfaUfL96 A-108315.1 aUfaAfaAfaGfaAfggaGfcUfuAfaUfusGfsu AD-53064.1 A-108574.1 CfaUfuAfuAfuUfGfAfaUfaUfuCfuUfuUfL96 A-108575.1 aAfaAfgAfaUfaUfucaAfuAfuAfaUfgsUfsu AD-53033.1 A-108458.1 AfcUfaAfcUfaAfCfUfuAfaUfuCfaAfaAfL96 A-108459.1 uUfuUfgAfaUfuAfaguUfaGfuUfaGfusUfsg AD-52954.1 A-108322.1 UfuAfuUfgUfuCfCfUfcUfaGfuUfaUfuUfL96 A-108323.1 aAfaUfaAfcUfaGfaggAfaCfaAfuAfasAfsa AD-53098.1 A-108554.1 CfaUfaGfuGfaAfGfCfaAfuCfuAfaUfuAfL96 A-108555.1 uAfaUfuAfgAfuUfgcuUfcAfcUfaUfgsGfsa AD-53092.1 A-108552.1 CfcAfuAfgUfgAfAfGfcAfaUfcUfaAfuUfL96 A-108553.1 aAfuUfaGfaUfuGfcuuCfaCfuAfuGfgsAfsg AD-53073.1 A-108530.1 GfaUfcAfcAfaAfAfCfuUfcAfaUfgAfaAfL96 A-108531.1 uUfuCfaUfuGfaAfguuUfuGfuGfaUfcsCfsa AD-53132.1 A-108628.1 AfuGfgAfaGfgUfUfAfuAfcUfcUfaUfaAfL96 A-108629.1 uUfaUfaGfaGfuAfuaaCfcUfuCfcAfusUfsu AD-53086.1 A-108550.1 UfcCfaUfaGfuGfAfAfgCfaAfuCfuAfaUfL96 A-108551.1 aUfuAfgAfuUfgCfuucAfcUfaUfgGfasGfsu AD-52961.1 A-108340.1 CfuAfuGfuUfaGfAfCfgAfuGfuAfaAfaAfL96 A-108341.1 uUfuUfuAfcAfuCfgucUfaAfcAfuAfgsCfsa AD-52983.1 A-108316.1 AfuUfaAfgCfuCfCfUfuCfuUfuUfuAfuUfL96 A-108317.1 aAfuAfaAfaAfgAfaggAfgCfuUfaAfusUfsg AD-53027.1 A-108456.1 AfaCfuAfaCfuAfAfCfuUfaAfuUfcAfaAfL96 A-108457.1 uUfuGfaAfuUfaAfguuAfgUfuAfgUfusGfsc AD-52986.1 A-108364.1 GfgCfcAfaAfuUfAfAfuGfaCfaUfaUfuUfL96 A-108365.1 aAfaUfaUfgUfcAfuuaAfuUfuGfgCfcsCfsu AD-52989.1 A-108318.1 UfuUfuAfuUfgUfUfCfcUfcUfaGfuUfaUfL96 A-108319.1 aUfaAfcUfaGfaGfgaaCfaAfuAfaAfasAfsg AD-52981.1 A-108378.1 AfcAfuAfuUfuGfAfUfcAfgUfcUfuUfuUfL96 A-108379.1 aAfaAfaGfaCfuGfaucAfaAfuAfuGfusUfsg AD-53077.1 A-108500.1 CfcCfaGfcAfaCfUfCfuCfaAfgUfuUfuUfL96 A-108501.1 aAfaAfaCfuUfgAfgagUfuGfcUfgGfgsUfsc AD-53095.1 A-108506.1 CfaGfgUfaGfuCfCfAfuGfgAfcAfuUfaAfL96 A-108507.1 uUfaAfuGfuCfcAfuggAfcUfaCfcUfgsAfsu AD-52970.1 A-108390.1 AfcUfgAfgAfaGfAfAfcUfaCfaUfaUfaAfL96 A-108391.1 uUfaUfaUfgUfaGfuucUfuCfuCfaGfusUfsc AD-53015.1 A-108452.1 GfaGfcAfaCfuAfAfCfuAfaCfuUfaAfuUfL96 A-108453.1 aAfuUfaAfgUfuAfguuAfgUfuGfcUfcsUfsu AD-53147.1 A-108618.1 AfaCfaAfcCfuAfAfAfuGfgUfaAfaUfaUfL96 A-108619.1 aUfaUfuUfaCfcAfuuuAfgGfuUfgUfusUfsu AD-53103.1 A-108540.1 CfcUfaGfaGfaAfGfAfuAfuAfcUfcCfaUfL96 A-108541.1 aUfgGfaGfuAfuAfucuUfcUfcUfaGfgsCfsc AD-52969.1 A-108374.1 CfaAfcAfuAfuUfUfGfaUfcAfgUfcUfuUfL96 A-108375.1 aAfaGfaCfuGfaUfcaaAfuAfuGfuUfgsAfsg AD-53075.1 A-108562.1 AfcAfaCfaAfaCfAfUfuAfuAfuUfgAfaUfL96 A-108563.1 aUfuCfaAfuAfuAfaugUfuUfgUfuGfusCfsu AD-52994.1 A-108398.1 AfcAfuAfuAfaAfCfUfaCfaAfgUfcAfaAfL96 A-108399.1 uUfuGfaCfuUfgUfaguUfuAfuAfuGfusAfsg AD-52960.1 A-108324.1 CfuAfgUfuAfuUfUfCfcUfcCfaGfaAfuUfL96 A-108325.1 aAfuUfcUfgGfaGfgaaAfuAfaCfuAfgsAfsg AD-53003.1 A-108448.1 AfaGfaGfcAfaCfUfAfaCfuAfaCfuUfaAfL96 A-108449.1 uUfaAfgUfuAfgUfuagUfuGfcUfcUfusCfsu AD-52995.1 A-108320.1 UfuUfaUfuGfuUfCfCfuCfuAfgUfuAfuUfL96 A-108321.1 aAfuAfaCfuAfgAfggaAfcAfaUfaAfasAfsa AD-53037.1 A-108428.1 CfuCfcUfaGfaAfGfAfaAfaAfaUfuCfuAfL96 A-108429.1 uAfgAfaUfuUfuUfucuUfcUfaGfgAfgsGfsc AD-53087.1 A-108566.1 AfaCfaAfaCfaUfUfAfuAfuUfgAfaUfaUfL96 A-108567.1 aUfaUfuCfaAfuAfuaaUfgUfuUfgUfusGfsu AD-53076.1 A-108578.1 GfgAfaAfuCfaCfGfAfaAfcCfaAfcUfaUfL96 A-108579.1 aUfaGfuUfgGfuUfucgUfgAfuUfuCfcsCfsa AD-52975.1 A-108376.1 AfaCfaUfaUfuUfGfAfuCfaGfuCfuUfuUfL96 A-108377.1 aAfaAfgAfcUfgAfucaAfaUfaUfgUfusGfsa AD-53138.1 A-108630.1 UfgGfaAfgGfuUfAfUfaCfuCfuAfuAfaAfL96 A-108631.1 uUfuAfuAfgAfgUfauaAfcCfuUfcCfasUfsu AD-53091.1 A-108536.1 GfgAfgAfaCfuAfCfAfaAfuAfuGfgUfuUfL96 A-108537.1 aAfaCfcAfuAfuUfuguAfgUfuCfuCfcsCfsa AD-53124.1 A-108594.1 GfaAfaAfcAfaAfGfAfuUfuGfgUfgUfuUfL96 A-108595.1 aAfaCfaCfcAfaAfucuUfuGfuUfuUfcsCfsg AD-53125.1 A-108610.1 AfgUfgUfgGfaGfAfAfaAfcAfaCfcUfaAfL96 A-108611.1 uUfaGfgUfuGfuUfuucUfcCfaCfaCfusCfsa AD-53036.1 A-108412.1 GfuCfaCfuUfgAfAfCfuCfaAfcUfcAfaAfL96 A-108413.1 uUfuGfaGfuUfgAfguuCfaAfgUfgAfcsAfsu AD-53061.1 A-108526.1 GfaUfgGfaUfcAfCfAfaAfaCfuUfcAfaUfL96 A-108527.1 aUfuGfaAfgUfuUfuguGfaUfcCfaUfcsUfsa AD-53093.1 A-108568.1 AfcAfaAfcAfuUfAfUfaUfuGfaAfuAfuUfL96 A-108569.1 aAfuAfuUfcAfaUfauaAfuGfuUfuGfusUfsg AD-53137.1 A-108614.1 UfgUfgGfaGfaAfAfAfcAfaCfcUfaAfaUfL96 A-108615.1 aUfuUfaGfgUfuGfuuuUfcUfcCfaCfasCfsu AD-52999.1 A-108384.1 AfuCfaGfuCfuUfUfUfuAfuGfaUfcUfaUfL96 A-108385.1 aUfaGfaUfcAfuAfaaaAfgAfcUfgAfusCfsa AD-53069.1 A-108560.1 GfaCfaAfcAfaAfCfAfuUfaUfaUfuGfaAfL96 A-108561.1 uUfcAfaUfaUfaAfuguUfuGfuUfgUfcsUfsu AD-53034.1 A-108474.1 CfaAfcAfgCfaUfAfGfuCfaAfaUfaAfaAfL96 A-108475.1 uUfuUfaUfuUfgAfcuaUfgCfuGfuUfgsGfsu AD-52976.1 A-108392.1 CfuGfaGfaAfgAfAfCfuAfcAfuAfuAfaAfL96 A-108393.1 uUfuAfuAfuGfuAfguuCfuUfcUfcAfgsUfsu AD-52996.1 A-108336.1 UfgCfuAfuGfuUfAfGfaCfgAfuGfuAfaAfL96 A-108337.1 uUfuAfcAfuCfgUfcuaAfcAfuAfgCfasAfsa AD-53029.1 A-108488.1 AfaCfcCfaCfaGfAfAfaUfuUfcUfcUfaUfL96 A-108489.1 aUfaGfaGfaAfaUfuucUfgUfgGfgUfusCfsu AD-53020.1 A-108438.1 CfuUfcAfaCfaAfAfAfaGfuGfaAfaUfaUfL96 A-108439.1 aUfaUfuUfcAfcUfuuuUfgUfuGfaAfgsUfsa AD-53042.1 A-108414.1 UfcAfcUfuGfaAfCfUfcAfaCfuCfaAfaAfL96 A-108415.1 uUfuUfgAfgUfuGfaguUfcAfaGfuGfasCfsa AD-53011.1 A-108482.1 CfaUfaGfuCfaAfAfUfaAfaAfgAfaAfuAfL96 A-108483.1 uAfuUfuCfuUfuUfauuUfgAfcUfaUfgsCfsu AD-52957.1 A-108370.1 CfaAfaAfaCfuCfAfAfcAfuAfuUfuGfaUfL96 A-108371.1 aUfcAfaAfuAfuGfuugAfgUfuUfuUfgsAfsa AD-53008.1 A-108434.1 UfaCfuUfcAfaCfAfAfaAfaGfuGfaAfaUfL96 A-108435.1 aUfuUfcAfcUfuUfuugUfuGfaAfgUfasGfsa AD-53065.1 A-108496.1 GfaCfcCfaGfcAfAfCfuCfuCfaAfgUfuUfL96 A-108497.1 aAfaCfuUfgAfgAfguuGfcUfgGfgUfcsUfsg AD-53115.1 A-108638.1 UfuGfaAfuGfaAfCfUfgAfgGfcAfaAfuUfL96 A-108639.1 aAfuUfuGfcCfuCfaguUfcAfuUfcAfasAfsg AD-53012.1 A-108404.1 UfaUfaAfaCfuAfCfAfaGfuCfaAfaAfaUfL96 A-108405.1 aUfuUfuUfgAfcUfuguAfgUfuUfaUfasUfsg AD-53004.1 A-108464.1 AfaAfcAfaGfaUfAfAfuAfgCfaUfcAfaAfL96 A-108465.1 uUfuGfaUfgCfuAfuuaUfcUfuGfuUfusUfsu AD-53021.1 A-108454.1 CfaAfcUfaAfcUfAfAfcUfuAfaUfuCfaAfL96 A-108455.1 uUfgAfaUfuAfaGfuuaGfuUfaGfuUfgsCfsu AD-52955.1 A-108338.1 GfcUfaUfgUfuAfGfAfcGfaUfgUfaAfaAfL96 A-108339.1 uUfuUfaCfaUfcGfucuAfaCfaUfaGfcsAfsa AD-53119.1 A-108608.1 AfcUfuGfgGfaUfCfAfcAfaAfgCfaAfaAfL96 A-108609.1 uUfuUfgCfuUfuGfugaUfcCfcAfaGfusAfsg AD-52990.1 A-108334.1 UfuGfcUfaUfgUfUfAfgAfcGfaUfgUfaAfL96 A-108335.1 uUfaCfaUfcGfuCfuaaCfaUfaGfcAfasAfsu AD-52964.1 A-108388.1 AfaCfuGfaGfaAfGfAfaCfuAfcAfuAfuAfL96 A-108389.1 uAfuAfuGfuAfgUfucuUfcUfcAfgUfusCfsc AD-52973.1 A-108344.1 GfaUfgUfaAfaAfAfUfuUfuAfgCfcAfaUfL96 A-108345.1 aUfuGfgCfuAfaAfauuUfuUfaCfaUfcsGfsu AD-53074.1 A-108546.1 AfcUfcCfaUfaGfUfGfaAfgCfaAfuCfuAfL96 A-108547.1 uAfgAfuUfgCfuUfcacUfaUfgGfaGfusAfsu AD-53026.1 A-108440.1 UfuCfaAfcAfaAfAfAfgUfgAfaAfuAfuUfL96 A-108441.1 aAfuAfuUfuCfaCfuuuUfuGfuUfgAfasGfsu AD-53062.1 A-108542.1 CfuAfgAfgAfaGfAfUfaUfaCfuCfcAfuAfL96 A-108543.1 uAfuGfgAfgUfaUfaucUfuCfuCfuAfgsGfsc AD-53114.1 A-108622.1 CfaAfcCfuAfaAfUfGfgUfaAfaUfaUfaAfL96 A-108623.1 uUfaUfaUfuUfaCfcauUfuAfgGfuUfgsUfsu AD-53082.1 A-108580.1 GfaAfaUfcAfcGfAfAfaCfcAfaCfuAfuAfL96 A-108581.1 uAfuAfgUfuGfgUfuucGfuGfaUfuUfcsCfsc AD-53035.1 A-108490.1 CfcAfcAfgAfaAfUfUfuCfuCfuAfuCfuUfL96 A-108491.1 aAfgAfuAfgAfgAfaauUfuCfuGfuGfgsGfsu AD-52978.1 A-108330.1 AfaAfuCfaAfgAfUfUfuGfcUfaUfgUfuAfL96 A-108331.1 uAfaCfaUfaGfcAfaauCfuUfgAfuUfusUfsg AD-53084.1 A-108518.1 AfcAfuUfaAfuUfCfAfaCfaUfcGfaAfuAfL96 A-108519.1 uAfuUfcGfaUfgUfugaAfuUfaAfuGfusCfsc AD-52972.1 A-108328.1 CfcAfgAfgCfcAfAfAfaUfcAfaGfaUfuUfL96 A-108329.1 aAfaUfcUfuGfaUfuuuGfgCfuCfuGfgsAfsg AD-53002.1 A-108432.1 CfuAfcUfuCfaAfCfAfaAfaAfgUfgAfaAfL96 A-108433.1 uUfuCfaCfuUfuUfuguUfgAfaGfuAfgsAfsa AD-53078.1 A-108516.1 GfaCfaUfuAfaUfUfCfaAfcAfuCfgAfaUfL96 A-108517.1 aUfuCfgAfuGfuUfgaaUfuAfaUfgUfcsCfsa AD-53072.1 A-108514.1 GfgAfcAfuUfaAfUfUfcAfaCfaUfcGfaAfL96 A-108515.1 uUfcGfaUfgUfuGfaauUfaAfuGfuCfcsAfsu AD-53005.1 A-108480.1 GfcAfuAfgUfcAfAfAfuAfaAfaGfaAfaUfL96 A-108481.1 aUfuUfcUfuUfuAfuuuGfaCfuAfuGfcsUfsg AD-53083.1 A-108502.1 CfuCfuCfaAfgUfUfUfuUfcAfuGfuCfuAfL96 A-108503.1 uAfgAfcAfuGfaAfaaaCfuUfgAfgAfgsUfsu AD-53102.1 A-108524.1 AfuCfgAfaUfaGfAfUfgGfaUfcAfcAfaAfL96 A-108525.1 uUfuGfuGfaUfcCfaucUfaUfuCfgAfusGfsu AD-53105.1 A-108572.1 AfcAfuUfaUfaUfUfGfaAfuAfuUfcUfuUfL96 A-108573.1 aAfaGfaAfuAfuUfcaaUfaUfaAfuGfusUfsu AD-53090.1 A-108520.1 UfuAfaUfuCfaAfCfAfuCfgAfaUfaGfaUfL96 A-108521.1 aUfcUfaUfuCfgAfuguUfgAfaUfuAfasUfsg AD-53010.1 A-108466.1 GfaUfaAfuAfgCfAfUfcAfaAfgAfcCfuUfL96 A-108467.1 aAfgGfuCfuUfuGfaugCfuAfuUfaUfcsUfsu AD-52998.1 A-108368.1 UfgAfcAfuAfuUfUfCfaAfaAfaCfuCfaAfL96 A-108369.1 uUfgAfgUfuUfuUfgaaAfuAfuGfuCfasUfsu AD-52992.1 A-108366.1 AfaAfuUfaAfuGfAfCfaUfaUfuUfcAfaAfL96 A-108367.1 uUfuGfaAfaUfaUfgucAfuUfaAfuUfusGfsg AD-53068.1 A-108544.1 GfaAfgAfuAfuAfCfUfcCfaUfaGfuGfaAfL96 A-108545.1 uUfcAfcUfaUfgGfaguAfuAfuCfuUfcsUfsc AD-53032.1 A-108442.1 AfaUfaUfuUfaGfAfAfgAfgCfaAfcUfaAfL96 A-108443.1 uUfaGfuUfgCfuCfuucUfaAfaUfaUfusUfsc AD-52967.1 A-108342.1 CfgAfuGfuAfaAfAfAfuUfuUfaGfcCfaAfL96 A-108343.1 uUfgGfcUfaAfaAfuuuUfuAfcAfuCfgsUfsc AD-53096.1 A-108522.1 UfuCfaAfcAfuCfGfAfaUfaGfaUfgGfaUfL96 A-108523.1 aUfcCfaUfcUfaUfucgAfuGfuUfgAfasUfsu AD-53131.1 A-108612.1 GfuGfuGfgAfgAfAfAfaCfaAfcCfuAfaAfL96 A-108613.1 uUfuAfgGfuUfgUfuuuCfuCfcAfcAfcsUfsc AD-52963.1 A-108372.1 UfcAfaCfaUfaUfUfUfgAfuCfaGfuCfuUfL96 A-108373.1 aAfgAfcUfgAfuCfaaaUfaUfgUfuGfasGfsu AD-53089.1 A-108504.1 UfcAfgGfuAfgUfCfCfaUfgGfaCfaUfuAfL96 A-108505.1 uAfaUfgUfcCfaUfggaCfuAfcCfuGfasUfsa AD-53044.1 A-108446.1 UfuUfaGfaAfgAfGfCfaAfcUfaAfcUfaAfL96 A-108447.1 uUfaGfuUfaGfuUfgcuCfuUfcUfaAfasUfsa AD-52988.1 A-108396.1 UfaCfaUfaUfaAfAfCfuAfcAfaGfuCfaAfL96 A-108397.1 uUfgAfcUfuGfuAfguuUfaUfaUfgUfasGfsu AD-53067.1 A-108528.1 GfgAfuCfaCfaAfAfAfcUfuCfaAfuGfaAfL96 A-108529.1 uUfcAfuUfgAfaGfuuuUfgUfgAfuCfcsAfsu AD-53009.1 A-108450.1 AfgAfgCfaAfcUfAfAfcUfaAfcUfuAfaUfL96 A-108451.1 aUfuAfaGfuUfaGfuuaGfuUfgCfuCfusUfsc AD-53022.1 A-108470.1 AfcCfaAfcAfgCfAfUfaGfuCfaAfaUfaAfL96 A-108471.1 uUfaUfuUfgAfcUfaugCfuGfuUfgGfusUfsu AD-53016.1 A-108468.1 AfaCfcAfaCfaGfCfAfuAfgUfcAfaAfuAfL96 A-108469.1 uAfuUfuGfaCfuAfugcUfgUfuGfgUfusUfsa AD-53007.1 A-108418.1 GfaAfcUfcAfaCfUfCfaAfaAfcUfuGfaAfL96 A-108419.1 uUfcAfaGfuUfuUfgagUfuGfaGfuUfcsAfsa AD-53148.1 A-108634.1 UfaCfuCfuAfuAfAfAfaUfcAfaCfcAfaAfL96 A-108635.1 uUfuGfgUfuGfaUfuuuAfuAfgAfgUfasUfsa AD-53040.1 A-108476.1 CfaGfcAfuAfgUfCfAfaAfuAfaAfaGfaAfL96 A-108477.1 uUfcUfuUfuAfuUfugaCfuAfuGfcUfgsUfsu AD-53041.1 A-108492.1 GfaAfaUfaAfgAfAfAfuGfuAfaAfaCfaUfL96 A-108493.1 aUfgUfuUfuAfcAfuuuCfuUfaUfuUfcsAfsu AD-53039.1 A-108460.1 CfuAfaCfuAfaCfUfUfaAfuUfcAfaAfaUfL96 A-108461.1 aUfuUfuGfaAfuUfaagUfuAfgUfuAfgsUfsu AD-53139.1 A-108646.1 AfuGfaAfcUfgAfGfGfcAfaAfuUfuAfaAfL96 A-108647.1 uUfuAfaAfuUfuGfccuCfaGfuUfcAfusUfsc AD-53144.1 A-108648.1 UfgAfaCfuGfaGfGfCfaAfaUfuUfaAfaAfL96 A-108649.1 uUfuUfaAfaUfuUfgccUfcAfgUfuCfasUfsu AD-53142.1 A-108616.1 AfaAfcAfaCfcUfAfAfaUfgGfuAfaAfuAfL96 A-108617.1 uAfuUfuAfcCfaUfuuaGfgUfuGfuUfusUfsc AD-53108.1 A-108620.1 AfcAfaCfcUfaAfAfUfgGfuAfaAfuAfuAfL96 A-108621.1 uAfuAfuUfuAfcCfauuUfaGfgUfuGfusUfsu AD-53079.1 A-108532.1 AfaCfgUfgGfgAfGfAfaCfuAfcAfaAfuAfL96 A-108533.1 uAfuUfuGfuAfgUfucuCfcCfaCfgUfusUfsc AD-53133.1 A-108644.1 AfaUfgAfaCfuGfAfGfgCfaAfaUfuUfaAfL96 A-108645.1 uUfaAfaUfuUfgCfcucAfgUfuCfaUfusCfsa AD-53104.1 A-108556.1 GfuUfgGfaAfgAfCfUfgGfaAfaGfaCfaAfL96 A-108557.1 uUfgUfcUfuUfcCfaguCfuUfcCfaAfcsUfsc AD-53088.1 A-108582.1 UfgGfcAfaUfgUfCfCfcCfaAfuGfcAfaUfL96 A-108583.1 aUfuGfcAfuUfgGfggaCfaUfuGfcCfasGfsu AD-53101.1 A-108508.1 GfgUfaGfuCfcAfUfGfgAfcAfuUfaAfuUfL96 A-108509.1 aAfuUfaAfuGfuCfcauGfgAfcUfaCfcsUfsg AD-53000.1 A-108400.1 CfaUfaUfaAfaCfUfAfcAfaGfuCfaAfaAfL96 A-108401.1 uUfuUfgAfcUfuGfuagUfuUfaUfaUfgsUfsa AD-53112.1 A-108590.1 AfaUfcCfcGfgAfAfAfaCfaAfaGfaUfuUfL96 A-108591.1 aAfaUfcUfuUfgUfuuuCfcGfgGfaUfusGfsc AD-53107.1 A-108604.1 CfuAfcUfuGfgGfAfUfcAfcAfaAfgCfaAfL96 A-108605.1 uUfgCfuUfuGfuGfaucCfcAfaGfuAfgsAfsa AD-53121.1 A-108640.1 UfgAfaUfgAfaCfUfGfaGfgCfaAfaUfuUfL96 A-108641.1 aAfaUfuUfgCfcUfcagUfuCfaUfuCfasAfsa AD-53046.1 A-108478.1 AfgCfaUfaGfuCfAfAfaUfaAfaAfgAfaAfL96 A-108479.1 uUfuCfuUfuUfaUfuugAfcUfaUfgCfusGfsu AD-53038.1 A-108444.1 AfuUfuAfgAfaGfAfGfcAfaCfuAfaCfuAfL96 A-108445.1 uAfgUfuAfgUfuGfcucUfuCfuAfaAfusAfsu AD-53140.1 A-108662.1 AfgGfcAfaAfuUfUfAfaAfaGfgCfaAfuAfL96 A-108663.1 uAfuUfgCfcUfuUfuaaAfuUfuGfcCfusCfsa AD-52987.1 A-108380.1 CfaUfaUfuUfgAfUfCfaGfuCfuUfuUfuAfL96 A-108381.1 uAfaAfaAfgAfcUfgauCfaAfaUfaUfgsUfsu AD-53130.1 A-108596.1 AfaAfaCfaAfaGfAfUfuUfgGfuGfuUfuUfL96 A-108597.1 aAfaAfcAfcCfaAfaucUfuUfgUfuUfusCfsc AD-53106.1 A-108588.1 CfaAfuCfcCfgGfAfAfaAfcAfaAfgAfuUfL96 A-108589.1 aAfuCfuUfuGfuUfuucCfgGfgAfuUfgsCfsa AD-53081.1 A-108564.1 CfaAfcAfaAfcAfUfUfaUfaUfuGfaAfuAfL96 A-108565.1 uAfuUfcAfaUfaUfaauGfuUfuGfuUfgsUfsc AD-53118.1 A-108592.1 GfgAfaAfaCfaAfAfGfaUfuUfgGfuGfuUfL96 A-108593.1 aAfcAfcCfaAfaUfcuuUfgUfuUfuCfcsGfsg AD-53136.1 A-108598.1 AfcAfaAfgAfuUfUfGfgUfgUfuUfuCfuAfL96 A-108599.1 uAfgAfaAfaCfaCfcaaAfuCfuUfuGfusUfsu AD-53127.1 A-108642.1 GfaAfuGfaAfcUfGfAfgGfcAfaAfuUfuAfL96 A-108643.1 uAfaAfuUfuGfcCfucaGfuUfcAfuUfcsAfsa AD-53066.1 A-108512.1 CfcAfuGfgAfcAfUfUfaAfuUfcAfaCfaUfL96 A-108513.1 aUfgUfuGfaAfuUfaauGfuCfcAfuGfgsAfsc AD-53013.1 A-108420.1 AfaCfuCfaAfcUfCfAfaAfaCfuUfgAfaAfL96 A-108421.1 uUfuCfaAfgUfuUfugaGfuUfgAfgUfusCfsa AD-52991.1 A-108350.1 CfaGfuUfgGfgAfCfAfuGfgUfcUfuAfaAfL96 A-108351.1 uUfuAfaGfaCfcAfuguCfcCfaAfcUfgsAfsa AD-53099.1 A-108570.1 AfaCfaUfuAfuAfUfUfgAfaUfaUfuCfuUfL96 A-108571.1 aAfgAfaUfaUfuCfaauAfuAfaUfgUfusUfsg AD-52958.1 A-108386.1 AfcCfaGfuGfaAfAfUfcAfaAfgAfaGfaAfL96 A-108387.1 uUfcUfuCfuUfuGfauuUfcAfcUfgGfusUfsu AD-53097.1 A-108538.1 GfuUfgGfgCfcUfAfGfaGfaAfgAfuAfuAfL96 A-108539.1 uAfuAfuCfuUfcUfcuaGfgCfcCfaAfcsCfsa AD-52966.1 A-108326.1 CfuCfcAfgAfgCfCfAfaAfaUfcAfaGfaUfL96 A-108327.1 aUfcUfuGfaUfuUfuggCfuCfuGfgAfgsAfsu AD-53145.1 A-108664.1 GfgCfaAfaUfuUfAfAfaAfgGfcAfaUfaAfL96 A-108665.1 uUfaUfuGfcCfuUfuuaAfaUfuUfgCfcsUfsc AD-53113.1 A-108606.1 UfaCfuUfgGfgAfUfCfaCfaAfaGfcAfaAfL96 A-108607.1 uUfuGfcUfuUfgUfgauCfcCfaAfgUfasGfsa AD-52993.1 A-108382.1 GfaUfcAfgUfcUfUfUfuUfaUfgAfuCfuAfL96 A-108383.1 uAfgAfuCfaUfaAfaaaGfaCfuGfaUfcsAfsa AD-53031.1 A-108426.1 GfaAfaGfcCfuCfCfUfaGfaAfgAfaAfaAfL96 A-108427.1 uUfuUfuCfuUfcUfaggAfgGfcUfuUfcsAfsa AD-53017.1 A-108484.1 AfgUfcAfaAfuAfAfAfaGfaAfaUfaGfaAfL96 A-108485.1 uUfcUfaUfuUfcUfuuuAfuUfuGfaCfusAfsu AD-53143.1 A-108632.1 AfuAfcUfcUfaUfAfAfaAfuCfaAfcCfaAfL96 A-108633.1 uUfgGfuUfgAfuUfuuaUfaGfaGfuAfusAfsa AD-53149.1 A-108650.1 GfaAfcUfgAfgGfCfAfaAfuUfuAfaAfaAfL96 A-108651.1 uUfuUfuAfaAfuUfugcCfuCfaGfuUfcsAfsu AD-53059.1 A-108494.1 AfgAfcCfcAfgCfAfAfcUfcUfcAfaGfuUfL96 A-108495.1 aAfcUfuGfaGfaGfuugCfuGfgGfuCfusGfsa AD-53006.1 A-108402.1 AfuAfuAfaAfcUfAfCfaAfgUfcAfaAfaAfL96 A-108403.1 uUfuUfuGfaCfuUfguaGfuUfuAfuAfusGfsu AD-53025.1 A-108424.1 UfgAfaAfgCfcUfCfCfuAfgAfaGfaAfaAfL96 A-108425.1 uUfuUfcUfuCfuAfggaGfgCfuUfuCfasAfsg AD-53085.1 A-108534.1 GfgGfaGfaAfcUfAfCfaAfaUfaUfgGfuUfL96 A-108535.1 aAfcCfaUfaUfuUfguaGfuUfcUfcCfcsAfsc AD-52984.1 A-108332.1 AfgAfuUfuGfcUfAfUfgUfuAfgAfcGfaUfL96 A-108333.1 aUfcGfuCfuAfaCfauaGfcAfaAfuCfusUfsg AD-53023.1 A-108486.1 GfaAfcCfcAfcAfGfAfaAfuUfuCfuCfuAfL96 A-108487.1 uAfgAfgAfaAfuUfucuGfuGfgGfuUfcsUfsu AD-53014.1 A-108436.1 AfcUfuCfaAfcAfAfAfaAfgUfgAfaAfuAfL96 A-108437.1 uAfuUfuCfaCfuUfuuuGfuUfgAfaGfusAfsg AD-53060.1 A-108510.1 AfgUfcCfaUfgGfAfCfaUfuAfaUfuCfaAfL96 A-108511.1 uUfgAfaUfuAfaUfgucCfaUfgGfaCfusAfsc AD-53110.1 A-108652.1 AfaCfuGfaGfgCfAfAfaUfuUfaAfaAfgAfL96 A-108653.1 uCfuUfuUfaAfaUfuugCfcUfcAfgUfusCfsa AD-52980.1 A-108362.1 GfgGfcCfaAfaUfUfAfaUfgAfcAfuAfuUfL96 A-108363.1 aAfuAfuGfuCfaUfuaaUfuUfgGfcCfcsUfsu AD-53109.1 A-108636.1 AfuCfcAfuCfcAfAfCfaGfaUfuCfaGfaAfL96 A-108637.1 uUfcUfgAfaUfcUfguuGfgAfuGfgAfusCfsa AD-53141.1 A-108600.1 AfaGfaUfuUfgGfUfGfuUfuUfcUfaCfuUfL96 A-108601.1 aAfgUfaGfaAfaAfcacCfaAfaUfcUfusUfsg AD-53126.1 A-108626.1 GfuCfuCfaAfaAfUfGfgAfaGfgUfuAfuAfL96 A-108627.1 uAfuAfaCfcUfuCfcauUfuUfgAfgAfcsUfsu AD-53116.1 A-108654.1 AfcUfgAfgGfcAfAfAfuUfuAfaAfaGfgAfL96 A-108655.1 uCfcUfuUfuAfaAfuuuGfcCfuCfaGfusUfsc AD-52997.1 A-108352.1 GfgGfaCfaUfgGfUfCfuUfaAfaGfaCfuUfL96 A-108353.1 aAfgUfcUfuUfaAfgacCfaUfgUfcCfcsAfsa AD-53120.1 A-108624.1 AfuGfgUfaAfaUfAfUfaAfcAfaAfcCfaAfL96 A-108625.1 uUfgGfuUfuGfuUfauaUfuUfaCfcAfusUfsu AD-53070.1 A-108576.1 GfgGfaAfaUfcAfCfGfaAfaCfcAfaCfuAfL96 A-108577.1 uAfgUfuGfgUfuUfcguGfaUfuUfcCfcsAfsa AD-53028.1 A-108472.1 CfcAfaCfaGfcAfUfAfgUfcAfaAfuAfaAfL96 A-108473.1 uUfuAfuUfuGfaCfuauGfcUfgUfuGfgsUfsu AD-53146.1 A-108602.1 UfuUfuCfuAfcUfUfGfgGfaUfcAfcAfaAfL96 A-108603.1 uUfuGfuGfaUfcCfcaaGfuAfgAfaAfasCfsa AD-52982.1 A-108394.1 AfgAfaCfuAfcAfUfAfuAfAfcUfaCfaAfL96 A-108395.1 uUfgUfaGfuUfuAfuauGfuAfgUfuCfusUfsc AD-53111.1 A-108668.1 AfgAfgUfaUfgUfGfUfaAfaAfaUfcUfgUfL96 A-108669.1 aCfaGfaUfuUfuUfacaCfaUfaCfuCfusGfsu AD-53045.1 A-108462.1 AfaAfaCfaAfgAfUfAfaUfaGfcAfuCfaAfL96 A-108463.1 uUfgAfuGfcUfaUfuauCfuUfgUfuUfusUfsc AD-53123.1 A-108672.1 AfgUfaUfgUfgUfAfAfaAfaUfcUfgUfaAfL96 A-108673.1 uUfaCfaGfaUfuUfuuaCfaCfaUfaCfusCfsu AD-53018.1 A-108406.1 AfgUfcAfaAfaAfUfGfaAfgAfgGfuAfaAfL96 A-108407.1 uUfuAfcCfuCfuUfcauUfuUfuGfaCfusUfsg AD-52956.1 A-108354.1 GfgAfcAfuGfgUfCfUfuAfaAfgAfcUfuUfL96 A-108355.1 aAfaGfuCfuUfuAfagaCfcAfuGfuCfcsCfsa AD-53134.1 A-108660.1 GfaGfgCfaAfaUfUfUfaAfaAfgGfcAfaUfL96 A-108661.1 aUfuGfcCfuUfuUfaaaUfuUfgCfcUfcsAfsg AD-52968.1 A-108358.1 GfuCfuUfaAfaGfAfCfuUfuGfuCfcAfuAfL96 A-108359.1 uAfuGfgAfcAfaAfgucUfuUfaAfgAfcsCfsa AD-53122.1 A-108656.1 CfuGfaGfgCfaAfAfUfuUfaAfaAfgGfcAfL96 A-108657.1 uGfcCfuUfuUfaAfauuUfgCfcUfcAfgsUfsu AD-53100.1 A-108586.1 GfcAfaUfcCfcGfGfAfaAfaCfaAfaGfaUfL96 A-108587.1 aUfcUfuUfgUfuUfuccGfgGfaUfuGfcsAfsu AD-53128.1 A-108658.1 UfgAfgGfcAfaAfUfUfuAfaAfaGfgCfaAfL96 A-108659.1 uUfgCfcUfuUfuAfaauUfuGfcCfuCfasGfsu AD-53043.1 A-108430.1 UfcUfaCfuUfcAfAfCfaAfaAfaGfuGfaAfL96 A-108431.1 uUfcAfcUfuUfuUfguuGfaAfgUfaGfasAfsu AD-53135.1 A-108676.1 UfaUfgUfgUfaAfAfAfaUfcUfgUfaAfuAfL96 A-108677.1 uAfuUfaCfaGfaUfuuuUfaCfaCfaUfasCfsu AD-53094.1 A-108584.1 AfaUfgCfaAfuCfCfCfgGfaAfaAfcAfaAfL96 A-108585.1 uUfuGfuUfuUfcCfgggAfuUfgCfaUfusGfsg AD-53019.1 A-108422.1 CfuUfgAfaAfgCfCfUfcCfuAfgAfaGfaAfL96 A-108423.1 uUfcUfuCfuAfgGfaggCfuUfuCfaAfgsUfsu AD-53129.1 A-108674.1 GfuAfuGfuGfuAfAfAfaAfuCfuGfuAfaUfL96 A-108675.1 aUfuAfcAfgAfuUfuuuAfcAfcAfuAfcsUfsc AD-53150.1 A-108666.1 CfaGfaGfuAfuGfUfGfuAfaAfaAfuCfuUfL96 A-108667.1 aAfgAfuUfuUfuAfcacAfuAfcUfcUfgsUfsg AD-53117.1 A-108670.1 GfaGfuAfuGfuGfUfAfaAfaAfuCfuGfuAfL96 A-108671.1 uAfcAfgAfuUfuUfuacAfcAfuAfcUfcsUfsg AD-52985.1 A-108348.1 UfcAfgUfuGfgGfAfCfaUfgGfuCfuUfaAfL96 A-108349.1 uUfaAfgAfcCfaUfgucCfcAfaCfuGfasAfsg AD-52962.1 A-108356.1 GfgUfcUfuAfaAfGfAfcUfuUfgUfcCfaUfL96 A-108357.1 aUfgGfaCfaAfaGfucuUfuAfaGfaCfcsAfsu AD-52974.1 A-108360.1 UfcUfuAfaAfgAfCfUfuUfgUfcCfaUfaAfL96 A-108361.1 uUfaUfgGfaCfaAfaguCfuUfuAfaGfasCfsc AD-52979.1 A-108346.1 UfuCfaGfuUfgGfGfAfcAfuGfgUfcUfuAfL96 A-108347.1 uAfaGfaCfcAfuGfuccCfaAfcUfgAfasGfsg

Lowercase nucleotides (a, u, g, c) are 2'-O-methylnucleotides, NF (eg, Af) is a 2'-O-fluoronucleotide, s is a thiophosphate bond, L96 is a GalNac ligand.

Table 9
Unmodified sequences of sense and antisense strands of dsRNA ANGPTL3 without conjugation to GalNal
The sequences are similar to those listed in Table 7, except that they do not contain conjugation to GalNal duplex name The name of the semantic oligo Semantic sequence (SEQ ID NO:1004-1184, respectively, in order of appearance) Name of antisense oligo Antisense sequence (SEQ ID NO:1185-1365, respectively, in order of appearance) Position in NM_014495.2 AD-52637.1 A-108817.1 UCACAAUUAAGCUCCUUCUUU A-108307.2 AAAGAAGGAGCUUAAUUGUGAAC 54-76 AD-52638.1 A-108825.1 UUAUUGUUCCUCUAGUUAUUU A-108323.2 AAAUAACUAGAGGAACAAUAAAA 75-97 AD-52639.1 A-108833.1 GCUAUGUUAGACGAUGUAAAA A-108339.2 UUUUACAUCGUCUAACAUAGCAA 161-183 AD-52640.1 A-108841.1 GGACAUGGUCUUAAAGACUUU A-108355.2 AAAGUCUUUAAGACCAUGUCCCA 209-231 AD-52641.1 A-108849.1 CAAAAACUCAACAUAUUUGAU A-108371.2 AUCAAAUAUGUUGAGUUUUUGAA 266-288 AD-52642.1 A-108857.1 ACCAGUGAAAAUCAAAGAAGAA A-108387.2 UUCUUCUUUGAUUUCACUGGUUU 314-336 AD-52643.1 A-108818.1 CACAAUUAAGCUCCUUCUUUU A-108309.2 AAAAGAAGGAGCUUAAUUGUGAA 55-77 AD-52645.1 A-108834.1 CUAUGUUAGACGAUGUAAAAAA A-108341.2 UUUUUACAUCGUCUAACAUAGCA 162-184 AD-52647.1 A-108850.1 UCAACAUAUUUGAUCAGUCUU A-108373.2 AAGACUGAUCAAAUAUGUUGAGU 273-295 AD-52648.1 A-108858.1 AACUGAGAAGAACUCAAUUA A-108389.2 UAUAUGUAGUUCUUCUCAGUUCC 342-364 AD-52649.1 A-108819.1 ACAAUUAAGCUCCUUCUUUUU A-108311.2 AAAAAGAAGGAGCUUAAUUGUGA 56-78 AD-52650.1 A-108827.1 CUCCAGAGCCAAAAUCAAGAU A-108327.2 AUCUUGAUUUUGGCUCUGGAGAU 138-160 AD-52651.1 A-108835.1 CGAUGUAAAAAUUUUAGCCAA A-108343.2 UUGGCUAAAAUUUUUACAUCGUC 172-194 AD-52652.1 A-108843.1 GUCUUAAAGACUUUGUCCAUA A-108359.2 UAUGGACAAAGUCUUUAAGACCA 216-238 AD-52653.1 A-108851.1 CAACAUAUUUGAUCAGUCUUU A-108375.2 AAAGACUGAUCAAAUAUGUUGAG 274-296 AD-52654.1 A-108859.1 ACUGAGAAGAACUACAUAUAA A-108391.2 UUAUAUGUAGUUCUUCUCAGUUC 343-365 AD-52656.1 A-108828.1 CCAGAGCCAAAAUCAAGAUUU A-108329.2 AAAUCUUGAUUUUGGCUCUGGAG 140-162 AD-52657.1 A-108836.1 GAUGUAAAAAUUUUAGCCAAU A-108345.2 AUUGGCUAAAAUUUUUACAUCGU 173-195 AD-52658.1 A-108844.1 UCUUAAAGACUUUGUCCAUAA A-108361.2 UUAUGGACAAAGUCUUUAAGAC 217-239 AD-52659.1 A-108852.1 AACAUAUUUGAUCAGUCUUUU A-108377.2 AAAAGACUGAUCAAAUAUGUUGA 275-297 AD-52660.1 A-108860.1 CUGAGAAGAACUACAUAUAAAA A-108393.2 UUUAUAUGUAGUUCUUCUCAGUU 344-366 AD-52661.1 A-108821.1 AAUUAAGCUCCUUCUUUUUAU A-108315.2 AUAAAAAGAAGGAGCUUAAUUGU 58-80 AD-52662.1 A-108829.1 AAAUCAAGAUUUGCUAUGUUA A-108331.2 UAACAUAGCAAAUCUUGAUUUUG 149-171 AD-52663.1 A-108837.1 UUCAGUUGGGACAUGGUCUUA A-108347.2 UAAGACCAUGUCCCAACUGAAGG 201-223 AD-52664.1 A-108845.1 GGGCCAAAUUAAUGACAUAUU A-108363.2 AAUAUGUCAUUAAUUUGGCCCUU 244-266 AD-52665.1 A-108853.1 ACAUAUUUGAUCAGUCUUUUU A-108379.2 AAAAAGACUGAUCAAAUAUGUUG 276-298 AD-52666.1 A-108861.1 AGAACUACAUAUAAACUACAA A-108395.2 UUGUAGUUUAUAUGUAGUUCUUC 350-372 AD-52667.1 A-108822.1 AUUAAGCUCCUUCUUUUUAUU A-108317.2 AAUAAAAAGAAGGAGCUUAAUUG 59-81 AD-52668.1 A-108830.1 AGAUUUGCUAUGUUAGACGAU A-108333.2 AUCGUCUAACAUAGCAAAUCUUG 155-177 AD-52669.1 A-108838.1 UCAGUUGGGACAUGGUCUUAA A-108349.2 UUAAGACCAUGUCCCAACUGAAG 202-224 AD-52670.1 A-108846.1 GGCCAAAUUAAUGACAUAUUU A-108365.2 AAAUAUGUCAUUAAUUUGCCCU 245-267 AD-52671.1 A-108854.1 CAUAUUUGAUCAGUCUUUUUA A-108381.2 UAAAAAGACUGAUCAAAUAUGUU 277-299 AD-52672.1 A-108862.1 UACAUAUAAACUACAAGUCAA A-108397.2 UUGACUUGUAGUUUAUAUGUAGU 355-377 AD-52673.1 A-108823.1 UUUUAUUGUUCCUCUAGUUAU A-108319.2 AUAACUAGAGGAACAAUAAAAAG 73-95 AD-52674.1 A-108831.1 UUGCUAUGUUAGACGAUGUAA A-108335.2 UUACAUCGUCUAACAUAGCAAAU 159-181 AD-52675.1 A-108839.1 CAGUUGGGACAUGGUCUUAAA A-108351.2 UUUAAGACCAUGUCCCAACUGAA 203-225 AD-52676.1 A-108847.1 AAAUUAAUGACAUAUUUCAAAA A-108367.2 UUUGAAAUAUGUCAUUAAUUUGG 249-271 AD-52677.1 A-108855.1 GAUCAGUCUUUUUAUGAUCUA A-108383.2 UAGAUCAUAAAAAGACUGAUCAA 284-306 AD-52678.1 A-108863.1 ACAUAUAAACUACAAGUCAAAA A-108399.2 UUUGACUUGUAGUUUAUAUGUAG 356-378 AD-52679.1 A-108824.1 UUUAUUGUUCCUCUAGUUAUU A-108321.2 AAUAACUAGAGGAACAAUAAAAA 74-96 AD-52680.1 A-108832.1 UGCUAUGUUAGACGAUGUAAAA A-108337.2 UUUACAUCGUCUAAACAUAGCAAA 160-182 AD-52681.1 A-108840.1 GGGACAUGGUCUUAAAGACUU A-108353.2 AAGUCUUUAAGACCAUGUCCCAAA 208-230 AD-52682.1 A-108848.1 UGACAUAUUUCAAAAACUCAA A-108369.2 UUGAGUUUUUGAAAUAUAUGUCAUU 256-278 AD-52683.1 A-108856.1 AUCAGUCUUUUUAUGAUCUAU A-108385.2 AUAGAUCAUAAAAAGACUGAUCA 285-307 AD-52684.1 A-108864.1 CAUAUAAACUACAAGUCAAAA A-108401.2 UUUUGACUUGUAGUUUAUAUGUA 357-379 AD-52685.1 A-108872.1 CUUGAACUCAACUCAAAAACUU A-108417.2 AAGUUUUGAGUUGAGUUCAAGUG 401-423 AD-52686.1 A-108880.1 CUACUUCAACAAAAAGUGAAA A-108433.2 UUUCACUUUUUGUUGAAGUAGAA 446-468 AD-52687.1 A-108888.1 AAGAGCAACUAACUAACCUUAA A-108449.2 UUAAGUUAGUUAGUUGCUCUUCU 474-496 AD-52688.1 A-108896.1 AAACAAGAUAAUAGCAUCAAA A-108465.2 UUUGAUGCUAUUAUCUUGUUUUU 557-579 AD-52689.1 A-108904.1 GCAUAGUCAAAUAAAAGAAAU A-108481.2 AUUUCUUUUAUUUGACUAUGCUG 625-647 AD-52690.1 A-108865.1 AUAUAAACUACAAGUCAAAAA A-108403.2 UUUUUGACUUGUAGUUUAUAUGU 358-380 AD-52691.1 A-108873.1 GAACUCAACUCAAAACUUGAA A-108419.2 UUCAAGUUUUGAGUUGAGUUCAA 404-426 AD-52692.1 A-108881.1 UACUUCAACAAAAAGUGAAAU A-108435.2 AUUUCACUUUUUGUUGAAGUAGA 447-469 AD-52693.1 A-108889.1 AGAGCAACUAACUAACUUAAU A-108451.2 AUUAAGUUAGUUAGUUGCUCUUC 475-497 AD-52694.1 A-108897.1 GAUAAUAGCAUCAAAGACCUU A-108467.2 AAGGUCUUUGAUGCUAUUAUCUU 563-585 AD-52695.1 A-108905.1 CAUAGUCAAAUAAAAGAAAUA A-108483.2 UAUUUCUUUUAUUUGACUAUGCU 626-648 AD-52696.1 A-108866.1 UAUAAACUACAAGUCAAAAAU A-108405.2 AUUUUUGACUUGUAGUUUAUAUG 359-381 AD-52697.1 A-108874.1 AACUCAACUCAAAACUUGAAA A-108421.2 UUUCAAGUUUUGAGUUGAGUUCA 405-427 AD-52698.1 A-108882.1 ACUUCAACAAAAAGUGAAAUA A-108437.2 UAUUUCACUUUUUGUUGAGUAG 448-470 AD-52699.1 A-108890.1 GAGCAACUAACUAACUUAAUU A-108453.2 AAUUAGUUAGUUAGUUGCUCUU 476-498 AD-52700.1 A-108898.1 AACCAACAGCAUAGUCAAAUA A-108469.2 UAUUUGACUAUGCUGUUGGUUUA 617-639 AD-52701.1 A-108906.1 AGUCAAAUAAAAGAAAUAGAA A-108485.2 UUCUAUUUCUUUUAUUUGACUAU 629-651 AD-52702.1 A-108867.1 AGUCAAAAAUGAAGAGGUAAAA A-108407.2 UUUACCUCUUCAUUUUUGACUUG 370-392 AD-52703.1 A-108875.1 CUUGAAAGCCUCCUAGAAGAA A-108423.2 UUCUUCUAGGAGGCUUUCAAGUU 419-441 AD-52704.1 A-108883.1 CUUCAACAAAAAGUGAAAUAU A-108439.2 AUAUUUCACUUUUUGUUGAAGUA 449-471 AD-52705.1 A-108891.1 CAACUAACUAACUUAAUUCAA A-108455.2 UUGAAUUAAGUUAGUUAGUUGCU 479-501 AD-52706.1 A-108899.1 ACCAACAGCAAUAGUCAAAUAA A-108471.2 UUAUUUGACUAUGCUGUUGGUUU 618-640 AD-52707.1 A-108907.1 GAACCCACAGAAAUUUCUCUA A-108487.2 UAGAGAAAUUUCUGUGGGUUCUU 677-699 AD-52708.1 A-108868.1 GAAUAUGUCACUUGAACUCAA A-108409.2 UUGAGUUCAAGUGACAUAUUCUU 391-413 AD-52709.1 A-108876.1 UGAAAGCCUCCUAGAAGAAAA A-108425.2 UUUUCUUCUAGGAGGCUUUCAAG 421-443 AD-52710.1 A-108884.1 UUCAACAAAAAGUGAAAUAUU A-108441.2 AAUAUUUCACUUUUUGUUGAAGU 450-472 AD-52711.1 A-108892.1 AACUAACUAACUUAAUUCAAAA A-108457.2 UUUGAAUUAAGUUAGUUAGUUGC 480-502 AD-52712.1 A-108900.1 CCAACAGCAUAGUCAAAUAAA A-108473.2 UUUAUUUGACUAUGCUGUUGGUU 619-641 AD-52713.1 A-108908.1 AACCCACAGAAAUUUCUCUAU A-108489.2 AUAGAGAAAUUUCUGUGGGUUCU 678-700 AD-52714.1 A-108869.1 UGUCACUUGAACUCAACUCAAA A-108411.2 UUGAGUUGAGUUCAAGUGACAUA 396-418 AD-52715.1 A-108877.1 GAAAGCCUCCUAGAAGAAAAA A-108427.2 UUUUUCUUCUAGGAGGCUUUCAA 422-444 AD-52716.1 A-108885.1 AAUAUUUAGAAGAGCAACUAA A-108443.2 UUAGUUGCUCUUCUAAAUAUUUC 465-487 AD-52717.1 A-108893.1 ACUAACUAACUUAAUUCAAAA A-108459.2 UUUUGAAUUAAGUUAGUUAGUUG 481-503 AD-52718.1 A-108901.1 CAACAGCAUAGUCAAAUAAAA A-108475.2 UUUUAUUUGACUAUGCUGUUGGU 620-642 AD-52719.1 A-108909.1 CCACAGAAAAUUUCUCUAUCUU A-108491.2 AAGAUAGAGAAAUUUCUGUGGGU 681-703 AD-52720.1 A-108870.1 GUCACUUGAACUCAACUCAAA A-108413.2 UUUGAGUUGAGUUCAAGUGACAU 397-419 AD-52721.1 A-108878.1 CUCCUAGAAGAAAAAAUUCUA A-108429.2 UAGAAUUUUUUCUUCUAGGAGGC 428-450 AD-52722.1 A-108886.1 AUUUAGAAGAGCAACUAACUA A-108445.2 UAGUUAGUUGCUCUUCUAAAUAU 468-490 AD-52723.1 A-108894.1 CUAACUAACUUAAUUCAAAU A-108461.2 AUUUUGAAUUAAGUUAGUUAGUU 482-504 AD-52724.1 A-108902.1 CAGCAUAGUCAAAUAAAAGAA A-108477.2 UUCUUUUAUUUGACUAUGCUGUU 623-645 AD-52725.1 A-108910.1 GAAAUAAGAAAUGUAAAAACAU A-108493.2 AUGUUUUACAUUUCUUAUUUCAU 746-768 AD-52726.1 A-108871.1 UCACUUGAACUCAACUCAAAAA A-108415.2 UUUUGAGUUGAGUUCAAGUGACA 398-420 AD-52727.1 A-108879.1 UCUACUUCAACAAAAAGUGAA A-108431.2 UUCACUUUUUGUUGAAGUAGAAU 445-467 AD-52728.1 A-108887.1 UUUAGAAGAGCAACUAACUAA A-108447.2 UUAGUUAGUUGCUCUUCUAAAUA 469-491 AD-52729.1 A-108895.1 AAAACAAGAUAAUAGCAUCAA A-108463.2 UUGAUGCUAUUAUCUUGUUUUUC 556-578 AD-52730.1 A-108903.1 AGCAUAGUCAAAUAAAAGAAA A-108479.2 UUUCUUUUAUUUGACUAUGCUGU 624-646 AD-52731.1 A-108958.1 AGACCCAGCAACUCUCAAGUU A-108495.2 AACUUGAGAGUUGCUGGGUCUGA 836-858 AD-52732.1 A-108966.1 AGUCCAUGGACAUUAAUUCAA A-108511.2 UUGAAUUAAUGUCCAUGGACUAC 887-909 AD-52733.1 A-108974.1 GAUGGAUCACAAAACUUCAAU A-108527.2 AUUGAAGUUUUGUGAUCCAUCUA 917-939 AD-52734.1 A-108982.1 CUAGAGAAGAUAUACUCCAUA A-108543.2 UAUGGAGUAUAUCUUCUCUAGGC 998-1020 AD-52735.1 A-108990.1 AAAGACAACAAACAUUAUAUU A-108559.2 AAUAUAAUGUUUGUUGUCUUUCC 1064-1086 AD-52736.1 A-108998.1 CAUUAUAUUGAAUAUUCUUU A-108575.2 AAAAGAAUAUUCAAUAUAAUGUU 1076-1098 AD-52737.1 A-108959.1 GACCCAGCAACUCUCAAGUUU A-108497.2 AAACUUGAGAGUUGCUGGGUCUG 837-859 AD-52739.1 A-108975.1 GGAUCACAAAACUUCAAUGAA A-108529.2 UUCAUUGAAGUUUUGUGAUCCAU 920-942 AD-52740.1 A-108983.1 GAAGAUAUACUCCAUAGUGAA A-108545.2 UUCACCUAUGGAGUAUAUCUUCUCUC 1003-1025 AD-52741.1 A-108991.1 GACAACAAACAUUAUAUUGAA A-108561.2 UUCAAUAUAAUGUUUGUUGUCUU 1067-1089 AD-52742.1 A-108999.1 GGGAAAUCACGAAAACCAACUA A-108577.2 UAGUUGGUUUCGUGAUUUCCCAA 1102-1124 AD-52743.1 A-108960.1 ACCCAGCAACUCUCAAGUUUU A-108499.2 AAAACUUGAGAGUUGCUGGGUCU 838-860 AD-52744.1 A-108968.1 GGACAUUAAUUCAACAUCGAA A-108515.2 UUCGAUGUUGAAUUAAUGUCCAU 894-916 AD-52745.1 A-108976.1 GAUCACAAAAACUUCAAUGAAA A-108531.2 UUUCAUUGAAGUUUUGUGAUCCA 921-943 AD-52746.1 A-108984.1 ACUCCAUAGUGAAGCAAUCUA A-108547.2 UAGAUUGCUUCACUAUGGAGUAU 1011-1033 AD-52747.1 A-108992.1 ACAACAAACAUUAUAUUGAAU A-108563.2 AUUCAAUAUAAUGUUUGUUGUCU 1068-1090 AD-52748.1 A-109000.1 GGAAAUCACGAAACCAACUAU A-108579.2 AUAGUUGGUUUCGUGAUUUCCCA 1103-1125 AD-52749.1 A-108961.1 CCCAGCAACUCUCAAGUUUUU A-108501.2 AAAAACUUGAGAGUUGCUGGGUC 839-861 AD-52750.1 A-108969.1 GACAUUAAUUCAACAUCGAAU A-108517.2 AUUCGAUGUUGAAUUAAUGUCCA 895-917 AD-52751.1 A-108977.1 AACGUGGGAGAACUACAAAUA A-108533.2 UAUUUGUAGUUCUCCCACGUUUC 940-962 AD-52752.1 A-108985.1 CUCCAUAGUGAAGCAAUCUAA A-108549.2 UUAGAUUGCUUCACUAUGGAGUA 1012-1034 AD-52753.1 A-108993.1 CAACAAACAUUAUAUUGAAUA A-108565.2 UAUUCAAUAUAAUGUUUGUUGUC 1069-1091 AD-52754.1 A-109001.1 GAAAUCACGAAACCAACUAUA A-108581.2 UAUAGUUGGUUUCGUGAUUUCCC 1104-1126 AD-52755.1 A-108962.1 CUCUCAAGUUUUUCAUGUCUA A-108503.2 UAGACAUGAAAAACUUGAGAGUU 847-869 AD-52756.1 A-108970.1 ACAUUAAUUCAACAUCGAAUA A-108519.2 UAUUCGAUGUUGAAUUAAUGUCC 896-918 AD-52757.1 A-108978.1 GGGAGAACUACAAAUAUGGUU A-108535.2 AACCAUAUUUGUAGUUCUCCCAC 945-967 AD-52758.1 A-108986.1 UCCAUAGUGAAGCAAUCUAAU A-108551.2 AUUAGAUUGCUUCACUAUGGAGU 1013-1035 AD-52759.1 A-108994.1 AACAAACAUUAUAUUGAAUAU A-108567.2 AUAUUCAAUAUAAUGUUUGUUGU 1070-1092 AD-52760.1 A-109002.1 UGGCAAUGUCCCCCAAUGCAAU A-108583.2 AUUGCAUUGGGGACAUUGCCAGU 1147-1169 AD-52761.1 A-108963.1 UCAGGUAGUCCAUGGACAUUA A-108505.2 UAAUGUCCAUGGACUACCUGAUA 881-903 AD-52762.1 A-108971.1 UUAAUUCAACAUCGAAUAGAU A-108521.2 AUCUAUUCGAUGUUGAAUUAAUG 899-921 AD-52763.1 A-108979.1 GGAGAACUACAAAAUAUGGUUU A-108537.2 AAACCAUAUUUGUAGUUCUCCA 946-968 AD-52764.1 A-108987.1 CCAUAGUGAAGCAAUCUAAUU A-108553.2 AAUUAGAUUGCUUCACUAUGGAG 1014-1036 AD-52765.1 A-108995.1 ACAAACAUUAUAUUGAAUAUU A-108569.2 AAUAUUCAAUAUAAUGUUUGUUG 1071-1093 AD-52766.1 A-109003.1 AAUGCAAUCCCGGAAAACAAA A-108585.2 UUUGUUUUCCGGGAUUGCAUUGG 1160-1182 AD-52767.1 A-108964.1 CAGGUAGUCCAUGGACAUUAA A-108507.2 UUAAUGUCCAUGGACUACCUGAU 882-904 AD-52768.1 A-108972.1 UUCAACAUCGAAUAGAUGGAU A-108523.2 AUCCAUCUAUUCGAUGUUGAAUU 903-925 AD-52769.1 A-108980.1 GUUGGGCCUAGAGAAGAUAUA A-108539.2 UAUAUCUUCUCUAGGCCCAACCA 991-1013 AD-52770.1 A-108988.1 CAUAGUGAAGCAAUCUAAUUA A-108555.2 UAAUUAGAUUGCUUCACUAUGGA 1015-1037 AD-52771.1 A-108996.1 AACAUUAUAUUGAAUAUUCUU A-108571.2 AAGAAUAUUCAAUAUAAUGUUUG 1074-1096 AD-52772.1 A-109004.1 GCAAUCCCGGAAAACAAAGAU A-108587.2 AUCUUUGUUUUCCGGGAUUGCAU 1163-1185 AD-52773.1 A-108965.1 GGUAGUCCAUGGACAUUAAUU A-108509.2 AAUUAAUGUCCAUGGACUACCUG 884-906 AD-52774.1 A-108973.1 AUCGAAUAGAUGGAUCCAAA A-108525.2 UUUGUGAUCCAUCAUUCGAUGU 909-931 AD-52775.1 A-108981.1 CCUAGAGAAGAUAUACUCCAU A-108541.2 AUGGAGUAUAUCUUCUCUAGGCC 997-1019 AD-52776.1 A-108989.1 GUUGGAAGACUGGAAAGACAAA A-108557.2 UUGUCUUUCCAGUCUUCCAACUC 1051-1073 AD-52777.1 A-108997.1 ACAUUAUAUUGAAUAUUCUUU A-108573.2 AAAGAAUAUUCAAUAUAAUGUUU 1075-1097 AD-52778.1 A-109005.1 CAAUCCCGGAAAACAAAGAUU A-108589.2 AAUCUUUGUUUUCCGGGAUUGCA 1164-1186 AD-52779.1 A-109013.1 CUACUUGGGAUCACAAAGCAA A-108605.2 UUGCUUUGUGAUCCCAAGUAGAA 1194-1216 AD-52780.1 A-109021.1 ACAACCUAAAUGGUAAAUUA A-108621.2 UAUAUUUACCAUUUAGGUUGUUU 1281-1303 AD-52781.1 A-109029.1 AUCCAUCCAACAGAUUCAGAA A-108637.2 UUCUGAAUCUGUUGGAUGGAUCA 1400-1422 AD-52782.1 A-109037.1 AACUGAGGCAAAUUUAAAAAGA A-108653.2 UCUUUUAAAUUUGCCUCAGUUCA 1432-1454_G21A AD-52783.1 A-109045.1 AGAGUAUGUGUAAAAAUCUGU A-108669.2 ACAGAUUUUUACACAUACUCUGU 1913-1935 AD-52784.1 A-109006.1 AAUCCCGGAAAACAAAGAUUU A-108591.2 AAAUCUUUGUUUUCCGGGAUUGC 1165-1187 AD-52785.1 A-109014.1 UACUUGGGAUCACAAAGCAAA A-108607.2 UUUGCUUUGUGAUCCCAAGUAGA 1195-1217 AD-52786.1 A-109022.1 CAACCUAAAUGGUAAAUAUAA A-108623.2 UUAUAUUUACCAUUUAGGUUGUU 1282-1304 AD-52787.1 A-109030.1 UUGAAUGAACUGAGGCAAAUU A-108639.2 AAUUUGCCUCAGUUCAUUCAAAG 1425-1447 AD-52788.1 A-109038.1 ACUGAGGCAAAUUUAAAAGGA A-108655.2 UCCUUUUAAAUUUGCCUCAGUUC 1433-1455_C21A AD-52789.1 A-109046.1 GAGUAUGUGUAAAAAUCUGUA A-108671.2 UACAGAUUUUUACACAUACUCUG 1914-1936 AD-52791.1 A-109015.1 ACUUGGGAUCACAAAGCAAAAA A-108609.2 UUUUGCUUUGUGAUCCCAAGUAG 1196-1218 AD-52792.1 A-109023.1 AUGGUAAAUAUAACAAACCAA A-108625.2 UUGGUUUGUUAUAUUUACCAUUU 1290-1312 AD-52793.1 A-109031.1 UGAAUGAACUGAGGCAAAUUU A-108641.2 AAAUUUGCCUCAGUUCAUUCAAAA 1426-1448 AD-52794.1 A-109039.1 CUGAGGCAAAUUUAAAAGGCA A-108657.2 UGCCUUUUAAAUUUGCCUCAGUU 1434-1456 AD-52795.1 A-109047.1 AGUAUGUGUAAAAAUCUGUAA A-108673.2 UUACAGAUUUUUACACAUACUCU 1915-1937 AD-52796.1 A-109008.1 GAAAACAAAGAUUUGGUGUUU A-108595.2 AAACACCAAAUCUUUGUUUUCCG 1172-1194 AD-52797.1 A-109016.1 AGUGUGGAGAAAAACAACCUAA A-108611.2 UUAGGUUGUUUUCUCCACACUCA 1269-1291 AD-52798.1 A-109024.1 GUCUCAAAAUGGAAGGUUAUA A-108627.2 UAUAACCUUCCAUUUUGAGACUU 1354-1376 AD-52799.1 A-109032.1 GAAUGAACUGAGGCAAAUUUA A-108643.2 UAAAUUUGCCUCAGUUCAUUCAA 1427-1449 AD-52800.1 A-109040.1 UGAGGCAAAUUUAAAAGGCAA A-108659.2 UUGCCUUUUAAAUUUGCCUCAGU 1435-1457 AD-52801.1 A-109048.1 GUAUGUGUAAAAAUCUGUAAU A-108675.2 AUUACAGAUUUUUACACAUACUC 1916-1938 AD-52802.1 A-109009.1 AAAACAAAGAUUUGGUGUUUU A-108597.2 AAAACACCAAAUCUUUGUUUUCC 1173-1195 AD-52803.1 A-109017.1 GUGUGGAGAAAACAACCUAAA A-108613.2 UUUAGGUUGUUUUCUCCCACUCUC 1270-1292 AD-52804.1 A-109025.1 AUGGAAGGUUAUACUCUAUAA A-108629.2 UUAUAGAGUAUAAACCUUCCAUUU 1362-1384 AD-52805.1 A-109033.1 AAUGAACUGAGGCAAAUUUAA A-108645.2 UUAAAUUUGCCUCAGUUCAUUCA 1428-1450 AD-52806.1 A-109041.1 GAGGCAAAUUUAAAAGGCAAU A-108661.2 AUUGCCUUUUAAAUUUGCCUCAG 1436-1458 AD-52807.1 A-109049.1 UAUGUGUAAAAAUCUGUAAUA A-108677.2 UAUUACAGAUUUUUACACAUACU 1917-1939 AD-52808.1 A-109010.1 ACAAAGAUUUGGUGUUUUCUA A-108599.2 UAGAAAACACCAAAUCUUUGUUU 1176-1198 AD-52809.1 A-109018.1 UGUGGAGAAAAACAACCUAAAU A-108615.2 AUUUAGGUUGUUUUCUCCACACU 1271-1293 AD-52810.1 A-109026.1 UGGAAGGUUAUACUCUAUAAAA A-108631.2 UUUAUAGAGUAUAAACCUUCCAUU 1363-1385 AD-52811.1 A-109034.1 AUGAACUGAGGCAAAUUUAAA A-108647.2 UUUAAAUUUGCCUCAGUUCAUUC 1429-1451 AD-52812.1 A-109042.1 AGGCAAAUUUAAAAGGCAAUA A-108663.2 UAUUGCCUUUUAAAUUUGCCUCA 1437-1459 AD-52813.1 A-109011.1 AAGAUUUGGUGUUUUCUACUU A-108601.2 AAGUAGAAAACACCAAAUCUUUG 1179-1201 AD-52814.1 A-109019.1 AAACAACCUAAAUGGUAAAUA A-108617.2 UAUUUACCAUUUAGGUUGUUUUC 1279-1301 AD-52815.1 A-109027.1 AUACUCUAUAAAAUCAACCAA A-108633.2 UUGGUUGAUUUUAUAGAGUAUAA 1372-1394 AD-52816.1 A-109035.1 UGAACUGAGGCAAAUUUAAA A-108649.2 UUUUAAAUUUGCCUCAGUUCAUU 1430-1452 AD-52817.1 A-109043.1 GGCAAAUUUAAAAGGCAAUAA A-108665.2 UUAUUGCCUUUUAAAUUUGCCUC 1438-1460 AD-52818.1 A-109012.1 UUUUCUACUUGGGAUCCAAA A-108603.2 UUUGUGAUCCCAAGUAGAAAACA 1190-1212 AD-52819.1 A-109020.1 AACAACCUAAAUGGUAAAUAU A-108619.2 AUAUUUACCAUUUAGGUUGUUUU 1280-1302 AD-52820.1 A-109028.1 UACUCUAUAAAAUCAACCAAA A-108635.2 UUUGGUUGAUUUUAUAGAGUUAUA 1373-1395 AD-52821.1 A-109036.1 GAACUGAGGCAAAUUUAAAAA A-108651.2 UUUUUAAAUUUGCCUCAGUUCAU 1431-1453_G21A AD-52822.1 A-109044.1 CAGAGUAUGUGUAAAAAUCUU A-108667.2 AAGAUUUUUACACAUACUCUGUG 1912-1934_G21U

Table 10
Modified sequences of sense and antisense strands of dsRNA ANGPTL3 without conjugation with GalNal
The sequences are similar to those listed in Table 8, except that they do not contain conjugation to GalNal duplex name The name of the semantic oligo Semantic sequence (SEQ ID NO:1366-1546, respectively, in order of appearance) The name of the anti-sense oligo Antisense sequence (SEQ ID NO:1547-1727, respectively, in order of appearance) AD-52637.1 A-108817.1 UfcAfcAfaUfuAfAfGfcUfcCfuUfcUfuUf A-108307.2 aAfaGfaAfgGfaGfcuuAfaUfuGfuGfasAfsc AD-52638.1 A-108825.1 UfuAfuUfgUfuCfCfUfcUfaGfuUfaUfuUf A-108323.2 aAfaUfaAfcUfaGfaggAfaCfaAfuAfasAfsa AD-52639.1 A-108833.1 GfcUfaUfgUfuAfGfAfcGfaUfgUfaAfaAf A-108339.2 uUfuUfaCfaUfcGfucuAfaCfaUfaGfcsAfsa AD-52640.1 A-108841.1 GfgAfcAfuGfgUfCfUfuAfaAfgAfcUfuUf A-108355.2 aAfaGfuCfuUfuAfagaCfcAfuGfuCfcsCfsa AD-52641.1 A-108849.1 CfaAfaAfaCfuCfAfAfcAfuAfuUfuGfaUf A-108371.2 aUfcAfaAfuAfuGfuugAfgUfuUfuUfgsAfsa AD-52642.1 A-108857.1 AfcCfaGfuGfaAfAfUfcAfaAfgAfaGfaAf A-108387.2 uUfcUfuCfuUfuGfauuUfcAfcUfgGfusUfsu AD-52643.1 A-108818.1 CfaCfaAfuUfaAfGfCfuCfcUfuCfuUfuUf A-108309.2 aAfaAfgAfaGfgAfgcuUfaAfuUfgUfgsAfsa AD-52645.1 A-108834.1 CfuAfuGfuUfaGfAfCfgAfuGfuAfaAfaAf A-108341.2 uUfuUfuAfcAfuCfgucUfaAfcAfuAfgsCfsa AD-52647.1 A-108850.1 UfcAfaCfaUfaUfUfUfgAfuCfaGfuCfuUf A-108373.2 aAfgAfcUfgAfuCfaaaUfaUfgUfuGfasGfsu AD-52648.1 A-108858.1 AfaCfuGfaGfaAfGfAfaCfuAfcAfuAfuAf A-108389.2 uAfuAfuGfuAfgUfucuUfcUfcAfgUfusCfsc AD-52649.1 A-108819.1 AfcAfaUfuAfaGfCfUfcCfuUfcUfuUfuUf A-108311.2 aAfaAfaGfaAfgGfagcUfuAfaUfuGfusGfsa AD-52650.1 A-108827.1 CfuCfcAfgAfgCfCfAfaAfaUfcAfaGfaUf A-108327.2 aUfcUfuGfaUfuUfuggCfuCfuGfgAfgsAfsu AD-52651.1 A-108835.1 CfgAfuGfuAfaAfAfAfuUfuUfaGfcCfaAf A-108343.2 uUfgGfcUfaAfaAfuuuUfuAfcAfuCfgsUfsc AD-52652.1 A-108843.1 GfuCfuUfaAfaGfAfCfuUfuGfuCfcAfuAf A-108359.2 uAfuGfgAfcAfaAfgucUfuUfaAfgAfcsCfsa AD-52653.1 A-108851.1 CfaAfcAfuAfuUfUfGfaUfcAfgUfcUfuUf A-108375.2 aAfaGfaCfuGfaUfcaaAfuAfuGfuUfgsAfsg AD-52654.1 A-108859.1 AfcUfgAfgAfaGfAfAfcUfaCfaUfaUfaAf A-108391.2 uUfaUfaUfgUfaGfuucUfuCfuCfaGfusUfsc AD-52656.1 A-108828.1 CfcAfgAfgCfcAfAfAfaUfcAfaGfaUfuUf A-108329.2 aAfaUfcUfuGfaUfuuuGfgCfuCfuGfgsAfsg AD-52657.1 A-108836.1 GfaUfgUfaAfaAfAfUfuUfuAfgCfcAfaUf A-108345.2 aUfuGfgCfuAfaAfauuUfuUfaCfaUfcsGfsu AD-52658.1 A-108844.1 UfcUfuAfaAfgAfCfUfuUfgUfcCfaUfaAf A-108361.2 uUfaUfgGfaCfaAfaguCfuUfuAfaGfasCfsc AD-52659.1 A-108852.1 AfaCfaUfaUfuUfGfAfuCfaGfuCfuUfuUf A-108377.2 aAfaAfgAfcUfgAfucaAfaUfaUfgUfusGfsa AD-52660.1 A-108860.1 CfuGfaGfaAfgAfAfCfuAfcAfuAfuAfaAf A-108393.2 uUfuAfuAfuGfuAfguuCfuUfcUfcAfgsUfsu AD-52661.1 A-108821.1 AfaUfuAfaGfcUfCfCfuUfcUfuUfuUfaUf A-108315.2 aUfaAfaAfaGfaAfggaGfcUfuAfaUfusGfsu AD-52662.1 A-108829.1 AfaAfuCfaAfgAfUfUfuGfcUfaUfgUfuAf A-108331.2 uAfaCfaUfaGfcAfaauCfuUfgAfuUfusUfsg AD-52663.1 A-108837.1 UfuCfaGfuUfgGfGfAfcAfuGfgUfcUfuAf A-108347.2 uAfaGfaCfcAfuGfuccCfaAfcUfgAfasGfsg AD-52664.1 A-108845.1 GfgGfcCfaAfaUfUfAfaUfgAfcAfuAfuUf A-108363.2 aAfuAfuGfuCfaUfuaaUfuUfgGfcCfcsUfsu AD-52665.1 A-108853.1 AfcAfuAfuUfuGfAfUfcAfgUfcUfuUfuUf A-108379.2 aAfaAfaGfaCfuGfaucAfaAfuAfuGfusUfsg AD-52666.1 A-108861.1 AfgAfaCfuAfcAfUfAfuAfaAfcUfaCfaAf A-108395.2 uUfgUfaGfuUfuAfuauGfuAfgUfuCfusUfsc AD-52667.1 A-108822.1 AfuUfaAfgCfuCfCfUfuCfuUfuUfuAfuUf A-108317.2 aAfuAfaAfaAfgAfaggAfgCfuUfaAfusUfsg AD-52668.1 A-108830.1 AfgAfuUfuGfcUfAfUfgUfuAfgAfcGfaUf A-108333.2 aUfcGfuCfuAfaCfauaGfcAfaAfuCfusUfsg AD-52669.1 A-108838.1 UfcAfgUfuGfgGfAfCfaUfgGfuCfuUfaAf A-108349.2 uUfaAfgAfcCfaUfgucCfcAfaCfuGfasAfsg AD-52670.1 A-108846.1 GfgCfcAfaAfuUfAfAfuGfaCfaUfaUfuUf A-108365.2 aAfaUfaUfgUfcAfuuaAfuUfuGfgCfcsCfsu AD-52671.1 A-108854.1 CfaUfaUfuUfgAfUfCfaGfuCfuUfuUfuAf A-108381.2 uAfaAfaAfgAfcUfgauCfaAfaUfaUfgsUfsu AD-52672.1 A-108862.1 UfaCfaUfaUfaAfAfCfuAfcAfaGfuCfaAf A-108397.2 uUfgAfcUfuGfuAfguuUfaUfaUfgUfasGfsu AD-52673.1 A-108823.1 UfuUfuAfuUfgUfUfCfcUfcUfaGfuUfaUf A-108319.2 aUfaAfcUfaGfaGfgaaCfaAfuAfaAfasAfsg AD-52674.1 A-108831.1 UfuGfcUfaUfgUfUfAfgAfcGfaUfgUfaAf A-108335.2 uUfaCfaUfcGfuCfuaaCfaUfaGfcAfasAfsu AD-52675.1 A-108839.1 CfaGfuUfgGfgAfCfAfuGfgUfcUfuAfaAf A-108351.2 uUfuAfaGfaCfcAfuguCfcCfaAfcUfgsAfsa AD-52676.1 A-108847.1 AfaAfuUfaAfuGfAfCfaUfaUfuUfcAfaAf A-108367.2 uUfuGfaAfaUfaUfgucAfuUfaAfuUfusGfsg AD-52677.1 A-108855.1 GfaUfcAfgUfcUfUfUfuUfaUfgAfuCfuAf A-108383.2 uAfgAfuCfaUfaAfaaaGfaCfuGfaUfcsAfsa AD-52678.1 A-108863.1 AfcAfuAfuAfaAfCfUfaCfaAfgUfcAfaAf A-108399.2 uUfuGfaCfuUfgUfaguUfuAfuAfuGfusAfsg AD-52679.1 A-108824.1 UfuUfaUfuGfuUfCfCfuCfuAfgUfuAfuUf A-108321.2 aAfuAfaCfuAfgAfggaAfcAfaUfaAfasAfsa AD-52680.1 A-108832.1 UfgCfuAfuGfuUfAfGfaCfgAfuGfuAfaAf A-108337.2 uUfuAfcAfuCfgUfcuaAfcAfuAfgCfasAfsa AD-52681.1 A-108840.1 GfgGfaCfaUfgGfUfCfuUfaAfaGfaCfuUf A-108353.2 aAfgUfcUfuUfaAfgacCfaUfgUfcCfcsAfsa AD-52682.1 A-108848.1 UfgAfcAfuAfuUfUfCfaAfaAfaCfuCfaAf A-108369.2 uUfgAfgUfuUfuUfgaaAfuAfuGfuCfasUfsu AD-52683.1 A-108856.1 AfuCfaGfuCfuUfUfUfuAfuGfaUfcUfaUf A-108385.2 aUfaGfaUfcAfuAfaaaAfgAfcUfgAfusCfsa AD-52684.1 A-108864.1 CfaUfaUfaAfaCfUfAfcAfaGfuCfaAfaAf A-108401.2 uUfuUfgAfcUfuGfuagUfuUfaUfaUfgsUfsa AD-52685.1 A-108872.1 CfuUfgAfaCfuCfAfAfcUfcAfaAfaCfuUf A-108417.2 aAfgUfuUfuGfaGfuugAfgUfuCfaAfgsUfsg AD-52686.1 A-108880.1 CfuAfcUfuCfaAfCfAfaAfaAfgUfgAfaAf A-108433.2 uUfuCfaCfuUfuUfuguUfgAfaGfuAfgsAfsa AD-52687.1 A-108888.1 AfaGfaGfcAfaCfUfAfaCfuAfaCfuUfaAf A-108449.2 uUfaAfgUfuAfgUfuagUfuGfcUfcUfusCfsu AD-52688.1 A-108896.1 AfaAfcAfaGfaUfAfAfuAfgCfaUfcAfaAf A-108465.2 uUfuGfaUfgCfuAfuuaUfcUfuGfuUfusUfsu AD-52689.1 A-108904.1 GfcAfuAfgUfcAfAfAfuAfaAfaGfaAfaUf A-108481.2 aUfuUfcUfuUfuAfuuuGfaCfuAfuGfcsUfsg AD-52690.1 A-108865.1 AfuAfuAfaAfcUfAfCfaAfgUfcAfaAfaAf A-108403.2 uUfuUfuGfaCfuUfguaGfuUfuAfuAfusGfsu AD-52691.1 A-108873.1 GfaAfcUfcAfaCfUfCfaAfaAfcUfuGfaAf A-108419.2 uUfcAfaGfuUfuUfgagUfuGfaGfuUfcsAfsa AD-52692.1 A-108881.1 UfaCfuUfcAfaCfAfAfaAfaGfuGfaAfaUf A-108435.2 aUfuUfcAfcUfuUfuugUfuGfaAfgUfasGfsa AD-52693.1 A-108889.1 AfgAfgCfaAfcUfAfAfcUfaAfcUfuAfaUf A-108451.2 aUfuAfaGfuUfaGfuuaGfuUfgCfuCfusUfsc AD-52694.1 A-108897.1 GfaUfaAfuAfgCfAfUfcAfaAfgAfcCfuUf A-108467.2 aAfgGfuCfuUfuGfaugCfuAfuUfaUfcsUfsu AD-52695.1 A-108905.1 CfaUfaGfuCfaAfAfUfaAfaAfgAfaAfuAf A-108483.2 uAfuUfuCfuUfuUfauuUfgAfcUfaUfgsCfsu AD-52696.1 A-108866.1 UfaUfaAfaCfuAfCfAfaGfuCfaAfaAfaUf A-108405.2 aUfuUfuUfgAfcUfuguAfgUfuUfaUfasUfsg AD-52697.1 A-108874.1 AfaCfuCfaAfcUfCfAfaAfaCfuUfgAfaAf A-108421.2 uUfuCfaAfgUfuUfugaGfuUfgAfgUfusCfsa AD-52698.1 A-108882.1 AfcUfuCfaAfcAfAfAfaAfgUfgAfaAfuAf A-108437.2 uAfuUfuCfaCfuUfuuuGfuUfgAfaGfusAfsg AD-52699.1 A-108890.1 GfaGfcAfaCfuAfAfCfuAfaCfuUfaAfuUf A-108453.2 aAfuUfaAfgUfuAfguuAfgUfuGfcUfcsUfsu AD-52700.1 A-108898.1 AfaCfcAfaCfaGfCfAfuAfgUfcAfaAfuAf A-108469.2 uAfuUfuGfaCfuAfugcUfgUfuGfgUfusUfsa AD-52701.1 A-108906.1 AfgUfcAfaAfuAfAfAfaGfaAfaUfaGfaAf A-108485.2 uUfcUfaUfuUfcUfuuuAfuUfuGfaCfusAfsu AD-52702.1 A-108867.1 AfgUfcAfaAfaAfUfGfaAfgAfgGfuAfaAf A-108407.2 uUfuAfcCfuCfuUfcauUfuUfuGfaCfusUfsg AD-52703.1 A-108875.1 CfuUfgAfaAfgCfCfUfcCfuAfgAfaGfaAf A-108423.2 uUfcUfuCfuAfgGfaggCfuUfuCfaAfgsUfsu AD-52704.1 A-108883.1 CfuUfcAfaCfaAfAfAfaGfuGfaAfaUfaUf A-108439.2 aUfaUfuUfcAfcUfuuuUfgUfuGfaAfgsUfsa AD-52705.1 A-108891.1 CfaAfcUfaAfcUfAfAfcUfuAfaUfuCfaAf A-108455.2 uUfgAfaUfuAfaGfuuaGfuUfaGfuUfgsCfsu AD-52706.1 A-108899.1 AfcCfaAfcAfgCfAfUfaGfuCfaAfaUfaAf A-108471.2 uUfaUfuUfgAfcUfaugCfuGfuUfgGfusUfsu AD-52707.1 A-108907.1 GfaAfcCfcAfcAfGfAfaAfuUfuCfuCfuAf A-108487.2 uAfgAfgAfaAfuUfucuGfuGfgGfuUfcsUfsu AD-52708.1 A-108868.1 GfaAfuAfuGfuCfAfCfuUfgAfaCfuCfaAf A-108409.2 uUfgAfgUfuCfaAfgugAfcAfuAfuUfcsUfsu AD-52709.1 A-108876.1 UfgAfaAfgCfcUfCfCfuAfgAfaGfaAfaAf A-108425.2 uUfuUfcUfuCfuAfggaGfgCfuUfuCfasAfsg AD-52710.1 A-108884.1 UfuCfaAfcAfaAfAfAfgUfgAfaAfuAfuUf A-108441.2 aAfuAfuUfuCfaCfuuuUfuGfuUfgAfasGfsu AD-52711.1 A-108892.1 AfaCfuAfaCfuAfAfCfuUfaAfuUfcAfaAf A-108457.2 uUfuGfaAfuUfaAfguuAfgUfuAfgUfusGfsc AD-52712.1 A-108900.1 CfcAfaCfaGfcAfUfAfgUfcAfaAfuAfaAf A-108473.2 uUfuAfuUfuGfaCfuauGfcUfgUfuGfgsUfsu AD-52713.1 A-108908.1 AfaCfcCfaCfaGfAfAfaUfuUfcUfcUfaUf A-108489.2 aUfaGfaGfaAfaUfuucUfgUfgGfgUfusCfsu AD-52714.1 A-108869.1 UfgUfcAfcUfuGfAfAfcUfcAfaCfuCfaAf A-108411.2 uUfgAfgUfuGfaGfuucAfaGfuGfaCfasUfsa AD-52715.1 A-108877.1 GfaAfaGfcCfuCfCfUfaGfaAfgAfaAfaAf A-108427.2 uUfuUfuCfuUfcUfaggAfgGfcUfuUfcsAfsa AD-52716.1 A-108885.1 AfaUfaUfuUfaGfAfAfgAfgCfaAfcUfaAf A-108443.2 uUfaGfuUfgCfuCfuucUfaAfaUfaUfusUfsc AD-52717.1 A-108893.1 AfcUfaAfcUfaAfCfUfuAfaUfuCfaAfaAf A-108459.2 uUfuUfgAfaUfuAfaguUfaGfuUfaGfusUfsg AD-52718.1 A-108901.1 CfaAfcAfgCfaUfAfGfuCfaAfaUfaAfaAf A-108475.2 uUfuUfaUfuUfgAfcuaUfgCfuGfuUfgsGfsu AD-52719.1 A-108909.1 CfcAfcAfgAfaAfUfUfuCfuCfuAfuCfuUf A-108491.2 aAfgAfuAfgAfgAfaauUfuCfuGfuGfgsGfsu AD-52720.1 A-108870.1 GfuCfaCfuUfgAfAfCfuCfaAfcUfcAfaAf A-108413.2 uUfuGfaGfuUfgAfguuCfaAfgUfgAfcsAfsu AD-52721.1 A-108878.1 CfuCfcUfaGfaAfGfAfaAfaAfaUfuCfuAf A-108429.2 uAfgAfaUfuUfuUfucuUfcUfaGfgAfgsGfsc AD-52722.1 A-108886.1 AfuUfuAfgAfaGfAfGfcAfaCfuAfaCfuAf A-108445.2 uAfgUfuAfgUfuGfcucUfuCfuAfaAfusAfsu AD-52723.1 A-108894.1 CfuAfaCfuAfaCfUfUfaAfuUfcAfaAfaUf A-108461.2 aUfuUfuGfaAfuUfaagUfuAfgUfuAfgsUfsu AD-52724.1 A-108902.1 CfaGfcAfuAfgUfCfAfaAfuAfaAfaGfaAf A-108477.2 uUfcUfuUfuAfuUfugaCfuAfuGfcUfgsUfsu AD-52725.1 A-108910.1 GfaAfaUfaAfgAfAfAfuGfuAfaAfaCfaUf A-108493.2 aUfgUfuUfuAfcAfuuuCfuUfaUfuUfcsAfsu AD-52726.1 A-108871.1 UfcAfcUfuGfaAfCfUfcAfaCfuCfaAfaAf A-108415.2 uUfuUfgAfgUfuGfaguUfcAfaGfuGfasCfsa AD-52727.1 A-108879.1 UfcUfaCfuUfcAfAfCfaAfaAfaGfuGfaAf A-108431.2 uUfcAfcUfuUfuUfguuGfaAfgUfaGfasAfsu AD-52728.1 A-108887.1 UfuUfaGfaAfgAfGfCfaAfcUfaAfcUfaAf A-108447.2 uUfaGfuUfaGfuUfgcuCfuUfcUfaAfasUfsa AD-52729.1 A-108895.1 AfaAfaCfaAfgAfUfAfaUfaGfcAfuCfaAf A-108463.2 uUfgAfuGfcUfaUfuauCfuUfgUfuUfusUfsc AD-52730.1 A-108903.1 AfgCfaUfaGfuCfAfAfaUfaAfaAfgAfaAf A-108479.2 uUfuCfuUfuUfaUfuugAfcUfaUfgCfusGfsu AD-52731.1 A-108958.1 AfgAfcCfcAfgCfAfAfcUfcUfcAfaGfuUf A-108495.2 aAfcUfuGfaGfaGfuugCfuGfgGfuCfusGfsa AD-52732.1 A-108966.1 AfgUfcCfaUfgGfAfCfaUfuAfaUfuCfaAf A-108511.2 uUfgAfaUfuAfaUfgucCfaUfgGfaCfusAfsc AD-52733.1 A-108974.1 GfaUfgGfaUfcAfCfAfaAfaCfuUfcAfaUf A-108527.2 aUfuGfaAfgUfuUfuguGfaUfcCfaUfcsUfsa AD-52734.1 A-108982.1 CfuAfgAfgAfaGfAfUfaUfaCfuCfcAfuAf A-108543.2 uAfuGfgAfgUfaUfaucUfuCfuCfuAfgsGfsc AD-52735.1 A-108990.1 AfaAfgAfcAfaCfAfAfaCfaUfuAfuAfuUf A-108559.2 aAfuAfuAfaUfgUfuugUfuGfuCfuUfusCfsc AD-52736.1 A-108998.1 CfaUfuAfuAfuUfGfAfaUfaUfuCfuUfuUf A-108575.2 aAfaAfgAfaUfaUfucaAfuAfuAfaUfgsUfsu AD-52737.1 A-108959.1 GfaCfcCfaGfcAfAfCfuCfuCfaAfgUfuUf A-108497.2 aAfaCfuUfgAfgAfguuGfcUfgGfgUfcsUfsg AD-52739.1 A-108975.1 GfgAfuCfaCfaAfAfAfcUfuCfaAfuGfaAf A-108529.2 uUfcAfuUfgAfaGfuuuUfgUfgAfuCfcsAfsu AD-52740.1 A-108983.1 GfaAfgAfuAfuAfCfUfcCfaUfaGfuGfaAf A-108545.2 uUfcAfcUfaUfgGfaguAfuAfuCfuUfcsUfsc AD-52741.1 A-108991.1 GfaCfaAfcAfaAfCfAfuUfaUfaUfuGfaAf A-108561.2 uUfcAfaUfaUfaAfuguUfuGfuUfgUfcsUfsu AD-52742.1 A-108999.1 GfgGfaAfaUfcAfCfGfaAfaCfcAfaCfuAf A-108577.2 uAfgUfuGfgUfuUfcguGfaUfuUfcCfcsAfsa AD-52743.1 A-108960.1 AfcCfcAfgCfaAfCfUfcUfcAfaGfuUfuUf A-108499.2 aAfaAfcUfuGfaGfaguUfgCfuGfgGfusCfsu AD-52744.1 A-108968.1 GfgAfcAfuUfaAfUfUfcAfaCfaUfcGfaAf A-108515.2 uUfcGfaUfgUfuGfaauUfaAfuGfuCfcsAfsu AD-52745.1 A-108976.1 GfaUfcAfcAfaAfAfCfuUfcAfaUfgAfaAf A-108531.2 uUfuCfaUfuGfaAfguuUfuGfuGfaUfcsCfsa AD-52746.1 A-108984.1 AfcUfcCfaUfaGfUfGfaAfgCfaAfuCfuAf A-108547.2 uAfgAfuUfgCfuUfcacUfaUfgGfaGfusAfsu AD-52747.1 A-108992.1 AfcAfaCfaAfaCfAfUfuAfuAfuUfgAfaUf A-108563.2 aUfuCfaAfuAfuAfaugUfuUfgUfuGfusCfsu AD-52748.1 A-109000.1 GfgAfaAfuCfaCfGfAfaAfcCfaAfcUfaUf A-108579.2 aUfaGfuUfgGfuUfucgUfgAfuUfuCfcsCfsa AD-52749.1 A-108961.1 CfcCfaGfcAfaCfUfCfuCfaAfgUfuUfuUf A-108501.2 aAfaAfaCfuUfgAfgagUfuGfcUfgGfgsUfsc AD-52750.1 A-108969.1 GfaCfaUfuAfaUfUfCfaAfcAfuCfgAfaUf A-108517.2 aUfuCfgAfuGfuUfgaaUfuAfaUfgUfcsCfsa AD-52751.1 A-108977.1 AfaCfgUfgGfgAfGfAfaCfuAfcAfaAfuAf A-108533.2 uAfuUfuGfuAfgUfucuCfcCfaCfgUfusUfsc AD-52752.1 A-108985.1 CfuCfcAfuAfgUfGfAfaGfcAfaUfcUfaAf A-108549.2 uUfaGfaUfuGfcUfucaCfuAfuGfgAfgsUfsa AD-52753.1 A-108993.1 CfaAfcAfaAfcAfUfUfaUfaUfuGfaAfuAf A-108565.2 uAfuUfcAfaUfaUfaauGfuUfuGfuUfgsUfsc AD-52754.1 A-109001.1 GfaAfaUfcAfcGfAfAfaCfcAfaCfuAfuAf A-108581.2 uAfuAfgUfuGfgUfuucGfuGfaUfuUfcsCfsc AD-52755.1 A-108962.1 CfuCfuCfaAfgUfUfUfuUfcAfuGfuCfuAf A-108503.2 uAfgAfcAfuGfaAfaaaCfuUfgAfgAfgsUfsu AD-52756.1 A-108970.1 AfcAfuUfaAfuUfCfAfaCfaUfcGfaAfuAf A-108519.2 uAfuUfcGfaUfgUfugaAfuUfaAfuGfusCfsc AD-52757.1 A-108978.1 GfgGfaGfaAfcUfAfCfaAfaUfaUfgGfuUf A-108535.2 aAfcCfaUfaUfuUfguaGfuUfcUfcCfcsAfsc AD-52758.1 A-108986.1 UfcCfaUfaGfuGfAfAfgCfaAfuCfuAfaUf A-108551.2 aUfuAfgAfuUfgCfuucAfcUfaUfgGfasGfsu AD-52759.1 A-108994.1 AfaCfaAfaCfaUfUfAfuAfuUfgAfaUfaUf A-108567.2 aUfaUfuCfaAfuAfuaaUfgUfuUfgUfusGfsu AD-52760.1 A-109002.1 UfgGfcAfaUfgUfCfCfcCfaAfuGfcAfaUf A-108583.2 aUfuGfcAfuUfgGfggaCfaUfuGfcCfasGfsu AD-52761.1 A-108963.1 UfcAfgGfuAfgUfCfCfaUfgGfaCfaUfuAf A-108505.2 uAfaUfgUfcCfaUfggaCfuAfcCfuGfasUfsa AD-52762.1 A-108971.1 UfuAfaUfuCfaAfCfAfuCfgAfaUfaGfaUf A-108521.2 aUfcUfaUfuCfgAfuguUfgAfaUfuAfasUfsg AD-52763.1 A-108979.1 GfgAfgAfaCfuAfCfAfaAfuAfuGfgUfuUf A-108537.2 aAfaCfcAfuAfuUfuguAfgUfuCfuCfcsCfsa AD-52764.1 A-108987.1 CfcAfuAfgUfgAfAfGfcAfaUfcUfaAfuUf A-108553.2 aAfuUfaGfaUfuGfcuuCfaCfuAfuGfgsAfsg AD-52765.1 A-108995.1 AfcAfaAfcAfuUfAfUfaUfuGfaAfuAfuUf A-108569.2 aAfuAfuUfcAfaUfauaAfuGfuUfuGfusUfsg AD-52766.1 A-109003.1 AfaUfgCfaAfuCfCfCfgGfaAfaAfcAfaAf A-108585.2 uUfuGfuUfuUfcCfgggAfuUfgCfaUfusGfsg AD-52767.1 A-108964.1 CfaGfgUfaGfuCfCfAfuGfgAfcAfuUfaAf A-108507.2 uUfaAfuGfuCfcAfuggAfcUfaCfcUfgsAfsu AD-52768.1 A-108972.1 UfuCfaAfcAfuCfGfAfaUfaGfaUfgGfaUf A-108523.2 aUfcCfaUfcUfaUfucgAfuGfuUfgAfasUfsu AD-52769.1 A-108980.1 GfuUfgGfgCfcUfAfGfaGfaAfgAfuAfuAf A-108539.2 uAfuAfuCfuUfcUfcuaGfgCfcCfaAfcsCfsa AD-52770.1 A-108988.1 CfaUfaGfuGfaAfGfCfaAfuCfuAfaUfuAf A-108555.2 uAfaUfuAfgAfuUfgcuUfcAfcUfaUfgsGfsa AD-52771.1 A-108996.1 AfaCfaUfuAfuAfUfUfgAfaUfaUfuCfuUf A-108571.2 aAfgAfaUfaUfuCfaauAfuAfaUfgUfusUfsg AD-52772.1 A-109004.1 GfcAfaUfcCfcGfGfAfaAfaCfaAfaGfaUf A-108587.2 aUfcUfuUfgUfuUfuccGfgGfaUfuGfcsAfsu AD-52773.1 A-108965.1 GfgUfaGfuCfcAfUfGfgAfcAfuUfaAfuUf A-108509.2 aAfuUfaAfuGfuCfcauGfgAfcUfaCfcsUfsg AD-52774.1 A-108973.1 AfuCfgAfaUfaGfAfUfgGfaUfcAfcAfaAf A-108525.2 uUfuGfuGfaUfcCfaucUfaUfuCfgAfusGfsu AD-52775.1 A-108981.1 CfcUfaGfaGfaAfGfAfuAfuAfcUfcCfaUf A-108541.2 aUfgGfaGfuAfuAfucuUfcUfcUfaGfgsCfsc AD-52776.1 A-108989.1 GfuUfgGfaAfgAfCfUfgGfaAfaGfaCfaAf A-108557.2 uUfgUfcUfuUfcCfaguCfuUfcCfaAfcsUfsc AD-52777.1 A-108997.1 AfcAfuUfaUfaUfUfGfaAfuAfuUfcUfuUf A-108573.2 aAfaGfaAfuAfuUfcaaUfaUfaAfuGfusUfsu AD-52778.1 A-109005.1 CfaAfuCfcCfgGfAfAfaAfcAfaAfgAfuUf A-108589.2 aAfuCfuUfuGfuUfuucCfgGfgAfuUfgsCfsa AD-52779.1 A-109013.1 CfuAfcUfuGfgGfAfUfcAfcAfaAfgCfaAf A-108605.2 uUfgCfuUfuGfuGfaucCfcAfaGfuAfgsAfsa AD-52780.1 A-109021.1 AfcAfaCfcUfaAfAfUfgGfuAfaAfuAfuAf A-108621.2 uAfuAfuUfuAfcCfauuUfaGfgUfuGfusUfsu AD-52781.1 A-109029.1 AfuCfcAfuCfcAfAfCfaGfaUfuCfaGfaAf A-108637.2 uUfcUfgAfaUfcUfguuGfgAfuGfgAfusCfsa AD-52782.1 A-109037.1 AfaCfuGfaGfgCfAfAfaUfuUfaAfaAfgAf A-108653.2 uCfuUfuUfaAfaUfuugCfcUfcAfgUfusCfsa AD-52783.1 A-109045.1 AfgAfgUfaUfgUfGfUfaAfaAfaUfcUfgUf A-108669.2 aCfaGfaUfuUfuUfacaCfaUfaCfuCfusGfsu AD-52784.1 A-109006.1 AfaUfcCfcGfgAfAfAfaCfaAfaGfaUfuUf A-108591.2 aAfaUfcUfuUfgUfuuuCfcGfgGfaUfusGfsc AD-52785.1 A-109014.1 UfaCfuUfgGfgAfUfCfaCfaAfaGfcAfaAf A-108607.2 uUfuGfcUfuUfgUfgauCfcCfaAfgUfasGfsa AD-52786.1 A-109022.1 CfaAfcCfuAfaAfUfGfgUfaAfaUfaUfaAf A-108623.2 uUfaUfaUfuUfaCfcauUfuAfgGfuUfgsUfsu AD-52787.1 A-109030.1 UfuGfaAfuGfaAfCfUfgAfgGfcAfaAfuUf A-108639.2 aAfuUfuGfcCfuCfaguUfcAfuUfcAfasAfsg AD-52788.1 A-109038.1 AfcUfgAfgGfcAfAfAfuUfuAfaAfaGfgAf A-108655.2 uCfcUfuUfuAfaAfuuuGfcCfuCfaGfusUfsc AD-52789.1 A-109046.1 GfaGfuAfuGfuGfUfAfaAfaAfuCfuGfuAf A-108671.2 uAfcAfgAfuUfuUfuacAfcAfuAfcUfcsUfsg AD-52791.1 A-109015.1 AfcUfuGfgGfaUfCfAfcAfaAfgCfaAfaAf A-108609.2 uUfuUfgCfuUfuGfugaUfcCfcAfaGfusAfsg AD-52792.1 A-109023.1 AfuGfgUfaAfaUfAfUfaAfcAfaAfcCfaAf A-108625.2 uUfgGfuUfuGfuUfauaUfuUfaCfcAfusUfsu AD-52793.1 A-109031.1 UfgAfaUfgAfaCfUfGfaGfgCfaAfaUfuUf A-108641.2 aAfaUfuUfgCfcUfcagUfuCfaUfuCfasAfsa AD-52794.1 A-109039.1 CfuGfaGfgCfaAfAfUfuUfaAfaAfgGfcAf A-108657.2 uGfcCfuUfuUfaAfauuUfgCfcUfcAfgsUfsu AD-52795.1 A-109047.1 AfgUfaUfgUfgUfAfAfaAfaUfcUfgUfaAf A-108673.2 uUfaCfaGfaUfuUfuuaCfaCfaUfaCfusCfsu AD-52796.1 A-109008.1 GfaAfaAfcAfaAfGfAfuUfuGfgUfgUfuUf A-108595.2 aAfaCfaCfcAfaAfucuUfuGfuUfuUfcsCfsg AD-52797.1 A-109016.1 AfgUfgUfgGfaGfAfAfaAfcAfaCfcUfaAf A-108611.2 uUfaGfgUfuGfuUfuucUfcCfaCfaCfusCfsa AD-52798.1 A-109024.1 GfuCfuCfaAfaAfUfGfgAfaGfgUfuAfuAf A-108627.2 uAfuAfaCfcUfuCfcauUfuUfgAfgAfcsUfsu AD-52799.1 A-109032.1 GfaAfuGfaAfcUfGfAfgGfcAfaAfuUfuAf A-108643.2 uAfaAfuUfuGfcCfucaGfuUfcAfuUfcsAfsa AD-52800.1 A-109040.1 UfgAfgGfcAfaAfUfUfuAfaAfaGfgCfaAf A-108659.2 uUfgCfcUfuUfuAfaauUfuGfcCfuCfasGfsu AD-52801.1 A-109048.1 GfuAfuGfuGfuAfAfAfaAfuCfuGfuAfaUf A-108675.2 aUfuAfcAfgAfuUfuuuAfcAfcAfuAfcsUfsc AD-52802.1 A-109009.1 AfaAfaCfaAfaGfAfUfuUfgGfuGfuUfuUf A-108597.2 aAfaAfcAfcCfaAfaucUfuUfgUfuUfusCfsc AD-52803.1 A-109017.1 GfuGfuGfgAfgAfAfAfaCfaAfcCfuAfaAf A-108613.2 uUfuAfgGfuUfgUfuuuCfuCfcAfcAfcsUfsc AD-52804.1 A-109025.1 AfuGfgAfaGfgUfUfAfuAfcUfcUfaUfaAf A-108629.2 uUfaUfaGfaGfuAfuaaCfcUfuCfcAfusUfsu AD-52805.1 A-109033.1 AfaUfgAfaCfuGfAfGfgCfaAfaUfuUfaAf A-108645.2 uUfaAfaUfuUfgCfcucAfgUfuCfaUfusCfsa AD-52806.1 A-109041.1 GfaGfgCfaAfaUfUfUfaAfaAfgGfcAfaUf A-108661.2 aUfuGfcCfuUfuUfaaaUfuUfgCfcUfcsAfsg AD-52807.1 A-109049.1 UfaUfgUfgUfaAfAfAfaUfcUfgUfaAfuAf A-108677.2 uAfuUfaCfaGfaUfuuuUfaCfaCfaUfasCfsu AD-52808.1 A-109010.1 AfcAfaAfgAfuUfUfGfgUfgUfuUfuCfuAf A-108599.2 uAfgAfaAfaCfaCfcaaAfuCfuUfuGfusUfsu AD-52809.1 A-109018.1 UfgUfgGfaGfaAfAfAfcAfaCfcUfaAfaUf A-108615.2 aUfuUfaGfgUfuGfuuuUfcUfcCfaCfasCfsu AD-52810.1 A-109026.1 UfgGfaAfgGfuUfAfUfaCfuCfuAfuAfaAf A-108631.2 uUfuAfuAfgAfgUfauaAfcCfuUfcCfasUfsu AD-52811.1 A-109034.1 AfuGfaAfcUfgAfGfGfcAfaAfuUfuAfaAf A-108647.2 uUfuAfaAfuUfuGfccuCfaGfuUfcAfusUfsc AD-52812.1 A-109042.1 AfgGfcAfaAfuUfUfAfaAfaGfgCfaAfuAf A-108663.2 uAfuUfgCfcUfuUfuaaAfuUfuGfcCfusCfsa AD-52813.1 A-109011.1 AfaGfaUfuUfgGfUfGfuUfuUfcUfaCfuUf A-108601.2 aAfgUfaGfaAfaAfcacCfaAfaUfcUfusUfsg AD-52814.1 A-109019.1 AfaAfcAfaCfcUfAfAfaUfgGfuAfaAfuAf A-108617.2 uAfuUfuAfcCfaUfuuaGfgUfuGfuUfusUfsc AD-52815.1 A-109027.1 AfuAfcUfcUfaUfAfAfaAfuCfaAfcCfaAf A-108633.2 uUfgGfuUfgAfuUfuuaUfaGfaGfuAfusAfsa AD-52816.1 A-109035.1 UfgAfaCfuGfaGfGfCfaAfaUfuUfaAfaAf A-108649.2 uUfuUfaAfaUfuUfgccUfcAfgUfuCfasUfsu AD-52817.1 A-109043.1 GfgCfaAfaUfuUfAfAfaAfgGfcAfaUfaAf A-108665.2 uUfaUfuGfcCfuUfuuaAfaUfuUfgCfcsUfsc AD-52818.1 A-109012.1 UfuUfuCfuAfcUfUfGfgGfaUfcAfcAfaAf A-108603.2 uUfuGfuGfaUfcCfcaaGfuAfgAfaAfasCfsa AD-52819.1 A-109020.1 AfaCfaAfcCfuAfAfAfuGfgUfaAfaUfaUf A-108619.2 aUfaUfuUfaCfcAfuuuAfgGfuUfgUfusUfsu AD-52820.1 A-109028.1 UfaCfuCfuAfuAfAfAfaUfcAfaCfcAfaAf A-108635.2 uUfuGfgUfuGfaUfuuuAfuAfgAfgUfasUfsa AD-52821.1 A-109036.1 GfaAfcUfgAfgGfCfAfaAfuUfuAfaAfaAf A-108651.2 uUfuUfuAfaAfuUfugcCfuCfaGfuUfcsAfsu AD-52822.1 A-109044.1 CfaGfaGfuAfuGfUfGfuAfaAfaAfuCfuUf A-108667.2 aAfgAfuUfuUfuAfcacAfuAfcUfcUfgsUfsg

Table 11
Single dose screening results using GalNac-conjugated dsRNA ANGPTL3
The modified dsRNAs were tested by transfection of HEP3b cells and free uptake in cynomolgus monkey (PCH) cells at the above doses. Duplex ID 10 nM (RNAimax) 0.1 nM (RNAimax) 500 nM PCH Celsis (FU) 100 nM PCH Celsis (FU) 10 nM PCH Celsis (FU) std. deviation 10 nM (RNAimax) std. deviation 0.1 nM (RNAimax) std. deviation 500 nM (FU) std. deviation 100 nM (FU) std. deviation 10 nM (FU) AD1955/ native FU 0.93 0.93 1.01 0.91 1.17 0.02 0.08 0.09 0.00 0.07 AD1955/ native FU 1.02 1.09 1.07 1.07 0.92 0.06 0.04 0.02 0.00 0.03 AD1955/ native FU 1.06 0.99 0.93 1.02 0.93 0.03 0.00 0.09 0.01 0.02 AD1955/ native FU 1.05 0.90 1.05 1.03 1.03 0.04 0.02 0.01 0.05 0.01 AD1955/ native FU 1.06 1.08 0.90 0.97 1.03 0.02 0.01 0.02 0.04 0.09 AD1955/ native FU 0.90 1.03 1.05 1.00 0.94 0.04 0.03 0.01 0.04 0.05 AD-45165 (TTR) 0.91 0.98 1.06 0.98 0.96 0.05 0.01 0.05 0.00 0.00 AD-52953.1 0.06 0.34 0.15 0.17 0.46 0.00 0.01 0.00 0.01 0.01 AD-52954.1 0.09 0.39 0.17 0.20 0.55 0.00 0.01 0.00 0.01 0.00 AD-52955.1 0.11 0.59 0.38 0.41 0.75 0.01 0.04 0.02 0.01 0.12 AD-52956.1 0.31 0.94 0.79 0.94 1.17 0.01 0.00 0.02 0.06 0.02 AD-52957.1 0.13 0.61 0.35 0.38 0.73 0.01 0.00 0.01 0.00 0.04 AD-52958.1 0.19 0.74 0.66 0.71 0.97 0.01 0.01 0.02 0.07 0.06 AD-52960.1 0.14 0.59 0.31 0.32 0.55 0.01 0.01 0.00 0.02 0.02 AD-52961.1 0.05 0.66 0.27 0.24 0.49 0.00 0.00 0.00 0.02 0.02 AD-52962.1 0.83 0.89 1.03 1.02 1.26 0.02 0.05 0.07 0.07 0.07 AD-52963.1 0.07 0.72 0.46 0.56 0.91 0.00 0.00 0.00 0.00 0.06 AD-52964.1 0.13 0.73 0.41 0.47 0.68 0.01 0.03 0.02 0.03 0.01 AD-52965.1 0.07 0.44 0.16 0.18 0.43 0.00 0.01 0.00 0.01 0.01 AD-52966.1 0.12 0.76 0.67 0.72 0.96 0.00 0.02 0.05 0.01 0.01 AD-52967.1 0.10 0.75 0.44 0.58 0.89 0.01 0.04 0.02 0.03 0.04 AD-52968.1 1.01 0.96 0.87 0.91 1.15 0.00 0.01 0.09 0.03 0.02 AD-52969.1 0.04 0.46 0.22 0.29 0.59 0.00 0.00 0.01 0.02 0.04 AD-52970.1 0.06 0.45 0.27 0.30 0.51 0.00 0.00 0.01 0.02 0.00 AD-52971.1 0.08 0.55 0.20 0.22 0.45 0.00 0.00 0.01 0.02 0.05 AD-52972.1 0.10 0.73 0.41 0.49 0.81 0.00 0.01 0.01 0.02 0.01 AD-52973.1 0.11 0.73 0.36 0.46 0.75 0.01 0.01 0.03 0.02 0.02 AD-52974.1 1.00 0.95 1.00 1.09 1.27 0.01 0.01 0.08 0.05 0.06 AD-52975.1 0.07 0.54 0.25 0.34 0.66 0.00 0.01 0.01 0.01 0.03 AD-52976.1 0.17 0.59 0.35 0.41 0.65 0.00 0.02 0.04 0.01 0.01 AD-52977.1 0.07 0.45 0.16 0.25 0.50 0.01 0.02 0.00 0.02 0.03 AD-52978.1 0.10 0.72 0.39 0.53 0.77 0.00 0.02 0.00 0.08 0.03 AD-52979.1 0.54 0.92 0.99 1.12 1.28 0.01 0.02 0.02 0.04 0.05 AD-52980.1 0.29 0.85 0.67 0.85 1.03 0.01 0.01 0.05 0.05 0.04 AD-52981.1 0.07 0.44 0.20 0.26 0.59 0.01 0.02 0.00 0.00 0.03 AD-52982.1 0.28 0.87 0.67 0.99 1.14 0.01 0.01 0.04 0.00 0.01 AD-52983.1 0.06 0.40 0.14 0.40 0.46 0.00 0.00 0.01 0.05 0.02 AD-52984.1 0.29 0.87 0.66 0.74 1.09 0.01 0.02 0.01 0.00 0.00 AD-52985.1 0.72 0.87 0.89 1.18 1.22 0.03 0.00 0.05 0.03 0.16 AD-52986.1 0.08 0.47 0.24 0.30 0.48 0.00 0.02 0.02 0.00 0.06 AD-52987.1 0.16 0.83 0.42 0.73 1.09 0.00 0.00 0.01 0.02 0.02 AD-52988.1 0.11 0.73 0.42 0.60 0.96 0.01 0.04 0.00 0.00 0.10 AD-52989.1 0.05 0.48 0.15 0.42 0.46 0.00 0.02 0.00 0.02 0.00 AD-52990.1 0.14 0.86 0.33 0.45 0.77 0.00 0.01 0.00 0.02 0.05 AD-52991.1 0.16 0.86 0.58 0.69 1.05 0.00 0.00 0.02 0.00 0.02 AD-52992.1 0.08 0.65 0.42 0.56 0.90 0.00 0.01 0.02 0.01 0.00 AD-52993.1 0.13 0.87 0.53 0.76 1.08 0.02 0.03 0.04 0.04 0.00 AD-52994.1 0.10 0.52 0.28 0.33 0.53 0.01 0.00 0.02 0.00 0.01 AD-52995.1 0.06 0.56 0.19 0.41 0.60 0.00 0.01 0.04 0.02 0.05 AD-52996.1 0.09 0.68 0.26 0.47 0.68 0.00 0.03 0.01 0.04 0.01 AD-52997.1 0.59 1.03 0.87 0.51 1.25 0.05 0.01 0.00 0.01 0.01 AD-52998.1 0.09 0.79 0.44 0.55 0.85 0.00 0.00 0.04 0.03 0.10 AD-52999.1 0.08 0.57 0.17 0.36 0.84 0.01 0.00 0.01 0.02 0.00 AD-53000.1 0.38 0.94 0.58 0.67 0.85 0.01 0.02 0.03 0.03 0.02 AD-53001.1 0.05 0.48 0.21 0.18 0.40 0.00 0.00 0.01 0.00 0.05 AD-53002.1 0.07 0.65 0.43 0.48 0.80 0.00 0.05 0.04 0.01 0.02 AD-53003.1 0.05 0.46 0.31 0.34 0.56 0.01 0.01 0.00 0.02 0.05 AD-53004.1 0.05 0.36 0.29 0.66 0.57 0.00 0.01 0.03 0.35 0.02 AD-53005.1 0.05 0.72 0.32 0.58 0.83 0.01 0.00 0.01 0.29 0.00 AD-53006.1 0.21 0.82 0.66 0.77 1.03 0.01 0.00 0.02 0.07 0.02 AD-53007.1 0.12 0.76 0.55 0.73 0.74 0.01 0.00 0.00 0.08 0.20 AD-53008.1 0.07 0.68 0.28 0.36 0.84 0.00 0.02 0.01 0.05 0.03 AD-53009.1 0.10 0.61 0.48 0.60 0.91 0.00 0.02 0.01 0.01 0.06 AD-53010.1 0.05 0.58 0.47 0.54 0.84 0.00 0.02 0.00 0.02 0.03 AD-53011.1 0.07 0.65 0.29 0.34 0.84 0.00 0.03 0.07 0.01 0.04 AD-53012.1 0.06 0.55 0.36 0.45 0.70 0.00 0.03 0.02 0.02 0.00 AD-53013.1 0.11 0.85 0.59 0.70 1.01 0.00 0.00 0.03 0.03 0.02 AD-53014.1 0.16 0.78 0.61 0.78 1.11 0.00 0.02 0.01 0.05 0.00 AD-53015.1 0.03 0.35 0.25 0.37 0.46 0.01 0.01 0.01 0.00 0.01 AD-53016.1 0.03 0.56 0.40 0.58 1.01 0.00 0.01 0.02 0.06 0.09 AD-53017.1 0.07 0.71 0.64 0.78 0.98 0.00 0.01 0.01 0.05 0.00 AD-53018.1 0.30 0.96 0.75 0.97 1.14 0.00 0.02 0.02 0.03 0.05 AD-53019.1 0.27 0.99 0.77 1.05 1.31 0.00 0.01 0.01 0.04 0.00 AD-53020.1 0.04 0.64 0.32 0.45 0.69 0.00 0.00 0.03 0.02 0.03 AD-53021.1 0.04 0.68 0.36 0.48 0.70 0.01 0.01 0.02 0.07 0.00 AD-53022.1 0.05 0.76 0.36 0.59 1.04 0.01 0.01 0.02 0.03 0.06 AD-53023.1 0.10 0.83 0.69 0.84 0.97 0.01 0.01 0.06 0.02 0.01 AD-53024.1 0.09 0.44 0.23 0.23 0.44 0.00 0.00 0.03 0.01 0.02 AD-53025.1 0.09 0.87 0.58 0.80 1.09 0.00 0.03 0.01 0.04 0.04 AD-53026.1 0.05 0.60 0.35 0.46 0.77 0.01 0.01 0.02 0.05 0.03 AD-53027.1 0.02 0.32 0.26 0.30 0.45 0.00 0.01 0.02 0.03 0.02 AD-53028.1 0.19 0.82 0.77 0.95 1.04 0.01 0.04 0.05 0.01 0.03 AD-53029.1 0.02 0.52 0.32 0.41 0.72 0.00 0.00 0.01 0.02 0.07 AD-53030.1 0.09 0.42 0.15 0.16 0.46 0.00 0.00 0.00 0.00 0.02 AD-53031.1 0.12 0.79 0.63 0.73 1.04 0.02 0.05 0.02 0.04 0.03 AD-53032.1 0.12 0.71 0.41 0.59 0.90 0.01 0.00 0.02 0.04 0.00 AD-53033.1 0.02 0.48 0.20 0.21 0.51 0.00 0.02 0.02 0.01 0.00 AD-53034.1 0.04 0.52 0.31 0.36 0.71 0.00 0.01 0.07 0.02 0.01 AD-53035.1 0.02 0.63 0.34 0.50 0.85 0.00 0.02 0.03 0.00 0.03 AD-53036.1 0.10 0.57 0.31 0.35 0.65 0.01 0.01 0.03 0.03 0.01 AD-53037.1 0.08 0.47 0.27 0.36 0.60 0.00 0.02 0.01 0.03 0.01 AD-53038.1 0.05 0.85 0.48 0.63 1.08 0.00 0.05 0.00 0.02 0.05 AD-53039.1 0.08 0.82 0.45 0.64 0.97 0.00 0.01 0.01 0.03 0.00 AD-53040.1 0.05 0.79 0.46 0.62 0.97 0.01 0.01 0.01 0.05 0.06 AD-53041.1 0.06 0.72 0.59 0.61 0.86 0.00 0.01 0.05 0.06 0.03 AD-53042.1 0.08 0.85 0.30 0.35 0.81 0.01 0.00 0.00 0.03 0.03 AD-53043.1 0.63 1.00 0.92 1.04 1.07 0.03 0.00 0.06 0.03 0.07 AD-53044.1 0.05 0.91 0.35 0.61 0.97 0.01 0.01 0.01 0.04 0.02 AD-53045.1 0.20 1.00 0.85 1.00 0.98 0.00 0.03 0.04 0.01 0.04 AD-53046.1 0.07 0.70 0.44 0.62 1.12 0.00 0.01 0.03 0.00 0.09 AD-53059.1 0.35 1.04 0.75 0.85 0.86 0.01 0.01 0.03 0.02 0.04 AD-53060.1 0.34 0.85 0.72 0.96 0.82 0.00 0.01 0.02 0.01 0.02 AD-53061.1 0.17 0.94 0.36 0.37 0.59 0.00 0.00 0.02 0.00 0.02 AD-53062.1 0.09 0.76 0.43 0.47 0.69 0.01 0.01 0.01 0.03 0.01 AD-53063.1 0.06 0.48 0.18 0.16 0.25 0.00 0.01 0.01 0.01 0.02 AD-53064.1 0.07 0.59 0.22 0.22 0.48 0.01 0.02 0.01 0.02 0.06 AD-53065.1 0.08 0.97 0.45 0.39 0.64 0.01 0.01 0.02 0.01 0.01 AD-53066.1 0.12 0.99 0.73 0.67 0.88 0.01 0.03 0.01 0.01 0.05 AD-53067.1 0.12 1.08 0.59 0.60 0.79 0.00 0.12 0.01 0.01 0.03 AD-53068.1 0.09 0.98 0.46 0.59 0.83 0.00 0.03 0.04 0.07 0.05 AD-53069.1 0.04 0.69 0.35 0.43 0.59 0.00 0.01 0.01 0.04 0.01 AD-53070.1 0.17 1.12 0.88 0.83 0.98 0.00 0.01 0.04 0.00 0.01 AD-53071.1 0.07 0.70 0.23 0.23 0.43 0.00 0.00 0.02 0.00 0.01 AD-53072.1 0.10 0.90 0.49 0.48 0.75 0.01 0.05 0.00 0.01 0.02 AD-53073.1 0.07 0.63 0.27 0.30 0.43 0.00 0.00 0.01 0.01 0.00 AD-53074.1 0.07 0.88 0.46 0.49 0.62 0.01 0.08 0.01 0.06 0.03 AD-53075.1 0.05 0.76 0.29 0.35 0.50 0.01 0.01 0.00 0.02 0.03 AD-53076.1 0.09 0.80 0.31 0.40 0.54 0.01 0.01 0.02 0.05 0.02 AD-53077.1 0.07 0.96 0.29 0.28 0.49 0.00 0.03 0.00 0.01 0.01 AD-53078.1 0.16 0.95 0.51 0.51 0.70 0.00 0.04 0.01 0.01 0.06 AD-53079.1 0.08 0.96 0.59 0.67 0.83 0.00 0.02 0.01 0.03 0.01 AD-53080.1 0.04 0.63 0.20 0.22 0.43 0.00 0.01 0.00 0.01 0.01 AD-53081.1 0.16 1.02 0.63 0.75 0.87 0.00 0.09 0.00 0.02 0.05 AD-53082.1 0.06 0.94 0.50 0.52 0.66 0.01 0.06 0.02 0.03 0.03 AD-53083.1 0.14 0.87 0.48 0.50 0.80 0.01 0.02 0.04 0.06 0.01 AD-53084.1 0.12 0.95 0.50 0.47 0.72 0.01 0.03 0.04 0.00 0.00 AD-53085.1 0.27 1.02 0.68 0.81 0.99 0.01 0.01 0.01 0.05 0.02 AD-53086.1 0.05 0.60 0.26 0.25 0.48 0.00 0.01 0.03 0.00 0.01 AD-53087.1 0.05 0.56 0.32 0.39 0.53 0.00 0.01 0.01 0.03 0.02 AD-53088.1 0.09 0.89 0.53 0.69 0.87 0.00 0.01 0.02 0.04 0.02 AD-53089.1 0.29 0.97 0.58 0.57 0.78 0.01 0.00 0.02 0.02 0.02 AD-53090.1 0.13 0.86 0.56 0.55 0.73 0.00 0.01 0.01 0.03 0.00 AD-53091.1 0.12 0.82 0.27 0.35 0.66 0.00 0.03 0.03 0.01 0.07 AD-53092.1 0.05 0.66 0.26 0.29 0.42 0.00 0.01 0.02 0.04 0.02 AD-53093.1 0.08 0.68 0.36 0.44 0.55 0.00 0.02 0.03 0.04 0.10 AD-53094.1 0.32 1.00 1.05 0.92 1.11 0.02 0.01 0.01 0.00 0.03 AD-53095.1 0.14 0.77 0.29 0.29 0.49 0.00 0.02 0.00 0.01 0.01 AD-53096.1 0.30 0.96 0.61 0.57 0.73 0.03 0.01 0.02 0.02 0.01 AD-53097.1 0.37 0.97 0.67 0.82 0.86 0.01 0.01 0.01 0.02 0.01 AD-53098.1 0.06 0.65 0.22 0.30 0.43 0.00 0.03 0.03 0.00 0.01 AD-53099.1 0.34 0.99 0.61 0.81 0.91 0.00 0.00 0.04 0.02 0.06 AD-53100.1 0.31 1.04 0.95 1.03 1.00 0.02 0.01 0.06 0.02 0.17 AD-53101.1 0.46 0.93 0.63 0.69 0.78 0.00 0.01 0.04 0.03 0.04 AD-53102.1 0.23 0.80 0.60 0.55 0.66 0.00 0.03 0.01 0.02 0.03 AD-53103.1 0.05 0.61 0.27 0.32 0.50 0.01 0.02 0.00 0.01 0.00 AD-53104.1 0.13 0.80 0.64 0.68 0.77 0.00 0.02 0.03 0.01 0.05 AD-53105.1 0.15 0.77 0.43 0.65 0.77 0.01 0.03 0.02 0.02 0.05 AD-53106.1 0.16 0.87 0.72 0.70 0.83 0.01 0.02 0.00 0.00 0.04 AD-53107.1 0.19 0.95 0.62 0.65 0.90 0.00 0.02 0.01 0.03 0.04 AD-53108.1 0.22 0.94 0.60 0.68 0.81 0.00 0.01 0.00 0.03 0.04 AD-53109.1 0.16 1.01 0.82 0.78 0.96 0.01 0.08 0.04 0.01 0.07 AD-53110.1 0.10 0.86 0.79 0.77 0.94 0.00 0.05 0.03 0.01 0.05 AD-53111.1 0.22 0.78 0.94 0.85 1.04 0.01 0.01 0.01 0.01 0.07 AD-53112.1 0.09 0.96 0.64 0.65 0.86 0.01 0.02 0.07 0.07 0.00 AD-53113.1 0.10 0.97 0.71 0.77 0.88 0.01 0.05 0.01 0.02 0.01 AD-53114.1 0.19 0.83 0.48 0.52 0.66 0.01 0.01 0.02 0.01 0.00 AD-53115.1 0.10 0.59 0.42 0.44 0.66 0.01 0.03 0.04 0.00 0.02 AD-53116.1 0.11 0.87 0.82 0.85 0.95 0.00 0.05 0.05 0.05 0.05 AD-53117.1 0.52 0.64 1.21 1.00 1.08 0.01 0.03 0.09 0.04 0.07 AD-53118.1 0.19 1.04 0.60 0.72 0.94 0.00 0.07 0.02 0.05 0.06 AD-53119.1 0.06 0.77 0.44 0.47 0.64 0.01 0.03 0.00 0.01 0.01 AD-53120.1 0.10 0.97 0.78 0.89 1.01 0.01 0.04 0.05 0.01 0.04 AD-53121.1 0.23 0.80 0.58 0.69 0.90 0.01 0.02 0.04 0.02 0.06 AD-53122.1 0.09 0.80 0.90 0.94 1.09 0.01 0.07 0.02 0.04 0.10 AD-53123.1 0.27 0.74 0.95 0.93 0.97 0.00 0.01 0.03 0.01 0.08 AD-53124.1 0.08 0.81 0.33 0.34 0.61 0.01 0.02 0.00 0.01 0.01 AD-53125.1 0.08 0.82 0.34 0.38 0.58 0.00 0.02 0.00 0.01 0.07 AD-53126.1 0.15 0.95 0.70 0.86 1.06 0.01 0.04 0.05 0.02 0.00 AD-53127.1 0.21 0.81 0.62 0.75 0.91 0.02 0.04 0.01 0.03 0.00 AD-53128.1 0.08 0.79 0.80 1.14 1.09 0.00 0.06 0.04 0.01 0.03 AD-53129.1 0.48 0.78 1.05 1.00 1.10 0.00 0.01 0.06 0.01 0.03 AD-53130.1 0.25 1.08 0.63 0.72 0.88 0.01 0.02 0.00 0.01 0.00 AD-53131.1 0.14 0.96 0.54 0.57 0.81 0.02 0.02 0.05 0.01 0.04 AD-53132.1 0.03 0.54 0.24 0.27 0.49 0.00 0.02 0.02 0.00 0.01 AD-53133.1 0.12 0.76 0.50 0.67 0.93 0.00 0.03 0.01 0.01 0.06 AD-53134.1 0.28 0.86 1.14 0.81 0.97 0.01 0.04 0.05 0.02 0.04 AD-53135.1 0.47 0.74 1.03 0.94 1.09 0.01 0.03 0.04 0.07 0.04 AD-53136.1 0.09 0.99 0.64 0.69 0.94 0.01 0.05 0.01 0.05 0.02 AD-53137.1 0.08 0.75 0.39 0.39 0.59 0.01 0.03 0.00 0.00 0.00 AD-53138.1 0.04 0.71 0.33 0.34 0.60 0.00 0.02 0.00 0.03 0.00 AD-53139.1 0.11 0.76 0.55 0.66 0.84 0.01 0.01 0.06 0.01 0.02 AD-53140.1 0.09 0.71 0.64 0.71 0.86 0.00 0.04 0.01 0.02 0.02 AD-53141.1 0.24 1.09 0.77 0.91 0.93 0.00 0.01 0.00 0.06 0.00 AD-53142.1 0.13 0.95 0.55 0.70 0.82 0.01 0.03 0.03 0.04 0.02 AD-53143.1 0.13 0.91 0.67 0.83 0.94 0.01 0.00 0.03 0.03 0.07 AD-53144.1 0.10 0.72 0.54 0.69 0.84 0.01 0.03 0.01 0.03 0.00 AD-53145.1 0.08 0.72 0.70 0.78 0.88 0.01 0.03 0.01 0.08 0.02 AD-53146.1 0.83 1.07 0.85 0.96 0.98 0.01 0.06 0.00 0.05 0.00 AD-53147.1 0.08 0.56 0.27 0.34 0.47 0.00 0.01 0.01 0.01 0.01 AD-53148.1 0.06 0.81 0.61 0.68 0.74 0.01 0.00 0.03 0.06 0.05 AD-53149.1 0.23 0.86 0.71 0.83 0.92 0.01 0.02 0.06 0.02 0.03 AD-53150.1 0.41 0.70 1.03 1.09 1.03 0.03 0.06 0.03 0.04 0.01

Table 12
Dose-response screening results for ANGPTL3 dsRNA sequences conjugated to GalNac
A subset of active siRNAs from the single dose screen (referring to the data in Table 11) was tested in a dose-response experiment by free cell uptake of PCH. A subset of these active siRNAs were also tested for dose-response on Hep3B cells by transfection. IC ₅₀ (nM) Free takeover Transfection (RNAiMax) AD-53063.1 1.60 0.03 AD-53001.1 2.27 0.01 AD-53015.1 2.90 0.02 AD-52953.1 2.94 0.03 AD-52986.1 3.30 0.03 AD-53024.1 3.42 0.02 AD-53033.1 3.42 0.02 AD-53027.1 3.84 0.01 AD-53030.1 3.90 0.03 AD-53080.1 4.08 0.04 AD-53073.1 4.20 0.05 AD-52965.1 4.63 ND AD-53092.1 5.37 ND AD-53132.1 5.54 ND AD-52983.1 5.55 ND AD-52954.1 5.67 ND AD-52961.1 6.37 ND AD-52994.1 6.43 ND AD-53098.1 6.58 ND AD-52970.1 6.71 ND AD-53075.1 6.74 ND AD-53086.1 7.08 ND AD-52971.1 7.50 ND AD-53064.1 8.33 ND AD-53147.1 8.34 ND AD-52969.1 8.86 ND AD-53077.1 8.98 ND AD-52981.1 9.44 ND AD-52977.1 10.45 ND AD-53071.1 11.19 ND AD-52960.1 13.03 ND AD-53095.1 21.31 ND AD-53103.1 21.92 ND

Table 13
Single dose screening results using the sequences listed in Table 10. Duplex 10 nM 0.1 nM 0.025 nM std. deviation 10 nM std. deviation 0.1 nM std. deviation 0.025 nM AD-52719.1 0.01 0.60 0.35 0.000 0.093 0.002 AD-52717.1 0.02 0.31 0.32 0.001 0.014 0.008 AD-52713.1 0.02 0.37 0.36 0.001 0.011 0.007 AD-52711.1 0.03 0.22 0.23 0.005 0.011 0.009 AD-52718.1 0.03 0.31 0.39 0.000 0.025 0.023 AD-52687.1 0.03 0.37 0.38 0.005 0.020 0.002 AD-52699.1 0.03 0.25 0.21 0.002 0.011 0.002 AD-52679.1 0.03 0.51 0.24 0.345 0.008 AD-52689.1 0.03 0.44 0.42 0.000 0.039 0.002 AD-52700.1 0.03 0.56 0.57 0.005 0.044 0.020 AD-52637.1 0.04 0.27 0.23 0.001 0.003 0.005 AD-52730.1 0.04 0.61 0.59 0.005 0.053 0.014 AD-52725.1 0.04 0.62 0.61 0.002 0.027 0.012 AD-52688.1 0.04 0.23 0.20 0.006 0.012 0.011 AD-52661.1 0.04 0.61 0.25 0.001 0.449 0.009 AD-52667.1 0.04 0.28 0.22 0.004 0.018 0.013 AD-52665.1 0.04 0.43 0.48 0.007 0.019 0.009 AD-52638.1 0.04 0.28 0.25 0.000 0.016 0.027 AD-52724.1 0.05 0.86 0.76 0.001 0.055 0.011 AD-52705.1 0.05 0.74 0.65 0.004 0.022 0.016 AD-52708.1 0.05 0.53 0.52 0.001 0.034 0.013 AD-52659.1 0.05 0.56 0.48 0.000 0.000 0.033 AD-52678.1 0.05 0.53 0.53 0.002 0.034 0.000 AD-52670.1 0.05 0.35 0.33 0.002 0.009 0.003 AD-52695.1 0.05 0.63 0.67 0.001 0.012 0.013 AD-52704.1 0.05 0.55 0.53 0.002 0.005 0.034 AD-52683.1 0.05 0.36 0.28 0.002 0.021 0.011 AD-52673.1 0.05 0.22 0.19 0.023 0.010 0.002 AD-52721.1 0.05 0.60 0.53 0.003 0.006 0.029 AD-52710.1 0.05 0.56 0.40 0.007 0.073 0.000 AD-52714.1 0.05 0.40 0.51 0.000 0.016 0.003 AD-52686.1 0.05 0.57 0.60 0.003 0.014 0.000 AD-52645.1 0.05 0.62 0.59 0.004 0.030 0.003 AD-52662.1 0.05 0.55 0.52 0.002 0.030 0.008 AD-52720.1 0.05 0.50 0.46 0.003 0.007 0.011 AD-52654.1 0.05 0.29 0.36 0.008 0.037 0.014 AD-52680.1 0.06 0.48 0.41 0.001 0.019 0.026 AD-52723.1 0.06 0.84 0.76 0.001 0.041 0.004 AD-52726.1 0.06 0.72 0.66 0.003 0.028 0.016 AD-52701.1 0.06 0.67 0.39 0.001 0.003 0.002 AD-52694.1 0.06 0.68 0.59 0.004 0.040 0.012 AD-52685.1 0.06 0.30 0.25 0.002 0.013 0.016 AD-52728.1 0.06 0.80 0.79 0.005 0.043 0.015 AD-52676.1 0.06 0.68 0.67 0.002 0.023 0.029 AD-52639.1 0.06 0.47 0.45 0.000 0.005 0.007 AD-52722.1 0.06 0.81 0.93 0.005 0.004 0.027 AD-52682.1 0.06 0.87 0.73 0.009 0.038 0.014 AD-52660.1 0.07 0.69 0.68 0.002 0.014 0.017 AD-52709.1 0.07 0.89 0.82 0.001 0.013 0.020 AD-52643.1 0.07 0.27 0.24 0.006 0.016 0.012 AD-52696.1 0.07 0.53 0.46 0.003 0.026 0.007 AD-52657.1 0.08 0.60 0.58 0.008 0.030 0.006 AD-52706.1 0.08 0.84 0.78 0.001 0.021 0.019 AD-52653.1 0.08 0.41 0.45 0.057 0.004 0.029 AD-52656.1 0.08 0.65 0.50 0.004 0.022 0.012 AD-52693.1 0.09 0.61 0.62 0.007 0.021 0.018 AD-52692.1 0.09 0.54 0.52 0.023 0.018 0.033 AD-52674.1 0.10 0.79 0.64 0.001 0.008 0.028 AD-52648.1 0.10 0.67 0.53 0.002 0.013 0.028 AD-52651.1 0.10 0.84 0.73 0.000 0.000 0.007 AD-52641.1 0.10 0.62 0.50 0.004 0.172 0.002 AD-52707.1 0.10 0.92 0.81 0.001 0.018 0.032 AD-52671.1 0.11 0.87 0.84 0.005 0.034 0.025 AD-52650.1 0.12 0.88 0.94 0.007 0.013 0.041 AD-52642.1 0.12 0.90 0.76 0.015 0.022 0.004 AD-52675.1 0.13 0.94 0.89 0.001 0.018 0.044 AD-52647.1 0.13 0.80 0.79 0.031 0.008 0.023 AD-52716.1 0.14 0.61 0.69 0.010 0.060 0.013 AD-52649.1 0.14 0.31 0.29 0.136 0.020 0.006 AD-52677.1 0.16 1.01 0.72 0.059 0.040 0.007 AD-52697.1 0.16 0.86 0.77 0.012 0.021 0.015 AD-52715.1 0.17 0.90 0.89 0.005 0.009 0.022 AD-52691.1 0.18 0.93 0.88 0.004 0.036 0.017 AD-52698.1 0.20 0.97 0.87 0.010 0.028 0.000 AD-52672.1 0.20 0.70 0.66 0.170 0.014 0.019 AD-52712.1 0.29 0.92 0.90 0.007 0.036 0.004 AD-52690.1 0.30 0.95 0.85 0.115 0.032 0.004 AD-52640.1 0.30 1.04 0.91 0.018 0.046 0.013 AD-52684.1 0.31 0.90 0.94 0.014 0.018 0.014 AD-52666.1 0.32 1.04 0.91 0.013 0.005 0.004 AD-52703.1 0.32 1.02 0.96 0.016 0.015 0.005 AD-52729.1 0.33 1.02 0.87 0.032 0.020 0.008 AD-52668.1 0.35 0.94 0.90 0.029 0.046 0.026 AD-52681.1 0.57 1.00 0.99 0.003 0.034 0.039 AD-52702.1 0.72 1.02 0.92 0.658 0.060 0.014 AD-52727.1 0.73 1.03 0.91 0.004 0.065 0.027 AD-52663.1 0.78 1.05 0.96 0.027 0.010 0.005 AD-52669.1 0.91 0.91 0.94 0.004 0.049 0.032 AD-1955 0.95 0.84 0.95 0.005 0.021 0.019 AD-1955 0.97 1.07 1.03 0.000 0.021 0.015 AD-1955 1.01 1.08 1.01 0.035 0.011 0.005 imitation 1.02 0.96 0.97 0.030 0.037 0.005 AD-1955 1.08 1.03 1.02 0.032 0.051 0.005 AD-52652.1 1.13 1.11 1.02 0.028 0.043 0.020 AD-52658.1 1.33 1.10 0.93 0.091 0.043 0.018 AD-52664.1 1.49 0.95 0.88 0.438 0.019 0.009 AD-52752.1 0.03 0.43 0.69 0.002 0.015 0.017 AD-52741.1 0.03 0.56 0.86 0.001 0.044 0.021 AD-52804.1 0.03 0.49 0.89 0.001 0.002 0.017 AD-52764.1 0.03 0.54 0.79 0.005 0.016 0.078 AD-52770.1 0.03 0.58 0.78 0.000 0.006 0.027 AD-52735.1 0.03 0.31 0.46 0.003 0.031 0.009 AD-52810.1 0.03 0.67 0.86 0.001 0.013 0.025 AD-52759.1 0.03 0.54 0.79 0.000 0.018 0.023 AD-52736.1 0.03 0.51 0.60 0.004 0.012 0.023 AD-52775.1 0.03 0.54 0.73 0.005 0.024 0.022 AD-52758.1 0.03 0.57 0.78 0.001 0.014 0.050 AD-52743.1 0.03 0.45 0.67 0.002 0.018 0.033 AD-52747.1 0.04 0.57 0.84 0.002 0.061 0.058 AD-52819.1 0.04 0.26 0.45 0.005 0.001 0.022 AD-52765.1 0.04 0.68 0.83 0.000 0.013 0.053 AD-52754.1 0.04 0.76 1.00 0.000 0.007 0.015 AD-52787.1 0.05 0.55 0.68 0.001 0.043 0.060 AD-52791.1 0.05 0.70 0.91 0.001 0.014 0.084 AD-52811.1 0.05 0.73 0.84 0.002 0.014 0.058 AD-52817.1 0.05 0.77 0.92 0.003 0.011 0.031 AD-52745.1 0.06 0.62 0.77 0.007 0.021 0.000 AD-52749.1 0.06 0.63 0.88 0.005 0.037 0.043 AD-52740.1 0.06 0.83 0.94 0.007 0.012 0.051 AD-52796.1 0.06 0.72 0.92 0.003 0.021 0.054 AD-52820.1 0.06 0.90 0.87 0.001 0.026 0.064 AD-52809.1 0.06 0.76 0.90 0.001 0.037 0.027 AD-52760.1 0.06 0.81 0.97 0.001 0.056 0.047 AD-52767.1 0.07 0.55 0.55 0.001 0.016 0.013 AD-52734.1 0.07 0.61 0.64 0.004 0.003 0.003 AD-52794.1 0.07 0.94 0.87 0.007 0.014 0.051 AD-52797.1 0.07 0.69 0.87 0.004 0.000 0.038 AD-52737.1 0.08 0.70 0.84 0.004 0.031 0.012 AD-52812.1 0.08 0.75 0.88 0.004 0.000 0.056 AD-52748.1 0.08 0.70 0.89 0.001 0.010 0.009 AD-52782.1 0.08 0.68 0.78 0.004 0.023 0.011 AD-52816.1 0.08 0.71 0.88 0.003 0.042 0.060 AD-52763.1 0.08 0.68 0.77 0.002 0.013 0.026 AD-52788.1 0.08 0.89 1.00 0.004 0.017 0.034 AD-52762.1 0.08 0.78 0.91 0.007 0.046 0.009 AD-52785.1 0.08 0.88 0.95 0.002 0.004 0.019 AD-52800.1 0.09 0.82 0.94 0.001 0.040 0.005 AD-52792.1 0.09 0.93 0.94 0.002 0.018 0.037 AD-52784.1 0.10 0.84 0.92 0.000 0.066 0.032 AD-52746.1 0.10 0.82 0.93 0.002 0.060 0.059 AD-52814.1 0.10 0.85 0.88 0.002 0.042 0.013 AD-52751.1 0.10 0.88 0.98 0.005 0.030 0.067 AD-52786.1 0.10 0.81 0.81 0.006 0.028 0.048 AD-52755.1 0.10 0.93 0.99 0.003 0.032 0.048 AD-52808.1 0.11 0.98 0.92 0.000 0.038 0.032 AD-52815.1 0.11 0.96 0.96 0.002 0.009 0.000 AD-52805.1 0.11 0.79 0.86 0.003 0.050 0.008 AD-52777.1 0.11 0.88 0.94 0.001 0.065 0.000 AD-52756.1 0.11 0.92 0.91 0.003 0.032 0.004 AD-52733.1 0.12 0.66 0.65 0.005 0.071 0.022 AD-52739.1 0.13 0.83 0.95 0.002 0.008 0.061 AD-52780.1 0.13 0.70 0.67 0.012 0.021 0.059 AD-52798.1 0.13 0.64 0.97 0.001 0.006 0.038 AD-52776.1 0.14 0.97 0.94 0.011 0.029 0.023 AD-52753.1 0.15 0.88 1.09 0.001 0.048 0.005 AD-52778.1 0.16 0.76 0.69 0.003 0.067 0.003 AD-52744.1 0.16 0.90 0.91 0.002 0.000 0.049 AD-52750.1 0.16 0.87 1.01 0.000 0.060 0.055 AD-52774.1 0.17 0.71 0.89 0.002 0.010 0.017 AD-52803.1 0.18 0.87 0.92 0.015 0.026 0.040 AD-52821.1 0.18 0.86 0.87 0.005 0.046 0.055 AD-52781.1 0.18 0.78 0.66 0.008 0.000 0.023 AD-52779.1 0.20 0.83 0.66 0.002 0.024 0.016 AD-52793.1 0.20 0.74 0.88 0.010 0.025 0.069 AD-52799.1 0.20 0.75 1.01 0.005 0.018 0.010 AD-52761.1 0.22 0.83 0.92 0.000 0.024 0.023 AD-52768.1 0.22 0.96 0.97 0.001 ND 0.028 AD-52757.1 0.23 1.02 0.95 0.018 0.040 0.042 AD-52806.1 0.24 0.96 0.87 0.011 0.084 0.055 AD-52771.1 0.25 0.92 0.98 0.010 0.018 0.048 AD-52802.1 0.30 0.95 1.00 0.010 0.019 0.005 AD-52731.1 0.30 0.85 0.75 0.001 0.067 0.022 AD-52813.1 0.30 1.07 0.98 0.001 0.109 0.014 AD-52742.1 0.31 0.95 1.03 0.005 0.028 0.056 AD-52766.1 0.35 0.97 1.00 0.010 0.024 0.044 AD-52732.1 0.41 0.79 0.73 0.004 0.016 0.039 AD-52773.1 0.43 0.99 0.92 0.004 0.029 0.022 AD-52772.1 0.43 1.00 1.02 0.006 0.000 0.065 AD-52822.1 0.44 0.68 0.81 0.004 0.010 0.016 AD-52783.1 0.45 0.66 0.76 0.009 0.036 0.019 AD-52789.1 0.50 0.68 0.78 0.010 0.053 0.004 AD-52795.1 0.50 0.82 0.69 0.000 0.080 0.054 AD-52801.1 0.54 0.70 0.79 0.018 0.038 0.035 AD-52807.1 0.57 0.76 0.93 0.006 0.011 0.032 AD-52769.1 0.76 0.97 0.92 0.015 0.085 0.045 AD-1955 0.90 0.96 1.04 0.018 0.165 0.010 AD-52818.1 0.92 1.03 0.92 0.009 0.010 0.063 AD-1955 1.01 0.90 0.96 0.005 0.031 0.019 AD-1955 1.05 1.09 1.00 0.046 0.085 0.005 AD-1955 1.05 1.07 1.00 0.010 0.031 0.039 imitation 1.20 0.98 0.92 0.000 0.014 0.005 imitation 1.25 0.99 1.00 0.006 0.005 0.034

Table 14
Dose-response screening results using a subset of sequences from Table 13.
A subset of active ANGPTL3 siRNAs from Table 10 was tested by transfection of Hep3B cells in a dose-response screen. Duplex IC50 (nM) AD-52819.1 0.0036 AD-52667.1 0.0037 AD-52638.1 0.0048 AD-52673.1 0.0049 AD-52711.1 0.0050 AD-52661.1 0.0054 AD-52654.1 0.0058 AD-52637.1 0.0058 AD-52643.1 0.0060 AD-52685.1 0.0062 AD-52670.1 0.0064 AD-52679.1 0.0064 AD-52649.1 0.0066 AD-52683.1 0.0069 AD-52688.1 0.0071 AD-52717.1 0.0072 AD-52699.1 0.0073 AD-52714.1 0.0086 AD-52718.1 0.0088 AD-52735.1 0.0093 AD-52653.1 0.0102 AD-52687.1 0.0109 AD-52680.1 0.0120 AD-52713.1 0.0133 AD-52720.1 0.0143 AD-52639.1 0.0161 AD-52696.1 0.0163 AD-52662.1 0.0179 AD-52659.1 0.0180 AD-52710.1 0.0195 AD-52689.1 0.0216 AD-52787.1 0.0242 AD-52765.1 0.0318

Table 15
Duplex pair IDs for which both unconjugated and GalNac-conjugated variants were synthesized and tested
The duplexes have similar sequences and patterns of modification. ID of the unconjugated duplex GalNac-conjugated duplex ID AD-52637.1 AD-52953.1 AD-52638.1 AD-52954.1 AD-52639.1 AD-52955.1 AD-52640.1 AD-52956.1 AD-52641.1 AD-52957.1 AD-52642.1 AD-52958.1 AD-52643.1 Not Not AD-52960.1 Not AD-52961.1 AD-52645.1 AD-52962.1 AD-52647.1 AD-52963.1 AD-52648.1 AD-52964.1 AD-52649.1 AD-52965.1 AD-52650.1 AD-52966.1 AD-52651.1 AD-52967.1 AD-52652.1 AD-52968.1 AD-52653.1 AD-52969.1 AD-52654.1 AD-52970.1 Not AD-52971.1 AD-52656.1 AD-52972.1 AD-52657.1 AD-52973.1 AD-52658.1 AD-52974.1 AD-52659.1 AD-52975.1 AD-52660.1 AD-52976.1 AD-52661.1 AD-52977.1 AD-52662.1 AD-52978.1 AD-52663.1 AD-52979.1 AD-52664.1 AD-52980.1 AD-52665.1 AD-52981.1 AD-52666.1 AD-52982.1 AD-52667.1 AD-52983.1 AD-52668.1 AD-52984.1 AD-52669.1 AD-52985.1 AD-52670.1 AD-52986.1 AD-52671.1 AD-52987.1 AD-52672.1 AD-52988.1 AD-52673.1 AD-52989.1 AD-52674.1 AD-52990.1 AD-52675.1 AD-52991.1 AD-52676.1 AD-52992.1 AD-52677.1 AD-52993.1 AD-52678.1 AD-52994.1 AD-52679.1 AD-52995.1 AD-52680.1 AD-52996.1 AD-52681.1 AD-52997.1 AD-52682.1 AD-52998.1 AD-52683.1 AD-52999.1 AD-52684.1 AD-53000.1 AD-52685.1 AD-53001.1 AD-52686.1 AD-53002.1 AD-52687.1 AD-53003.1 AD-52688.1 AD-53004.1 AD-52689.1 AD-53005.1 AD-52690.1 AD-53006.1 AD-52691.1 AD-53007.1 AD-52692.1 AD-53008.1 AD-52693.1 AD-53009.1 AD-52694.1 AD-53010.1 AD-52695.1 AD-53011.1 AD-52696.1 AD-53012.1 AD-52697.1 AD-53013.1 AD-52698.1 AD-53014.1 AD-52699.1 AD-53015.1 AD-52700.1 AD-53016.1 AD-52701.1 AD-53017.1 AD-52702.1 AD-53018.1 AD-52703.1 AD-53019.1 AD-52704.1 AD-53020.1 AD-52705.1 AD-53021.1 AD-52706.1 AD-53022.1 AD-52707.1 AD-53023.1 AD-52708.1 AD-53024.1 AD-52709.1 AD-53025.1 AD-52710.1 AD-53026.1 AD-52711.1 AD-53027.1 AD-52712.1 AD-53028.1 AD-52713.1 AD-53029.1 AD-52714.1 AD-53030.1 AD-52715.1 AD-53031.1 AD-52716.1 AD-53032.1 AD-52717.1 AD-53033.1 AD-52718.1 AD-53034.1 AD-52719.1 AD-53035.1 AD-52720.1 AD-53036.1 AD-52721.1 AD-53037.1 AD-52722.1 AD-53038.1 AD-52723.1 AD-53039.1 AD-52724.1 AD-53040.1 AD-52725.1 AD-53041.1 AD-52726.1 AD-53042.1 AD-52727.1 AD-53043.1 AD-52728.1 AD-53044.1 AD-52729.1 AD-53045.1 AD-52730.1 AD-53046.1 AD-52731.1 AD-53059.1 AD-52732.1 AD-53060.1 AD-52733.1 AD-53061.1 AD-52734.1 AD-53062.1 AD-52735.1 AD-53063.1 AD-52736.1 AD-53064.1 AD-52737.1 AD-53065.1 Not AD-53066.1 AD-52739.1 AD-53067.1 AD-52740.1 AD-53068.1 AD-52741.1 AD-53069.1 AD-52742.1 AD-53070.1 AD-52743.1 AD-53071.1 AD-52744.1 AD-53072.1 AD-52745.1 AD-53073.1 AD-52746.1 AD-53074.1 AD-52747.1 AD-53075.1 AD-52748.1 AD-53076.1 AD-52749.1 AD-53077.1 AD-52750.1 AD-53078.1 AD-52751.1 AD-53079.1 AD-52752.1 AD-53080.1 AD-52753.1 AD-53081.1 AD-52754.1 AD-53082.1 AD-52755.1 AD-53083.1 AD-52756.1 AD-53084.1 AD-52757.1 AD-53085.1 AD-52758.1 AD-53086.1 AD-52759.1 AD-53087.1 AD-52760.1 AD-53088.1 AD-52761.1 AD-53089.1 AD-52762.1 AD-53090.1 AD-52763.1 AD-53091.1 AD-52764.1 AD-53092.1 AD-52765.1 AD-53093.1 AD-52766.1 AD-53094.1 AD-52767.1 AD-53095.1 AD-52768.1 AD-53096.1 AD-52769.1 AD-53097.1 AD-52770.1 AD-53098.1 AD-52771.1 AD-53099.1 AD-52772.1 AD-53100.1 AD-52773.1 AD-53101.1 AD-52774.1 AD-53102.1 AD-52775.1 AD-53103.1 AD-52776.1 AD-53104.1 AD-52777.1 AD-53105.1 AD-52778.1 AD-53106.1 AD-52779.1 AD-53107.1 AD-52780.1 AD-53108.1 AD-52781.1 AD-53109.1 AD-52782.1 AD-53110.1 AD-52783.1 AD-53111.1 AD-52784.1 AD-53112.1 AD-52785.1 AD-53113.1 AD-52786.1 AD-53114.1 AD-52787.1 AD-53115.1 AD-52788.1 AD-53116.1 AD-52789.1 AD-53117.1 Not AD-53118.1 AD-52791.1 AD-53119.1 AD-52792.1 AD-53120.1 AD-52793.1 AD-53121.1 AD-52794.1 AD-53122.1 AD-52795.1 AD-53123.1 AD-52796.1 AD-53124.1 AD-52797.1 AD-53125.1 AD-52798.1 AD-53126.1 AD-52799.1 AD-53127.1 AD-52800.1 AD-53128.1 AD-52801.1 AD-53129.1 AD-52802.1 AD-53130.1 AD-52803.1 AD-53131.1 AD-52804.1 AD-53132.1 AD-52805.1 AD-53133.1 AD-52806.1 AD-53134.1 AD-52807.1 AD-53135.1 AD-52808.1 AD-53136.1 AD-52809.1 AD-53137.1 AD-52810.1 AD-53138.1 AD-52811.1 AD-53139.1 AD-52812.1 AD-53140.1 AD-52813.1 AD-53141.1 AD-52814.1 AD-53142.1 AD-52815.1 AD-53143.1 AD-52816.1 AD-53144.1 AD-52817.1 AD-53145.1 AD-52818.1 AD-53146.1 AD-52819.1 AD-53147.1 AD-52820.1 AD-53148.1 AD-52821.1 AD-53149.1 AD-52822.1 AD-53150.1

In vivo tests

Example 3

Tested drugs

In vivo experiments were performed using the dsRNA sequences of the invention. The dsRNA sequence used in the experiments was GalNac-conjugated AD-52981 ("ANG", sense sequence: AfcAfuAfuUfuGfAfUfcAfgUfcUfuUfuUfL96 (SEQ ID NO:657); antisense sequence: aAfaAfaGfaCfuGfaucAfaAfuAfuGfusUfsg (SEQ ID NO:842)). The dsRNA sequence used as a negative control was luciferase-conjugated AD-48399B1 ("Luc", sense sequence: CfaCfuUfaCfgCfuGfaGfuAfcUfuCfgAfL96 (SEQ ID NO:1728), antisense sequence: uCfgAfaGfuAfcUfcAfgCfgUfaAfgUfgsAfsu (SEQ9) ID9). Also, GalNal-conjugated AD-1955 containing altering 2'-methyl and 2'-fluoro modifications was used as a negative control.

Experimental way

The dsRNA sequences were tested in C57BL/6 (WT) and ob/ob mice. WT mice received five daily doses of dsRNA in PBS, Luc 20 mg/kg or ANG 5 or 20 mg/kg, and ob/ob mice received five daily doses of NPL formulated with Luc 20 mg/kg or ANG 20 mg/kg. All test drugs were administered by subcutaneous injection in the manner shown in Figure 1. Specifically, five daily doses of test drugs were administered on five consecutive days (days 0, 1, 2, 3, and 4) and blood samples were collected on days 5, 3, or 1 before administration, as well as on days 0, 1, 2, 3, 4, 7, 9, 11, 15, 18, 21, 25, 30, 37, 45 and 50 after administration. The collected blood samples were used to measure ANGPTL3 protein expression by ELISA assay. Serum triglycerides (TG), low density lipoprotein cholesterol (LDLc), high density lipoprotein cholesterol (HDLc), and total cholesterol (TC) levels were also measured using an Olympus analyzer.

results

Panels A and B in Figure 2 are the levels of mouse ANGPTL3 (mANGPTL3), a protein measured in WT mice after administration of control or ANG at a dose of 5 to 20 mg/kg. As shown in Figure 2, panel B is the levels of mANGPTL3 protein measured in ob/ob mice after administration of control or ANG at 20 mg/kg. The data indicate that for WT and ob/ob mice, administration of ANG results in a decrease in mANGPTL3 protein levels compared to controls.

Panel A in Figure 3 is the levels of LDL-c measured in WT mice after administration of control or ANG at 20 mg/kg. Panel B in Figure 3 is the levels of LDL-c measured in ob/ob mice after administration of control or ANG at 20 mg/kg. The data indicate that ANG administration causes a decrease in LDL-c levels, particularly in ob/ob mice compared to controls.

Panel A in Figure 4 is the levels of triglycerides measured in WT mice after administration of control or ANG at 20 mg/kg. Panel B in Figure 4 is the levels of triglycerides measured in ob/ob mice after administration of control or ANG at 20 mg/kg. The data indicate that ANG administration causes a decrease in triglyceride levels, particularly in ob/ob mice, compared to controls.

Panels A and B in Figure 5 are total cholesterol (TC) levels measured in WT and ob/ob mice, respectively, after administration of control or ANG at 20 mg/kg. The data indicate that ANG administration causes a modest decrease in TC levels in ob/ob mice, but not in WT mice. Similarly, administration of ANG causes a modest decrease in HDL-c levels in ob/ob mice, but not in WT mice, as demonstrated in the graphs in Figure 6.

Example 4

Test drug

The effect of a single injection of the dsRNA sequence of the invention on the level of ANGPTL3 protein was tested. The dsRNA sequence used in the experiments was GalNac-conjugated AD-52981 ("ANG", sense sequence: AfcAfuAfuUfuGfAfUfcAfgUfcUfuUfuUfL96 (SEQ ID NO:657), antisense sequence: aAfaAfaGfaCfuGfaucAfaAfuAfuGfusUfsg (SEQ ID NO:842)). PBS was used as a negative control.

Experimental way

The dsRNA sequences were tested in a human PCS transgenic mouse characterized by liver-specific expression of the full-length human PCSK9 gene. Human PCS transgenic mice were dosed with AD-52981 or PBS by a single subcutaneous injection. Mice were divided into four groups, where each group consisted of two males and two females. Each group received an injection of PBS or AD-52981 at 5 mg/kg, 20 mg/kg, or 60 mg/kg. Blood samples were collected on day 1 and day 0 before dosing and 72 hours after dosing. ANGPTL3 protein levels were measured by ELISA and compared to levels on day 1 and day 0 prior to dosing.

results

Figure 7 shows the levels of mouse ANGPTL3 protein (mANGPTL3) measured in mice transgenic for human PCS. Data shown are expressed relative to PBS control and represent the mean of 2 males and 2 females in each group. The error rates are the standard deviation. Data suggest that administration of a single injection of AD-52981 reduces ANGPTL3 protein levels in mice in a dose-dependent manner, with a dose of 60 mg/kg reducing ANGPTL3 protein levels by over five-fold (see Figure 7).

Sequences

SEQID NO:1

>gi|41327750|ref|NM_014495.2| Homo sapiens angiopoietin 3 (ANGPTL3)-like, mRNA

TTCCAGAAGAAAACAGTTCCACGTTGCTTGAAATTGAAAATCAAGATAAAAATGTTCACAATTA AGCTCCTTCTTTTTATTGTTCCTCTAGTTATTTCCTCCAGAATTGATCAAGACAATTCATCATT TGATTCTCTATCTCCAGAGCCAAAATCAAGATTTGCTATGTTAGACGATGTAAAAATTTTAGCC AATGGCCTCCTTCAGTTGGGACATGGTCTTAAAGACTTTGTCCATAAGACGAAGGGCCAAATTA ATGACATATTTCAAAAACTCAACATATTTGATCAGTCTTTTTATGATCTATCGCTGCAAACCAG TGAAATCAAAGAAGAAGAAAAGGAACTGAGAAGAACTACATATAAACTACAAGTCAAAAATGAAGAGGTAAAGAATATGTCACTTGAACTCAACTCAAAACTTGAAAGCCTCCTAGAAGAAAAAATTCTACTTCAACAAAAAGTGAAATATTTAGAAGAGCAACTAACTAACTTAATTCAAAATCAACCTGAAACTCCAGAACACCCAGAAGTAACTTCACTTAAAACTTTTGTAGAAAAACAAGATAATAGCATCAAAGACCTTCTCCAGACCGTGGAAGACCAATATAAACAATTAAACCAACAGCATAGTCAAATAAAAGAAATAGAAAATCAGCTCAGAAGGACTAGTATTCAAGAACCCACAGAAATTTCTCTATCTTCCAAGCCAAGAGCACCAAGAACTACTCCCTTTCTTCAGTTGAATGAAATAAGAAATGTAAAACATGATGGCATTCCTGCTGAATGTACCACCATTTATAACAGAGGTGAACATACAAGTGGCATGTATGCCATCAGACCCAGCAACTCTCAAGTTTTTCATGTCTACTGTGATGTTATATCAGGTAGTCCATGGACATTAATTCAACATCGAATAGATGGATCACAAAACTTCAATGAAACGTGGGAGAACTACAAATATGGTTTTGGGAGGCTTGATGGAGAATTTTGGTT GGGCCTAGAGAAGATATACTCCATAGTGAAGCAATCTAATTATGTTTTACGAATTGAGTTGGAAGACTGGAAAGACAACAAACATTATATTGAATATTCTTTTTACTTGGGAAATCACGAAACCAACTATACGCTACATCTAGTTGCGATTACTGGCAATGTCCCCAATGCAATCCCGGAAAACAAAGATTTGGTGTTTTCTACTTGGGATCACAAAGCAAAAGGACACTTCAACTGTCCAGAGGGTTATTCAGGAGGCTGGTGGTGGCATGATGAGTGTGGAGAAAACAACCTAAATGGTAAATATAACAAACCAAGAGCAAAATCTAAGCCAGAGAGGAGAAGAGGATTATCTTGGAAGTCTCAAAATGGAAGGTTATACTCTATAAAATCAACCAAAATGTTGATCCATCCAACAGATTCAGAAAGCTTTGAATGAACTGAGGCAAATTTAAAAGGCAATAATTTAAACATTAACCTCATTCCAAGTTAATGTGGTCTAATAATCTGGTATTAAATCCTTAAGAGAAAGCTTGAGAAATAGATTTTTTTTATCTTAAAGTCACTGTCTATTTAAGATTAAACATACAATCACATAACCTTAAAGAATACCGTTTACATTTCTCAATCAAAATTCTTATAATACTATTTGTTTTAAATTTTGTGATGTGGGAATCAATTTTAGATGGTCACAATCTAGATTATAATCAATAGGTGAACTTATTAAATAACTTTTCTAAATAAAAAATTTAGAGACTTTTATTTTAAAAGGCATCATATGAGCTAATATCACAACTTTCCCAGTTTAAAAAACTAGTACTCTTGTTAAAACTCTAAACTTGACTAAATACAGAGGACTGGTAATTGTACAGTTCTTAAATGTTGTAGTATTAATTTCAAAACTAAAAATCGTCAGCACAGAGTATGTGTAAAAATCTGTAATACAAATTTTTAAACTGATGCTTCATTTTGCTACAAAATAATTTGGAGTAAATGTTTG ATATGATTTATTTATGAAACCTAATGAAGCAGAATTAAATACTGTATTAAAATAAGTTCGCTGTCTTTAAACAAATGGAGATGACTACTAAGTCACATTGACTTTAACATGAGGTATCACTATACCTTATT

SEQ ID NO:2

>gi|297278846|ref|XM_001086114.2| Theoretically calculated: similar to angiopoietin 3 (ANGPTL3) Macaca mulatta, mRNA.

ATATATAGAGTTAAGAAGTCTAGGTCTGCTTCCAGAAGAACACAGTTCCACGTTGCTTGAAATTGAAAATCAGGATAAAAATGTTCACAATTAAGCTCCTTCTTTTTATTGTTCCTCTAGTTATTTCCTCCAGAATTGACCAAGACAATTCATCATTTGATTCTGTATCTCCAGAGCCAAAATCAAGATTTGCTATGTTAGACGATGTAAAAATTTTAGCCAATGGCCTCCTTCAGTTGGGACATGGTCTTAAAGACTTTGTCCATAAGACTAAGGGCCAAATTAATGACATATTTCAAAAACTCAACATATTTGATCAGTCTTTTTATGATCTATCACTGCAAACCAGTGAAATCAAAGAAGAAGAAAAGGAACTGAGAAGAACTACATATAAACTACAAGTCAAAAATGAAGAGGTAAAGAATATGTCACTTGAACTCAACTCAAAACTTGAAAGCCTCCTAGAAGAAAAAATTCTACTTCAACAAAAAGTGAAATATTTAGAAGAGCAACTAACTAACTTAATTCAAAATCAACCTGAAACTCCAGAACATCCAGAAGTAACTTCACTTAAAAGTTTTGTAGAAAAACAAGATAATAGCATCAAAGACCTTCTCCAGACTGTGGAAGAACAATATAAGCAATTAAACCAACAGCACAGTCAAATAAAAGAAATAGAAAATCAGCTCAGAATGACTAATATTCAAGAACCCACAGAAATTTCTCTATCTTCCAAGCCAAGAGCACCAAGAACTACTCCCTTTCTTCAGCTGAATGAAATAAGAAATGTAAAACATGATGGCATTCCTGCTGATTGTACCACCATTTACAATAGAGGTGAACATATAAGTGGCATGTATGCCATCAGACCCAGCAACTCTCAAGTTTTTCATGTCTACTGTGATGTTGTATCAGGTAAAACCTGTCTAAGGAGAATAGATGGATCACAAAACTTCAATGAAACGTGGGAGAACTACAAATATGGTTTCGGGAGGCTTGA TGGAGAATTCTGGTTGGGCCTAGAGAAGATATACTCCATAGTGAAGCAATCTAATTACGTTTTACGAATTGAGTTGGAAGACTGGAAAGACAACAAACATTATATTGAATATTCTTTTTACTTGGGAAATCACGAAACCAACTATACGCTACATGTAGTTAAGATTACTGGCAATGTCCCCAATGCAATCCCGGAAAACAAAGATTTGGTGTTTTCTACTTGGGATCACAAAGCAAAAGGACACTTCAGCTGTCCAGAGAGTTATTCAGGAGGCTGGTGGTGGCATGATGAGTGTGGAGAAAACAACCTAAATGGTAAATATAACAAACCAAGAACAAAATCTAAGCCAGAGCGGAGAAGAGGATTATCCTGGAAGTCTCAAAATGGAAGGTTATACTCTATAAAATCAACCAAAATGTTGATCCATCCAACAGATTCAGAAAGCTTTGAATGAACTGAGGCAAATTTAAAAGGCAATAAATTAAACATTAAACTCATTCCAAGTTAATGTGGTTTAATAATCTGGTATTAAATCCTTAAGAGAAGGCTTGAGAAATAGATTTTTTTATCTTAAAGTCACTGTCAATTTAAGATTAAACATACAATCACATAACCTTAAAGAATACCATTTACATTTCTCAATCAAAATTCCTACAACACTATTTGTTTTATATTTTGTGATGTGGGAATCAATTTTAGATGGTCGCAATCTAAATTATAATCAACAGGTGAACTTACTAAATAACTTTTCTAAATAAAAAACTTAGAGACTTTAATTTTAAAAGTCATCATATGAGCTAATATCACAATTTTCCCAGTTTAAAAAACTAGTTTTCTTGTTAAAACTCTAAACTTGACTAAATAAAGAGGACTGATAATTATACAGTTCTTAAATTTGTTGTAATATTAATTTCAAAACTAAAAATTGTCAGCACAGAGTATGTGTAAAAATCTGTAATATAAATTTTTAAACTGATGCCTCATTTTGCTACAAAATAAT CTGGAGTAAATTTTTGATAGGATTTATTATGAAACCTAATGAAGCAGGATTAAATACTGTATTAAAATAGGTTCGCTGTCTTTTAAACAAATGGAGATGATGATTACTAAGTCACATTGACTTTAATATGAGGTATCACTATACCTTA

SEQ ID NO:3

>gi|142388354|ref|NM_013913.3| similar to angiopoietin 3 (ANGPTL3) Mus musculus, mRNA.

CAGGAGGGAGAAGTTCCAAATTGCTTAAAATTGAATAATTGAGACAAAAAATGCACACAATTAAATTATTCCTTTTTGTTGTTCCTTTAGTAATTGCATCCAGAGTGGATCCAGACCTTTCATCATTTGATTCTGCACCTTCAGAGCCAAAATCAAGATTTGCTATGTTGGATGATGTCAAAATTTTAGCGAATGGCCTCCTGCAGCTGGGTCATGGACTTAAAGATTTTGTCCATAAGACTAAGGGACAAATTAACGACATATTTCAGAAGCTCAACATATTTGATCAGTCTTTTTATGACCTATCACTTCGAACCAATGAAATCAAAGAAGAGGAAAAGGAGCTAAGAAGAACTACATCTACACTACAAGTTAAAAACGAGGAGGTGAAGAACATGTCAGTAGAACTGAACTCAAAGCTTGAGAGTCTGCTGGAAGAGAAGACAGCCCTTCAACACAAGGTCAGGGCTTTGGAGGAGCAGCTAACCAACTTAATTCTAAGCCCAGCTGGGGCTCAGGAGCACCCAGAAGTAACATCACTCAAAAGTTTTGTAGAACAGCAAGACAACAGCATAAGAGAACTCCTCCAGAGTGTGGAAGAACAGTATAAACAATTAAGTCAACAGCACATGCAGATAAAAGAAATAGAAAAGCAGCTCAGAAAGACTGGTATTCAAGAACCCTCAGAAAATTCTCTTTCTTCTAAATCAAGAGCACCAAGAACTACTCCCCCTCTTCAACTGAACGAAACAGAAAATACAGAACAAGATGACCTTCCTGCCGACTGCTCTGCCGTTTATAACAGAGGCGAACATACAAGTGGCGTGTACACTATTAAACCAAGAAACTCCCAAGGGTTTAATGTCTACTGTGATACCCAATCAGGCAGTCCATGGACATTAATTCAACACCGGAAAGATGGCTCACAGGACTTCAACGAAACATGGGAAAACTACGAAAAGGGCTTTGGGAGGCTCGATGGAGAATTTTGGTTGGGCCT AGAGAAGATCTATGCTATAGTCCAACAGTCTAACTACATTTTACGACTCGAGCTACAAGACTGGAAAGACAGCAAGCACTACGTTGAATACTCCTTTCACCTGGGCAGTCACGAAACCAACTACACGCTACATGTGGCTGAGATTGCTGGCAATATCCCTGGGGCCCTCCCAGAGCACACAGACCTGATGTTTTCTACATGGAATCACAGAGCAAAGGGACAGCTCTACTGTCCAGAAAGTTACTCAGGTGGCTGGTGGTGGAATGACATATGTGGAGAAAACAACCTAAATGGAAAATACAACAAACCCAGAACCAAATCCAGACCAGAGAGAAGAAGAGGGATCTACTGGAGACCTCAGAGCAGAAAGCTCTATGCTATCAAATCATCCAAAATGATGCTCCAGCCCACCACCTAAGAAGCTTCAACTGAACTGAGACAAAATAAAAGATCAATAAATTAAATATTAAAGTCCTCCCGATCACTGTAGTAATCTGGTATTAAAATTTTAATGGAAAGCTTGAGAATTGAATTTCAATTAGGTTTAAACTCATTGTTAAGATCAGATATCACCGAATCAACGTAAACAAAATTTATC

SEQ ID NO:4

>gi|68163568|ref|NM_001025065.1| similar to angiopoietin 3 (ANGPTL3) Rattus norvegicus , mRNA.

GACGTTCCAAATTGCTTGAAATTGAATAATTGAAACAAAAATGCACACAATTAAGCTGCTCCTTTTTGTTGTTCCTCTAGTAATTTCGTCCAGAGTTGATCCAGACCTTTCGCCATTTGATTCTGTACCGTCAGAGCCAAAATCAAGATTTGCTATGTTGGATGATGTCAAAATTTTAGCCAATGGCCTCCTGCAGCTGGGTCATGGTCTTAAAGATTTTGTCCATAAGACAAAGGGACAAATTAATGACATATTTCAGAAGCTCAACATATTTGATCAGTGTTTTTATGACCTATCACTTCAAACCAATGAAATCAAAGAAGAGGAAAAGGAGCTAAGAAGAACCACATCTAAACTACAAGTTAAAAACGAAGAGGTGAAGAATATGTCACTTGAACTGAACTCAAAGCTTGAAAGTCTACTGGAGGAGAAGATGGCGCTCCAACACAGAGTCAGGGCTTTGGAGGAACAGCTGACCAGCTTGGTTCAGAACCCGCCTGGGGCTCGGGAGCACCCAGAGGTAACGTCACTTAAAAGTTTTGTAGAACAGCAAGATAACAGCATAAGAGAACTCCTCCAGAGTGTGGAAGAACAATATAAACAACTAAGTCAACAGCACATTCAGATAAAAGAAATAGAAAATCAGCTCAGAAAGACTGGCATTCAAGAACCCACTGAAAATTCTCTTTATTCTAAACCAAGAGCACCAAGAACTACTCCCCCTCTTCATCTGAAGGAAGCAAAAAATATAGAACAAGATGATCTGCCTGCTGACTGCTCTGCCATTTATAACAGAGGTGAACATACAAGTGGCGTGTATACTATTAGACCAAGCAGCTCTCAAGTGTTTAATGTCTACTGTGACACCCAATCAGGCACTCCACGGACATTAATTCAACACCGGAAAGATGGCTCTCAAAACTTCAACCAAACGTGGGAAAACTACGAAAAGGGTTTTGGGAGGCTTGATGGTAAAGTGATTTCCTTGCATCACTCACTT ATCTGTTGATTTAATAGTATTAGTTGGGTGTGTTGACACAGGCCTGAGACCATAGCGCTTTTGGGCAAGGGGGGAGGAGGAGCAGCAGGTGAATTGAAAGTTCAAGACCAGTCTGGGCCACACATTGATACTCCTTCTCGACATTAAGAATTATAAATTAAGCAGCAATTATAAAATGGGCTGTGGAAATGTAACAATAAGCAAAAGCAGACCCCAGTCTTCATAAAACTGATTGGTAAATATTATCCATGATAGCAACTGCAATGATCTCATTGTACTTATCACTACTGCATGCCTGCAGTATGCTTGTTGAAACTTAATTCTATAGTTCATGGTTATCATAAGTCTTATTAAGGAACATAGTATACGCCATTGGCTCTAGTGAGGGGCCATGCTACAAATGAGCTGCAAAGATAGCAGTATAGAGCTCTTTCAGTGATATCCTAAGCACAACGTAACACAGGTGAAATGGGCTGGAGGCACAGTTGTGGTGGAACACGCGGCCAGCAGGACACTGGGACTGATCCCCAGCAGCACAAAGAAAGTGATAGGAACACAGAGCGAGAGTTAGAAGGGACAGGGTCACCGTCAGAGATACGGTGTCTAACTCCTGCAACCCTACCTGTAATTATTCCATATTATAAACATATACTATATAACTGTGGGTCTCTGCATGTTCTAGAATATGAATTCTATTTGATTGTAAAACAAAACTATAAAAATAAGTAAAAAAATAAAAAATAAACAGATACTTAAAATCAAAAAAAAAAAAAAAAAAAAAAAAA

SEQ ID NO:5 Reverse Complement SEQ ID NO:1

AATAAGGTATAGTGATACCTCATGTTAAAGTCAATGTGACTTAGTAGTCATCTCCATTTGTTTAAAGACAGCGAACTTATTTTAATACAGTATTTAATTCTGCTTCATTAGGTTTCATAAATAAATCATATCAAACATTTACTCCAAATTATTTTGTAGCAAAATGAAGCATCAGTTTAAAAATTTGTATTACAGATTTTTACACATACTCTGTGCTGACGATTTTTAGTTTTGAAATTAATACTACAACATTTAAGAACTGTACAATTACCAGTCCTCTGTATTTAGTCAAGTTTAGAGTTTTAACAAGAGTACTAGTTTTTTAAACTGGGAAAGTTGTGATATTAGCTCATATGATGCCTTTTAAAATAAAAGTCTCTAAATTTTTTATTTAGAAAAGTTATTTAATAAGTTCACCTATTGATTATAATCTAGATTGTGACCATCTAAAATTGATTCCCACATCACAAAATTTAAAACAAATAGTATTATAAGAATTTTGATTGAGAAATGTAAACGGTATTCTTTAAGGTTATGTGATTGTATGTTTAATCTTAAATAGACAGTGACTTTAAGATAAAAAAAATCTATTTCTCAAGCTTTCTCTTAAGGATTTAATACCAGATTATTAGACCACATTAACTTGGAATGAGGTTAATGTTTAAATTATTGCCTTTTAAATTTGCCTCAGTTCATTCAAAGCTTTCTGAATCTGTTGGATGGATCAACATTTTGGTTGATTTTATAGAGTATAACCTTCCATTTTGAGACTTCCAAGATAATCCTCTTCTCCTCTCTGGCTTAGATTTTGCTCTTGGTTTGTTATATTTACCATTTAGGTTGTTTTCTCCACACTCATCATGCCACCACCAGCCTCCTGAATAACCCTCTGGACAGTTGAAGTGTCCTTTTGCTTTGTGATCCCAAGTAGAAAACACCAAATCTTTGTTTTCCGGGATTGCATTGGGGACATTGCCAGTAATCGCAACTAGATGTAGCG TATAGTTGGTTTCGTGATTTCCCAAGTAAAAAGAATATTCAATATAATGTTTGTTGTCTTTCCAGTCTTCCAACTCAATTCGTAAAACATAATTAGATTGCTTCACTATGGAGTATATCTTCTCTAGGCCCAACCAAAATTCTCCATCAAGCCTCCCAAAACCATATTTGTAGTTCTCCCACGTTTCATTGAAGTTTTGTGATCCATCTATTCGATGTTGAATTAATGTCCATGGACTACCTGATATAACATCACAGTAGACATGAAAAACTTGAGAGTTGCTGGGTCTGATGGCATACATGCCACTTGTATGTTCACCTCTGTTATAAATGGTGGTACATTCAGCAGGAATGCCATCATGTTTTACATTTCTTATTTCATTCAACTGAAGAAAGGGAGTAGTTCTTGGTGCTCTTGGCTTGGAAGATAGAGAAATTTCTGTGGGTTCTTGAATACTAGTCCTTCTGAGCTGATTTTCTATTTCTTTTATTTGACTATGCTGTTGGTTTAATTGTTTATATTGGTCTTCCACGGTCTGGAGAAGGTCTTTGATGCTATTATCTTGTTTTTCTACAAAAGTTTTAAGTGAAGTTACTTCTGGGTGTTCTGGAGTTTCAGGTTGATTTTGAATTAAGTTAGTTAGTTGCTCTTCTAAATATTTCACTTTTTGTTGAAGTAGAATTTTTTCTTCTAGGAGGCTTTCAAGTTTTGAGTTGAGTTCAAGTGACATATTCTTTACCTCTTCATTTTTGACTTGTAGTTTATATGTAGTTCTTCTCAGTTCCTTTTCTTCTTCTTTGATTTCACTGGTTTGCAGCGATAGATCATAAAAAGACTGATCAAATATGTTGAGTTTTTGAAATATGTCATTAATTTGGCCCTTCGTCTTATGGACAAAGTCTTTAAGACCATGTCCCAACTGAAGGAGGCCATTGGCTAAAATTTTTACATCGTCTAACATAGCAAATCTTGATTTTGGCTCTGGAGATAGAGAATCAAA TGATGAATTGTCTTGATCAATTCTGGAGGAAATAACTAGAGGAACAATAAAAAGAAGGAGCTTAATTGTGAACATTTTTATCTTGATTTTCAATTTCAAGCAACGTGGAACTGTTTTCTTCTGGAA

SEQ ID NO:6 Reverse Complement SEQ ID NO:2

TAAGGTATAGTGATACCTCATATTAAAGTCAATGTGACTTAGTAATCATCATCTCCATTTGTTTAAAAGACAGCGAACCTATTTTAATACAGTATTTAATCCTGCTTCATTAGGTTTCATAAATAAATCCTATCAAAAATTTACTCCAGATTATTTTGTAGCAAAATGAGGCATCAGTTTAAAAATTTATATTACAGATTTTTACACATACTCTGTGCTGACAATTTTTAGTTTTGAAATTAATATTACAACAAATTTAAGAACTGTATAATTATCAGTCCTCTTTATTTAGTCAAGTTTAGAGTTTTAACAAGAAAACTAGTTTTTTAAACTGGGAAAATTGTGATATTAGCTCATATGATGACTTTTAAAATTAAAGTCTCTAAGTTTTTTATTTAGAAAAGTTATTTAGTAAGTTCACCTGTTGATTATAATTTAGATTGCGACCATCTAAAATTGATTCCCACATCACAAAATATAAAACAAATAGTGTTGTAGGAATTTTGATTGAGAAATGTAAATGGTATTCTTTAAGGTTATGTGATTGTATGTTTAATCTTAAATTGACAGTGACTTTAAGATAAAAAAATCTATTTCTCAAGCCTTCTCTTAAGGATTTAATACCAGATTATTAAACCACATTAACTTGGAATGAGTTTAATGTTTAATTTATTGCCTTTTAAATTTGCCTCAGTTCATTCAAAGCTTTCTGAATCTGTTGGATGGATCAACATTTTGGTTGATTTTATAGAGTATAACCTTCCATTTTGAGACTTCCAGGATAATCCTCTTCTCCGCTCTGGCTTAGATTTTGTTCTTGGTTTGTTATATTTACCATTTAGGTTGTTTTCTCCACACTCATCATGCCACCACCAGCCTCCTGAATAACTCTCTGGACAGCTGAAGTGTCCTTTTGCTTTGTGATCCCAAGTAGAAAACACCAAATCTTTGTTTTCCGGGATTGCATTGGGGACATTGCCAGTAATCTTAACTACATGTA GCGTATAGTTGGTTTCGTGATTTCCCAAGTAAAAAGAATATTCAATATAATGTTTGTTGTCTTTCCAGTCTTCCAACTCAATTCGTAAAACGTAATTAGATTGCTTCACTATGGAGTATATCTTCTCTAGGCCCAACCAGAATTCTCCATCAAGCCTCCCGAAACCATATTTGTAGTTCTCCCACGTTTCATTGAAGTTTTGTGATCCATCTATTCTCCTTAGACAGGTTTTACCTGATACAACATCACAGTAGACATGAAAAACTTGAGAGTTGCTGGGTCTGATGGCATACATGCCACTTATATGTTCACCTCTATTGTAAATGGTGGTACAATCAGCAGGAATGCCATCATGTTTTACATTTCTTATTTCATTCAGCTGAAGAAAGGGAGTAGTTCTTGGTGCTCTTGGCTTGGAAGATAGAGAAATTTCTGTGGGTTCTTGAATATTAGTCATTCTGAGCTGATTTTCTATTTCTTTTATTTGACTGTGCTGTTGGTTTAATTGCTTATATTGTTCTTCCACAGTCTGGAGAAGGTCTTTGATGCTATTATCTTGTTTTTCTACAAAACTTTTAAGTGAAGTTACTTCTGGATGTTCTGGAGTTTCAGGTTGATTTTGAATTAAGTTAGTTAGTTGCTCTTCTAAATATTTCACTTTTTGTTGAAGTAGAATTTTTTCTTCTAGGAGGCTTTCAAGTTTTGAGTTGAGTTCAAGTGACATATTCTTTACCTCTTCATTTTTGACTTGTAGTTTATATGTAGTTCTTCTCAGTTCCTTTTCTTCTTCTTTGATTTCACTGGTTTGCAGTGATAGATCATAAAAAGACTGATCAAATATGTTGAGTTTTTGAAATATGTCATTAATTTGGCCCTTAGTCTTATGGACAAAGTCTTTAAGACCATGTCCCAACTGAAGGAGGCCATTGGCTAAAATTTTTACATCGTCTAACATAGCAAATCTTGATTTTGGCTCTGGAGATACAGAATCAAATGATGA ATTGTCTTGGTCAATTCTGGAGGAAATAACTAGAGGAACAATAAAAAGAAGGAGCTTAATTGTGAACATTTTTATCCTGATTTTCAATTTCAAGCAACGTGGAACTGTGTTCTTCTGGAAGCAGACCTAGACTTCTTAACTCTATATAT

SEQ ID NO:7 Reverse Complement SEQ ID NO:3

CAGGAGGGAGAAGTTCCAAATTGCTTAAAATTGAATAATTGAGACAAAAAATGCACACAATTAAATTATTCCTTTTTGTTGTTCCTTTAGTAATTGCATCCAGAGTGGATCCAGACCTTTCATCATTTGATTCTGCACCTTCAGAGCCAAAATCAAGATTTGCTATGTTGGATGATGTCAAAATTTTAGCGAATGGCCTCCTGCAGCTGGGTCATGGACTTAAAGATTTTGTCCATAAGACTAAGGGACAAATTAACGACATATTTCAGAAGCTCAACATATTTGATCAGTCTTTTTATGACCTATCACTTCGAACCAATGAAATCAAAGAAGAGGAAAAGGAGCTAAGAAGAACTACATCTACACTACAAGTTAAAAACGAGGAGGTGAAGAACATGTCAGTAGAACTGAACTCAAAGCTTGAGAGTCTGCTGGAAGAGAAGACAGCCCTTCAACACAAGGTCAGGGCTTTGGAGGAGCAGCTAACCAACTTAATTCTAAGCCCAGCTGGGGCTCAGGAGCACCCAGAAGTAACATCACTCAAAAGTTTTGTAGAACAGCAAGACAACAGCATAAGAGAACTCCTCCAGAGTGTGGAAGAACAGTATAAACAATTAAGTCAACAGCACATGCAGATAAAAGAAATAGAAAAGCAGCTCAGAAAGACTGGTATTCAAGAACCCTCAGAAAATTCTCTTTCTTCTAAATCAAGAGCACCAAGAACTACTCCCCCTCTTCAACTGAACGAAACAGAAAATACAGAACAAGATGACCTTCCTGCCGACTGCTCTGCCGTTTATAACAGAGGCGAACATACAAGTGGCGTGTACACTATTAAACCAAGAAACTCCCAAGGGTTTAATGTCTACTGTGATACCCAATCAGGCAGTCCATGGACATTAATTCAACACCGGAAAGATGGCTCACAGGACTTCAACGAAACATGGGAAAACTACGAAAAGGGCTTTGGGAGGCTCGATGGAGAATTTTGGTTGGGCCT AGAGAAGATCTATGCTATAGTCCAACAGTCTAACTACATTTTACGACTCGAGCTACAAGACTGGAAAGACAGCAAGCACTACGTTGAATACTCCTTTCACCTGGGCAGTCACGAAACCAACTACACGCTACATGTGGCTGAGATTGCTGGCAATATCCCTGGGGCCCTCCCAGAGCACACAGACCTGATGTTTTCTACATGGAATCACAGAGCAAAGGGACAGCTCTACTGTCCAGAAAGTTACTCAGGTGGCTGGTGGTGGAATGACATATGTGGAGAAAACAACCTAAATGGAAAATACAACAAACCCAGAACCAAATCCAGACCAGAGAGAAGAAGAGGGATCTACTGGAGACCTCAGAGCAGAAAGCTCTATGCTATCAAATCATCCAAAATGATGCTCCAGCCCACCACCTAAGAAGCTTCAACTGAACTGAGACAAAATAAAAGATCAATAAATTAAATATTAAAGTCCTCCCGATCACTGTAGTAATCTGGTATTAAAATTTTAATGGAAAGCTTGAGAATTGAATTTCAATTAGGTTTAAACTCATTGTTAAGATCAGATATCACCGAATCAACGTAAACAAAATTTATC

SEQ ID NO:8 Reverse Complement SEQ ID NO:4

TTTTTTTTTTTTTTTTTTTTTTTTTGATTTTAAGTATCTGTTTATTTTTTATTTTTTTACTTATTTTTATAGTTTTGTTTTACAATCAAATAGAATTCATATTCTAGAACATGCAGAGACCCACAGTTATATAGTATATGTTTATAATATGGAATAATTACAGGTAGGGTTGCAGGAGTTAGACACCGTATCTCTGACGGTGACCCTGTCCCTTCTAACTCTCGCTCTGTGTTCCTATCACTTTCTTTGTGCTGCTGGGGATCAGTCCCAGTGTCCTGCTGGCCGCGTGTTCCACCACAACTGTGCCTCCAGCCCATTTCACCTGTGTTACGTTGTGCTTAGGATATCACTGAAAGAGCTCTATACTGCTATCTTTGCAGCTCATTTGTAGCATGGCCCCTCACTAGAGCCAATGGCGTATACTATGTTCCTTAATAAGACTTATGATAACCATGAACTATAGAATTAAGTTTCAACAAGCATACTGCAGGCATGCAGTAGTGATAAGTACAATGAGATCATTGCAGTTGCTATCATGGATAATATTTACCAATCAGTTTTATGAAGACTGGGGTCTGCTTTTGCTTATTGTTACATTTCCACAGCCCATTTTATAATTGCTGCTTAATTTATAATTCTTAATGTCGAGAAGGAGTATCAATGTGTGGCCCAGACTGGTCTTGAACTTTCAATTCACCTGCTGCTCCTCCTCCCCCCTTGCCCAAAAGCGCTATGGTCTCAGGCCTGTGTCAACACACCCAACTAATACTATTAAATCAACAGATAAGTGAGTGATGCAAGGAAATCACTTTACCATCAAGCCTCCCAAAACCCTTTTCGTAGTTTTCCCACGTTTGGTTGAAGTTTTGAGAGCCATCTTTCCGGTGTTGAATTAATGTCCGTGGAGTGCCTGATTGGGTGTCACAGTAGACATTAAACACTTGAGAGCTGCTTGGTCTAATAGTATACACGCCACTTGTATGTTCACCTCTGTTATAAA TGGCAGAGCAGTCAGCAGGCAGATCATCTTGTTCTATATTTTTTGCTTCCTTCAGATGAAGAGGGGGAGTAGTTCTTGGTGCTCTTGGTTTAGAATAAAGAGAATTTTCAGTGGGTTCTTGAATGCCAGTCTTTCTGAGCTGATTTTCTATTTCTTTTATCTGAATGTGCTGTTGACTTAGTTGTTTATATTGTTCTTCCACACTCTGGAGGAGTTCTCTTATGCTGTTATCTTGCTGTTCTACAAAACTTTTAAGTGACGTTACCTCTGGGTGCTCCCGAGCCCCAGGCGGGTTCTGAACCAAGCTGGTCAGCTGTTCCTCCAAAGCCCTGACTCTGTGTTGGAGCGCCATCTTCTCCTCCAGTAGACTTTCAAGCTTTGAGTTCAGTTCAAGTGACATATTCTTCACCTCTTCGTTTTTAACTTGTAGTTTAGATGTGGTTCTTCTTAGCTCCTTTTCCTCTTCTTTGATTTCATTGGTTTGAAGTGATAGGTCATAAAAACACTGATCAAATATGTTGAGCTTCTGAAATATGTCATTAATTTGTCCCTTTGTCTTATGGACAAAATCTTTAAGACCATGACCCAGCTGCAGGAGGCCATTGGCTAAAATTTTGACATCATCCAACATAGCAAATCTTGATTTTGGCTCTGACGGTACAGAATCAAATGGCGAAAGGTCTGGATCAACTCTGGACGAAATTACTAGAGGAACAACAAAAAGGAGCAGCTTAATTGTGTGCATTTTTGTTTCAATTATTCAATTTCAAGCAATTTGGAACGTC

SEQ ID NO:9

similar to angiopoietin 3 (ANGPTL3) Macaca fascicularis , mRNA.

GGgTAgTATATAGAGTtAAGAAGTCTAGgTCTGCTTCCAGAAGAACACAGTTCCACGCTGCTTGAAATTGAAAATCAGGATAAAAATGTTCACAATTAAGCTCCTTCTTTTTATTGTTCCTCTAGTTATTTCCTCCAGAATTGACCAAGACAATTCATCATTTGATTCTGTATCTCCAGAGCCAAAATCAAGATTTGCTATGTTAGACGATGTAAAAATTTTAGCCAATGGCCTCCTTCAGTTGGGACATGGTCTTAAAGACTTTGTCCATAAGACTAAGGGCCAAATTAATGACATATTTCAAAAACTCAACATATTTGATCAGTCTTTTTATGATCTATCACTGCAAACCAGTGAAATCAAAGAAGAAGAAAAGGAACTGAGAAGAACTACATATAAACTACAAGTCAAAAATGAAGAGGTAAAGAATATGTCACTTGAACTCAACTCAAAACTTGAAAGCCTCCTAGAAGAAAAAATTCTACTTCAACAAAAAGTGAAATATTTAGAAGAGCAACTAACTAACTTAATTCAAAATCAACCTGCAACTCCAGAACATCCAGAAGTAACTTCACTTAAAAGTTTTGTAGAAAAACAAGATAATAGCATCAAAGACCTTCTCCAGACTGTGGAAGAACAATATAAGCAATTAAACCAACAGCATAGTCAAATAAAAGAAATAGAAAATCAGCTCAGAATGACTAATATTCAAGAACCCACAGAAATTTCTCTATCTTCCAAGCCAAGAGCACCAAGAACTACTCCCTTTCTTCAGCTGAATGAAATAAGAAATGTAAAACATGATGGCATTCCTGCTGATTGTACCACCATTTACAATAGAGGTGAACATATAAGTGGCACGTATGCCATCAGACCCAGCAACTCTCAAGTTTTTCATGTCTACTGTGATGTTGTATCAGGTAGTCCATGGACATTAATTCAACATCGAATAGATGGATCACAAAACTTCAATGAAACGTGGGAGAACTACAAATATGGT TTCGGGAGGCTTGATGGAGAATTCTGGTTGGGCCTAGAGAAGATATACTCCATAGTGAAGCAATCTAATTACGTTTTACGAATTGAGTTGGAAGACTGGAAAGACAACAAACATTATATTGAATATTCTTTTTACTTGGGAAATCACGAAACCAACTATACGCTACATGTAGTTAAGATTACTGGCAATGTCCCCAATGCAATCCCGGAAAACAAAGATTTGGTGTTTTCTACTTGGGATCACAAAGCAAAAGGACACTTCAGCTGTCCAGAGAGTTATTCAGGAGGCTGGTGGTGGCATGATGAGTGTGGAGAAAACAACCTAAATGGTAAATATAACAAACCAAGAACAAAATCTAAGCCAGAGCGGAGAAGAGGATTATCCTGGAAGTCTCAAAATGGAAGGTTATACTCTATAAAATCAACCAAAATGTTGATCCATCCAACAGATTCAGAAAGCTTTGAATGAACTGAGGCAAATTTAAAAGGCAATAAATTAAACATTAAACTCATTCCAAGTTAATGTGGTTTAATAATctGGTATTAAATCCTTAAGAGAAGGCTTGAGAAATAGATTTTTTtATCTtAAAGTCACTGTCAATTTAAGATTAAaCATACAaTCACATAACCTTAAAGAATACCATTTACATTtCTCAaTCAAAaTTCTtACAaCaCTATTtGTTTTaTAttttgtgatgtgggaatcaattttagATGGTCGCAATCTAAATTATAATCAACAGgTGAaCTTACTAAATAaCTTTtCTAAaTAAAAAaCTTAGAGACTTtAATTTtAAAAGTCATCATATGAGCTAATGtCACAaTTTtCCcAGTTtAAAAAaCTAGTTTtCTTGTTAAAACTCTAAACTTGaCTAAATAAAGAGGACTGATAATTATACAGTTCTTAAATTTGTTGTAATATTAATTtCAAAACTAAAAATtGTCagCACAGAGTATGTGTAAAAATCTGTAATATAAATTTTtAAACTGaTGCCTCATTT TGCTACAAAATAATCTGGAGTAAATTTTtGATAGGATTTATTTATGAAaCCTAATGAAGCAGGATTAAaTACTGTATTAAAATAGGTTCGCTGTCTTTTAAACAAATGGaGATGATGATTACTAAGTCACATTGACTTTAATAtGAGGTATCACTATACCTTAACATaTTtGTTAAaaCGTAtAcTGTATACATTTtgtGt

--->

SEQUENCE LIST

<110> ALNYLAM PHARMACEUTICALS

<120> mRNA COMPOSITIONS FOR ANGIOPOETIN 3 (ANGPTL3) SIMILAR PROTEIN

AND WAYS OF THEIR APPLICATION

<130> 121301-00320

<140> PCT/US12/43378

<141> 2012-06-20

<150> 61/638.288

<151> 2012-04-25

<150> 61/499.620

<151> 2011-06-21

<160> 1729

<170>PatentIn version 3.5

<210> 1

<211> 2126

<212> DNA

<213> Homo sapiens

<400> 1

ttccagaaga aaacagttcc acgttgcttg aaattgaaaa tcaagataaa aatgttcaca 60

attaagctcc ttctttttat tgttcctcta gttatttcct ccagaattga tcaagacaat 120

tcatcatttg attctctatc tccagagcca aaatcaagat ttgctatgtt agacgatgta 180

aaaattttag ccaatggcct ccttcagttg ggacatggtc ttaaagactt tgtccataag 240

acgaagggcc aaattaatga catatttcaa aaactcaaca tatttgatca gtctttttat 300

gatctatcgc tgcaaaccag tgaaatcaaa gaagaagaaa aggaactgag aagaactaca 360

tataaactac aagtcaaaaa tgaagaggta aagaatatgt cacttgaact caactcaaaa 420

cttgaaagcc tcctagaaga aaaaattcta cttcaacaaa aagtgaaata tttagagag 480

caactaacta acttaattca aaatcaacct gaaactccag aacacccaga agtaacttca 540

cttaaaactt ttgtagaaaa acaagataat agcatcaaag accttctcca gaccgtggaa 600

gaccaatata aacaattaaa ccaacagcat agtcaaataa aagaaataga aaatcagctc 660

agaaggacta gtattcaaga acccacagaa atttctctat cttccaagcc aagagcacca 720

agaactactc cctttcttca gttgaatgaa ataagaaatg taaaacatga tggcattcct 780

gctgaatgta ccaccattta taacagaggt gaacatacaa gtggcatgta tgccatcaga 840

cccagcaact ctcaagtttt tcatgtctac tgtgatgtta tatcaggtag tccatggaca 900

ttaattcaac atcgaataga tggatcacaa aacttcaatg aaacgtggga gaactacaaa 960

tatggttttg ggaggcttga tggagaattt tggttgggcc tagagaagat atactccata 1020

gtgaagcaat ctaattatgt tttacgaatt gagttggaag actggaaaga caacaaacat 1080

tatattgaat attcttttta cttgggaaat cacgaaacca actatacgct acatctagtt 1140

gcgattactg gcaatgtccc caatgcaatc cgggaaaaca aagatttggt gttttctact 1200

tgggatcaca aagcaaaagg acacttcaac tgtccagagg gttattcagg aggctggtgg 1260

1320

tctaagccag agaggagaag aggattatct tggaagtctc aaaatggaag gttatactct 1380

ataaaatcaa ccaaaatgtt gatccatcca acagattcag aaagctttga atgaactgag 1440

gcaaatttaa aaggcaataa tttaaacatt aacctcattc caagttaatg tggtctaata 1500

atctggtatt aaatccttaa gagaaagctt gagaaataga ttttttttat cttaaagtca 1560

ctgtctattt aagattaaac atacaatcac ataaccttaa agaataccgt ttacatttct 1620

1680

atggtcacaa tctagattat aatcaatagg tgaacttatt aaataacttt tctaaataaa 1740

1800

ttaaaaaact agtactcttg ttaaaactct aaacttgact aaatacagag gactggtaat 1860

tgtacagttc ttaaatgttg tagtattaat ttcaaaacta aaaatcgtca gcacagagta 1920

tgtgtaaaaa tctgtaatac aaatttttaa actgatgctt cattttgcta caaaataatt 1980

2040

attaaaataa gttcgctgtc tttaaacaaa tggagatgac tactaagtca cattgacttt 2100

aacatgaggt atcactatac cttatt 2126

<210> 2

<211> 2149

<212> DNA

<213> Macaca mulatta

<400> 2

atatatagag ttaagaagtc taggtctgct tccagaagaa cacagttcca cgttgcttga 60

aattgaaaat caggataaaa atgttcacaa ttaagctcct tctttttatt gttcctctag 120

ttatttcctc cagaattgac caagacaatt catcatttga ttctgtatct ccagagccaa 180

aatcaagatt tgctatgtta gacgatgtaa aaattttagc caatggcctc cttcagttgg 240

gacatggtct taaagacttt gtccataaga ctaagggcca aattaatgac atatttcaaa 300

aactcaacat atttgatcag tctttttatg atctatcact gcaaaccagt gaaatcaaag 360

aagaagaaaa ggaactgaga agaactacat ataaactaca agtcaaaaat gaagaggtaa 420

agaatatgtc acttgaactc aactcaaaac ttgaaagcct cctagaagaa aaaattctac 480

ttcaacaaaa agtgaaatat ttagaagagc aactaactaa cttaattcaa aatcaacctg 540

aaactccaga acatccagaa gtaacttcac ttaaaagttt tgtagaaaaa caagataata 600

gcatcaaaga ccttctccag actgtggaag aacaatataa gcaattaaac caacagcaca 660

gtcaaataaa agaaatagaa aatcagctca gaatgactaa tattcaagaa cccacagaaa 720

tttctctatc ttccaagcca agagcaccaa gaactactcc ctttcttcag ctgaatgaaa 780

taagaaatgt aaaacatgat ggcattcctg ctgattgtac caccatttac aatagaggtg 840

aacatataag tggcatgtat gccatcagac ccagcaactc tcaagttttt catgtctact 900

gtgatgttgt atcaggtaaa acctgtctaa ggagaataga tggatcacaa aacttcaatg 960

aaacgtggga gaactacaaa tatggtttcg ggaggcttga tggagaattc tggttggggcc 1020

tagagaagat atactccata gtgaagcaat ctaattacgt tttacgaatt gagttggaag 1080

actggaaaga caacaaacat tatattgaat attcttttta cttgggaaat cacgaaacca 1140

actatacgct acatgtagtt aagattactg gcaatgtccc caatgcaatc ccggaaaaca 1200

1260

gttattcagg aggctggtgg tggcatgatg agtgtggaga aaacaaccta aatggtaaat 1320

ataacaaacc aagaacaaaa tctaagccag agcggagaag aggattatcc tggaagtctc 1380

aaaatggaag gttatactct ataaaatcaa ccaaaatgtt gatccatcca acagattcag 1440

aaagctttga atgaactgag gcaaatttaa aaggcaataa attaaacatt aaactcattc 1500

caagttaatg tggtttaata atctggtatt aaatccttaa gagaaggctt gagaaataga 1560

tttttttatc ttaaagtcac tgtcaattta agattaaaca tacaatcaca taaccttaaa 1620

gaataccatt tacatttctc aatcaaaatt cctacaacac tatttgtttt atattttgtg 1680

atgtgggaat caattttaga tggtcgcaat ctaaattata atcaacaggt gaacttacta 1740

aataactttt ctaaataaaa aacttagaga ctttaatttt aaaagtcatc atatgagcta 1800

atatcacaat tttcccagtt taaaaaacta gttttcttgt taaaactcta aacttgacta 1860

aataaagagg actgataatt atacagttct taaatttgtt gtaatattaa tttcaaaact 1920

aaaaattgtc agcacagagt atgtgtaaaa atctgtaata taaattttta aactgatgcc 1980

tcattttgct acaaaataat ctggagtaaa tttttgatag gatttattta tgaaacctaa 2040

tgaagcagga ttaaatactg tattaaaata ggttcgctgt cttttaaaca aatggagatg 2100

atgattacta agtcacattg actttaatat gaggtatcac tatacctta 2149

<210> 3

<211> 1598

<212> DNA

<213> Mus musculus

<400> 3

caggagggag aagttccaaa ttgcttaaaa ttgaataatt gagacaaaaa atgcacacaa 60

ttaaattatt cctttttgtt gttcctttag taattgcatc cagagtggat ccagaccttt 120

catcatttga ttctgcacct tcagagccaa aatcaagatt tgctatgttg gatgatgtca 180

aaattttagc gaatggcctc ctgcagctgg gtcatggact taaagatttt gtccataaga 240

ctaagggaca aattaacgac atatttcaga agctcaacat atttgatcag tctttttatg 300

acctatcact tcgaaccaat gaaatcaaag aagaggaaaa ggagctaaga agaactacat 360

ctacactaca agttaaaaac gaggaggtga agaacatgtc agtagaactg aactcaaagc 420

ttgagagtct gctggaagag aagacagccc ttcaacacaa ggtcaggggct ttggaggagc 480

agctaaccaa cttaattcta agcccagctg gggctcagga gcacccagaa gtaacatcac 540

tcaaaagttt tgtagaacag caagacaaca gcataagaga actcctccag agtgtggaag 600

aacagtataa acaattaagt caacagcaca tgcagataaa agaaatagaa aagcagctca 660

gaaagactgg tattcaagaa ccctcagaaa attctctttc ttctaaatca agagcaccaa 720

gaactactcc ccctcttcaa ctgaacgaaa cagaaaatac agaacaagat gaccttcctg 780

ccgactgctc tgccgtttat aacagaggcg aacatacaag tggcgtgtac actattaaac 840

caagaaactc ccaagggttt aatgtctact gtgataccca atcaggcagt ccatggacat 900

taattcaaca ccggaaagat ggctcacagg acttcaacga aacatgggaa aactacgaaa 960

agggctttgg gaggctcgat ggagaatttt ggttgggcct agagaagatc tatgctatag 1020

tccaacagtc taactacatt ttacgactcg agctacaaga ctggaaagac agcaagcact 1080

acgttgaata ctcctttcac ctgggcagtc acgaaaccaa ctacacgcta catgtggctg 1140

agattgctgg caatatccct ggggccctcc cagagcacac agacctgatg ttttctacat 1200

ggaatcacag agcaaaggga cagctctact gtccagaaag ttactcaggt ggctggtggt 1260

ggaatgacat atgtggagaa aacaacctaa atggaaaata caacaaaccc agaaccaaat 1320

ccagaccaga gagaagaaga gggatctact ggagacctca gagcagaaag ctctatgcta 1380

tcaaatcatc caaaatgatg ctccagccca ccacctaaga agcttcaact gaactgagac 1440

aaaataaaag atcaataaat taaatattaa agtcctcccg atcactgtag taatctggta 1500

ttaaaatttt aatggaaagc ttgagaattg aatttcaatt aggtttaaac tcattgttaa 1560

gatcagatat caccgaatca acgtaaacaa aattatc 1598

<210> 4

<211> 1785

<212> DNA

<213> Rattus norvegicus

<400> 4

gacgttccaa attgcttgaa attgaataat tgaaacaaaa atgcacacaa ttaagctgct 60

cctttttgtt gttcctctag taatttcgtc cagagttgat ccagaccttt cgccatttga 120

ttctgtaccg tcagagccaa aatcaagatt tgctatgttg gatgatgtca aaattttagc 180

caatggcctc ctgcagctgg gtcatggtct taaagatttt gtccataaga caaagggaca 240

aattaatgac atatttcaga agctcaacat atttgatcag tgtttttatg acctatcact 300

360

agttaaaaac gaagaggtga agaatatgtc acttgaactg aactcaaagc ttgaaagtct 420

actggaggag aagatggcgc tccaacacag agtcagggct ttggaggaac agctgaccag 480

cttggttcag aacccgcctg gggctcggga gcaccagag gtaacgtcac ttaaaagttt 540

tgtagaacag caagataaca gcataagaga actcctccag agtgtggaag aacaatataa 600

acaactaagt caacagcaca ttcagataaa agaaatagaa aatcagctca gaaagactgg 660

cattcaagaa cccactgaaa attctcttta ttctaaacca agagcaccaa gaactactcc 720

ccctcttcat ctgaaggaag caaaaaatat agaacaagat gatctgcctg ctgactgctc 780

tgccatttat aacagaggtg aacatacaag tggcgtgtat actattagac caagcagctc 840

tcaagtgttt aatgtctact gtgacaccca atcaggcact ccacggacat taattcaaca 900

ccggaaagat ggctctcaaa acttcaacca aacgtgggaa aactacgaaa agggttttgg 960

gaggcttgat ggtaaagtga tttccttgca tcactcactt atctgttgat ttaatagtat 1020

1080

agcagcaggt gaattgaaag ttcaagacca gtctgggcca cacattgata ctccttctcg 1140

acattaagaa ttataaatta agcagcaatt ataaaatggg ctgtggaaat gtaacaataa 1200

gcaaaagcag accccagtct tcataaaact gattggtaaa tattatccat gatagcaact 1260

gcaatgatct cattgtactt atcactactg catgcctgca gtatgcttgt tgaaacttaa 1320

ttctatagtt catggttatc ataagtctta ttaaggaaca tagtatacgc cattggctct 1380

agtgaggggc catgctacaa atgagctgca aagatagcag tatagagctc tttcagtgat 1440

atcctaagca caacgtaaca caggtgaaat gggctggagg cacagttgtg gtggaacacg 1500

cggccagcag gacactggga ctgatcccca gcagcacaaa gaaagtgata ggaacacaga 1560

gcgagagtta gaagggacag ggtcaccgtc agagatacgg tgtctaactc ctgcaaccct 1620

acctgtaatt attccatatt ataaacatat actatataac tgtgggtctc tgcatgttct 1680

agaatatgaa ttctatttga ttgtaaaaca aaactataaa aataagtaaa aaaataaaaa 1740

ataaacagat acttaaaatc aaaaaaaaaa aaaaaaaaaa aaaaa 1785

<210> 5

<211> 2126

<212> DNA

<213> Homo sapiens

<400> 5

aataaggtat agtgatacct catgttaaag tcaatgtgac ttagtagtca tctccatttg 60

tttaaagaca gcgaacttat tttaatacag tatttaattc tgcttcatta ggtttcataa 120

ataaatcata tcaaacattt actccaaatt attttgtagc aaaatgaagc atcagtttaa 180

aaatttgtat tacagatttt tacacatact ctgtgctgac gatttttagt tttgaaatta 240

atactacaac atttaagaac tgtacaatta ccagtcctct gtatttagtc aagtttagag 300

ttttaacaag agtactagtt ttttaaactg ggaaagttgt gatattagct catatgatgc 360

cttttaaaat aaaagtctct aaatttttta tttagaaaag ttatttaata agttcaccta 420

ttgattataa tctagattgt gaccatctaa aattgattcc cacatcacaa aatttaaaac 480

aaatagtatt ataagaattt tgattgagaa atgtaaacgg tattctttaa ggttatgtga 540

ttgtatgttt aatcttaaat agacagtgac tttaagataa aaaaaatcta tttctcaagc 600

tttctcttaa ggatttaata ccagattatt agaccacatt aacttggaat gaggttaatg 660

tttaaattat tgcctttttaa atttgcctca gttcattcaa agctttctga atctgttgga 720

tggatcaaca ttttggttga ttttatagag tataaccttc cattttgaga cttccaagat 780

aatcctcttc tcctctctgg cttagatttt gctcttggtt tgttatattt accatttagg 840

ttgttttctc cacactcatc atgccaccac cagcctcctg aataaccctc tggacagttg 900

aagtgtcctt ttgctttgtg atcccaagta gaaaacacca aatctttgtt ttccgggatt 960

gcattgggga cattgccagt aatcgcaact agatgtagcg tatagttggt ttcgtgattt 1020

cccaagtaaa aagaatattc aatataatgt ttgttgtctt tccagtcttc caactcaatt 1080

cgtaaaacat aattagattg cttcactatg gagtatatct tctctaggcc caaccaaaat 1140

tctccatcaa gcctcccaaa accatatttg tagttctccc acgtttcatt gaagttttgt 1200

gatccatcta ttcgatgttg aattaatgtc catggactac ctgatataac atcacagtag 1260

1320

ctgttataaa tggtggtaca ttcagcagga atgccatcat gttttacatt tcttatttca 1380

ttcaactgaa gaaagggagt agttcttggt gctcttggct tggaagatag agaaatttct 1440

gtgggttctt gaatactagt ccttctgagc tgattttcta tttcttttat ttgactatgc 1500

tgttggttta attgtttata ttggtcttcc acggtctgga gaaggtcttt gatgctatta 1560

1620

1680

attttttctt ctaggaggct ttcaagtttt gagttgagtt caagtgacat attctttacc 1740

tcttcatttt tgacttgtag tttatatgta gttcttctca gttccttttc ttcttctttg 1800

1860

aatatgtcat taatttggcc cttcgtctta tggacaaagt ctttaagacc atgtcccaac 1920

tgaaggaggc cattggctaa aatttttaca tcgtctaaca tagcaaatct tgattttggc 1980

tctggagata gagaatcaaa tgatgaattg tcttgatcaa ttctggagga aataactaga 2040

ggaacaataa aaagaaggag cttaattgtg aacattttta tcttgatttt caatttcaag 2100

caacgtggaa ctgttttctt ctggaa 2126

<210> 6

<211> 2149

<212> DNA

<213> Macaca mulatta

<400> 6

taaggtatag tgatacctca tattaaagtc aatgtgactt agtaatcatc atctccattt 60

gtttaaaaga cagcgaacct attttaatac agtatttaat cctgcttcat taggtttcat 120

180

aaaaatttat attacagatt tttacacata ctctgtgctg acaattttta gttttgaaat 240

taatattaca acaaatttaa gaactgtata attatcagtc ctctttattt agtcaagttt 300

agagttttaa caagaaaact agttttttaa actgggaaaa ttgtgatatt agctcatatg 360

420

cctgttgatt ataatttaga ttgcgaccat ctaaaattga ttcccacatc acaaaatata 480

aaacaaatag tgttgtagga attttgattg agaaatgtaa atggtattct ttaaggttat 540

gtgattgtat gtttaatctt aaattgacag tgactttaag ataaaaaaat ctatttctca 600

agccttctct taaggattta ataccagatt attaaaccac attaacttgg aatgagttta 660

atgtttaatt tattgccttt taaatttgcc tcagttcatt caaagctttc tgaatctgtt 720

ggatggatca acattttggt tgattttata gagtataacc ttccattttg agacttccag 780

gataatcctc ttctccgctc tggcttagat tttgttcttg gtttgttata tttaccattt 840

aggttgtttt ctccacactc atcatgccac caccagcctc ctgaataact ctctggacag 900

ctgaagtgtc cttttgcttt gtgatcccaa gtagaaaaca ccaaatcttt gttttccgggg 960

attgcattgg ggacattgcc agtaatctta actacatgta gcgtatagtt ggtttcgtga 1020

tttcccaagt aaaaagaata ttcaatataa tgtttgttgt ctttccagtc ttccaactca 1080

attcgtaaaa cgtaattaga ttgcttcact atggagtata tcttctctag gccaaccag 1140

aattctccat caagcctccc gaaaccatat ttgtagttct cccacgtttc attgaagttt 1200

tgtgatccat ctattctcct tagacagggtt ttacctgata caacatcaca gtagacatga 1260

aaaacttgag agttgctggg tctgatggca tacatgccac ttatatgttc acctctattg 1320

taaatggtgg tacaatcagc aggaatgcca tcatgtttta catttcttat ttcattcagc 1380

tgaagaaagg gagtagttct tggtgctctt ggcttggaag atagagaaat ttctgtgggt 1440

tcttgaatat tagtcattct gagctgattt tctatttctt ttatttgact gtgctgttgg 1500

tttaattgct tatattgttc ttccacagtc tggagaaggt ctttgatgct attatcttgt 1560

ttttctacaa aacttttaag tgaagttact tctggatgtt ctggagtttc aggttgattt 1620

1680

tcttctagga ggctttcaag ttttgagttg agttcaagtg acatattctt tacctcttca 1740

tttttgactt gtagtttata tgtagttctt ctcagttcct ttttcttcttc tttgatttca 1800

1860

tcattaattt ggcccttagt cttatggaca aagtctttaa gaccatgtcc caactgaagg 1920

aggccattgg ctaaaatttt tacatcgtct aacatagcaa atcttgattt tggctctgga 1980

gatacagaat caaatgatga attgtcttgg tcaattctgg aggaaataac tagaggaaca 2040

ataaaaagaa ggagcttaat tgtgaacatt tttatcctga ttttcaattt caagcaacgt 2100

ggaactgtgt tcttctggaa gcagacctag acttcttaac tctatatat 2149

<210> 7

<211> 1598

<212> DNA

<213> Mus musculus

<400> 7

caggagggag aagttccaaa ttgcttaaaa ttgaataatt gagacaaaaa atgcacacaa 60

ttaaattatt cctttttgtt gttcctttag taattgcatc cagagtggat ccagaccttt 120

catcatttga ttctgcacct tcagagccaa aatcaagatt tgctatgttg gatgatgtca 180

aaattttagc gaatggcctc ctgcagctgg gtcatggact taaagatttt gtccataaga 240

ctaagggaca aattaacgac atatttcaga agctcaacat atttgatcag tctttttatg 300

acctatcact tcgaaccaat gaaatcaaag aagaggaaaa ggagctaaga agaactacat 360

ctacactaca agttaaaaac gaggaggtga agaacatgtc agtagaactg aactcaaagc 420

ttgagagtct gctggaagag aagacagccc ttcaacacaa ggtcaggggct ttggaggagc 480

agctaaccaa cttaattcta agcccagctg gggctcagga gcacccagaa gtaacatcac 540

tcaaaagttt tgtagaacag caagacaaca gcataagaga actcctccag agtgtggaag 600

aacagtataa acaattaagt caacagcaca tgcagataaa agaaatagaa aagcagctca 660

gaaagactgg tattcaagaa ccctcagaaa attctctttc ttctaaatca agagcaccaa 720

gaactactcc ccctcttcaa ctgaacgaaa cagaaaatac agaacaagat gaccttcctg 780

ccgactgctc tgccgtttat aacagaggcg aacatacaag tggcgtgtac actattaaac 840

caagaaactc ccaagggttt aatgtctact gtgataccca atcaggcagt ccatggacat 900

taattcaaca ccggaaagat ggctcacagg acttcaacga aacatgggaa aactacgaaa 960

agggctttgg gaggctcgat ggagaatttt ggttgggcct agagaagatc tatgctatag 1020

tccaacagtc taactacatt ttacgactcg agctacaaga ctggaaagac agcaagcact 1080

acgttgaata ctcctttcac ctgggcagtc acgaaaccaa ctacacgcta catgtggctg 1140

agattgctgg caatatccct ggggccctcc cagagcacac agacctgatg ttttctacat 1200

ggaatcacag agcaaaggga cagctctact gtccagaaag ttactcaggt ggctggtggt 1260

ggaatgacat atgtggagaa aacaacctaa atggaaaata caacaaaccc agaaccaaat 1320

ccagaccaga gagaagaaga gggatctact ggagacctca gagcagaaag ctctatgcta 1380

tcaaatcatc caaaatgatg ctccagccca ccacctaaga agcttcaact gaactgagac 1440

aaaataaaag atcaataaat taaatattaa agtcctcccg atcactgtag taatctggta 1500

ttaaaatttt aatggaaagc ttgagaattg aatttcaatt aggtttaaac tcattgttaa 1560

gatcagatat caccgaatca acgtaaacaa aattatc 1598

<210> 8

<211> 1785

<212> DNA

<213> Rattus norvegicus

<400> 8

tttttttttt tttttttttt tttttgattt taagtatctg tttatttttt atttttttac 60

ttatttttat agttttgttt tacaatcaaa tagaattcat attctagaac atgcagagac 120

ccacagttat atagtatatg tttataatat ggaataatta caggtagggt tgcaggagtt 180

agacaccgta tctctgacgg tgaccctgtc ccttctaact ctcgctctgt gttcctatca 240

ctttctttgt gctgctgggg atcagtccca gtgtcctgct ggccgcgtgt tccaccacaa 300

ctgtgcctcc agcccatttc acctgtgtta cgttgtgctt aggatatcac tgaaagagct 360

ctatactgct atctttgcag ctcatttgta gcatggcccc tcactagagc caatggcgta 420

tactatgttc cttaataaga cttatgataa ccatgaacta tagaattaag tttcaacaag 480

catactgcag gcatgcagta gtgataagta caatgagatc attgcagttg ctatcatgga 540

taatatttac caatcagttt tatgaagact ggggtctgct tttgcttatt gttacatttc 600

cacagcccat tttataattg ctgcttaatt tataattctt aatgtcgaga aggagtatca 660

atgtgtggcc cagactggtc ttgaactttc aattcacctg ctgctcctcc tccccccttg 720

cccaaaagcg ctatggtctc aggcctgtgt caacacaccc aactaatact attaaatcaa 780

cagataagtg agtgatgcaa ggaaatcact ttaccatcaa gcctcccaaa acccttttcg 840

tagttttccc acgtttggtt gaagttttga gagccatctt tccggtgttg aattaatgtc 900

cgtggagtgc ctgattgggt gtcacagtag acattaaaca cttgagagct gcttggtcta 960

atagtataca cgccacttgt atgttcacct ctgttataaa tggcagagca gtcagcaggc 1020

agatcatctt gttctatatt ttttgcttcc ttcagatgaa gagggggagt agttcttggt 1080

1140

tgattttcta tttcttttat ctgaatgtgc tgttgactta gttgtttata ttgttcttcc 1200

acactctgga ggagttctct tatgctgtta tcttgctgtt ctacaaaact tttaagtgac 1260

gttacctctg ggtgctcccg agccccaggc gggttctgaa ccaagctggt cagctgttcc 1320

1380

gagttcagtt caagtgacat attcttcacc tcttcgtttt taacttgtag tttagatgtg 1440

gttcttctta gctccttttc ctcttctttg atttcattgg tttgaagtga taggtcataa 1500

aaacactgat caaatatgtt gagcttctga aatatgtcat taatttgtcc ctttgtctta 1560

tggacaaaat ctttaagacc atgacccagc tgcaggaggc cattggctaa aattttgaca 1620

tcatccaaca tagcaaatct tgattttggc tctgacggta cagaatcaaa tggcgaaagg 1680

tctggatcaa ctctggacga aattactaga ggaacaacaa aaaggagcag cttaattgtg 1740

tgcattttg tttcaattat tcaatttcaa gcaatttggga acgtc 1785

<210> 9

<211> 2201

<212> DNA

<213> Macaca fascicularis

<400> 9

gggtagtata tagagttaag aagtctaggt ctgcttccag aagaacacag ttccacgctg 60

cttgaaattg aaaatcagga taaaaatgtt cacaattaag ctccttcttt ttattgttcc 120

tctagttatt tcctccagaa ttgaccaaga caattcatca

gccaaaatca agatttgcta tgttagacga tgtaaaaatt ttagccaatg gcctccttca 240

gttgggacat ggtcttaaag actttgtcca taagactaag ggccaaatta atgacatatt 300

tcaaaaactc aacatatttg atcagtcttt ttatgatcta tcactgcaaa ccagtgaaat 360

caaagaagaa gaaaaggaac tgagaagaac tacatataaa ctacaagtca aaaatgaaga 420

ggtaaagaat atgtcacttg aactcaactc aaaacttgaa agcctcctag aagaaaaaat 480

tctacttcaa caaaaagtga aatatttaga agagcaacta actaacttaa ttcaaaatca 540

acctgcaact ccagaacatc cagaagtaac ttcacttaaa agttttgtag aaaaacaaga 600

taatagcatc aaagaccttc tccagactgt ggaagaacaa tataagcaat taaaccaaca 660

gcatagtcaa ataaaagaaa tagaaaatca gctcagaatg actaatattc aagaacccac 720

agaaatttct ctatcttcca agccaaagc accaagaact actccctttc ttcagctgaa 780

tgaaataaga aatgtaaaac atgatggcat tcctgctgat tgtaccacca tttacaatag 840

aggtgaacat ataagtggca cgtatgccat cagacccagc aactctcaag ttttcatgt 900

ctactgtgat gttgtatcag gtagtccatg gacattaatt caacatcgaa tagatggatc 960

acaaaacttc aatgaaacgt gggagaacta caaatatggt ttcgggaggc ttgatggaga 1020

attctggttg ggcctagaga agatatactc catagtgaag caatctaatt acgttttacg 1080

1140

aaatcacgaa accaactata cgctacatgt agttaagatt actggcaatg tccccaatgc 1200

aatcccggaa aacaaagatt tggtgttttc tacttgggat cacaaagcaa aggacactt 1260

cagctgtcca gagagtttatt caggaggctg gtggtggcat gatgagtgtg gagaaaacaa 1320

1380

atcctggaag tctcaaaatg gaaggttata ctctataaaa tcaaccaaaa tgttgatcca 1440

tccaacagat tcagaaagct ttgaatgaac tgaggcaaat ttaaaaggca ataaattaaa 1500

cattaaactc attccaagtt aatgtggttt aataatctgg tattaaatcc ttaagagaag 1560

gcttgagaaa tagatttttt tatcttaaag tcactgtcaa tttaagatta aacatacaat 1620

cacataacct taaagaatac catttacatt tctcaatcaa aattcttaca acactatttg 1680

ttttattt tgtgatgtgg gaatcaattt tagatggtcg caatctaaat tataatcaac 1740

aggtgaactt actaaataac ttttctaaat 1800

catcatattga gctaatgtca caattttccc agtttaaaaa actagttttc ttgttaaaac 1860

tctaaacttg actaaataaa gaggactgat aattatacag ttcttaaatt tgttgtaata 1920

ttaatttcaa aactaaaaat tgtcagcaca gagtatgtgt aaaaatctgt aatataaatt 1980

tttaaactga tgcctcattt tgctacaaaa taatctggag taaatttttg ataggattta 2040

tttatgaaac ctaatgaagc aggattaaat actgtattaa aataggttcg ctgtctttta 2100

aacaaatgga gatgatgatt actaagtcac attgacttta atatgaggta tcactatacc 2160

ttaacatatt tgttaaaacg tatactgtat acattttgtg t 2201

<210> 10

<211> 11

<212> PROTEIN

<213> Unknown

<220>

<223> Description of unknown: Hydrophobic

membrane translocation peptide

<400> 10

Ala Ala Leu Leu Pro Val Leu Leu Ala Ala Pro

1 5 10

<210> 11

<211> 13

<212> PROTEIN

<213> Human immunodeficiency virus

<400> 11

Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Pro Pro Gln

1 5 10

<210> 12

<211> 16

<212> PROTEIN

<213> Drosophila sp.

<400> 12

Arg Gln Ile Lys Ile Trp Phe Gln Asn Arg Arg Met Lys Trp Lys Lys

1 5 10 15

<210> 13

<211> 16

<212> PROTEIN

<213> Unknown

<220>

<223> Description of unknown: Hydrophobic

membrane translocation peptide

<400> 13

Ala Ala Val Ala Leu Leu Pro Ala Val Leu Leu Ala Leu Leu Ala Pro

1 5 10 15

<210> 14

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 14

cuuacgcuga guacuucgat t 21

<210> 15

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 15

ucgaaguacu cagcguaagt t 21

<210> 16

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 16

uauuugauca gucuuuuua 19

<210> 17

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 17

gagcaacuaa cuaacuuaa 19

<210> 18

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 18

ggccaaauua augacauau 19

<210> 19

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 19

cgaauugagu uggaagacu 19

<210> 20

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 20

ccuccuucag uugggacau 19

<210> 21

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 21

cacuugaacu caacucaaa 19

<210> 22

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 22

guccauggac auuaauuca 19

<210> 23

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 23

aaucaagauu ugcuauguu 19

<210> 24

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 24

cuagagaaga uauacucca 19

<210> 25

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 25

cuaacuaacu uaauucaaa 19

<210> 26

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 26

cuaacuaacu uaauucaaa 19

<210> 27

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 27

cauuaauuca acaucgaau 19

<210> 28

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 28

caaaauguug auccaucca 19

<210> 29

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 29

cauauaaacu acaagucaa 19

<210> 30

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 30

gacccagcaa cucucaagu 19

<210> 31

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 31

gguugggccu agagaagau 19

<210> 32

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 32

guggagaa aacaaccua 19

<210> 33

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 33

gacauuaauu caacaucga 19

<210> 34

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 34

caaugugaag caaucuaau 19

<210> 35

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 35

cuauguuaga cgauguaaa 19

<210> 36

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 36

cacagaaauu ucucuaucu 19

<210> 37

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 37

guugggccua gagaagaua 19

<210> 38

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 38

gccaaaauca agauuugcu 19

<210> 39

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 39

acauauuuga ucagucuuu 19

<210> 40

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 40

acauauuuga ucagucuuu 19

<210> 41

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 41

cuuaaagacu uuguccaua 19

<210> 42

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 42

ccaaugugaa gcaaucuaa 19

<210> 43

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 43

caaccaaaau guugaucca 19

<210> 44

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 44

cuacauauaa acuacaagu 19

<210> 45

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 45

gggaggcuug aggagaau 19

<210> 46

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 46

gguguuuucu acuugggau 19

<210> 47

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 47

agagcacca agaacuacu 19

<210> 48

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 48

uggagaaaac aaccuaaau 19

<210> 49

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 49

gcaacuaacu aacuuaauu 19

<210> 50

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 50

caaccuaaau gguaaauau 19

<210> 51

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 51

gcuauguuag acgauguaa 19

<210> 52

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 52

cccacagaaa uuucucuau 19

<210> 53

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 53

gauuuggugu uuucuacuu 19

<210> 54

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 54

cagagccaaa aucaagauu 19

<210> 55

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 55

aaaucaagau uugcuaugu 19

<210> 56

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 56

cauggacauu aauucaaca 19

<210> 57

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 57

gauuugcuau guuagacga 19

<210> 58

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 58

gaacuacaua uaaacuaca 19

<210> 59

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 59

cgaauagaug gaucacaaa 19

<210> 60

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 60

Cuuguuaaaa Cucuuaaacu 19

<210> 61

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 61

auuugaucag ucuuuuuau 19

<210> 62

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 62

uccauggaca uuaauucaa 19

<210> 63

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 63

cacaauuaag cuccuucuu 19

<210> 64

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 64

caacauauuu gaucagucu 19

<210> 65

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 65

cuccaauagug aagcaaucu 19

<210> 66

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 66

gccaaauuaa ugacauauuu 19

<210> 67

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 67

caacagcaua gucaaauaa 19

<210> 68

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 68

ggaaaucacg aaaccaacu 19

<210> 69

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 69

caguugggac aggucuua 19

<210> 70

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 70

gacauggucu uaaagacuu 19

<210> 71

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 71

ugggagaaa acaaccuaa 19

<210> 72

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 72

guggagaaaa caaccuaaa 19

<210> 73

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 73

ccaacagcau agucaaaua 19

<210> 74

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 74

caacaucgaa uagauggau 19

<210> 75

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 75

gcaaauuuaa aaggcaaua 19

<210> 76

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 76

caaaaucaag auuugcuau 19

<210> 77

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 77

agagccaaaa ucaagauuu 19

<210> 78

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 78

uaaaaagacu gaucaaaua 19

<210> 79

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 79

uuaaguuagu uaguugcuc 19

<210> 80

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 80

aauugucauu aauuuggcc 19

<210> 81

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 81

agucuuccaa cucaauucg 19

<210> 82

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 82

augucccaac ugagggagg 19

<210> 83

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 83

uuugaguuga guucaagug 19

<210> 84

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 84

ugaauuaaug uccauggac 19

<210> 85

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 85

aacauagcaa aucuugauu 19

<210> 86

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 86

uggaguauau cuucucuag 19

<210> 87

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 87

uuugaauuaa guuaguuag 19

<210> 88

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 88

uuugaauuaa guuaguuag 19

<210> 89

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 89

auucgauguu gaauuaaug 19

<210> 90

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 90

uggauggauc aacauuuug 19

<210> 91

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 91

uugacuugua guuuauaug 19

<210> 92

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 92

acuugagagu ugcggguc 19

<210> 93

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 93

aucuucucua ggcccaacc 19

<210> 94

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 94

uagguuguuu ucuccacac 19

<210> 95

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 95

ucgauguuga auuaauguc 19

<210> 96

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 96

auuagauugc uucacuaug 19

<210> 97

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 97

uuuacaucgu cuaacauag 19

<210> 98

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 98

agauagagaa auuucugug 19

<210> 99

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 99

uaucuucucu aggcccaac 19

<210> 100

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 100

agcaaaucuu gauuuuggc 19

<210> 101

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 101

aaagacugau caaauaugu 19

<210> 102

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 102

aaagacugau caaauaugu 19

<210> 103

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 103

uauggaaaa gucuuuaag 19

<210> 104

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 104

uuagauugcu ucacuaugg 19

<210> 105

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 105

uggaucaaca uuuugguug 19

<210> 106

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 106

acuuguaguu uauauguag 19

<210> 107

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 107

auucuccauc aagccuccc 19

<210> 108

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 108

aucccaagua gaaaacacc 19

<210> 109

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 109

aguaguucuu ggugcucuu 19

<210> 110

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 110

auuuagguug uuuucucca 19

<210> 111

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 111

aauuaaguua guuaguugc 19

<210> 112

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 112

auauuuacca uuuagguug 19

<210> 113

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 113

uuacaucguc uaacauagc 19

<210> 114

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 114

auagagaaau uucuguggg 19

<210> 115

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 115

aaguagaaaa caccaaauc 19

<210> 116

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 116

aaucuugauu uuggcucug 19

<210> 117

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 117

acauagcaaa ucuugauuu 19

<210> 118

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 118

uguugaauua auguccaug 19

<210> 119

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 119

ucgucuaaca uagcaaauc 19

<210> 120

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 120

uguaguuuau auguaguuc 19

<210> 121

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 121

uuugugaucc aucuauucg 19

<210> 122

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 122

aguuuagagu uuuuacaag 19

<210> 123

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 123

auaaaaagac ugaucaaau 19

<210> 124

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 124

uugaauuaau guccaugga 19

<210> 125

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 125

aagaaggagc uuaauugug 19

<210> 126

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 126

agacugauca aauauguug 19

<210> 127

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 127

agauugcuuc acuauggag 19

<210> 128

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 128

auauugucau uaauuuggc 19

<210> 129

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 129

uuauuugacu augcuguug 19

<210> 130

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 130

aguugguuuc gugauuucc 19

<210> 131

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 131

uaagaccaug ucccaacug 19

<210> 132

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 132

aagucuuuaa gaccauguc 19

<210> 133

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 133

uuagguuguu uucuccaca 19

<210> 134

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 134

uuuagguuguuuuucuccac 19

<210> 135

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 135

uauuugacua ugcuguugg 19

<210> 136

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 136

auccaucauau ucgauguug 19

<210> 137

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 137

uauugccuuu uaaauuugc 19

<210> 138

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 138

auagcaaauc uugauuuug 19

<210> 139

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 139

aaaucuugau uuuggcucu 19

<210> 140

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 140

uauuugauca gucuuuuuat t 21

<210> 141

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 141

gagcaacuaa cuaacuuaat t 21

<210> 142

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 142

ggccaaauua augacauaut t 21

<210> 143

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 143

cgaauugagu uggaagacut t 21

<210> 144

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 144

ccuccuucag uugggacaut t 21

<210> 145

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 145

cacuugaacu caacucaaat t 21

<210> 146

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 146

guccauggac auuaauucat t 21

<210> 147

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 147

aaucaagauu ugcuauguut t 21

<210> 148

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 148

cuagagaaga uauacuccat t 21

<210> 149

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 149

cuaacuaacu uaauucaaat t 21

<210> 150

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 150

cuaacuaacu uaauucaaat t 21

<210> 151

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 151

cauuaauuca acaucgaaut t 21

<210> 152

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 152

caaaauguug auccauccat t 21

<210> 153

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 153

cauauaaacu acaagucaat t 21

<210> 154

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 154

gacccagcaa cucucaagut t 21

<210> 155

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 155

gguugggccu agagaagaut t 21

<210> 156

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 156

guggagaa aacaaccuat t 21

<210> 157

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 157

gacauuaauu caacaucgat t 21

<210> 158

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 158

caaugugaag caaucuaaut t 21

<210> 159

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 159

cuauguuaga cgauguaaat t 21

<210> 160

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 160

cacagaaauu ucucuaucut t 21

<210> 161

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 161

guugggccua gagaagauat t 21

<210> 162

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 162

gccaaaauca agauuugcut t 21

<210> 163

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 163

acauauuuga ucagucuuut t 21

<210> 164

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 164

acauauuuga ucagucuuut t 21

<210> 165

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 165

cuuaaagacu uuguccauat t 21

<210> 166

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 166

ccaaugugaa gcaaucuaat t 21

<210> 167

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 167

caaccaaaau guugauccat t 21

<210> 168

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 168

cuacauauaa acuacaagut t 21

<210> 169

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 169

gggaggcuug aggagaaut t 21

<210> 170

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 170

gguguuuucu acuugggaut t 21

<210> 171

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 171

aagaccacca agaacuacut t 21

<210> 172

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 172

uggagaaaac aaccuaaaut t 21

<210> 173

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 173

gcaacuaacu aacuuaauut t 21

<210> 174

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 174

caaccuaaau gguaaauaut t 21

<210> 175

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 175

gcuauguuag acgauguaat t 21

<210> 176

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 176

cccacagaaa uuucucuaut t 21

<210> 177

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 177

gauuuggugu uuucuacuut t 21

<210> 178

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 178

cagagccaaa aucaagauut t 21

<210> 179

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 179

aaaucaagau uugcuaugut t 21

<210> 180

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 180

cauggacauu aauucaacat t 21

<210> 181

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 181

gauuugcuau guuagacgat t 21

<210> 182

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 182

gaacuacaua uaaacuacat t 21

<210> 183

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 183

cgaauagaug gaucacaaat t 21

<210> 184

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 184

cuuguuaaaa cucuuaaacut t 21

<210> 185

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 185

auuugaucag ucuuuuuaut t 21

<210> 186

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 186

uccauggaca uuaauucaat t 21

<210> 187

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 187

cacaauuaag cuccuucuut t 21

<210> 188

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 188

caacauauuu gaucagucut t 21

<210> 189

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 189

cuccauagug aagcaaucut t 21

<210> 190

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 190

gccaaauuaa ugacauauut t 21

<210> 191

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 191

caacagcaua gucaaauaatt 21

<210> 192

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 192

ggaaaucacg aaaccaacut t 21

<210> 193

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 193

caguugggac aggucuuat t 21

<210> 194

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 194

gacauggucu uaaagacuut t 21

<210> 195

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 195

ugggagaaa acaaccuaat t 21

<210> 196

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 196

guggagaaaa caaccuaaat t 21

<210> 197

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 197

ccaacagcau agucaaauat t 21

<210> 198

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 198

caacaucgaa uagauggaut t 21

<210> 199

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 199

gcaaauuuaa aaggcaauat t 21

<210> 200

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 200

caaaaucaag auuugcuaut t 21

<210> 201

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 201

agagccaaaa ucaagauuut t 21

<210> 202

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 202

uaaaaagacu gaucaaauat t 21

<210> 203

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 203

uuaaguuagu uaguugcuct t 21

<210> 204

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 204

auaugucuauu aauuuggcct t 21

<210> 205

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 205

agucuuccaa cucaauucgt t 21

<210> 206

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 206

augucccaac ugaaggaggt t 21

<210> 207

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 207

uuugaguuga guucaagugt t 21

<210> 208

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 208

ugaauuaaug uccauggact t 21

<210> 209

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 209

aacauagcaa aucuugauut t 21

<210> 210

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 210

uggaguauau cuucucuagt t 21

<210> 211

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 211

uuugaauuaa guuaguuagt t 21

<210> 212

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 212

uuugaauuaa guuaguuagt t 21

<210> 213

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 213

auucgauguu gaauuaaugt t 21

<210> 214

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 214

uggauggauc aacauuuugt t 21

<210> 215

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 215

uugacuugua guuuauaugt t 21

<210> 216

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 216

acuugagagu ugcuggguct t 21

<210> 217

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 217

aucuucucua ggcccaacct t 21

<210> 218

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 218

uagguuguuu ucuccacact t 21

<210> 219

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 219

ucgauguuga auuaauguct t 21

<210> 220

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 220

auuagauugc uucacuaugt t 21

<210> 221

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 221

uuuacaucgu cuaacauagt t 21

<210> 222

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 222

agauagagaa auuucugugt t 21

<210> 223

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 223

uaucuucucu aggcccaact t 21

<210> 224

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 224

agcaaaucuu gauuuuggct t 21

<210> 225

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 225

aaagacugau caaauaugut t 21

<210> 226

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 226

aaagacugau caaauaugut t 21

<210> 227

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 227

uuggacaaa gucuuuaagt t 21

<210> 228

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 228

uuagauugcu ucacuauggt t 21

<210> 229

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 229

uggaucaaca uuuugguugt t 21

<210> 230

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 230

acuuguaguu uauauguagt t 21

<210> 231

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 231

auucuccauc aagccuccct t 21

<210> 232

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 232

aucccaagua gaaaacacct t 21

<210> 233

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 233

aguaguucuu ggugcucuut t 21

<210> 234

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 234

auuuagguug uuuucuccat t 21

<210> 235

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 235

aauuaaguua guuaguugct t 21

<210> 236

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 236

auauuuacca uuuagguugt t 21

<210> 237

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 237

uuacaucguc uaacauagct t 21

<210> 238

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 238

auagagaaau uucugugggt 21

<210> 239

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 239

aaguagaaaa caccaaauct t 21

<210> 240

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 240

aaucuugauu uuggcucugt t 21

<210> 241

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 241

acauagcaaa ucuugauuut t 21

<210> 242

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 242

uguugaauua auguccaugt t 21

<210> 243

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 243

ucgucuaaca uagcaaauct t 21

<210> 244

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 244

uguaguuuau auguaguuct t 21

<210> 245

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 245

uuugugaucc aucuauucgt t 21

<210> 246

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 246

aguuuagagu uuuaacaagt t 21

<210> 247

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 247

auaaaaagac ugaucaaaut t 21

<210> 248

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 248

uugaauuaau guccauggat t 21

<210> 249

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 249

aagaaggagc uuaauugugt t 21

<210> 250

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 250

agacugauca aauauguugt t 21

<210> 251

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 251

agauugcuuc acuauggagt t 21

<210> 252

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 252

auauugucau uaauuuggct t 21

<210> 253

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 253

uuauuugacu augcuguugt t 21

<210> 254

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 254

aguugguuuc gugauuucct t 21

<210> 255

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 255

uaagaccaug ucccaacugt t 21

<210> 256

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 256

aagucuuuaa gaccauguct t 21

<210> 257

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 257

uuagguuguu uucuccacat t 21

<210> 258

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 258

uuuagguugu uuucuccact t 21

<210> 259

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 259

uauuugacua ugcuguuggt t 21

<210> 260

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 260

auccaucauau ucgauguugt t 21

<210> 261

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 261

uauugccuuu uaaauuugct t 21

<210> 262

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 262

auagcaaauc uugauuuugt 21

<210> 263

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule: Synthetic

oligonucleotide

<400> 263

aaaucuugau uuuggcucut t 21

<210> 264

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 264

aaagacaaca aacauuauauau u 21

<210> 265

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 265

acaauuaagc uccuucuuuu u 21

<210> 266

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 266

ugucacuuga acucaacuca a 21

<210> 267

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 267

ucacaauuaa gcuccuucuu u 21

<210> 268

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 268

cuugaacuca acucaaaacu u 21

<210> 269

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 269

cuccaauagug aagcaaucua a 21

<210> 270

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 270

caauuaagcu ccuucuuuuu a 21

<210> 271

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 271

acccagcaac ucucaaguuu u 21

<210> 272

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 272

gaauauguca cuugaacuca a 21

<210> 273

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 273

aauuaagcuc cuucuuuuua u 21

<210> 274

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 274

cauuauauug aauauucuuu u 21

<210> 275

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 275

acuaacuaac uuaauucaaaa 21

<210> 276

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 276

uuauuguucc ucuaguuauu u 21

<210> 277

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 277

cauagugaag caaucuaauu a 21

<210> 278

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 278

ccaaugugaa gcaaucuaau u 21

<210> 279

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 279

gaucacaaaa cuucaaugaa a 21

<210> 280

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 280

auggaagguu auacucuaua a 21

<210> 281

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 281

uccauaguga agcaaucuaa u 21

<210> 282

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 282

cuauguuaga cgauguaaaa a 21

<210> 283

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 283

auuaagcucc uucuuuuuau u 21

<210> 284

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 284

aacuaacuaa cuuaauucaa a 21

<210> 285

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 285

ggccaaauua augacauauu u 21

<210> 286

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 286

uuuuauuguu ccucuaguua u 21

<210> 287

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 287

acauauuuga ucagucuuuu u 21

<210> 288

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 288

cccagcaacu cucaaguuuu u 21

<210> 289

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 289

cagguagucc auggacauua a 21

<210> 290

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 290

acugagaaga acuacauaua a 21

<210> 291

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 291

gagcaacuaa cuaacuuaau u 21

<210> 292

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 292

aacaaccuaa augguaaaua u 21

<210> 293

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 293

ccuagagaag auauacucca u 21

<210> 294

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 294

caacauauuu gaucagucuu u 21

<210> 295

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 295

acaacaaaca uuauauugaa u 21

<210> 296

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 296

acauauaaac uacaagucaa a 21

<210> 297

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 297

cuaguuauuu ccuccagaau u 21

<210> 298

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 298

aagagcaacu aacuaacuua a 21

<210> 299

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 299

uuuuuguuc cucuaguuau u 21

<210> 300

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 300

cuccuagaag aaaaaauucu a 21

<210> 301

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 301

aacaaacauu auauugaaua u 21

<210> 302

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 302

ggaaaucacg aaaccaacua u 21

<210> 303

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 303

aacauauuug aucagucuuu u 21

<210> 304

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 304

uggaagguua uacucuauaa a 21

<210> 305

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 305

ggagaacuac aaauaugguuu 21

<210> 306

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 306

gaaaacaaag auuugguguuu 21

<210> 307

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 307

aguguggaga aaacaaccua a 21

<210> 308

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 308

gucacuugaa cucaacucaa a 21

<210> 309

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 309

guggaucac aaaacuucaa u 21

<210> 310

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 310

acaaacauua uauugaauau u 21

<210> 311

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 311

ugggagaaa acaaccuaaa u 21

<210> 312

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 312

aucagucuuu uuaugaucua u 21

<210> 313

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 313

gacaacaaac auuauauuga a 21

<210> 314

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 314

caacagcaua gucaaauaaa a 21

<210> 315

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 315

cugagaagaa cuacauauaa a 21

<210> 316

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 316

ugcuauguua gacgauguaa a 21

<210> 317

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 317

aacccacaga aauuucucua u 21

<210> 318

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 318

cuucaacaaa aagugaaaua u 21

<210> 319

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 319

ucacuugaac ucaacucaaa a 21

<210> 320

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 320

cauagucaaa uaaaagaaau a 21

<210> 321

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 321

caaaaacuca acauauuuga u 21

<210> 322

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 322

uacuucaaca aaaagugaaa u 21

<210> 323

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 323

gacccagcaa cucucaaguu u 21

<210> 324

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 324

uugaaugaac ugaggcaaau u 21

<210> 325

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 325

uauaaacuac aagucaaaaa u 21

<210> 326

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 326

aaacaagaua auagcaucaa a 21

<210> 327

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 327

caacuaacua acuuaauuca a 21

<210> 328

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 328

gcuauguuag acgauguaaa a 21

<210> 329

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 329

acuugggauc acaaagcaaa a 21

<210> 330

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 330

uugcuauguu agacgaugua a 21

<210> 331

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 331

aacugagaag aacuacauau a 21

<210> 332

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 332

gauguaaaaa uuuuagccaa u 21

<210> 333

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 333

acuccauagu gaagcaaucu a 21

<210> 334

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 334

uucaacaaaa agugaaauau u 21

<210> 335

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 335

cuagagaaga uauacuccau a 21

<210> 336

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 336

caaccuaaau gguaaauaua a 21

<210> 337

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 337

gaaaucacga aaccaacuau a 21

<210> 338

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 338

ccacagaaau uucucuaucu u 21

<210> 339

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 339

aaaucaagau uugcuauguu a 21

<210> 340

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 340

acauuaauuc aacaucgaau a 21

<210> 341

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 341

ccagagccaa aaucaagauu u 21

<210> 342

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 342

cuacuucaac aaaaagugaa a 21

<210> 343

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 343

gacauuaauu caacaucgaa u 21

<210> 344

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 344

ggacauuaau ucaacaucga a 21

<210> 345

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 345

gcauagucaa auaaaagaaa u 21

<210> 346

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 346

cucucaaguu uuucaugucu a 21

<210> 347

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 347

aucgaauaga uggaucacaa a 21

<210> 348

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 348

acauuauauu gaauauucuu u 21

<210> 349

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 349

uuaauucaac aucgaauaga u 21

<210> 350

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 350

gauaauagca ucaaagaccu u 21

<210> 351

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 351

ugacauauuu caaaaacuca a 21

<210> 352

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 352

aaauuaauga cauauuucaa a 21

<210> 353

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 353

gaagauauac uccauaguga a 21

<210> 354

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 354

aauauuuaga agagcaacua a 21

<210> 355

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 355

cgauguaaaa auuuuagcca a 21

<210> 356

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 356

uucaacaucg aauagaugga u 21

<210> 357

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 357

guggagaa aacaaccuaa a 21

<210> 358

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 358

ucaacauauuu ugaucagucu u 21

<210> 359

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 359

ucagguaguc cauggacauu a 21

<210> 360

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 360

uuuagaagag caacuaacua a 21

<210> 361

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 361

uacauauaaa cuacaaguca a 21

<210> 362

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 362

ggaucacaaa acuucaauga a 21

<210> 363

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 363

agagcaacua acuaacuuaa u 21

<210> 364

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 364

accacagca uagucaaaua a 21

<210> 365

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 365

aaccaacagc auagucaaau a 21

<210> 366

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 366

gaacucaacu caaaacuuga a 21

<210> 367

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 367

uacucuauaa aaucaaccaa a 21

<210> 368

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 368

cagcauaguguc aaauaaaaga a 21

<210> 369

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 369

gaaauaagaa auguaaaaca u 21

<210> 370

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 370

cuaacuaacu uaauucaaaa u 21

<210> 371

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 371

augaacugag gcaaauuuaa a 21

<210> 372

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 372

ugaacugagg caaauuuaaaa 21

<210> 373

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 373

aaacaaccua aaugguaaau a 21

<210> 374

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 374

acaaccuaaa ugguaaauau a 21

<210> 375

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 375

aacgugggag aacuacaaau a 21

<210> 376

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 376

aaugaacuga ggcaaauuua a 21

<210> 377

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 377

guuggaagac uggaaagaca a 21

<210> 378

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 378

uggcaauguc cccaaugcaa u 21

<210> 379

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 379

gguaguccau ggacauuaau u 21

<210> 380

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 380

cauauaaacu acaagucaaa a 21

<210> 381

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 381

aaucccggaa aacaaagauuu 21

<210> 382

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 382

cuacuuggga ucacaaagca a 21

<210> 383

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 383

ugaaugaacu gaggcaaauu u 21

<210> 384

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 384

agcauaguca aauaaaagaa a 21

<210> 385

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 385

auuuagaaga gcaacuaacu a 21

<210> 386

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 386

aggcaaauuu aaaaggcaau a 21

<210> 387

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 387

cauauuugau cagucuuuuu a 21

<210> 388

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 388

aaaacaaaga uuugguguuuu 21

<210> 389

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 389

caauccggga aaacaaagau u 21

<210> 390

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 390

caacaaacau uauauugaau a 21

<210> 391

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 391

ggaaaacaaa gauuuggugu u 21

<210> 392

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 392

acaaagauuu gguguuuucu a 21

<210> 393

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 393

gaaugaacug aggcaaauuuu a 21

<210> 394

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 394

ccauggacau uaauucaaca u 21

<210> 395

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 395

aacucaacuc aaaacuugaa a 21

<210> 396

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 396

caguugggac aggucuuaa a 21

<210> 397

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 397

aacauuauau ugaauauucu u 21

<210> 398

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 398

accagugaaa ucaaagaaga a 21

<210> 399

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 399

guugggccua gagaagauau a 21

<210> 400

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 400

cucgagcc aaaaucaaga u 21

<210> 401

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 401

ggcaaauuua aaaggcaaua a 21

<210> 402

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 402

uacuugggau cacaaagcaa a 21

<210> 403

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 403

gaucagucuu uuuaugaucu a 21

<210> 404

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 404

gaaagccucc uagaagaaaa a 21

<210> 405

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 405

agucaaauaa aagaaauaga a 21

<210> 406

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 406

auacucuaua aaaucaacca a 21

<210> 407

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 407

gaacugaggc aaauuuaaaaa 21

<210> 408

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 408

agacccagca acucucaagu u 21

<210> 409

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 409

auauaaacua caagucaaaa a 21

<210> 410

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 410

ugaaagccuc cuagaagaaa a 21

<210> 411

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 411

gggagaacua caaauauuggu u 21

<210> 412

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 412

agauuugcua uguuagacga u 21

<210> 413

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 413

gaacccacag aaauuucucu a 21

<210> 414

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 414

acuucaaca aaagugaaau a 21

<210> 415

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 415

aguccaugga cauuaauuca a 21

<210> 416

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 416

aacugaggca aauuuaaaag a 21

<210> 417

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 417

gggccaaauu augacauau u 21

<210> 418

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 418

auccauccaa cagauucaga a 21

<210> 419

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 419

aagauuuggu guuuucuacu u 21

<210> 420

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 420

gucucaaaau ggaagguuau a 21

<210> 421

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 421

acugaggcaa auuuaaaagg a 21

<210> 422

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 422

gggacauggu cuuaaagacu u 21

<210> 423

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 423

augguaaaua uaacaaacca a 21

<210> 424

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 424

gggaaaucac gaaaccaacu a 21

<210> 425

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 425

ccaacagcau agucaaauaa a 21

<210> 426

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 426

uuuucuacuu gggaucacaa a 21

<210> 427

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 427

agaacuacau auaaacuaca a 21

<210> 428

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 428

agaguaugug uaaaaaucug u 21

<210> 429

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 429

aaaacaagau aauagcauca a 21

<210> 430

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 430

aguaugugua aaaaucugua a 21

<210> 431

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 431

agucaaaaau gaagagguaa a 21

<210> 432

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 432

ggacaugguc uuaaagacuu u 21

<210> 433

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 433

gaggcaaauu uaaaaggcaa u 21

<210> 434

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 434

gucuuaaaga cuuuguccau a 21

<210> 435

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 435

cugaggcaaa uuuaaaaggc a 21

<210> 436

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 436

gcaaucccgg aaaacaaaga u 21

<210> 437

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 437

ugaggcaaau uuaaaaggca a 21

<210> 438

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 438

ucuacuucaa caaaaaguga a 21

<210> 439

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 439

uauguguaaa aaucuguaau a 21

<210> 440

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 440

aaugcaaucc cggaaaacaa a 21

<210> 441

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 441

cuugaaagcc uccuagaaga a 21

<210> 442

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 442

guauguguaa aaaucuguaa u 21

<210> 443

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 443

cagaguaugu guaaaaaucu u 21

<210> 444

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 444

gaguaugugu aaaaaucugu a 21

<210> 445

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 445

ucaguuggga cauggucuua a 21

<210> 446

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 446

ggucuuaaag acuuugucca u 21

<210> 447

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 447

ucuuaaagac uuuguccaua a 21

<210> 448

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 448

uucaguuggg acauggucuu a 21

<210> 449

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 449

aauauaaugu uuguugucuu ucc 23

<210> 450

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 450

aaaaagaagg agcuuaauug uga 23

<210> 451

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 451

uugaguugag uucaagugac aua 23

<210> 452

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 452

aaagaaggag cuuaauugug aac 23

<210> 453

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 453

aaguuuugag uugaguucaa gug 23

<210> 454

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 454

uuagauugcu ucacuugga gua 23

<210> 455

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 455

uaaaaagaag gagcuuaauu gug 23

<210> 456

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 456

aaaacuugag aguugcuggg ucu 23

<210> 457

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 457

uugaguucaa gugacauauu cuu 23

<210> 458

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 458

auaaaaagaa ggagcuuaau ugu 23

<210> 459

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 459

aaaagaauau ucaauauaau guu 23

<210> 460

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 460

uuuugaauua aguuaguuag uug 23

<210> 461

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 461

aaauaacuag aggaacaaua aaa 23

<210> 462

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 462

uaauuagauu gcuucacuau gga 23

<210> 463

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 463

aauuagauug cuucacuaug gag 23

<210> 464

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 464

uuucauugaa guuuugugau cca 23

<210> 465

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 465

uuuagagua uaaccuucca uuu 23

<210> 466

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 466

auuagauugc uucacuaugg agu 23

<210> 467

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 467

uuuuuacauc gucuaacaua gca 23

<210> 468

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 468

aauaaaaaga aggagcuuaa uug 23

<210> 469

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 469

uuugaauuaa guuaguuagu ugc 23

<210> 470

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 470

aaauauguca uuaauuuggc ccu 23

<210> 471

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 471

auaacuagag gaacaauaaa aag 23

<210> 472

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 472

aaaaagacug aucaaauauug uug 23

<210> 473

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 473

aaaaacuuga gaguugcugg guc 23

<210> 474

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 474

uuaaugucca uggacuaccu gau 23

<210> 475

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 475

uuauauguag uucuucucag uuc 23

<210> 476

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 476

aauuaaguua guuaguugcu cuu 23

<210> 477

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 477

auauuuacca uuuagguugu uuu 23

<210> 478

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 478

auggaguaua ucuucucuag gcc 23

<210> 479

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 479

aaagacugau caaauauguu gag 23

<210> 480

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 480

auucaauaua auguuuguug ucu 23

<210> 481

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 481

uuugacuugu aguuuauaug uag 23

<210> 482

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 482

aauucuggag gaaauaacua gag 23

<210> 483

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 483

uuaaguuagu uaguugcucu ucu 23

<210> 484

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 484

aauaacuaga ggaacaauaa aaa 23

<210> 485

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 485

uagaauuuuu ucuucuagga ggc 23

<210> 486

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 486

auauucaaua uaauguuugu ugu 23

<210> 487

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 487

auaguugguu ucgugauuuc cca 23

<210> 488

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 488

aaaagacuga ucaaauaugu uga 23

<210> 489

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 489

uuuuagagu auaaccuucc auu 23

<210> 490

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 490

aaaccauauu uguaguucuc cca 23

<210> 491

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 491

aaacaccaaa ucuuuguuuu ccg 23

<210> 492

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 492

uuagguuguu uucuccacac uca 23

<210> 493

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 493

uuugaguuga guucaaguga cau 23

<210> 494

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 494

auugaaguuu ugugauccau cua 23

<210> 495

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 495

aauauucaau auaauguuug uug 23

<210> 496

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 496

auuuagguug uuuucuccac acu 23

<210> 497

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 497

auagaucaua aaaagacuga uca 23

<210> 498

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 498

uucaauauaa uguuuguugu cuu 23

<210> 499

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 499

uuuuauuuga cuaugcuguu ggu 23

<210> 500

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 500

uuuauaugua guucuucuca guu 23

<210> 501

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 501

uuuacaucgu cuaacauagc aaa 23

<210> 502

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 502

auagagaaau uucugugggu ucu 23

<210> 503

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 503

auauuucacu uuuuguugaa gua 23

<210> 504

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 504

uuuugaguug aguucaagug aca 23

<210> 505

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 505

uauuucuuuu auuugacuau gcu 23

<210> 506

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 506

aucaaauug uugaguuuuu gaa 23

<210> 507

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 507

auuucacuuu uuguugaagu aga 23

<210> 508

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 508

aaacuugaga guugcugggu cug 23

<210> 509

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 509

aauuugccuc aguucauuca aag 23

<210> 510

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 510

aug 23

<210> 511

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 511

uuugaugcua uuaucuuguu uuu 23

<210> 512

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 512

uugaauuaag uuaguuaguu gcu 23

<210> 513

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 513

uuuuacaucg ucuaacauag caa 23

<210> 514

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 514

uuuugcuuug ugaucccaag uag 23

<210> 515

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 515

uuacaucguc uaacauagca aau 23

<210> 516

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 516

uauauguagu ucuucucagu ucc 23

<210> 517

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 517

auuggcuaaa auuuuuacau cgu 23

<210> 518

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 518

uugauugcuu cacuauggag uau 23

<210> 519

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 519

aauauuucac uuuuuguuga agu 23

<210> 520

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 520

uuggaguau aucuucucua ggc 23

<210> 521

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 521

uuauauuuac cauuuagguu guu 23

<210> 522

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 522

uauaguuggu uucgugauuu ccc 23

<210> 523

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 523

aagauagaga aauuucugug ggu 23

<210> 524

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 524

uaacauagca aaucuugauu uug 23

<210> 525

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 525

uauucgaugu ugaauuaug ucc 23

<210> 526

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 526

aaaucuugau uuuggcucug gag 23

<210> 527

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 527

uuucacuuuu uguugaagua gaa 23

<210> 528

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 528

auucgauguu gaauuaaugu cca 23

<210> 529

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 529

uucgauguug aauuauguc cau 23

<210> 530

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 530

auuucuuuua uuugacuaug cug 23

<210> 531

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 531

uagacaugaa aaacuugaga guu 23

<210> 532

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 532

uuugugaucc aucuauucga ugu 23

<210> 533

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 533

aaagaauauu caauauaaug uuu 23

<210> 534

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 534

aug 23

<210> 535

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 535

aaggucuuug augcuauuau cuu 23

<210> 536

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 536

uugaguuuuu gaaauauuguc auu 23

<210> 537

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 537

uuugaaauau gucauuaauu ugg 23

<210> 538

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 538

uucacuaugg aguauaucuu cuc 23

<210> 539

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 539

uuaguugcuc uucuaaauau uuc 23

<210> 540

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 540

uuggcuaaaa uuuuuacauc guc 23

<210> 541

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 541

auccaucauau ucgauguuga auu 23

<210> 542

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 542

uuuagguugu uuucuccaca cuc 23

<210> 543

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 543

aagacugauc aaauauguug agu 23

<210> 544

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 544

uaauguccau ggacuaccug aua 23

<210> 545

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 545

uuaguuaguu gcucuucuaa aua 23

<210> 546

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 546

uugacuugua guuuauaugu agu 23

<210> 547

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 547

uucauugaag uuuugugauc cau 23

<210> 548

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 548

auuaaguuag uuaguugcuc uuc 23

<210> 549

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 549

uuuuugacu augcuguugg uuu 23

<210> 550

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 550

uauuugacua ugcuguuggu uua 23

<210> 551

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 551

uucaaguuuu gaguugaguu caa 23

<210> 552

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 552

uuugguugau uuuauagagu aua 23

<210> 553

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 553

uucuuuuauu ugacuaugcu guu 23

<210> 554

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 554

auguuuuaca uuucuuauuu cau 23

<210> 555

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 555

auuuugaauu aaguuaguua guu 23

<210> 556

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 556

uuuaaauuug ccucaguuca uuc 23

<210> 557

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 557

uuuuaaauuu gccucaguuc auu 23

<210> 558

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 558

uauuuuaccau uuagguuguu uuc 23

<210> 559

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 559

uauauuuacc auuuagguug uuu 23

<210> 560

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 560

uauuuguagu ucucccgu uuc 23

<210> 561

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 561

uuaaauuugc cucaguucau uca 23

<210> 562

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 562

uugucuuucc agucuuccaa cuc 23

<210> 563

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 563

auugcauugg ggacauugcc agu 23

<210> 564

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 564

aauuaauguc cauggacuac cug 23

<210> 565

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 565

uuuugacuug uaguuuauau gua 23

<210> 566

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 566

aaaucuuugu uuuccgggau ugc 23

<210> 567

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 567

uugcuuugug aucccaagua gaa 23

<210> 568

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 568

aaauuugccu caguucauuc aaa 23

<210> 569

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 569

uuucuuuuau uugacuaugc ugu 23

<210> 570

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 570

uaguuaguug cucuucuaaa uau 23

<210> 571

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 571

uauugccuuu uaaauuugcc uca 23

<210> 572

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 572

uaaaaagacu gaucaaauau guu 23

<210> 573

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 573

aaaacaccaa aucuuuguuu ucc 23

<210> 574

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 574

aaucuuuguu uuccgggauu gca 23

<210> 575

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 575

uauucaauau aauguuuguu guc 23

<210> 576

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 576

aacaccaaau cuuuguuuuc cgg 23

<210> 577

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 577

uagaaaacac caaaucuuug uuu 23

<210> 578

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 578

uaaauuugcc ucaguucauu caa 23

<210> 579

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 579

auguugaauu aauguccaug gac 23

<210> 580

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 580

uuucaaguuu ugaguugagu uca 23

<210> 581

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 581

uuuaagacca ugucccaacu gaa 23

<210> 582

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 582

aagaauauuc aauauaaugu uug 23

<210> 583

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 583

uuuuuuug auuucacugg uuu 23

<210> 584

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 584

uauaucuucu cuaggcccaa cca 23

<210> 585

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 585

aucuugauuu uggcugga gau 23

<210> 586

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 586

cuc 23

<210> 587

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 587

uuugcuuugu gaucccaagu aga 23

<210> 588

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 588

uagaucauaa aaagacugau caa 23

<210> 589

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 589

uuuuucuucu aggaggcuuu caa 23

<210> 590

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 590

uuuuuuucu uuuauuugac uau 23

<210> 591

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 591

uugguugauu uuauagagua uaa 23

<210> 592

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 592

uuuuuaaauu ugccucaguu cau 23

<210> 593

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 593

aacuugag uugcuggguc uga 23

<210> 594

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 594

uuuuugacuu guaguuuaua ugu 23

<210> 595

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 595

uuuucuucua ggaggcuuuc aag 23

<210> 596

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 596

aaccauauuu guaguucucc cac 23

<210> 597

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 597

aucgucuaac auagcaaauc uug 23

<210> 598

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 598

uagagaaauu ucuguggguu cuu 23

<210> 599

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 599

uuuuucacuu uuuguugaag uag 23

<210> 600

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 600

uugaauuaau guccauggac uac 23

<210> 601

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 601

ucuuuuaaau uugccucagu uca 23

<210> 602

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 602

auauugucau uaauuuggcc cuu 23

<210> 603

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 603

uucugaaucu guuggaugga uca 23

<210> 604

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 604

aaguagaaaa caccaaaucu uug 23

<210> 605

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 605

uauaaccuuc cauuuugaga cuu 23

<210> 606

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 606

uccuuuuaaa uuugccucag uuc 23

<210> 607

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 607

aagucuuuaa gaccaugucc caa 23

<210> 608

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 608

uugguuuguu auauuuacca uuu 23

<210> 609

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 609

uaguugguuu cgugauuucc caa 23

<210> 610

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 610

uuuuuugac uaugcuguug guu 23

<210> 611

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 611

uuugugaucc caaguagaaa aca 23

<210> 612

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 612

uuguaguuua uauguaguuc uuc 23

<210> 613

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 613

acagauuuuu acacauacuc ugu 23

<210> 614

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 614

uugaugcuau uaucuuguuu uuc 23

<210> 615

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 615

uuacagauuuuuuacacauac ucu 23

<210> 616

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 616

uuuaccucuu cauuuuugac uug 23

<210> 617

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 617

aaagucuuua agaccauguc cca 23

<210> 618

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 618

auugccuuuu aaauuugccu cag 23

<210> 619

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 619

uauggaaaa gucuuuaaga cca 23

<210> 620

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 620

ugccuuuuaa auuugccuca guu 23

<210> 621

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 621

aucuuuguuu uccgggauug cau 23

<210> 622

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 622

uugccuuuua aauuugccuc agu 23

<210> 623

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 623

uucacuuuuu guugaaguag aau 23

<210> 624

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 624

uauuuacagau uuuuuacacau acu 23

<210> 625

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 625

uuuguuuucc gggauugcau ugg 23

<210> 626

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 626

uucuucuagg aggcuuucaa guu 23

<210> 627

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 627

auuacagauu uuuacacaua cuc 23

<210> 628

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 628

aagauuuuua cacauacucu gug 23

<210> 629

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 629

uacagauuuu uacacauacu cug 23

<210> 630

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 630

uuaagaccau gucccaacug aag 23

<210> 631

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 631

auggacaaag ucuuuaagac cau 23

<210> 632

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 632

uuauggaca agucuuuaag acc 23

<210> 633

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 633

uaagaccaug ucccaacuga agg 23

<210> 634

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 634

aaagacaaca aacauuauauau u 21

<210> 635

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 635

acaauuaagc uccuucuuuu u 21

<210> 636

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 636

ugucacuuga acucaacuca a 21

<210> 637

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 637

ucacaauuaa gcuccuucuu u 21

<210> 638

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 638

cuugaacuca acucaaaacu u 21

<210> 639

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 639

cuccaauagug aagcaaucua a 21

<210> 640

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 640

caauuaagcu ccuucuuuuu a 21

<210> 641

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 641

acccagcaac ucucaaguuu u 21

<210> 642

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 642

gaauauguca cuugaacuca a 21

<210> 643

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 643

aauuaagcuc cuucuuuuua u 21

<210> 644

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 644

cauuauauug aauauucuuu u 21

<210> 645

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 645

acuaacuaac uuaauucaaaa 21

<210> 646

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 646

uuauuguucc ucuaguuauu u 21

<210> 647

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 647

cauagugaag caaucuaauu a 21

<210> 648

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 648

ccaaugugaa gcaaucuaau u 21

<210> 649

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 649

gaucacaaaa cuucaaugaa a 21

<210> 650

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 650

auggaagguu auacucuaua a 21

<210> 651

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 651

uccauaguga agcaaucuaa u 21

<210> 652

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 652

cuauguuaga cgauguaaaa a 21

<210> 653

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 653

auuaagcucc uucuuuuuau u 21

<210> 654

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 654

aacuaacuaa cuuaauucaa a 21

<210> 655

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 655

ggccaaauua augacauauu u 21

<210> 656

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 656

uuuuauuguu ccucuaguua u 21

<210> 657

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 657

acauauuuga ucagucuuuu u 21

<210> 658

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 658

cccagcaacu cucaaguuuu u 21

<210> 659

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 659

cagguagucc auggacauua a 21

<210> 660

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 660

acugagaaga acuacauaua a 21

<210> 661

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 661

gagcaacuaa cuaacuuaau u 21

<210> 662

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 662

aacaaccuaa augguaaaua u 21

<210> 663

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 663

ccuagagaag auauacucca u 21

<210> 664

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 664

caacauauuu gaucagucuu u 21

<210> 665

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 665

acaacaaaca uuauauugaa u 21

<210> 666

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 666

acauauaaac uacaagucaa a 21

<210> 667

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 667

cuaguuauuu ccuccagaau u 21

<210> 668

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 668

aagagcaacu aacuaacuua a 21

<210> 669

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 669

uuuuuguuc cucuaguuau u 21

<210> 670

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 670

cuccuagaag aaaaaauucu a 21

<210> 671

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 671

aacaaacauu auauugaaua u 21

<210> 672

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 672

ggaaaucacg aaaccaacua u 21

<210> 673

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 673

aacauauuug aucagucuuu u 21

<210> 674

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 674

uggaagguua uacucuauaa a 21

<210> 675

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 675

ggagaacuac aaauaugguuu 21

<210> 676

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 676

gaaaacaaag auuugguguuu 21

<210> 677

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 677

aguguggaga aaacaaccua a 21

<210> 678

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 678

gucacuugaa cucaacucaa a 21

<210> 679

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 679

guggaucac aaaacuucaa u 21

<210> 680

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 680

acaaacauua uauugaauau u 21

<210> 681

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 681

ugggagaaa acaaccuaaa u 21

<210> 682

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 682

aucagucuuu uuaugaucua u 21

<210> 683

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 683

gacaacaaac auuauauuga a 21

<210> 684

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 684

caacagcaua gucaaauaaa a 21

<210> 685

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 685

cugagaagaa cuacauauaa a 21

<210> 686

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 686

ugcuauguua gacgauguaa a 21

<210> 687

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 687

aacccacaga aauuucucua u 21

<210> 688

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 688

cuucaacaaa aagugaaaua u 21

<210> 689

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 689

ucacuugaac ucaacucaaa a 21

<210> 690

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 690

cauagucaaa uaaaagaaau a 21

<210> 691

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 691

caaaaacuca acauauuuga u 21

<210> 692

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 692

uacuucaaca aaaagugaaa u 21

<210> 693

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 693

gacccagcaa cucucaaguu u 21

<210> 694

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 694

uugaaugaac ugaggcaaau u 21

<210> 695

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 695

uauaaacuac aagucaaaaa u 21

<210> 696

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 696

aaacaagaua auagcaucaa a 21

<210> 697

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 697

caacuaacua acuuaauuca a 21

<210> 698

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 698

gcuauguuag acgauguaaa a 21

<210> 699

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 699

acuugggauc acaaagcaaa a 21

<210> 700

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 700

uugcuauguu agacgaugua a 21

<210> 701

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 701

aacugagaag aacuacauau a 21

<210> 702

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 702

gauguaaaaa uuuuagccaa u 21

<210> 703

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 703

acuccauagu gaagcaaucu a 21

<210> 704

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 704

uucaacaaaa agugaaauau u 21

<210> 705

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 705

cuagagaaga uauacuccau a 21

<210> 706

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 706

caaccuaaau gguaaauaua a 21

<210> 707

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 707

gaaaucacga aaccaacuau a 21

<210> 708

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 708

ccacagaaau uucucuaucu u 21

<210> 709

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 709

aaaucaagau uugcuauguu a 21

<210> 710

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 710

acauuaauuc aacaucgaau a 21

<210> 711

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 711

ccagagccaa aaucaagauu u 21

<210> 712

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 712

cuacuucaac aaaaagugaa a 21

<210> 713

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 713

gacauuaauu caacaucgaa u 21

<210> 714

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 714

ggacauuaau ucaacaucga a 21

<210> 715

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 715

gcauagucaa auaaaagaaa u 21

<210> 716

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 716

cucucaaguu uuucaugucu a 21

<210> 717

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 717

aucgaauaga uggaucacaa a 21

<210> 718

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 718

acauuauauu gaauauucuu u 21

<210> 719

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 719

uuaauucaac aucgaauaga u 21

<210> 720

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 720

gauaauagca ucaaagaccu u 21

<210> 721

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 721

ugacauauuu caaaaacuca a 21

<210> 722

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 722

aaauuaauga cauauuucaa a 21

<210> 723

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 723

gaagauauac uccauaguga a 21

<210> 724

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 724

aauauuuaga agagcaacua a 21

<210> 725

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 725

cgauguaaaa auuuuagcca a 21

<210> 726

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 726

uucaacaucg aauagaugga u 21

<210> 727

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 727

guggagaa aacaaccuaa a 21

<210> 728

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 728

ucaacauauuu ugaucagucu u 21

<210> 729

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 729

ucagguaguc cauggacauu a 21

<210> 730

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 730

uuuagaagag caacuaacua a 21

<210> 731

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 731

uacauauaaa cuacaaguca a 21

<210> 732

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 732

ggaucacaaa acuucaauga a 21

<210> 733

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 733

agagcaacua acuaacuuaa u 21

<210> 734

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 734

accacagca uagucaaaua a 21

<210> 735

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 735

aaccaacagc auagucaaau a 21

<210> 736

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 736

gaacucaacu caaaacuuga a 21

<210> 737

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 737

uacucuauaa aaucaaccaa a 21

<210> 738

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 738

cagcauaguguc aaauaaaaga a 21

<210> 739

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 739

gaaauaagaa auguaaaaca u 21

<210> 740

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 740

cuaacuaacu uaauucaaaa u 21

<210> 741

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 741

augaacugag gcaaauuuaa a 21

<210> 742

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 742

ugaacugagg caaauuuaaaa 21

<210> 743

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 743

aaacaaccua aaugguaaau a 21

<210> 744

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 744

acaaccuaaa ugguaaauau a 21

<210> 745

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 745

aacgugggag aacuacaaau a 21

<210> 746

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 746

aaugaacuga ggcaaauuua a 21

<210> 747

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 747

guuggaagac uggaaagaca a 21

<210> 748

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 748

uggcaauguc cccaaugcaa u 21

<210> 749

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 749

gguaguccau ggacauuaau u 21

<210> 750

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 750

cauauaaacu acaagucaaaa 21

<210> 751

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 751

aaucccggaa aacaaagauu u 21

<210> 752

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 752

cuacuuggga ucacaaagca a 21

<210> 753

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 753

ugaaugaacu gaggcaaauu u 21

<210> 754

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 754

agcauaguca aauaaaagaa a 21

<210> 755

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 755

auuuagaaga gcaacuaacu a 21

<210> 756

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 756

aggcaaauuu aaaaggcaau a 21

<210> 757

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 757

cauauuugau cagucuuuuu a 21

<210> 758

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 758

aaaacaaaga uuugguguuuu 21

<210> 759

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 759

caauccggga aaacaaagau u 21

<210> 760

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 760

caacaaacau uauauugaau a 21

<210> 761

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 761

ggaaaacaaa gauuuggugu u 21

<210> 762

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 762

acaaagauuu gguguuuucu a 21

<210> 763

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 763

gaaugaacug aggcaaauuuu a 21

<210> 764

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 764

ccauggacau uaauucaaca u 21

<210> 765

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 765

aacucaacuc aaaacuugaa a 21

<210> 766

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 766

caguugggac aggucuuaa a 21

<210> 767

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 767

aacauuauau ugaauauucu u 21

<210> 768

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 768

accagugaaa ucaaagaaga a 21

<210> 769

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 769

guugggccua gagaagauau a 21

<210> 770

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 770

cucgagcc aaaaucaaga u 21

<210> 771

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 771

ggcaaauuua aaaggcaaua a 21

<210> 772

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 772

uacuugggau cacaaagcaa a 21

<210> 773

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 773

gaucagucuu uuuaugaucu a 21

<210> 774

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 774

gaaagccucc uagaagaaaa a 21

<210> 775

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 775

agucaaauaa aagaaauaga a 21

<210> 776

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 776

auacucuaua aaaucaacca a 21

<210> 777

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 777

gaacugaggc aaauuuaaaaa 21

<210> 778

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 778

agacccagca acucucaagu u 21

<210> 779

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 779

auauaaacua caagucaaaa a 21

<210> 780

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 780

ugaaagccuc cuagaagaaa a 21

<210> 781

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 781

gggagaacua caaauauuggu u 21

<210> 782

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 782

agauuugcua uguuagacga u 21

<210> 783

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 783

gaacccacag aaauuucucu a 21

<210> 784

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 784

acuucaaca aaagugaaau a 21

<210> 785

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 785

aguccaugga cauuaauuca a 21

<210> 786

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 786

aacugaggca aauuuaaaag a 21

<210> 787

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 787

gggccaaauu augacauau u 21

<210> 788

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 788

auccauccaa cagauucaga a 21

<210> 789

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 789

aagauuuggu guuuucuacu u 21

<210> 790

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 790

gucucaaaau ggaagguuau a 21

<210> 791

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 791

acugaggcaa auuuaaaagg a 21

<210> 792

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 792

gggacauggu cuuaaagacu u 21

<210> 793

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 793

augguaaaua uaacaaacca a 21

<210> 794

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 794

gggaaaucac gaaaccaacu a 21

<210> 795

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 795

ccaacagcau agucaaauaa a 21

<210> 796

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 796

uuuucuacuu gggaucacaa a 21

<210> 797

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 797

agaacuacau auaaacuaca a 21

<210> 798

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 798

agaguaugug uaaaaaucug u 21

<210> 799

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 799

aaaacaagau aauagcauca a 21

<210> 800

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 800

aguaugugua aaaaucugua a 21

<210> 801

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 801

agucaaaaau gaagagguaa a 21

<210> 802

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 802

ggacaugguc uuaaagacuu u 21

<210> 803

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 803

gaggcaaauu uaaaaggcaa u 21

<210> 804

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 804

gucuuaaaga cuuuguccau a 21

<210> 805

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 805

cugaggcaaa uuuaaaaggc a 21

<210> 806

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 806

gcaaucccgg aaaacaaaga u 21

<210> 807

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 807

ugaggcaaau uuaaaaggca a 21

<210> 808

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 808

ucuacuucaa caaaaaguga a 21

<210> 809

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 809

uauguguaaa aaucuguaau a 21

<210> 810

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 810

aaugcaaucc cggaaaacaa a 21

<210> 811

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 811

cuugaaagcc uccuagaaga a 21

<210> 812

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 812

guauguguaa aaaucuguaa u 21

<210> 813

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 813

cagaguaugu guaaaaaucu u 21

<210> 814

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 814

gaguaugugu aaaaaucugu a 21

<210> 815

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 815

ucaguuggga cauggucuua a 21

<210> 816

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 816

ggucuuaaag acuuugucca u 21

<210> 817

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 817

ucuuaaagac uuuguccaua a 21

<210> 818

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 818

uucaguuggg acauggucuu a 21

<210> 819

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 819

aauauaaugu uuguugucuu ucc 23

<210> 820

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 820

aaaaagaagg agcuuaauug uga 23

<210> 821

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 821

uugaguugag uucaagugac aua 23

<210> 822

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 822

aaagaaggag cuuaauugug aac 23

<210> 823

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 823

aaguuuugag uugaguucaa gug 23

<210> 824

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 824

uuagauugcu ucacuugga gua 23

<210> 825

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 825

uaaaaagaag gagcuuaauu gug 23

<210> 826

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 826

aaaacuugag aguugcuggg ucu 23

<210> 827

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 827

uugaguucaa gugacauauu cuu 23

<210> 828

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 828

auaaaaagaa ggagcuuaau ugu 23

<210> 829

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 829

aaaagaauau ucaauauaau guu 23

<210> 830

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 830

uuuugaauua aguuaguuag uug 23

<210> 831

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 831

aaauaacuag aggaacaaua aaa 23

<210> 832

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 832

uaauuagauu gcuucacuau gga 23

<210> 833

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 833

aauuagauug cuucacuaug gag 23

<210> 834

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 834

uuucauugaa guuuugugau cca 23

<210> 835

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 835

uuuagagua uaaccuucca uuu 23

<210> 836

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 836

auuagauugc uucacuaugg agu 23

<210> 837

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 837

uuuuuacauc gucuaacaua gca 23

<210> 838

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 838

aauaaaaaga aggagcuuaa uug 23

<210> 839

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 839

uuugaauuaa guuaguuagu ugc 23

<210> 840

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 840

aaauauguca uuaauuuggc ccu 23

<210> 841

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 841

auaacuagag gaacaauaaa aag 23

<210> 842

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 842

aaaaagacug aucaaauauug uug 23

<210> 843

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 843

aaaaacuuga gaguugcugg guc 23

<210> 844

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 844

uuaaugucca uggacuaccu gau 23

<210> 845

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 845

uuauauguag uucuucucag uuc 23

<210> 846

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 846

aauuaaguua guuaguugcu cuu 23

<210> 847

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 847

auauuuacca uuuagguugu uuu 23

<210> 848

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 848

auggaguaua ucuucucuag gcc 23

<210> 849

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 849

aaagacugau caaauauguu gag 23

<210> 850

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 850

auucaauaua auguuuguug ucu 23

<210> 851

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 851

uuugacuugu aguuuauaug uag 23

<210> 852

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 852

aauucuggag gaaauaacua gag 23

<210> 853

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 853

uuaaguuagu uaguugcucu ucu 23

<210> 854

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 854

aauaacuaga ggaacaauaa aaa 23

<210> 855

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 855

uagaauuuuu ucuucuagga ggc 23

<210> 856

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 856

auauucaaua uaauguuugu ugu 23

<210> 857

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 857

auaguugguu ucgugauuuc cca 23

<210> 858

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 858

aaaagacuga ucaaauaugu uga 23

<210> 859

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 859

uuuuagagu auaaccuucc auu 23

<210> 860

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 860

aaaccauauu uguaguucuc cca 23

<210> 861

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 861

aaacaccaaa ucuuuguuuu ccg 23

<210> 862

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 862

uuagguuguu uucuccacac uca 23

<210> 863

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 863

uuugaguuga guucaaguga cau 23

<210> 864

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 864

auugaaguuu ugugauccau cua 23

<210> 865

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 865

aauauucaau auaauguuug uug 23

<210> 866

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 866

auuuagguug uuuucuccac acu 23

<210> 867

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 867

auagaucaua aaaagacuga uca 23

<210> 868

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 868

uucaauauaa uguuuguugu cuu 23

<210> 869

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 869

uuuuauuuga cuaugcuguu ggu 23

<210> 870

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 870

uuuauaugua guucuucuca guu 23

<210> 871

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 871

uuuacaucgu cuaacauagc aaa 23

<210> 872

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 872

auagagaaau uucugugggu ucu 23

<210> 873

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 873

auauuucacu uuuuguugaa gua 23

<210> 874

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 874

uuuugaguug aguucaagug aca 23

<210> 875

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 875

uauuucuuuu auuugacuau gcu 23

<210> 876

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 876

aucaaauug uugaguuuuu gaa 23

<210> 877

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 877

auuucacuuu uuguugaagu aga 23

<210> 878

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 878

aaacuugaga guugcugggu cug 23

<210> 879

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 879

aauuugccuc aguucauuca aag 23

<210> 880

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 880

aug 23

<210> 881

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 881

uuugaugcua uuaucuuguu uuu 23

<210> 882

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 882

uugaauuaag uuaguuaguu gcu 23

<210> 883

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 883

uuuuacaucg ucuaacauag caa 23

<210> 884

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 884

uuuugcuuug ugaucccaag uag 23

<210> 885

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 885

uuacaucguc uaacauagca aau 23

<210> 886

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 886

uauauguagu ucuucucagu ucc 23

<210> 887

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 887

auuggcuaaa auuuuuacau cgu 23

<210> 888

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 888

uugauugcuu cacuauggag uau 23

<210> 889

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 889

aauauuucac uuuuuguuga agu 23

<210> 890

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 890

uuggaguau aucuucucua ggc 23

<210> 891

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 891

uuauauuuac cauuuagguu guu 23

<210> 892

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 892

uauaguuggu uucgugauuu ccc 23

<210> 893

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 893

aagauagaga aauuucugug ggu 23

<210> 894

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 894

uaacauagca aaucuugauu uug 23

<210> 895

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 895

uauucgaugu ugaauuaug ucc 23

<210> 896

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 896

aaaucuugau uuuggcucug gag 23

<210> 897

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 897

uuucacuuuu uguugaagua gaa 23

<210> 898

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 898

auucgauguu gaauuaaugu cca 23

<210> 899

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 899

uucgauguug aauuauguc cau 23

<210> 900

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 900

auuucuuuua uuugacuaug cug 23

<210> 901

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 901

uagacaugaa aaacuugaga guu 23

<210> 902

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 902

uuugugaucc aucuauucga ugu 23

<210> 903

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 903

aaagaauauu caauauaaug uuu 23

<210> 904

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 904

aug 23

<210> 905

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 905

aaggucuuug augcuauuau cuu 23

<210> 906

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 906

uugaguuuuu gaaauauuguc auu 23

<210> 907

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 907

uuugaaauau gucauuaauu ugg 23

<210> 908

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 908

uucacuaugg aguauaucuu cuc 23

<210> 909

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 909

uuaguugcuc uucuaaauau uuc 23

<210> 910

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 910

uuggcuaaaa uuuuuacauc guc 23

<210> 911

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 911

auccaucauau ucgauguuga auu 23

<210> 912

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 912

uuuagguugu uuucuccaca cuc 23

<210> 913

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 913

aagacugauc aaauauguug agu 23

<210> 914

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 914

uaauguccau ggacuaccug aua 23

<210> 915

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 915

uuaguuaguu gcucuucuaa aua 23

<210> 916

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 916

uugacuugua guuuauaugu agu 23

<210> 917

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 917

uucauugaag uuuugugauc cau 23

<210> 918

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 918

auuaaguuag uuaguugcuc uuc 23

<210> 919

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 919

uuuuugacu augcuguugg uuu 23

<210> 920

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 920

uauuugacua ugcuguuggu uua 23

<210> 921

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 921

uucaaguuuu gaguugaguu caa 23

<210> 922

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 922

uuugguugau uuuauagagu aua 23

<210> 923

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 923

uucuuuuauu ugacuaugcu guu 23

<210> 924

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 924

auguuuuaca uuucuuauuu cau 23

<210> 925

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 925

auuuugaauu aaguuaguua guu 23

<210> 926

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 926

uuuaaauuug ccucaguuca uuc 23

<210> 927

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 927

uuuuaaauuu gccucaguuc auu 23

<210> 928

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 928

uauuuuaccau uuagguuguu uuc 23

<210> 929

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 929

uauauuuacc auuuagguug uuu 23

<210> 930

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 930

uauuuguagu ucucccgu uuc 23

<210> 931

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 931

uuaaauuugc cucaguucau uca 23

<210> 932

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 932

uugucuuucc agucuuccaa cuc 23

<210> 933

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 933

auugcauugg ggacauugcc agu 23

<210> 934

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 934

aauuaauguc cauggacuac cug 23

<210> 935

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 935

uuuugacuug uaguuuauau gua 23

<210> 936

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 936

aaaucuuugu uuuccgggau ugc 23

<210> 937

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 937

uugcuuugug aucccaagua gaa 23

<210> 938

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 938

aaauuugccu caguucauuc aaa 23

<210> 939

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 939

uuucuuuuau uugacuaugc ugu 23

<210> 940

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 940

uaguuaguug cucuucuaaa uau 23

<210> 941

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 941

uauugccuuu uaaauuugcc uca 23

<210> 942

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 942

uaaaaagacu gaucaaauau guu 23

<210> 943

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 943

aaaacaccaa aucuuuguuu ucc 23

<210> 944

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 944

aaucuuuguu uuccgggauu gca 23

<210> 945

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 945

uauucaauau aauguuuguu guc 23

<210> 946

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 946

aacaccaaau cuuuguuuuc cgg 23

<210> 947

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 947

uagaaaacac caaaucuuug uuu 23

<210> 948

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 948

uaaauuugcc ucaguucauu caa 23

<210> 949

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 949

auguugaauu aauguccaug gac 23

<210> 950

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 950

uuucaaguuu ugaguugagu uca 23

<210> 951

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 951

uuuaagacca ugucccaacu gaa 23

<210> 952

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 952

aagaauauuc aauauaaugu uug 23

<210> 953

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 953

uuuuuuug auuucacugg uuu 23

<210> 954

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 954

uauaucuucu cuaggcccaa cca 23

<210> 955

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 955

aucuugauuu uggcugga gau 23

<210> 956

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 956

cuc 23

<210> 957

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 957

uuugcuuugu gaucccaagu aga 23

<210> 958

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 958

uagaucauaa aaagacugau caa 23

<210> 959

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 959

uuuuucuucu aggaggcuuu caa 23

<210> 960

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 960

uuuuuuucu uuuauuugac uau 23

<210> 961

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 961

uugguugauu uuauagagua uaa 23

<210> 962

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 962

uuuuuaaauu ugccucaguu cau 23

<210> 963

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 963

aacuugag uugcuggguc uga 23

<210> 964

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 964

uuuuugacuu guaguuuaua ugu 23

<210> 965

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 965

uuuucuucua ggaggcuuuc aag 23

<210> 966

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 966

aaccauauuu guaguucucc cac 23

<210> 967

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 967

aucgucuaac auagcaaauc uug 23

<210> 968

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 968

uagagaaauu ucuguggguu cuu 23

<210> 969

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 969

uuuuucacuu uuuguugaag uag 23

<210> 970

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 970

uugaauuaau guccauggac uac 23

<210> 971

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 971

ucuuuuaaau uugccucagu uca 23

<210> 972

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 972

auauugucau uaauuuggcc cuu 23

<210> 973

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 973

uucugaaucu guuggaugga uca 23

<210> 974

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 974

aaguagaaaa caccaaaucu uug 23

<210> 975

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 975

uauaaccuuc cauuuugaga cuu 23

<210> 976

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 976

uccuuuuaaa uuugccucag uuc 23

<210> 977

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 977

aagucuuuaa gaccaugucc caa 23

<210> 978

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 978

uugguuuguu auauuuacca uuu 23

<210> 979

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 979

uaguugguuu cgugauuucc caa 23

<210> 980

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 980

uuuuuugac uaugcuguug guu 23

<210> 981

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 981

uuugugaucc caaguagaaa aca 23

<210> 982

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 982

uuguaguuua uauguaguuc uuc 23

<210> 983

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 983

acagauuuuu acacauacuc ugu 23

<210> 984

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 984

uugaugcuau uaucuuguuu uuc 23

<210> 985

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 985

uuacagauuuuuuacacauac ucu 23

<210> 986

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 986

uuuaccucuu cauuuuugac uug 23

<210> 987

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 987

aaagucuuua agaccauguc cca 23

<210> 988

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 988

auugccuuuu aaauuugccu cag 23

<210> 989

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 989

uauggaaaa gucuuuaaga cca 23

<210> 990

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 990

ugccuuuuaa auuugccuca guu 23

<210> 991

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 991

aucuuuguuu uccgggauug cau 23

<210> 992

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 992

uugccuuuua aauuugccuc agu 23

<210> 993

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 993

uucacuuuuu guugaaguag aau 23

<210> 994

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 994

uauuuacagau uuuuuacacau acu 23

<210> 995

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 995

uuuguuuucc gggauugcau ugg 23

<210> 996

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 996

uucuucuagg aggcuuucaa guu 23

<210> 997

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 997

auuacagauu uuuacacaua cuc 23

<210> 998

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 998

aagauuuuua cacauacucu gug 23

<210> 999

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 999

uacagauuuu uacacauacu cug 23

<210> 1000

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1000

uuaagaccau gucccaacug aag 23

<210> 1001

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1001

auggacaaag ucuuuaagac cau 23

<210> 1002

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1002

uuauggaca agucuuuaag acc 23

<210> 1003

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1003

uaagaccaug ucccaacuga agg 23

<210> 1004

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1004

ucacaauuaa gcuccuucuu u 21

<210> 1005

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1005

uuauuguucc ucuaguuauu u 21

<210> 1006

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1006

gcuauguuag acgauguaaa a 21

<210> 1007

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1007

ggacaugguc uuaaagacuu u 21

<210> 1008

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1008

caaaaacuca acauauuuga u 21

<210> 1009

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1009

accagugaaa ucaaagaaga a 21

<210> 1010

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1010

cacaauuaag cuccuucuuu u 21

<210> 1011

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1011

cuauguuaga cgauguaaaa a 21

<210> 1012

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1012

ucaacauauuu ugaucagucu u 21

<210> 1013

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1013

aacugagaag aacuacauau a 21

<210> 1014

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1014

acaauuaagc uccuucuuuu u 21

<210> 1015

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1015

cucgagcc aaaaucaaga u 21

<210> 1016

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1016

cgauguaaaa auuuuagcca a 21

<210> 1017

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1017

gucuuaaaga cuuuguccau a 21

<210> 1018

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1018

caacauauuu gaucagucuu u 21

<210> 1019

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1019

acugagaaga acuacauaua a 21

<210> 1020

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1020

ccagagccaa aaucaagauu u 21

<210> 1021

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1021

gauguaaaaa uuuuagccaa u 21

<210> 1022

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1022

ucuuaaagac uuuguccaua a 21

<210> 1023

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1023

aacauauuug aucagucuuu u 21

<210> 1024

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1024

cugagaagaa cuacauauaa a 21

<210> 1025

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1025

aauuaagcuc cuucuuuuua u 21

<210> 1026

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1026

aaaucaagau uugcuauguu a 21

<210> 1027

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1027

uucaguuggg acauggucuu a 21

<210> 1028

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1028

gggccaaauu augacauau u 21

<210> 1029

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1029

acauauuuga ucagucuuuu u 21

<210> 1030

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1030

agaacuacau auaaacuaca a 21

<210> 1031

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1031

auuaagcucc uucuuuuuau u 21

<210> 1032

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1032

agauuugcua uguuagacga u 21

<210> 1033

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1033

ucaguuggga cauggucuua a 21

<210> 1034

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1034

ggccaaauua augacauauu u 21

<210> 1035

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1035

cauauuugau cagucuuuuu a 21

<210> 1036

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1036

uacauauaaa cuacaaguca a 21

<210> 1037

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1037

uuuuauuguu ccucuaguua u 21

<210> 1038

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1038

uugcuauguu agacgaugua a 21

<210> 1039

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1039

caguugggac aggucuuaa a 21

<210> 1040

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1040

aaauuaauga cauauuucaa a 21

<210> 1041

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1041

gaucagucuu uuuaugaucu a 21

<210> 1042

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1042

acauauaaac uacaagucaa a 21

<210> 1043

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1043

uuuuuguuc cucuaguuau u 21

<210> 1044

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1044

ugcuauguua gacgauguaa a 21

<210> 1045

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1045

gggacauggu cuuaaagacu u 21

<210> 1046

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1046

ugacauauuu caaaaacuca a 21

<210> 1047

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1047

aucagucuuu uuaugaucua u 21

<210> 1048

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1048

cauauaaacu acaagucaaaa 21

<210> 1049

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1049

cuugaacuca acucaaaacu u 21

<210> 1050

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1050

cuacuucaac aaaaagugaa a 21

<210> 1051

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1051

aagagcaacu aacuaacuua a 21

<210> 1052

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1052

aaacaagaua auagcaucaa a 21

<210> 1053

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1053

gcauagucaa auaaaagaaa u 21

<210> 1054

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1054

auauaaacua caagucaaaa a 21

<210> 1055

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1055

gaacucaacu caaaacuuga a 21

<210> 1056

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1056

uacuucaaca aaaagugaaa u 21

<210> 1057

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1057

agagcaacua acuaacuuaa u 21

<210> 1058

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1058

gauaauagca ucaaagaccu u 21

<210> 1059

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1059

cauagucaaa uaaaagaaau a 21

<210> 1060

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1060

uauaaacuac aagucaaaaa u 21

<210> 1061

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1061

aacucaacuc aaaacuugaa a 21

<210> 1062

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1062

acuucaaca aaagugaaau a 21

<210> 1063

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1063

gagcaacuaa cuaacuuaau u 21

<210> 1064

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1064

aaccaacagc auagucaaau a 21

<210> 1065

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1065

agucaaauaa aagaaauaga a 21

<210> 1066

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1066

agucaaaaau gaagagguaa a 21

<210> 1067

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1067

cuugaaagcc uccuagaaga a 21

<210> 1068

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1068

cuucaacaaa aagugaaaua u 21

<210> 1069

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1069

caacuaacua acuuaauuca a 21

<210> 1070

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1070

accacagca uagucaaaua a 21

<210> 1071

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1071

gaacccacag aaauuucucu a 21

<210> 1072

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1072

gaauauguca cuugaacuca a 21

<210> 1073

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1073

ugaaagccuc cuagaagaaa a 21

<210> 1074

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1074

uucaacaaaa agugaaauau u 21

<210> 1075

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1075

aacuaacuaa cuuaauucaa a 21

<210> 1076

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1076

ccaacagcau agucaaauaa a 21

<210> 1077

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1077

aacccacaga aauuucucua u 21

<210> 1078

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1078

ugucacuuga acucaacuca a 21

<210> 1079

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1079

gaaagccucc uagaagaaaa a 21

<210> 1080

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1080

aauauuuaga agagcaacua a 21

<210> 1081

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1081

acuaacuaac uuaauucaaaa 21

<210> 1082

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1082

caacagcaua gucaaauaaa a 21

<210> 1083

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1083

ccacagaaau uucucuaucu u 21

<210> 1084

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1084

gucacuugaa cucaacucaa a 21

<210> 1085

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1085

cuccuagaag aaaaaauucu a 21

<210> 1086

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1086

auuuagaaga gcaacuaacu a 21

<210> 1087

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1087

cuaacuaacu uaauucaaaa u 21

<210> 1088

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1088

cagcauaguguc aaauaaaaga a 21

<210> 1089

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1089

gaaauaagaa auguaaaaca u 21

<210> 1090

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1090

ucacuugaac ucaacucaaa a 21

<210> 1091

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1091

ucuacuucaa caaaaaguga a 21

<210> 1092

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1092

uuuagaagag caacuaacua a 21

<210> 1093

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1093

aaaacaagau aauagcauca a 21

<210> 1094

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1094

agcauaguca aauaaaagaa a 21

<210> 1095

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1095

agacccagca acucucaagu u 21

<210> 1096

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1096

aguccaugga cauuaauuca a 21

<210> 1097

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1097

guggaucac aaaacuucaa u 21

<210> 1098

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1098

cuagagaaga uauacuccau a 21

<210> 1099

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1099

aaagacaaca aacauuauauau u 21

<210> 1100

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1100

cauuauauug aauauucuuu u 21

<210> 1101

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1101

gacccagcaa cucucaaguu u 21

<210> 1102

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1102

ggaucacaaa acuucaauga a 21

<210> 1103

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1103

gaagauauac uccauaguga a 21

<210> 1104

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1104

gacaacaaac auuauauuga a 21

<210> 1105

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1105

gggaaaucac gaaaccaacu a 21

<210> 1106

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1106

acccagcaac ucucaaguuu u 21

<210> 1107

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1107

ggacauuaau ucaacaucga a 21

<210> 1108

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1108

gaucacaaaa cuucaaugaa a 21

<210> 1109

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1109

acuccauagu gaagcaaucu a 21

<210> 1110

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1110

acaacaaaca uuauauugaa u 21

<210> 1111

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1111

ggaaaucacg aaaccaacua u 21

<210> 1112

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1112

cccagcaacu cucaaguuuu u 21

<210> 1113

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1113

gacauuaauu caacaucgaa u 21

<210> 1114

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1114

aacgugggag aacuacaaau a 21

<210> 1115

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1115

cuccaauagug aagcaaucua a 21

<210> 1116

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1116

caacaaacau uauauugaau a 21

<210> 1117

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1117

gaaaucacga aaccaacuau a 21

<210> 1118

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1118

cucucaaguu uuucaugucu a 21

<210> 1119

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1119

acauuaauuc aacaucgaau a 21

<210> 1120

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1120

gggagaacua caaauauuggu u 21

<210> 1121

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1121

uccauaguga agcaaucuaa u 21

<210> 1122

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1122

aacaaacauu auauugaaua u 21

<210> 1123

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1123

uggcaauguc cccaaugcaa u 21

<210> 1124

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1124

ucagguaguc cauggacauu a 21

<210> 1125

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1125

uuaauucaac aucgaauaga u 21

<210> 1126

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1126

ggagaacuac aaauaugguuu 21

<210> 1127

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1127

ccaaugugaa gcaaucuaau u 21

<210> 1128

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1128

acaaacauua uauugaauau u 21

<210> 1129

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1129

aaugcaaucc cggaaaacaa a 21

<210> 1130

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1130

cagguagucc auggacauua a 21

<210> 1131

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1131

uucaacaucg aauagaugga u 21

<210> 1132

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1132

guugggccua gagaagauau a 21

<210> 1133

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1133

cauagugaag caaucuaauu a 21

<210> 1134

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1134

aacauuauau ugaauauucu u 21

<210> 1135

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1135

gcaaucccgg aaaacaaaga u 21

<210> 1136

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1136

gguaguccau ggacauuaau u 21

<210> 1137

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1137

aucgaauaga uggaucacaa a 21

<210> 1138

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1138

ccuagagaag auauacucca u 21

<210> 1139

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1139

guuggaagac uggaaagaca a 21

<210> 1140

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1140

acauuauauu gaauauucuu u 21

<210> 1141

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1141

caauccggga aaacaaagau u 21

<210> 1142

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1142

cuacuuggga ucacaaagca a 21

<210> 1143

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1143

acaaccuaaa ugguaaauau a 21

<210> 1144

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1144

auccauccaa cagauucaga a 21

<210> 1145

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1145

aacugaggca aauuuaaaag a 21

<210> 1146

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1146

agaguaugug uaaaaaucug u 21

<210> 1147

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1147

aaucccggaa aacaaagauuu 21

<210> 1148

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1148

uacuugggau cacaaagcaa a 21

<210> 1149

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1149

caaccuaaau gguaaauaua a 21

<210> 1150

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1150

uugaaugaac ugaggcaaau u 21

<210> 1151

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1151

acugaggcaa auuuaaaagg a 21

<210> 1152

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1152

gaguaugugu aaaaaucugu a 21

<210> 1153

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1153

acuugggauc acaaagcaaa a 21

<210> 1154

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1154

augguaaaua uaacaaacca a 21

<210> 1155

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1155

ugaaugaacu gaggcaaauu u 21

<210> 1156

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1156

cugaggcaaa uuuaaaaggc a 21

<210> 1157

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1157

aguaugugua aaaaucugua a 21

<210> 1158

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1158

gaaaacaaag auuugguguuu 21

<210> 1159

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1159

aguguggaga aaacaaccua a 21

<210> 1160

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1160

gucucaaaau ggaagguuau a 21

<210> 1161

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1161

gaaugaacug aggcaaauuuu a 21

<210> 1162

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1162

ugaggcaaau uuaaaaggca a 21

<210> 1163

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1163

guauguguaa aaaucuguaa u 21

<210> 1164

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1164

aaaacaaaga uuugguguuuu 21

<210> 1165

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1165

guggagaa aacaaccuaa a 21

<210> 1166

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1166

auggaagguu auacucuaua a 21

<210> 1167

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1167

aaugaacuga ggcaaauuua a 21

<210> 1168

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1168

gaggcaaauu uaaaaggcaa u 21

<210> 1169

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1169

uauguguaaa aaucuguaau a 21

<210> 1170

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1170

acaaagauuu gguguuuucu a 21

<210> 1171

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1171

ugggagaaa acaaccuaaa u 21

<210> 1172

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1172

uggaagguua uacucuauaa a 21

<210> 1173

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1173

augaacugag gcaaauuuaa a 21

<210> 1174

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1174

aggcaaauuu aaaaggcaau a 21

<210> 1175

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1175

aagauuuggu guuuucuacu u 21

<210> 1176

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1176

aaacaaccua aaugguaaau a 21

<210> 1177

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1177

auacucuaua aaaucaacca a 21

<210> 1178

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1178

ugaacugagg caaauuuaaaa 21

<210> 1179

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1179

ggcaaauuua aaaggcaaua a 21

<210> 1180

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1180

uuuucuacuu gggaucacaa a 21

<210> 1181

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1181

aacaaccuaa augguaaaua u 21

<210> 1182

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1182

uacucuauaa aaucaaccaa a 21

<210> 1183

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1183

gaacugaggc aaauuuaaaaa 21

<210> 1184

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1184

cagaguaugu guaaaaaucu u 21

<210> 1185

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1185

aaagaaggag cuuaauugug aac 23

<210> 1186

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1186

aaauaacuag aggaacaaua aaa 23

<210> 1187

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1187

uuuuacaucg ucuaacauag caa 23

<210> 1188

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1188

aaagucuuua agaccauguc cca 23

<210> 1189

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1189

aucaaauuug uugaguuuuu gaa 23

<210> 1190

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1190

uuuuuuug auuucacugg uuu 23

<210> 1191

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1191

aaaagaagga gcuuaauugu gaa 23

<210> 1192

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1192

uuuuuacauc gucuaacaua gca 23

<210> 1193

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1193

aagacugauc aaauauguug agu 23

<210> 1194

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1194

uauauguagu ucuucucagu ucc 23

<210> 1195

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1195

aaaaagaagg agcuuaauug uga 23

<210> 1196

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1196

aucuugauuu uggcugga gau 23

<210> 1197

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1197

uuggcuaaaa uuuuuacauc guc 23

<210> 1198

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1198

uauggaaaa gucuuuaaga cca 23

<210> 1199

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1199

aaagacugau caaauauguu gag 23

<210> 1200

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1200

uuauauguag uucuucucag uuc 23

<210> 1201

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1201

aaaucuugau uuuggcucug gag 23

<210> 1202

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1202

auuggcuaaa auuuuuacau cgu 23

<210> 1203

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1203

uuauggacaa agucuuuaag acc 23

<210> 1204

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1204

aaaagacuga ucaaauaugu uga 23

<210> 1205

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1205

uuuauaugua guucuucuca guu 23

<210> 1206

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1206

auaaaaagaa ggagcuuaau ugu 23

<210> 1207

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1207

uaacauagca aaucuugauu uug 23

<210> 1208

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1208

uaagaccaug ucccaacuga agg 23

<210> 1209

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1209

auauugucau uaauuuggcc cuu 23

<210> 1210

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1210

aaaaagacug aucaaauauug uug 23

<210> 1211

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1211

uuguaguuua uauguaguuc uuc 23

<210> 1212

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1212

aauaaaaaga aggagcuuaa uug 23

<210> 1213

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1213

aucgucuaac auagcaaauc uug 23

<210> 1214

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1214

uuaagaccau gucccaacug aag 23

<210> 1215

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1215

aaauauguca uuaauuuggc ccu 23

<210> 1216

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1216

uaaaaagacu gaucaaauau guu 23

<210> 1217

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1217

uugacuugua guuuauaugu agu 23

<210> 1218

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1218

auaacuagag gaacaauaaa aag 23

<210> 1219

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1219

uuacaucguc uaacauagca aau 23

<210> 1220

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1220

uuuaagacca ugucccaacu gaa 23

<210> 1221

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1221

uuugaaauau gucauuaauu ugg 23

<210> 1222

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1222

uagaucauaa aaagacugau caa 23

<210> 1223

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1223

uuugacuugu aguuuauaug uag 23

<210> 1224

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1224

aauaacuaga ggaacaauaa aaa 23

<210> 1225

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1225

uuuacaucgu cuaacauagc aaa 23

<210> 1226

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1226

aagucuuuaa gaccaugucc caa 23

<210> 1227

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1227

uugaguuuuu gaaauauuguc auu 23

<210> 1228

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1228

auagaucaua aaaagacuga uca 23

<210> 1229

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1229

uuuugacuug uaguuuauau gua 23

<210> 1230

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1230

aaguuuugag uugaguucaa gug 23

<210> 1231

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1231

uuucacuuuu uguugaagua gaa 23

<210> 1232

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1232

uuaaguuagu uaguugcucu ucu 23

<210> 1233

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1233

uuugaugcua uuaucuuguu uuu 23

<210> 1234

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1234

auuucuuuua uuugacuaug cug 23

<210> 1235

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1235

uuuuugacuu guaguuuaua ugu 23

<210> 1236

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1236

uucaaguuuu gaguugaguu caa 23

<210> 1237

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1237

auuucacuuu uuguugaagu aga 23

<210> 1238

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1238

auuaaguuag uuaguugcuc uuc 23

<210> 1239

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1239

aaggucuuug augcuauuau cuu 23

<210> 1240

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1240

uauuucuuuu auuugacuau gcu 23

<210> 1241

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1241

aug 23

<210> 1242

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1242

uuucaaguuu ugaguugagu uca 23

<210> 1243

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1243

uuuuucacuu uuuguugaag uag 23

<210> 1244

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1244

aauuaaguua guuaguugcu cuu 23

<210> 1245

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1245

uauuugacua ugcuguuggu uua 23

<210> 1246

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1246

uuuuuuucu uuuauuugac uau 23

<210> 1247

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1247

uuuaccucuu cauuuuugac uug 23

<210> 1248

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1248

uucuucuagg aggcuuucaa guu 23

<210> 1249

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1249

auauuucacu uuuuguugaa gua 23

<210> 1250

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1250

uugaauuaag uuaguuaguu gcu 23

<210> 1251

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1251

uuuuugacu augcuguugg uuu 23

<210> 1252

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1252

uagagaaauu ucuguggguu cuu 23

<210> 1253

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1253

uugaguucaa gugacauauu cuu 23

<210> 1254

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1254

uuuucuucua ggaggcuuuc aag 23

<210> 1255

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1255

aauauuucac uuuuuguuga agu 23

<210> 1256

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1256

uuugaauuaa guuaguuagu ugc 23

<210> 1257

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1257

uuuuuugac uaugcuguug guu 23

<210> 1258

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1258

auagagaaau uucugugggu ucu 23

<210> 1259

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1259

uugaguugag uucaagugac aua 23

<210> 1260

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1260

uuuuucuucu aggaggcuuu caa 23

<210> 1261

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1261

uuaguugcuc uucuaaauau uuc 23

<210> 1262

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1262

uuuugaauua aguuaguuag uug 23

<210> 1263

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1263

uuuuauuuga cuaugcuguu ggu 23

<210> 1264

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1264

aagauagaga aauuucugug ggu 23

<210> 1265

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1265

uuugaguuga guucaaguga cau 23

<210> 1266

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1266

uagaauuuuu ucuucuagga ggc 23

<210> 1267

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1267

uaguuaguug cucuucuaaa uau 23

<210> 1268

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1268

auuuugaauu aaguuaguua guu 23

<210> 1269

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1269

uucuuuuauu ugacuaugcu guu 23

<210> 1270

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1270

auguuuuaca uuucuuauuu cau 23

<210> 1271

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1271

uuuugaguug aguucaagug aca 23

<210> 1272

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1272

uucacuuuuu guugaaguag aau 23

<210> 1273

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1273

uuaguuaguu gcucuucuaa aua 23

<210> 1274

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1274

uugaugcuau uaucuuguuu uuc 23

<210> 1275

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1275

uuucuuuuau uugacuaugc ugu 23

<210> 1276

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1276

aacuugag uugcuggguc uga 23

<210> 1277

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1277

uugaauuaau guccauggac uac 23

<210> 1278

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1278

auugaaguuu ugugauccau cua 23

<210> 1279

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1279

uuggaguau aucuucucua ggc 23

<210> 1280

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1280

aauauaaugu uuguugucuu ucc 23

<210> 1281

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1281

aaaagaauau ucaauauaau guu 23

<210> 1282

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1282

aaacuugaga guugcugggu cug 23

<210> 1283

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1283

uucauugaag uuuugugauc cau 23

<210> 1284

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1284

uucacuaugg aguauaucuu cuc 23

<210> 1285

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1285

uucaauauaa uguuuguugu cuu 23

<210> 1286

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1286

uaguugguuu cgugauuucc caa 23

<210> 1287

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1287

aaaacuugag aguugcuggg ucu 23

<210> 1288

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1288

uucgauguug aauuauguc cau 23

<210> 1289

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1289

uuucauugaa guuuugugau cca 23

<210> 1290

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1290

uugauugcuu cacuauggag uau 23

<210> 1291

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1291

auucaauaua auguuuguug ucu 23

<210> 1292

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1292

auaguugguu ucgugauuuc cca 23

<210> 1293

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1293

aaaaacuuga gaguugcugg guc 23

<210> 1294

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1294

auucgauguu gaauuaaugu cca 23

<210> 1295

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1295

uauuuguagu ucucccgu uuc 23

<210> 1296

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1296

uuagauugcu ucacuugga gua 23

<210> 1297

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1297

uauucaauau aauguuuguu guc 23

<210> 1298

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1298

uauaguuggu uucgugauuu ccc 23

<210> 1299

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1299

uagacaugaa aaacuugaga guu 23

<210> 1300

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1300

uauucgaugu ugaauuaug ucc 23

<210> 1301

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1301

aaccauauuu guaguucucc cac 23

<210> 1302

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1302

auuagauugc uucacuaugg agu 23

<210> 1303

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1303

auauucaaua uaauguuugu ugu 23

<210> 1304

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1304

auugcauugg ggacauugcc agu 23

<210> 1305

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1305

uaauguccau ggacuaccug aua 23

<210> 1306

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1306

aug 23

<210> 1307

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1307

aaaccauauu uguaguucuc cca 23

<210> 1308

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1308

aauuagauug cuucacuaug gag 23

<210> 1309

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1309

aauauucaau auaauguuug uug 23

<210> 1310

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1310

uuuguuuucc gggauugcau ugg 23

<210> 1311

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1311

uuaaugucca uggacuaccu gau 23

<210> 1312

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1312

auccaucauau ucgauguuga auu 23

<210> 1313

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1313

uauaucuucu cuaggcccaa cca 23

<210> 1314

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1314

uaauuagauu gcuucacuau gga 23

<210> 1315

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1315

aagaauauuc aauauaaugu uug 23

<210> 1316

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1316

aucuuuguuu uccgggauug cau 23

<210> 1317

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1317

aauuaauguc cauggacuac cug 23

<210> 1318

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1318

uuugugaucc aucuauucga ugu 23

<210> 1319

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1319

auggaguaua ucuucucuag gcc 23

<210> 1320

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1320

uugucuuucc agucuuccaa cuc 23

<210> 1321

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1321

aaagaauauu caauauaaug uuu 23

<210> 1322

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1322

aaucuuuguu uuccgggauu gca 23

<210> 1323

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1323

uugcuuugug aucccaagua gaa 23

<210> 1324

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1324

uauauuuacc auuuagguug uuu 23

<210> 1325

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1325

uucugaaucu guuggaugga uca 23

<210> 1326

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1326

ucuuuuaaau uugccucagu uca 23

<210> 1327

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1327

acagauuuuu acacauacuc ugu 23

<210> 1328

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1328

aaaucuuugu uuuccgggau ugc 23

<210> 1329

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1329

uuugcuuugu gaucccaagu aga 23

<210> 1330

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1330

uuauauuuac cauuuagguu guu 23

<210> 1331

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1331

aauuugccuc aguucauuca aag 23

<210> 1332

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1332

uccuuuuaaa uuugccucag uuc 23

<210> 1333

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1333

uacagauuuu uacacauacu cug 23

<210> 1334

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1334

uuuugcuuug ugaucccaag uag 23

<210> 1335

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1335

uugguuuguu auauuuacca uuu 23

<210> 1336

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1336

aaauuugccu caguucauuc aaa 23

<210> 1337

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1337

ugccuuuuaa auuugccuca guu 23

<210> 1338

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1338

uuacagauuuuuuacacauac ucu 23

<210> 1339

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1339

aaacaccaaa ucuuuguuuu ccg 23

<210> 1340

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1340

uuagguuguu uucuccacac uca 23

<210> 1341

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1341

uauaaccuuc cauuuugaga cuu 23

<210> 1342

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1342

uaaauuugcc ucaguucauu caa 23

<210> 1343

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1343

uugccuuuua aauuugccuc agu 23

<210> 1344

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1344

auuacagauu uuuacacaua cuc 23

<210> 1345

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1345

aaaacaccaa aucuuuguuu ucc 23

<210> 1346

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1346

uuuagguugu uuucuccaca cuc 23

<210> 1347

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1347

uuuagagua uaaccuucca uuu 23

<210> 1348

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1348

uuaaauuugc cucaguucau uca 23

<210> 1349

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1349

auugccuuuu aaauuugccu cag 23

<210> 1350

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1350

uauuuacagau uuuuuacacau acu 23

<210> 1351

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1351

uagaaaacac caaaucuuug uuu 23

<210> 1352

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1352

auuuagguug uuuucuccac acu 23

<210> 1353

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1353

uuuuagagu auaaccuucc auu 23

<210> 1354

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1354

uuuaaauuug ccucaguuca uuc 23

<210> 1355

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1355

uauugccuuu uaaauuugcc uca 23

<210> 1356

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1356

aaguagaaaa caccaaaucu uug 23

<210> 1357

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1357

uauuuuaccau uuagguuguu uuc 23

<210> 1358

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1358

uugguugauu uuauagagua uaa 23

<210> 1359

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1359

uuuuaaauuu gccucaguuc auu 23

<210> 1360

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1360

cuc 23

<210> 1361

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1361

uuugugaucc caaguagaaa aca 23

<210> 1362

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1362

auauuuacca uuuagguugu uuu 23

<210> 1363

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1363

uuugguugau uuuauagagu aua 23

<210> 1364

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1364

uuuuuaaauu ugccucaguu cau 23

<210> 1365

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1365

aagauuuuua cacauacucu gug 23

<210> 1366

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1366

ucacaauuaa gcuccuucuu u 21

<210> 1367

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1367

uuauuguucc ucuaguuauu u 21

<210> 1368

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1368

gcuauguuag acgauguaaa a 21

<210> 1369

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1369

ggacaugguc uuaaagacuu u 21

<210> 1370

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1370

caaaaacuca acauauuuga u 21

<210> 1371

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1371

accagugaaa ucaaagaaga a 21

<210> 1372

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1372

cacaauuaag cuccuucuuu u 21

<210> 1373

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1373

cuauguuaga cgauguaaaa a 21

<210> 1374

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1374

ucaacauauuu ugaucagucu u 21

<210> 1375

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1375

aacugagaag aacuacauau a 21

<210> 1376

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1376

acaauuaagc uccuucuuuu u 21

<210> 1377

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1377

cucgagcc aaaaucaaga u 21

<210> 1378

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1378

cgauguaaaa auuuuagcca a 21

<210> 1379

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1379

gucuuaaaga cuuuguccau a 21

<210> 1380

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1380

caacauauuu gaucagucuu u 21

<210> 1381

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1381

acugagaaga acuacauaua a 21

<210> 1382

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1382

ccagagccaa aaucaagauu u 21

<210> 1383

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1383

gauguaaaaa uuuuagccaa u 21

<210> 1384

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1384

ucuuaaagac uuuguccaua a 21

<210> 1385

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1385

aacauauuug aucagucuuu u 21

<210> 1386

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1386

cugagaagaa cuacauauaa a 21

<210> 1387

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1387

aauuaagcuc cuucuuuuua u 21

<210> 1388

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1388

aaaucaagau uugcuauguu a 21

<210> 1389

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1389

uucaguuggg acauggucuu a 21

<210> 1390

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1390

gggccaaauu augacauau u 21

<210> 1391

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1391

acauauuuga ucagucuuuu u 21

<210> 1392

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1392

agaacuacau auaaacuaca a 21

<210> 1393

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1393

auuaagcucc uucuuuuuau u 21

<210> 1394

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1394

agauuugcua uguuagacga u 21

<210> 1395

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1395

ucaguuggga cauggucuua a 21

<210> 1396

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1396

ggccaaauua augacauauu u 21

<210> 1397

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1397

cauauuugau cagucuuuuu a 21

<210> 1398

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1398

uacauauaaa cuacaaguca a 21

<210> 1399

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1399

uuuuauuguu ccucuaguua u 21

<210> 1400

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1400

uugcuauguu agacgaugua a 21

<210> 1401

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1401

caguugggac aggucuuaa a 21

<210> 1402

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1402

aaauuaauga cauauuucaa a 21

<210> 1403

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1403

gaucagucuu uuuaugaucu a 21

<210> 1404

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1404

acauauaaac uacaagucaa a 21

<210> 1405

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1405

uuuuuguuc cucuaguuau u 21

<210> 1406

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1406

ugcuauguua gacgauguaa a 21

<210> 1407

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1407

gggacauggu cuuaaagacu u 21

<210> 1408

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1408

ugacauauuu caaaaacuca a 21

<210> 1409

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1409

aucagucuuu uuaugaucua u 21

<210> 1410

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1410

cauauaaacu acaagucaaaa 21

<210> 1411

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1411

cuugaacuca acucaaaacu u 21

<210> 1412

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1412

cuacuucaac aaaaagugaa a 21

<210> 1413

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1413

aagagcaacu aacuaacuua a 21

<210> 1414

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1414

aaacaagaua auagcaucaa a 21

<210> 1415

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1415

gcauagucaa auaaaagaaa u 21

<210> 1416

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1416

auauaaacua caagucaaaa a 21

<210> 1417

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1417

gaacucaacu caaaacuuga a 21

<210> 1418

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1418

uacuucaaca aaaagugaaa u 21

<210> 1419

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1419

agagcaacua acuaacuuaa u 21

<210> 1420

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1420

gauaauagca ucaaagaccu u 21

<210> 1421

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1421

cauagucaaa uaaaagaaau a 21

<210> 1422

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1422

uauaaacuac aagucaaaaa u 21

<210> 1423

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1423

aacucaacuc aaaacuugaa a 21

<210> 1424

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1424

acuucaaca aaagugaaau a 21

<210> 1425

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1425

gagcaacuaa cuaacuuaau u 21

<210> 1426

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1426

aaccaacagc auagucaaau a 21

<210> 1427

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1427

agucaaauaa aagaaauaga a 21

<210> 1428

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1428

agucaaaaau gaagagguaa a 21

<210> 1429

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1429

cuugaaagcc uccuagaaga a 21

<210> 1430

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1430

cuucaacaaa aagugaaaua u 21

<210> 1431

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1431

caacuaacua acuuaauuca a 21

<210> 1432

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1432

accacagca uagucaaaua a 21

<210> 1433

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1433

gaacccacag aaauuucucu a 21

<210> 1434

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1434

gaauauguca cuugaacuca a 21

<210> 1435

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1435

ugaaagccuc cuagaagaaa a 21

<210> 1436

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1436

uucaacaaaa agugaaauau u 21

<210> 1437

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1437

aacuaacuaa cuuaauucaa a 21

<210> 1438

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1438

ccaacagcau agucaaauaa a 21

<210> 1439

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1439

aacccacaga aauuucucua u 21

<210> 1440

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1440

ugucacuuga acucaacuca a 21

<210> 1441

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1441

gaaagccucc uagaagaaaa a 21

<210> 1442

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1442

aauauuuaga agagcaacua a 21

<210> 1443

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1443

acuaacuaac uuaauucaaaa 21

<210> 1444

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1444

caacagcaua gucaaauaaa a 21

<210> 1445

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1445

ccacagaaau uucucuaucu u 21

<210> 1446

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1446

gucacuugaa cucaacucaa a 21

<210> 1447

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1447

cuccuagaag aaaaaauucu a 21

<210> 1448

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1448

auuuagaaga gcaacuaacu a 21

<210> 1449

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1449

cuaacuaacu uaauucaaaa u 21

<210> 1450

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1450

cagcauaguguc aaauaaaaga a 21

<210> 1451

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1451

gaaauaagaa auguaaaaca u 21

<210> 1452

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1452

ucacuugaac ucaacucaaa a 21

<210> 1453

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1453

ucuacuucaa caaaaaguga a 21

<210> 1454

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1454

uuuagaagag caacuaacua a 21

<210> 1455

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1455

aaaacaagau aauagcauca a 21

<210> 1456

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1456

agcauaguca aauaaaagaa a 21

<210> 1457

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1457

agacccagca acucucaagu u 21

<210> 1458

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1458

aguccaugga cauuaauuca a 21

<210> 1459

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1459

guggaucac aaaacuucaa u 21

<210> 1460

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1460

cuagagaaga uauacuccau a 21

<210> 1461

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1461

aaagacaaca aacauuauauau u 21

<210> 1462

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1462

cauuauauug aauauucuuu u 21

<210> 1463

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1463

gacccagcaa cucucaaguu u 21

<210> 1464

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1464

ggaucacaaa acuucaauga a 21

<210> 1465

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1465

gaagauauac uccauaguga a 21

<210> 1466

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1466

gacaacaaac auuauauuga a 21

<210> 1467

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1467

gggaaaucac gaaaccaacu a 21

<210> 1468

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1468

acccagcaac ucucaaguuu u 21

<210> 1469

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1469

ggacauuaau ucaacaucga a 21

<210> 1470

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1470

gaucacaaaa cuucaaugaa a 21

<210> 1471

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1471

acuccauagu gaagcaaucu a 21

<210> 1472

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1472

acaacaaaca uuauauugaa u 21

<210> 1473

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1473

ggaaaucacg aaaccaacua u 21

<210> 1474

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1474

cccagcaacu cucaaguuuu u 21

<210> 1475

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1475

gacauuaauu caacaucgaa u 21

<210> 1476

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1476

aacgugggag aacuacaaau a 21

<210> 1477

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1477

cuccaauagug aagcaaucua a 21

<210> 1478

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1478

caacaaacau uauauugaau a 21

<210> 1479

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1479

gaaaucacga aaccaacuau a 21

<210> 1480

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1480

cucucaaguu uuucaugucu a 21

<210> 1481

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1481

acauuaauuc aacaucgaau a 21

<210> 1482

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1482

gggagaacua caaauauuggu u 21

<210> 1483

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1483

uccauaguga agcaaucuaa u 21

<210> 1484

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1484

aacaaacauu auauugaaua u 21

<210> 1485

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1485

uggcaauguc cccaaugcaa u 21

<210> 1486

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1486

ucagguaguc cauggacauu a 21

<210> 1487

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1487

uuaauucaac aucgaauaga u 21

<210> 1488

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1488

ggagaacuac aaauaugguuu 21

<210> 1489

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1489

ccaaugugaa gcaaucuaau u 21

<210> 1490

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1490

acaaacauua uauugaauau u 21

<210> 1491

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1491

aaugcaaucc cggaaaacaa a 21

<210> 1492

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1492

cagguagucc auggacauua a 21

<210> 1493

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1493

uucaacaucg aauagaugga u 21

<210> 1494

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1494

guugggccua gagaagauau a 21

<210> 1495

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1495

cauagugaag caaucuaauu a 21

<210> 1496

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1496

aacauuauau ugaauauucu u 21

<210> 1497

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1497

gcaaucccgg aaaacaaaga u 21

<210> 1498

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1498

gguaguccau ggacauuaau u 21

<210> 1499

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1499

aucgaauaga uggaucacaa a 21

<210> 1500

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1500

ccuagagaag auauacucca u 21

<210> 1501

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1501

guuggaagac uggaaagaca a 21

<210> 1502

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1502

acauuauauu gaauauucuu u 21

<210> 1503

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1503

caauccggga aaacaaagau u 21

<210> 1504

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1504

cuacuuggga ucacaaagca a 21

<210> 1505

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1505

acaaccuaaa ugguaaauau a 21

<210> 1506

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1506

auccauccaa cagauucaga a 21

<210> 1507

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1507

aacugaggca aauuuaaaag a 21

<210> 1508

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1508

agaguaugug uaaaaaucug u 21

<210> 1509

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1509

aaucccggaa aacaaagauuu 21

<210> 1510

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1510

uacuugggau cacaaagcaa a 21

<210> 1511

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1511

caaccuaaau gguaaauaua a 21

<210> 1512

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1512

uugaaugaac ugaggcaaau u 21

<210> 1513

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1513

acugaggcaa auuuaaaagg a 21

<210> 1514

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1514

gaguaugugu aaaaaucugu a 21

<210> 1515

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1515

acuugggauc acaaagcaaa a 21

<210> 1516

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1516

augguaaaua uaacaaacca a 21

<210> 1517

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1517

ugaaugaacu gaggcaaauu u 21

<210> 1518

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1518

cugaggcaaa uuuaaaaggc a 21

<210> 1519

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1519

aguaugugua aaaaucugua a 21

<210> 1520

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1520

gaaaacaaag auuugguguuu 21

<210> 1521

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1521

aguguggaga aaacaaccua a 21

<210> 1522

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1522

gucucaaaau ggaagguuau a 21

<210> 1523

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1523

gaaugaacug aggcaaauuuu a 21

<210> 1524

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1524

ugaggcaaau uuaaaaggca a 21

<210> 1525

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1525

guauguguaa aaaucuguaa u 21

<210> 1526

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1526

aaaacaaaga uuugguguuu u 21

<210> 1527

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1527

guggagaa aacaaccuaa a 21

<210> 1528

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1528

auggaagguu auacucuaua a 21

<210> 1529

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1529

aaugaacuga ggcaaauuua a 21

<210> 1530

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1530

gaggcaaauu uaaaaggcaa u 21

<210> 1531

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1531

uauguguaaa aaucuguaau a 21

<210> 1532

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1532

acaaagauuu gguguuuucu a 21

<210> 1533

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1533

ugggagaaa acaaccuaaa u 21

<210> 1534

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1534

uggaagguua uacucuauaa a 21

<210> 1535

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1535

augaacugag gcaaauuuaa a 21

<210> 1536

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1536

aggcaaauuu aaaaggcaau a 21

<210> 1537

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1537

aagauuuggu guuuucuacu u 21

<210> 1538

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1538

aaacaaccua aaugguaaau a 21

<210> 1539

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1539

auacucuaua aaaucaacca a 21

<210> 1540

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1540

ugaacugagg caaauuuaaaa 21

<210> 1541

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1541

ggcaaauuua aaaggcaaua a 21

<210> 1542

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1542

uuuucuacuu gggaucacaa a 21

<210> 1543

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1543

aacaaccuaa augguaaaua u 21

<210> 1544

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1544

uacucuauaa aaucaaccaa a 21

<210> 1545

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1545

gaacugaggc aaauuuaaaaa 21

<210> 1546

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1546

cagaguaugu guaaaaaucu u 21

<210> 1547

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1547

aaagaaggag cuuaauugug aac 23

<210> 1548

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1548

aaauaacuag aggaacaaua aaa 23

<210> 1549

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1549

uuuuacaucg ucuaacauag caa 23

<210> 1550

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1550

aaagucuuua agaccauguc cca 23

<210> 1551

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1551

aucaaauug uugaguuuuu gaa 23

<210> 1552

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1552

uuuuuuug auuucacugg uuu 23

<210> 1553

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1553

aaaagaagga gcuuaauugu gaa 23

<210> 1554

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1554

uuuuuacauc gucuaacaua gca 23

<210> 1555

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1555

aagacugauc aaauauguug agu 23

<210> 1556

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1556

uauauguagu ucuucucagu ucc 23

<210> 1557

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1557

aaaaagaagg agcuuaauug uga 23

<210> 1558

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1558

aucuugauuu uggcugga gau 23

<210> 1559

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1559

uuggcuaaaa uuuuuacauc guc 23

<210> 1560

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1560

uauggaaaa gucuuuaaga cca 23

<210> 1561

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1561

aaagacugau caaauauguu gag 23

<210> 1562

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1562

uuauauguag uucuucucag uuc 23

<210> 1563

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1563

aaaucuugau uuuggcucug gag 23

<210> 1564

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1564

auuggcuaaa auuuuuacau cgu 23

<210> 1565

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1565

uuauggaca agucuuuaag acc 23

<210> 1566

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1566

aaaagacuga ucaaauaugu uga 23

<210> 1567

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1567

uuuauaugua guucuucuca guu 23

<210> 1568

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1568

auaaaaagaa ggagcuuaau ugu 23

<210> 1569

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1569

uaacauagca aaucuugauu uug 23

<210> 1570

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1570

uaagaccaug ucccaacuga agg 23

<210> 1571

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1571

auauugucau uaauuuggcc cuu 23

<210> 1572

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1572

aaaaagacug aucaaauauug uug 23

<210> 1573

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1573

uuguaguuua uauguaguuc uuc 23

<210> 1574

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1574

aauaaaaaga aggagcuuaa uug 23

<210> 1575

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1575

aucgucuaac auagcaaauc uug 23

<210> 1576

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1576

uuaagaccau gucccaacug aag 23

<210> 1577

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1577

aaauauguca uuaauuuggc ccu 23

<210> 1578

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1578

uaaaaagacu gaucaaauau guu 23

<210> 1579

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1579

uugacuugua guuuauaugu agu 23

<210> 1580

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1580

auaacuagag gaacaauaaa aag 23

<210> 1581

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1581

uuacaucguc uaacauagca aau 23

<210> 1582

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1582

uuuaagacca ugucccaacu gaa 23

<210> 1583

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1583

uuugaaauau gucauuaauu ugg 23

<210> 1584

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1584

uagaucauaa aaagacugau caa 23

<210> 1585

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1585

uuugacuugu aguuuauaug uag 23

<210> 1586

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1586

aauaacuaga ggaacaauaa aaa 23

<210> 1587

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1587

uuuacaucgu cuaacauagc aaa 23

<210> 1588

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1588

aagucuuuaa gaccaugucc caa 23

<210> 1589

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1589

uugaguuuuu gaaauauuguc auu 23

<210> 1590

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1590

auagaucaua aaaagacuga uca 23

<210> 1591

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1591

uuuugacuug uaguuuauau gua 23

<210> 1592

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1592

aaguuuugag uugaguucaa gug 23

<210> 1593

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1593

uuucacuuuu uguugaagua gaa 23

<210> 1594

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1594

uuaaguuagu uaguugcucu ucu 23

<210> 1595

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1595

uuugaugcua uuaucuuguu uuu 23

<210> 1596

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1596

auuucuuuua uuugacuaug cug 23

<210> 1597

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1597

uuuuugacuu guaguuuaua ugu 23

<210> 1598

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1598

uucaaguuuu gaguugaguu caa 23

<210> 1599

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1599

auuucacuuu uuguugaagu aga 23

<210> 1600

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1600

auuaaguuag uuaguugcuc uuc 23

<210> 1601

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1601

aaggucuuug augcuauuau cuu 23

<210> 1602

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1602

uauuucuuuu auuugacuau gcu 23

<210> 1603

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1603

aug 23

<210> 1604

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1604

uuucaaguuu ugaguugagu uca 23

<210> 1605

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1605

uuuuucacuu uuuguugaag uag 23

<210> 1606

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1606

aauuaaguua guuaguugcu cuu 23

<210> 1607

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1607

uauuugacua ugcuguuggu uua 23

<210> 1608

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1608

uuuuuuucu uuuauuugac uau 23

<210> 1609

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1609

uuuaccucuu cauuuuugac uug 23

<210> 1610

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1610

uucuucuagg aggcuuucaa guu 23

<210> 1611

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1611

auauuucacu uuuuguugaa gua 23

<210> 1612

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1612

uugaauuaag uuaguuaguu gcu 23

<210> 1613

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1613

uuuuugacu augcuguugg uuu 23

<210> 1614

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1614

uagagaaauu ucuguggguu cuu 23

<210> 1615

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1615

uugaguucaa gugacauauu cuu 23

<210> 1616

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1616

uuuucuucua ggaggcuuuc aag 23

<210> 1617

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1617

aauauuucac uuuuuguuga agu 23

<210> 1618

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1618

uuugaauuaa guuaguuagu ugc 23

<210> 1619

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1619

uuuuuugac uaugcuguug guu 23

<210> 1620

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1620

auagagaaau uucugugggu ucu 23

<210> 1621

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1621

uugaguugag uucaagugac aua 23

<210> 1622

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1622

uuuuucuucu aggaggcuuu caa 23

<210> 1623

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1623

uuaguugcuc uucuaaauau uuc 23

<210> 1624

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1624

uuuugaauua aguuaguuag uug 23

<210> 1625

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1625

uuuuauuuga cuaugcuguu ggu 23

<210> 1626

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1626

aagauagaga aauuucugug ggu 23

<210> 1627

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1627

uuugaguuga guucaaguga cau 23

<210> 1628

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1628

uagaauuuuu ucuucuagga ggc 23

<210> 1629

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1629

uaguuaguug cucuucuaaa uau 23

<210> 1630

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1630

auuuugaauu aaguuaguua guu 23

<210> 1631

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1631

uucuuuuauu ugacuaugcu guu 23

<210> 1632

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1632

auguuuuaca uuucuuauuu cau 23

<210> 1633

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1633

uuuugaguug aguucaagug aca 23

<210> 1634

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1634

uucacuuuuu guugaaguag aau 23

<210> 1635

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1635

uuaguuaguu gcucuucuaa aua 23

<210> 1636

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1636

uugaugcuau uaucuuguuu uuc 23

<210> 1637

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1637

uuucuuuuau uugacuaugc ugu 23

<210> 1638

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1638

aacuugag uugcuggguc uga 23

<210> 1639

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1639

uugaauuaau guccauggac uac 23

<210> 1640

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1640

auugaaguuu ugugauccau cua 23

<210> 1641

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1641

uuggaguau aucuucucua ggc 23

<210> 1642

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1642

aauauaaugu uuguugucuu ucc 23

<210> 1643

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1643

aaaagaauau ucaauauaau guu 23

<210> 1644

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1644

aaacuugaga guugcugggu cug 23

<210> 1645

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1645

uucauugaag uuuugugauc cau 23

<210> 1646

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1646

uucacuaugg aguauaucuu cuc 23

<210> 1647

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1647

uucaauauaa uguuuguugu cuu 23

<210> 1648

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1648

uaguugguuu cgugauuucc caa 23

<210> 1649

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1649

aaaacuugag aguugcuggg ucu 23

<210> 1650

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1650

uucgauguug aauuauguc cau 23

<210> 1651

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1651

uuucauugaa guuuugugau cca 23

<210> 1652

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1652

uugauugcuu cacuauggag uau 23

<210> 1653

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1653

auucaauaua auguuuguug ucu 23

<210> 1654

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1654

auaguugguu ucgugauuuc cca 23

<210> 1655

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1655

aaaaacuuga gaguugcugg guc 23

<210> 1656

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1656

auucgauguu gaauuaaugu cca 23

<210> 1657

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1657

uauuuguagu ucucccgu uuc 23

<210> 1658

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1658

uuagauugcu ucacuugga gua 23

<210> 1659

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1659

uauucaauau aauguuuguu guc 23

<210> 1660

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1660

uauaguuggu uucgugauuu ccc 23

<210> 1661

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1661

uagacaugaa aaacuugaga guu 23

<210> 1662

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1662

uauucgaugu ugaauuaug ucc 23

<210> 1663

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1663

aaccauauuu guaguucucc cac 23

<210> 1664

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1664

auuagauugc uucacuaugg agu 23

<210> 1665

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1665

auauucaaua uaauguuugu ugu 23

<210> 1666

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1666

auugcauugg ggacauugcc agu 23

<210> 1667

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1667

uaauguccau ggacuaccug aua 23

<210> 1668

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1668

aug 23

<210> 1669

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1669

aaaccauauu uguaguucuc cca 23

<210> 1670

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1670

aauuagauug cuucacuaug gag 23

<210> 1671

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1671

aauauucaau auaauguuug uug 23

<210> 1672

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1672

uuuguuuucc gggauugcau ugg 23

<210> 1673

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1673

uuaaugucca uggacuaccu gau 23

<210> 1674

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1674

auccaucauau ucgauguuga auu 23

<210> 1675

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1675

uauaucuucu cuaggcccaa cca 23

<210> 1676

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1676

uaauuagauu gcuucacuau gga 23

<210> 1677

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1677

aagaauauuc aauauaaugu uug 23

<210> 1678

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1678

aucuuuguuu uccgggauug cau 23

<210> 1679

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1679

aauuaauguc cauggacuac cug 23

<210> 1680

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1680

uuugugaucc aucuauucga ugu 23

<210> 1681

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1681

auggaguaua ucuucucuag gcc 23

<210> 1682

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1682

uugucuuucc agucuuccaa cuc 23

<210> 1683

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1683

aaagaauauu caauauaaug uuu 23

<210> 1684

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1684

aaucuuuguu uuccgggauu gca 23

<210> 1685

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1685

uugcuuugug aucccaagua gaa 23

<210> 1686

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1686

uauauuuacc auuuagguug uuu 23

<210> 1687

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1687

uucugaaucu guuggaugga uca 23

<210> 1688

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1688

ucuuuuaaau uugccucagu uca 23

<210> 1689

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1689

acagauuuuu acacauacuc ugu 23

<210> 1690

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1690

aaaucuuugu uuuccgggau ugc 23

<210> 1691

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1691

uuugcuuugu gaucccaagu aga 23

<210> 1692

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1692

uuauauuuac cauuuagguu guu 23

<210> 1693

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1693

aauuugccuc aguucauuca aag 23

<210> 1694

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1694

uccuuuuaaa uuugccucag uuc 23

<210> 1695

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1695

uacagauuuu uacacauacu cug 23

<210> 1696

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1696

uuuugcuuug ugaucccaag uag 23

<210> 1697

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1697

uugguuuguu auauuuacca uuu 23

<210> 1698

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1698

aaauuugccu caguucauuc aaa 23

<210> 1699

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1699

ugccuuuuaa auuugccuca guu 23

<210> 1700

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1700

uuacagauuuuuuacacauac ucu 23

<210> 1701

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1701

aaacaccaaa ucuuuguuuu ccg 23

<210> 1702

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1702

uuagguuguu uucuccacac uca 23

<210> 1703

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1703

uauaaccuuc cauuuugaga cuu 23

<210> 1704

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1704

uaaauuugcc ucaguucauu caa 23

<210> 1705

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1705

uugccuuuua aauuugccuc agu 23

<210> 1706

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1706

auuacagauu uuuacacaua cuc 23

<210> 1707

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1707

aaaacaccaa aucuuuguuu ucc 23

<210> 1708

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1708

uuuagguugu uuucuccaca cuc 23

<210> 1709

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1709

uuuagagua uaaccuucca uuu 23

<210> 1710

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1710

uuaaauuugc cucaguucau uca 23

<210> 1711

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1711

auugccuuuu aaauuugccu cag 23

<210> 1712

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1712

uauuuacagau uuuuuacacau acu 23

<210> 1713

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1713

uagaaaacac caaaucuuug uuu 23

<210> 1714

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1714

auuuagguug uuuucuccac acu 23

<210> 1715

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1715

uuuuagagu auaaccuucc auu 23

<210> 1716

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1716

uuuaaauuug ccucaguuca uuc 23

<210> 1717

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1717

uauugccuuu uaaauuugcc uca 23

<210> 1718

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1718

aaguagaaaa caccaaaucu uug 23

<210> 1719

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1719

uauuuuaccau uuagguuguu uuc 23

<210> 1720

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1720

uugguugauu uuauagagua uaa 23

<210> 1721

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1721

uuuuaaauuu gccucaguuc auu 23

<210> 1722

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1722

cuc 23

<210> 1723

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1723

uuugugaucc caaguagaaa aca 23

<210> 1724

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1724

auauuuacca uuuagguugu uuu 23

<210> 1725

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1725

uuugguugau uuuauagagu aua 23

<210> 1726

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1726

uuuuuaaauu ugccucaguu cau 23

<210> 1727

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1727

aagauuuuua cacauacucu gug 23

<210> 1728

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1728

cacuuacgcu gaguacuucg a 21

<210> 1729

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic

oligonucleotide

<400> 1729

ucgaaguacu cagcguaagu gau 23

<---

Claims (45)

1. Conjugate for inhibition of ANGPTL3 expression, containing double-stranded ribonucleic acid (dsRNA) and a ligand, where the dsRNA contains a sense strand and an antisense strand forming a double stranded region, where the sense strand and antisense strand are each independently 17-25 nucleotides in length, where the antisense strand contains at least 17 contiguous nucleotides that differ by no more than three nucleotides from the nucleotide sequence: (a) 5'-AGACUGAUCAAAUAUGUUG-3'; (b) 5'-AAAGACUGAUCAAAUAUGUUGAG-3'; or (c) 5'-AAGACUGAUCAAAUAUGUUGAGU-3', where all nucleotides of the sense strand and all nucleotides of the antisense strand are modified nucleotides, where at least one of the modified nucleotides is selected from the group consisting of a 2'-O-methyl-modified nucleotide, a 2'-fluoro-modified nucleotide, a nucleotide containing a 5'-phosphorothioate group, and a 2'-amino-modified nucleotide, and, where the ligand contains a derivative of N-acetylgalactosamine (GalNAc). 2. The conjugate of claim 1, wherein the sense strand nucleotide sequence comprises a sense strand sequence selected from the following sense nucleotide sequences: (a) 5'-CAACAUAUUUGAUCAGUCU-3'; (b) 5'-CAACAUAUUUGAUCAGUCUUU-3'; or (c) 5'-UCAACAUAUUUGAUCAGUCUU-3'. 3. The conjugate of claim 1 or 2, wherein the sense strand and antisense strand are each independently 17-23 nucleotides in length. 4. A conjugate according to any one of claims 1 to 3, wherein at least one strand contains a 3' overhang of at least 1 nucleotide or at least 2 nucleotides. 5. A conjugate according to any one of claims 1 to 4, wherein the GalNAc derivative is attached via a divalent or trivalent branched linker. 6. The conjugate according to claim 5, where the ligand is

7. The conjugate according to any one of paragraphs. 1-6, characterized in that dsRNA contains at least one thiophosphate or methylphosphonate internucleotide bond. 8. The conjugate according to any one of paragraphs. 1-7, characterized in that the sense and antisense strands contain nucleotide sequences selected from the group consisting of 5'-CAUAUUUGAUCAGUCUUUUUA-3' (SEQ ID NO: 387) and 5'-UAAAAAGACUGAUCAAAUAUGUU-3' (SEQ ID NO: 572); 5'-ACAUAUUUGAUCAGUCUUUUU-3' (SEQ ID NO: 287) and 5'-AAAAAAGACUGAUCAAAUAUGUUG-3' (SEQ ID NO: 472); 5'-AACAUAUUUGAUCAGUCUUUU-3' (SEQ ID NO: 303) and 5'-AAAAGACUGAUCAAAUAUGUUGA-3' (SEQ ID NO: 488); 5'-ACAUAUUUGAUCAGUCUUU-3' (SEQ ID NO: 39) and 5'-AAAGACUGAUCAAAUAUGU-3' (SEQ ID NO: 101); 5'-CAACAUAUUUGAUCAGUCUUU-3' (SEQ ID NO: 294) and 5'-AAAGACUGAUCAAAUAUGUUGAG-3' (SEQ ID NO: 479); 5'-UCAACAUAUUUGAUCAGUCUU-3' (SEQ ID NO: 358) and 5'-AAGACUGAUCAAAUAUGUUGAGU-3' (SEQ ID NO: 543); and 5'-CAACAUAUUUGAUCAGUCU-3' (SEQ ID NO: 64) and 5'-AGACUGAUCAAAUAUGUUG-3' (SEQ ID NO: 126). 9. Pharmaceutical composition for inhibiting the expression of the ANGPTL3 gene, containing a therapeutically effective amount of the conjugate according to any one of paragraphs. 1-8 and a pharmaceutically acceptable carrier. 10. A method for inhibiting the expression of ANGPTL3 in a cell in vitro, comprising: (a) bringing the cell into contact with the conjugate according to any one of paragraphs. 1-8; and (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the ANGPTL3 gene mRNA transcript, thereby inhibiting expression of the ANGPTL3 gene in the cell. 11. A method of treating an individual with a disorder that would benefit from a reduction in ANGPTL3 expression, comprising administering to the individual a therapeutically effective amount of a conjugate according to any one of paragraphs. 1-8. 12. The method of claim 11 wherein the disorder is selected from the group consisting of lipid metabolism disorder, hypertriglyceridemia, obesity, hyperlipidemia, atherosclerosis, diabetes, cardiovascular disease, and coronary heart disease. 13. The method of claim 12 wherein the lipid metabolic disorder is hyperlipidemia or hypertriglyceridemia. 14. The method according to any one of paragraphs. 11-13 wherein the conjugate is administered to the individual at a dose of about 0.01 mg/kg to about 10 mg/kg, or about 5 mg/kg to about 50 mg/kg. 15. The method according to any one of paragraphs. 11-13, characterized in that the subject is administered an additional therapeutic agent. 16. The method according to p. 15, characterized in that the additional therapeutic agent is a statin.

Images