RU2768154C1 - Method for differential diagnosis of acute and chronic hepatitis in dogs based on cfa-mrna expression in blood serum - Google Patents

Method for differential diagnosis of acute and chronic hepatitis in dogs based on cfa-mrna expression in blood serum Download PDF

Info

Publication number
RU2768154C1
RU2768154C1 RU2021107768A RU2021107768A RU2768154C1 RU 2768154 C1 RU2768154 C1 RU 2768154C1 RU 2021107768 A RU2021107768 A RU 2021107768A RU 2021107768 A RU2021107768 A RU 2021107768A RU 2768154 C1 RU2768154 C1 RU 2768154C1
Authority
RU
Russia
Prior art keywords
mirna
cfa
dogs
hepatitis
cah
Prior art date
Application number
RU2021107768A
Other languages
Russian (ru)
Inventor
Ахмед Мохаммед Эль Себаей Али Хассан
Павел Николаевич Абрамов
Сергей Владимирович Позябин
Сеидфатима Мировна Борунова
Original Assignee
Федеральное государственное бюджетное образовательное учреждение высшего образования "Московская государственная академия ветеринарной медицины и биотехнологии - МВА имени К.И. Скрябина" (ФГБОУ ВО МГАВМиБ - МВА имени К.И. Скрябина)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Федеральное государственное бюджетное образовательное учреждение высшего образования "Московская государственная академия ветеринарной медицины и биотехнологии - МВА имени К.И. Скрябина" (ФГБОУ ВО МГАВМиБ - МВА имени К.И. Скрябина) filed Critical Федеральное государственное бюджетное образовательное учреждение высшего образования "Московская государственная академия ветеринарной медицины и биотехнологии - МВА имени К.И. Скрябина" (ФГБОУ ВО МГАВМиБ - МВА имени К.И. Скрябина)
Priority to RU2021107768A priority Critical patent/RU2768154C1/en
Application granted granted Critical
Publication of RU2768154C1 publication Critical patent/RU2768154C1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/58Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
    • G01N33/582Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with fluorescent label

Abstract

FIELD: veterinary science; biotechnology.SUBSTANCE: invention refers to veterinary science and biotechnology, particularly to molecular hepatology. Disclosed is a method for differential diagnosis between acute hepatitis (OH) and chronic active hepatitis (CAH), as well as early prediction of hepatic fibrosis in dogs with CAH. Expression of cfa-miRNA-122 and -21 in blood serum of dogs with primary hepatitis is analyzed. Analyses are applied in triplicate for each sample, and the obtained average cycle threshold (Ct) of each tested microRNA is normalized relative to the average ct of cfa-miRNA-16 and cel-miRNA-39-3p to obtain ΔCT. When expressing cfa-miRNA-122≥1.79 acute hepatitis is diagnosed. When expressing cfa-miRNA-122≥1.64 and cfa-miRNA-21≥1.51 expression, chronic active hepatitis and hepatic fibrosis are diagnosed in dogs.EFFECT: invention provides creation of new effective, liver-specific non-invasive diagnostic biomarkers based on genes for early diagnosis and differentiation of OH and CAH with high sensitivity and specificity in dogs with primary hepatitis.1 cl, 4 dwg, 1 tbl

Description

Изобретение относится к области ветеринарии и биотехнологии, в частности молекулярной гепатологии. Предлагается метод использования циркулирующих микроРНК (miRNA) canine familiaris (cfa), полученных из гепатоцитов, в качестве новых неинвазивных диагностических биомаркеров сыворотки для ранней диагностики и дифференциации двух форм первичного гепатита [острого гепатита (ОГ) и хронического активного гепатита (ХАГ)] и раннего прогнозирования фиброза печени до его прогрессирования в цирроз путем выделения общей РНК из образцов сыворотки крови собак, у которых гистологическими методами подтверждены некроз или фиброз печени, с последующей обратной транскрипцией, с последующей амплификацией в режиме ПЦР-РВ с использованием праймеров специфичных для собак, для cfa-miRNA-122-5p и cfa-miRNA-21-5p. Все исследования были применены в трех последовательностях для каждого образца, и полученный средний порог цикла (Ct) каждой тестируемой cfa-miRNA был нормализован относительно среднего Ct cfa-miRNA-16 (стабильно экспрессируемый эндогенный контроль) и cel-miRNA-39-3р (экзогенный дополнительный контроль) и относительное кратное изменение каждой протестированной cfa-miRNA у собак групп ОГ и ХАГ по сравнению с соответствующими здоровыми контролями определяли с использованием метода 2-ΔΔCt. Тесты доказали, что cfa-miRNA-122 при относительном кратном изменении ≥ 1, 79 является диагностическим для ОГ и диагностическим для ХАГ при относительном кратном изменении ≥ 1, 64, cfa-miRNA-21 при относительном кратном изменении ≥ 1,51 является диагностическом маркером для ХАГ. Изобретение позволяет использовать выбранные сывороточные cfa-miRNA-122 и -21 в качестве новых неинвазивных диагностических биомаркеров для дифференциации ОГ от ХАГ с высокой чувствительностью и специфичностью и для раннего прогнозирования фиброза печени, ведущего к циррозу.The invention relates to the field of veterinary medicine and biotechnology, in particular molecular hepatology. A method is proposed for using canine familiaris (cfa) circulating hepatocyte-derived microRNAs (miRNAs) as new non-invasive diagnostic serum biomarkers for early diagnosis and differentiation of two forms of primary hepatitis [acute hepatitis (OH) and chronic active hepatitis (CAH)] and early prediction of liver fibrosis before progression to cirrhosis by isolation of total RNA from serum samples of dogs in which hepatic necrosis or fibrosis is confirmed by histological methods, followed by reverse transcription, followed by RT-PCR amplification using canine-specific primers for cfa -miRNA-122-5p and cfa-miRNA-21-5p. All studies were applied in three sequences for each sample, and the resulting mean cycle threshold (Ct) of each tested cfa-miRNA was normalized to the mean Ct of cfa-miRNA-16 (stably expressed endogenous control) and cel-miRNA-39-3p (exogenous additional control) and the relative fold change of each tested cfa-miRNA in dogs of the OG and CAH groups compared to the corresponding healthy controls was determined using the 2 -ΔΔCt method. The tests proved that cfa-miRNA-122 with a relative fold change ≥ 1.79 is diagnostic for OH and diagnostic for CAH with a relative fold change ≥ 1.64, cfa-miRNA-21 with a relative fold change ≥ 1.51 is a diagnostic marker for HAG. EFFECT: invention allows using selected serum cfa-miRNA-122 and -21 as new non-invasive diagnostic biomarkers for differentiation of OH from CAH with high sensitivity and specificity and for early prediction of liver fibrosis leading to cirrhosis.

Результаты изобретения могут быть использованы для ранней дифференциальной диагностики между ОГ и ХАГ у собак, что может быть полезно для мониторинга результатов лечения собак с первичным гепатитом, либо для разработки эффективных терапевтических средств с использованием анти-miRNA, либо для раннего прогнозирования фиброза печени у собак с ХАГ до его прогрессирования в цирроз. Следовательно, не возникает потребности в использовании менее чувствительных методов диагностики визуализации (УЗИ и КТ) и инвазивных биопсий печени, которые имеют потенциальные риски осложнений.The results of the invention can be used for early differential diagnosis between OH and CAH in dogs, which can be useful for monitoring the results of treatment of dogs with primary hepatitis, or for developing effective therapeutic agents using anti-miRNA, or for early prediction of liver fibrosis in dogs with CAH until it progresses to cirrhosis. Therefore, there is no need to use less sensitive diagnostic imaging methods (ultrasound and CT) and invasive liver biopsies, which have potential risks of complications.

Первичный гепатит (ПГ) является одним из наиболее часто диагностируемых паренхиматозных заболеваний печени у собак, и их наиболее часто определяемыми формами являются острый (ОГ) и хронический (ХАГ) гепатоцеллюлярный апоптоз или некроз с высокой распространенностью хронической формы, для которой фиброз печени является определяющим (Bayton, W., Watson, P. J., Bexfield, N. Η. Prednisolone therapy for chronic hepatitis in English springer spaniels: a prospective study of 12 cases. Veterinary Record, 2020; 105642). Часто ПГ являются причиной заболеваемости и летальности среди различных пород собак, включая Лабрадор ретривера, английского кокер спаниеля, доберман пинчера, шотландского терьера и бедлингтон терьера (Bexfield, Ν. Η., Buxton, R. J., Vicek, T. J., Day, M. J., Bailey, S. M., Haugland, S. P., Watson, P. J. Breed, age and gender distribution of dogs with chronic hepatitis in the United Kingdom. The Veterinary Journal, 2012, 193(1), 124-128; Ватников Ю.А., Куликов E.B., Попова И.А., Сахно Н.В., Петряева А.В., Лыхина B.C., Газин А.А. Изменение клинических и биохимических показателей крови при хроническом гепатите у собак. Вестник Красноярского государственного аграрного университета, 2018, 2(137), 62-69).Primary hepatitis (PH) is one of the most commonly diagnosed liver parenchymal diseases in dogs, and their most frequently defined forms are acute (OH) and chronic (CH) hepatocellular apoptosis or necrosis with a high prevalence of the chronic form, for which hepatic fibrosis is the defining ( Bayton, W., Watson, PJ, Bexfield, N. H. Prednisolone therapy for chronic hepatitis in English springer spaniels: a prospective study of 12 cases Veterinary Record, 2020; 105642). AI is a common cause of morbidity and mortality in a variety of dog breeds, including the Labrador Retriever, English Cocker Spaniel, Doberman Pinscher, Scottish Terrier, and Bedlington Terrier (Bexfield, N. N., Buxton, RJ, Vicek, TJ, Day, MJ, Bailey, SM, Haugland, SP, Watson, PJ Breed, age and gender distribution of dogs with chronic hepatitis in the United Kingdom The Veterinary Journal, 2012, 193(1), 124-128; I.A., Sakhno N.V., Petryaeva A.V., Lykhina V.S., Gazin A.A. Changes in clinical and biochemical blood parameters in chronic hepatitis in dogs Bulletin of the Krasnoyarsk State Agrarian University, 2018, 2(137), 62-69).

Фактически, клинические признаки обычно не информативны в большинстве случаев с первичным гепатитом, за исключением фиброза или цирроза печени на конечной стадии (DAVIES, D. Common inflammatory liver diseases in the dog (part 1). Vet. Ireland J, 2016, 6: 556-6; Eman SR, Kubesy AA, Baraka ТА, Torad FA, Shaymaa IS, Mohammed FF. Evaluation of hepatocyte-derived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs. Veterinary World. 2018; ll(5):667-673; Webster, C. R., Center, S. Α., Cullen, J. M, Penninck, D. G., Richter, K. P., Twedt, D. C, & Watson, P. J. (2019). ACVIM consensus statement on the diagnosis and treatment of chronic hepatitis in dogs. Journal of veterinary internal medicine, 33(3), 1173-1200). Неинвазивные стандартные биомаркеры печени объективны для диагностики и мониторинга печеночных некровоспалительных изменений при остром и хроническом гепатите, однако при ней невозможно выявить раннее отложение компонентов фибриллярного внеклеточного матрикса (коллагены типа I и типа III) и прогрессирующее рубцевание печени в связи с гепатоцеллюлярным повреждением или воспалением (Eulenberg V, Lidbury J. Hepatic Fibrosis in Dogs. Journal of Veterinary Internal Medicine. 2017; 32(1):26-41; Raghu C, Ekena J, Cullen JM, Webb CB, Trepanier LA. Evaluation of potential serum biomarkers of hepatic fibrosis and necroinflammatory activity in dogs with liver disease. Journal of Veterinary Internal Medicine. 2018; 32(3):1009-1018).In fact, clinical signs are usually not informative in most cases with primary hepatitis, with the exception of end-stage liver fibrosis or cirrhosis (DAVIES, D. Common inflammatory liver diseases in the dog (part 1). Vet. Ireland J, 2016, 6: 556 -6, Eman SR, Kubesy AA, Baraka TA, Torad FA, Shaymaa IS, Mohammed FF, Evaluation of hepatocyte-derived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs, Veterinary World 2018;ll(5):667 -673 Webster, CR, Center, S. A., Cullen, J. M, Penninck, DG, Richter, KP, Twedt, D. C, & Watson, PJ (2019). of chronic hepatitis in dogs Journal of veterinary internal medicine, 33(3), 1173-1200). Non-invasive standard liver biomarkers are objective for diagnosing and monitoring hepatic necroinflammatory changes in acute and chronic hepatitis, but it cannot detect early deposition of fibrillar extracellular matrix components (type I and type III collagens) and progressive liver scarring due to hepatocellular damage or inflammation (Eulenberg V, Lidbury J. Hepatic Fibrosis in Dogs. Journal of Veterinary Internal Medicine. 2017; 32(1):26-41; Raghu C, Ekena J, Cullen JM, Webb CB, Trepanier LA. Evaluation of potential serum biomarkers of hepatic fibrosis and necroinflammatory activity in dogs with liver disease Journal of Veterinary Internal Medicine 2018;32(3):1009-1018).

С другой стороны, УЗИ брюшной полости не является точным инструментом для распознавания или дифференциации различных легких форм первичного гепатита и эффективно только на поздних стадиях заболевания (Murakami Τ, Feeney DA, Bahr KL. Analysis of clinical and ultrasonographic data by use of logistic regression models for prediction of malignant versus benign causes of ultrasonographically detected focal liver lesions in dogs. Am J Vet Res 2012; 73 (6):821-829; Мезикова, Ε.Α., Завадовская, В.Д., Белобородова, Е В., Долгалев, И.В., Тонких, О.С. Перфузионная мультисрезовая компьютерная томография гепатолиенальной зоны у больных диффузными заболеваниями печени. Фарматека, 2019, 26(2), 42-47). Острый гепатит гистологически характеризуется гепатоцеллюлярным апоптозом или некрозом, связанным с инфильтрацией смешанных воспалительных клеток в ткани печени (Eman SR, Kubesy АА, Baraka ТА, Torad FA, Shaymaa IS, Mohammed FF. Evaluation of hepatocyte-derived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs. Veterinary World. 2018; 11(5):667-673; Meunier, L., Meszaros, M., Pageaux, G. P., Delay, J. M., Herrero, Α., Pinzani, V., Dominique, Η. B. (2020). Acute liver failure requiring transplantation caused by ulipristal acetate. Clinics and Research in Hepatology and Gastroenterology. 2020; 44 (3): e45-e49). Гистологические признаки хронического гепатита у собак включают искажение дольчатого рисунка, инфильтрацию мононуклеарных клеток (лимфоцитов и клеток Купфера), гепатоцеллюлярный некроз, апоптоз и фиброз (Eman SR, Kubesy АА, Baraka ТА, Torad FA, Shaymaa IS, Mohammed FF. Evaluation of hepatocyte-derived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs. Veterinary World. 2018; 11(5):667-673; Bexfield, N. (2020). Canine Inflammatory Liver Disease. Clinical Small Animal Internal Medicine, 695-704 Ватников, Ю. Α., Куликов, Ε. В., Попова, И. Α., и др. Изменение клинических и биохимических показателей крови при хроническом гепатите у собак. Вестник Красноярского государственного аграрного университета, 2018; 2 (137):62-69). Следовательно, гистологическое исследование печени в настоящее время является единственным средством диагностики степени поражения печени (Poldervaart, J.H., Favier, R.P., Penning, L.C. et al. Primary hepatitis in dogs: A retrospective review (2002-2006). Journal of Veterinary Internal Medicine, 2009, 23(1), 72-80; Favier, R. P., Poldervaart, J. Η., van den Ingh, T. S., et al. A retrospective study of oral prednisolone treatment in canine chronic hepatitis.On the other hand, abdominal ultrasonography is not an accurate tool for recognizing or differentiating different mild forms of primary hepatitis and is effective only in advanced stages of the disease (Murakami Τ, Feeney DA, Bahr KL. Analysis of clinical and ultrasonographic data by use of logistic regression models for prediction of malignant versus benign causes of ultrasonographically detected focal liver lesions in dogs Am J Vet Res 2012;73(6):821-829; Mezikova, E.A., Zavadovskaya, V.D., Beloborodova, E.V. Dolgalev, I.V., Tonkikh, O.S. Perfusion multislice computed tomography of the hepatolienal zone in patients with diffuse liver diseases, Farmateka, 2019, 26(2), 42-47. Acute hepatitis is histologically characterized by hepatocellular apoptosis or necrosis associated with infiltration of mixed inflammatory cells into the liver tissue (Eman SR, Kubesy AA, Baraka TA, Torad FA, Shaymaa IS, Mohammed FF. Evaluation of hepatocyte-derived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs Veterinary World 2018;11(5):667-673; Meunier, L., Meszaros, M., Pageaux, GP, Delay, JM, Herrero, A., Pinzani, V., Dominique, Η B. (2020) Acute liver failure requiring transplantation caused by ulipristal acetate Clinics and Research in Hepatology and Gastroenterology 2020;44(3):e45-e49). Histological features of chronic hepatitis in dogs include lobular distortion, mononuclear cell infiltration (lymphocytes and Kupffer cells), hepatocellular necrosis, apoptosis, and fibrosis (Eman SR, Kubesy AA, Baraka TA, Torad FA, Shaymaa IS, Mohammed FF. Evaluation of hepatocyte- derived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs Veterinary World 2018;11(5):667-673 Bexfield, N. (2020) Canine Inflammatory Liver Disease Clinical Small Animal Internal Medicine, 695-704 Vatnikov, Yu. A., Kulikov, E. V., Popova, I. A., et al., Changes in clinical and biochemical blood parameters in chronic hepatitis in dogs, Bulletin of the Krasnoyarsk State Agrarian University, 2018;2(137):62 -69). Consequently, liver histology is currently the only means of diagnosing the extent of liver damage (Poldervaart, JH, Favier, RP, Penning, LC et al. Primary hepatitis in dogs: A retrospective review (2002-2006). Journal of Veterinary Internal Medicine, 2009, 23(1), 72-80, Favier, RP, Poldervaart, J. H., van den Ingh, TS, et al., A retrospective study of oral prednisolone treatment in canine chronic hepatitis.

VeterinaryQuarterly, 2013, 33, 113-120), но, несмотря на это, не может использоваться регулярно, поскольку является инвазивным и дорогостоящим (Cadranel, J. F., Rufat, P., Degos, F. Practices of liver biopsy in France: results of a prospective nationwide survey. Hepatology, 2000, 32(3), 477-481). Таким образом, выявление неинвазивных сывороточных биомаркеров, которые могут точно диагностировать степень воспалительной активности печени и фиброза на ранней стадии, необходимо в ранней дифференции ОГ и ХАГ (Li, S., Zhu, J., Fu, Η., Wan, J., et al. Hepato-specific microRNA-122 facilitates accumulation of newly synthesized miRNA through regulating PRKRA. Nucleic Acids Research, 2012, 40(2), 884-891), следовательно, предотвращение поздней диагностики и плохого прогноза после необратимого фиброза и цирроза печени.VeterinaryQuarterly, 2013, 33, 113-120), but despite this, it cannot be used regularly because it is invasive and expensive (Cadranel, JF, Rufat, P., Degos, F. Practices of liver biopsy in France: results of a prospective nationwide survey Hepatology, 2000, 32(3), 477-481). Thus, the identification of non-invasive serum biomarkers that can accurately diagnose the degree of liver inflammation and fibrosis at an early stage is necessary in the early differentiation of OH and CAH (Li, S., Zhu, J., Fu, Η., Wan, J., et al., Hepato- microspecificRNA-122 facilitates accumulations of newly synthesized miRNA through regulating PRKRA. Nucleic Acids Research, 2012, 40(2), 884-891), hence preventing late diagnosis and poor prognosis after irreversible liver fibrosis and cirrhosis.

Зрелые микроРНК (miRNA) представляют собой класс коротких некодирующих молекул РНК (приблизительно 18-25 нуклеотидов в длину), которые действуют как важные регуляторы посттранскрипционной экспрессии генов в различных физиологических и патологических путях, связанных с окислительным стрессом печени, апоптозом, некрозом и фиброзом (Szabo G, Bala S. MicroRNAs in liver disease. Nat Rev Gastroenterol Hepatol. 2013, 10, 542-552). Недавние исследования показали, что концентрации miRNA в сыворотке и тканях значительно коррелируют.Таким образом, miRNA превратились в стабильные и чувствительные неинвазивные диагностические биомаркеры крови при различных повреждениях печени (Dirksen K, Verzijl Τ, van den Ingh TS et al. Hepatocyte-derived microRNAs as sensitive serum biomarkers of hepatocellular injury in Labrador retrievers. Vet J. 2016, 211, 75-81). Исследования, посвященные воспалительному поражению печени у людей (Schueller F, Roy S, Vucur Μ et al. The role of miRNAs in the pathophysiology of liver diseases and toxicity. Int J Mol Sci. 2018, 19, 261) и гепатобилиарные заболевания у собак (Dirksen K, Verzijl Τ, van den Ingh TS et al. Hepatocyte-derived microRNAs as sensitive serum biomarkers of hepatocellular injury in Labrador retrievers. Vet J. 2016, 211, 75-81) Было выявлено, что профилирование сывороточной miRNA может использоваться в качестве ценного диагностического, прогностического и прогностического инструмента в отношении степени гистологических аномалий печени. В настоящее время miRNA-122 представляет 70% всех miRNA в печени, и она играет точную роль в регуляции воспаления, некроза и стеатоза печени, следовательно, циркулирующая miRNA-122 может быть ранним специфическим и чувствительным биомаркером сыворотки для определения степени воспаления печени (Dirksen K, Verzijl Τ, Grinwis G, Favier R, Penning L, Burgener I, Laan LVD, Fieten H, Spee B. Use of Serum MicroRNAs as Biomarker for Hepatobiliary Diseases in Dogs. Journal of Veterinary Internal Medicine. 2016; 30(6): 1816-1823). Недавние исследования определили miRNA-21 как одну из основных движущих сил для прогрессирования повреждения печени в фиброз, поскольку она косвенно активирует HSC для синтеза ЕСМ (коллагена tpe I и III) через активацию TGF-β1 / Smads, ERK, PTEN / Akt и сигнальные пути NF-κΒ (Нао XJ, Xu CZ, Wang JT et al. miR-21 promotes proliferation and inhibits apoptosis of hepatic stellate cells through targeting PTEN/PI3K/AKT pathway. J Recept Signal Transduct Res. 2018, 38, 455-461: Huang Q, Zhang X Bai F et al. Methyl helicterte ameliorates liver fibrosis by regulating miR-21-mediated ERK and TGF-β1/Smads pathways. Int Immunopharmacol. 2019, 66, 41-51).Mature miRNAs (miRNAs) are a class of short, non-coding RNA molecules (approximately 18-25 nucleotides in length) that act as important regulators of post-transcriptional gene expression in various physiological and pathological pathways associated with liver oxidative stress, apoptosis, necrosis, and fibrosis (Szabo G, Bala S. MicroRNAs in liver disease Nat Rev Gastroenterol Hepatol 2013, 10, 542-552). Recent studies have shown that miRNA concentrations in serum and tissues are significantly correlated. Thus, miRNAs have become stable and sensitive non-invasive diagnostic blood biomarkers for various liver injuries (Dirksen K, Verzijl Τ, van den Ingh TS et al. Hepatocyte-derived microRNAs as sensitive serum biomarkers of hepatocellular injury in Labrador retrievers Vet J. 2016, 211, 75-81). Studies on inflammatory liver disease in humans (Schueller F, Roy S, Vucur Μ et al. The role of miRNAs in the pathophysiology of liver diseases and toxicity. Int J Mol Sci. 2018, 19, 261) and hepatobiliary disease in dogs ( Dirksen K, Verzijl Τ, van den Ingh TS et al Hepatocyte-derived microRNAs as sensitive serum biomarkers of hepatocellular injury in Labrador retrievers Vet J 2016, 211, 75-81) Serum miRNA profiling has been found to be useful as a a valuable diagnostic, prognostic and prognostic tool regarding the degree of histological abnormalities of the liver. Currently, miRNA-122 represents 70% of all miRNAs in the liver, and it plays a precise role in the regulation of inflammation, necrosis and steatosis of the liver, therefore, circulating miRNA-122 may be an early specific and sensitive serum biomarker to determine the degree of liver inflammation (Dirksen K , Verzijl Τ, Grinwis G, Favier R, Penning L, Burgener I, Laan LVD, Fieten H, Spee B. Use of Serum MicroRNAs as Biomarker for Hepatobiliary Diseases in Dogs Journal of Veterinary Internal Medicine 2016;30(6): 1816-1823). Recent studies have identified miRNA-21 as one of the main drivers for the progression of liver injury to fibrosis, as it indirectly activates HSCs for ECM (collagen tpe I and III) synthesis via activation of TGF-β1/Smads, ERK, PTEN/Akt, and signaling pathways. NF-κΒ (Nao XJ, Xu CZ, Wang JT et al. miR-21 promotes proliferation and inhibits apoptosis of hepatic stellate cells through targeting PTEN/PI3K/AKT pathway. J Recept Signal Transduct Res. 2018, 38, 455-461: Huang Q, Zhang X Bai F et al, Methyl helicterte ameliorates liver fibrosis by regulating miR-21-mediated ERK and TGF-β1/Smads pathways, Int Immunopharmacol 2019, 66, 41-51).

Анализ уровня техники показал, что никакие предыдущие аналоги не были связаны с использованием cfa-miRNA специфичных для собак в качестве биомаркеров сыворотки крови для ранней диагностики и дифференциации ОГ и ХАГ у собак с первичным гепатитом которые могут улучшить раннее прогнозирование фиброза печени у собак с ХАГ до его развития в цирроз, в то время как следующие непатентные документы в некоторых аспектах аналогичны заявленному нами:Prior art analysis showed that no previous analogues were associated with the use of canine-specific cfa-miRNAs as serum biomarkers for early diagnosis and differentiation of OH and CAH in dogs with primary hepatitis, which could improve the early prediction of liver fibrosis in dogs with CAH to its progression to cirrhosis, while the following non-patent documents are similar in some respects to what we have claimed:

1 - Способ дифференциальной диагностики острого и хронического гепатита у собак с использованием сывороточных miRNA в качестве нового молекулярного диагностического биомаркера (Eman SR, Kubesy АА, Baraka ТА, Torad FA, Shaymaa IS, Mohammed FF. Evaluation of hepatocyte-derived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs. Veterinary World. 2018; 11(5):667-673). Авторы предложили измерять сывороточные концентрации miRNA-122 в качестве нового биомаркера для ранней диагностики и дифференциальной острого и хронического гепатита собак. Дана оценка miRNA-122 в качестве биомаркера ОГ и ХАГ, а относительное кратное изменение miRNA было оценено с использованием метода 2-ΔΔCt, но уровни экспрессии были нормализованы с использованием только эндогенных контрольных эталонных генов (GAPDH) без проверки. Это неприемлемо, поскольку согласно справочнику Qiagen miScript PCR Array и другим предыдущим исследованиям (Hellemans J, Vandesompele J. Selection of reliable reference genes for RT-qPCR analysis. In Quantitative Real-Time PCR. Humana Press, New York, N.2014, pp.19-26; Wang X, Fu Y, Ban L, Wang Z, Feng G, Li J, Gao H. Selection of reliable reference genes for quantitative realtime RT-PCR in alfalfa. Genes & genetic systems. 2015. 90, 175-180): Для получения точных и воспроизводимых результатов количественной оценки miRNA с помощью ПЦР в реальном времени необходимо нормализовать количество тестируемой miRNA с помощью подходящей эндогенной и экзогенной эталонной РНК, чтобы нейтрализовать влияние биологических различий. Кроме того, miRNAs-122 оценивали с использованием последовательности праймеров, полученной из литературы, основанной на исследованиях на людях и не специфичной для собак (cfa - canine familiaris).1 - A method for the differential diagnosis of acute and chronic hepatitis in dogs using serum miRNA as a new molecular diagnostic biomarker (Eman SR, Kubesy AA, Baraka TA, Torad FA, Shaymaa IS, Mohammed FF. Evaluation of hepatocyte-derived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs Veterinary World 2018;11(5):667-673). The authors proposed to measure serum concentrations of miRNA-122 as a new biomarker for early diagnosis and differential diagnosis of acute and chronic canine hepatitis. miRNA-122 was assessed as a biomarker for OH and CAH, and relative miRNA fold change was assessed using the 2 -ΔΔCt method, but expression levels were normalized using only endogenous control reference genes (GAPDH) without validation. This is unacceptable because according to the Qiagen miScript PCR Array and other previous studies (Hellemans J, Vandesompele J. Selection of reliable reference genes for RT-qPCR analysis. In Quantitative Real-Time PCR. Humana Press, New York, N.2014, pp 19-26 Wang X, Fu Y, Ban L, Wang Z, Feng G, Li J, Gao H. Selection of reliable reference genes for quantitative realtime RT-PCR in alfalfa. Genes & genetic systems. 2015. 90, 175 -180): In order to obtain accurate and reproducible results of miRNA quantification by real-time PCR, it is necessary to normalize the amount of miRNA tested with appropriate endogenous and exogenous reference RNA to neutralize the effect of biological differences. In addition, miRNAs-122 was evaluated using a primer sequence obtained from literature based on human studies and not specific to dogs (cfa - canine familiaris).

2 - Способ раннего выявления субклинических гепатоцеллюлярных повреждений у лабрадоров-ретриверов с использованием сывороточной miRNA-122 в качестве высокочувствительного нового биомаркера (Dirksen K, Verzijl Τ, van den Ingh Τ S G et al. Hepatocyte-derived microRNAs as sensitive serum biomarkers of hepatocellular injury in Labrador retrievers. Vet J. 2016, 211, 75-81) в дополнение к методу исследования ассоциации сывороточных miRNA-122 и -29а со стадией фиброза и прогрессированием хронического гепатита у лабрадоров-ретриверов (Sakai Μ, Spee В, Grinwis GC et al. Association of circulating microRNA-122 and microiRNA-29a with stage of fibrosis and progression of chronic hepatitis in Labrador Retrievers. J Vet Intern Med. 2019, 33, 151-157). В этих методах только miRNA-122 была оценена для дифференциации острого и хронического гепатита только у одной породы собак (Лабрадор ретривер). Также в этом методе проверенный уровень экспрессии miRNA был нормализован с использованием только cel-miRNA-39-Зр в качестве экзогенных эталонных генов (spike-in control).2 - A method for the early detection of subclinical hepatocellular damage in Labrador Retrievers using serum miRNA-122 as a highly sensitive new biomarker (Dirksen K, Verzijl Τ, van den Ingh Τ SG et al. Hepatocyte-derived microRNAs as sensitive serum biomarkers of hepatocellular injury in Labrador retrievers. Vet J. 2016, 211, 75-81) in addition to a method to study the association of serum miRNA-122 and -29a with fibrosis stage and chronic hepatitis progression in Labrador Retrievers (Sakai M, Spee B, Grinwis GC et al. Association of circulating microRNA-122 and microiRNA-29a with stage of fibrosis and progression of chronic hepatitis in Labrador Retrievers J Vet Intern Med 2019, 33, 151-157). In these methods, only miRNA-122 was evaluated to differentiate between acute and chronic hepatitis in only one breed of dog (Labrador Retriever). Also in this method, the tested miRNA expression level was normalized using only cel-miRNA-39-3p as exogenous reference genes (spike-in control).

3- Метод дифференциальной диагностики гепатобилиарных заболеваний у собак с использованием сывороточных miRNA в качестве нового биомаркера (Dirksen K, Verzijl Τ, Grinwis, GC et al. Use of Serum MicroRNAs as Biomarker for Hepatobiliary Diseases in Dogs. J Vet Intern Med. 2016, 30, 1816-1823). Авторы предложили измерять сывороточные концентрации miRNA-122 и -21 в качестве диагностических биомаркеров у собак с острым и хроническим гепатитом, а также у здоровых контрольных собак. Концентрация концентрации протестированных miRNA были количественно определены путем абсолютного количественного определения с помощью стандартной кривой, и все количества были нормализованы только для cel-miRNA-39-3р в качестве эталонных генов (экзогенный контроль с добавлением импульсов), выбранных из литературы, без проверки на конкретные условия. Кроме того, все протестированные miRNA оценивались с использованием последовательностей праймеров, полученных из литературы, основанной на исследованиях на людях и не специфичных для собак (cfa - canine familiaris).3- A method for the differential diagnosis of hepatobiliary diseases in dogs using serum miRNA as a new biomarker (Dirksen K, Verzijl Τ, Grinwis, GC et al. Use of Serum MicroRNAs as Biomarker for Hepatobiliary Diseases in Dogs. J Vet Intern Med. 2016, 30 , 1816-1823). The authors proposed to measure serum concentrations of miRNA-122 and -21 as diagnostic biomarkers in dogs with acute and chronic hepatitis, as well as in healthy control dogs. Concentration concentrations of tested miRNAs were quantified by absolute quantitation using a standard curve, and all quantities were normalized to cel-miRNA-39-3p only as reference genes (exogenous control with added pulses) selected from the literature, without testing for specific terms. In addition, all tested miRNAs were evaluated using primer sequences obtained from literature based on human studies and not specific to dogs (cfa - canine familiaris).

Определяющими отличиями заявляемого способа, по сравнению с прототипом, являются:The defining differences of the proposed method, compared with the prototype, are:

1 - Способ основан на сравнении относительной экспрессии экспериментально выбранных cfa-miRNA-122 и -21 специфичных для собак, которые опосредуют различные гены и пути в гепатоцитах, а затем значительно повышаются в сыворотке крови в зависимости от степени дегенерации, некроза и фиброза печени у собак с первичным гепатитом. Это изобретение позволяет снизить стоимость, упростить и значительно ускорить процедуру тестирования для ранней диагностики ОГ и ХАГ, связанных с фиброзом печени до его прогрессирования в терминальную стадию цирроза без необходимости подтверждения диагноза с использованием опасной для жизни инвазивной биопсии.1 - The method is based on the comparison of the relative expression of experimentally selected cfa-miRNA-122 and -21 specific for dogs, which mediate various genes and pathways in hepatocytes, and then significantly increase in blood serum depending on the degree of degeneration, necrosis and fibrosis of the liver in dogs with primary hepatitis. This invention reduces the cost, simplifies and significantly speeds up the testing procedure for the early diagnosis of OH and CAH associated with liver fibrosis before it progresses to end-stage cirrhosis without the need to confirm the diagnosis using a life-threatening invasive biopsy.

2 - В заявленном способе, определение относительного уровня экспрессии cfa-miRNAs в образцах сыворотки осуществлялось с помощью ГЩР в реальном времени с использованием специфичных для собак прямого и обратного праймеров каждой измеренной miRNA и двух эталонных генов, включая cel-miRNA-39-3р (экзогенный контроль с добавлением импульсов), и cfa-miRNA-16 (стабильно экспрессируемый эндогенный контроль), которая была отобрана и подтверждена, поскольку она стабильно транскрибируется среди четырех исследованных кандидатов на эндогенные референсные гены (SNORD61-1, RNU6-2, SNORD95-1 и miRNA-16) на основе на результат анализа программного обеспечения NormFinder и geNorm, что увеличивает точность, специфичность и чувствительность процедур тестирования.2 - In the claimed method, determination of the relative level of expression of cfa-miRNAs in serum samples was carried out using real-time GAD using dog-specific forward and reverse primers of each measured miRNA and two reference genes, including cel-miRNA-39-3p (exogenous spike control), and cfa-miRNA-16 (stably expressed endogenous control), which was selected and validated because it is stably transcribed among the four endogenous reference gene candidates tested (SNORD61-1, RNU6-2, SNORD95-1 and miRNA-16) based on the result analysis software NormFinder and geNorm, which increases the accuracy, specificity and sensitivity of testing procedures.

3 - В этом способе, собаки с подозрением на поражение печени и здоровые контрольные собаки были предварительно идентифицированы на основе наблюдаемых клинических признаков, биохимических изменений в сыворотке крови и УЗИ брюшной полости, после чего тип патологии печени был точно идентифицирован и подтвержден как ОГ или ХАГ путем гистологического исследования собранной печени биопсии с использованием стандартной окраски гематоксилином и эозином. Кроме того, краситель Picrosirus Red использовался для выявления случаев фиброза путем окрашивания в красный цвет волокон соединительной ткани (коллаген типов I и III) в исследованных биопсиях печени в группе ХАГ.3 - In this method, dogs with suspected liver disease and healthy control dogs were tentatively identified based on observed clinical signs, serum biochemical changes, and abdominal ultrasonography, after which the type of liver disease was accurately identified and confirmed as OH or CAH by histological examination of the collected liver biopsy using standard staining with hematoxylin and eosin. In addition, Picrosirus Red was used to detect cases of fibrosis by red staining of connective tissue fibers (collagen types I and III) in the examined liver biopsies in the CAH group.

Предварительные исследования показали, что cfa-miRNA-122 и -21 значительно экспрессировались в сыворотке крови в корреляции с типом гистологических изменений печени у собак с ОГ или ХАГ с высокой чувствительностью и специфичностью.Preliminary studies have shown that cfa-miRNA-122 and -21 are significantly expressed in serum in correlation with the type of liver histology in dogs with OH or CAH with high sensitivity and specificity.

Техническим результатом заявленного изобретения является создание новых эффективных, специфичных для печени неинвазивных диагностических биомаркеров на основе генов для ранней диагностики и дифференциации ОГ и ХАГ с высокой чувствительностью и специфичностью у собак с первичным гепатитом, которые могут быть использованы для мониторинга результатов лечения собак с гепатитом, для разработки эффективных терапевтических средств с использованием анти-miRNAs, либо для раннего прогнозирования фиброза печени у собак с ХАГ, до его прогрессирования в цирроз, без проведения биопсии печени.The technical result of the claimed invention is the creation of new effective liver-specific non-invasive diagnostic biomarkers based on genes for early diagnosis and differentiation of OH and CAH with high sensitivity and specificity in dogs with primary hepatitis, which can be used to monitor the results of treatment of dogs with hepatitis, for development of effective therapeutic agents using anti-miRNAs, or for early prediction of liver fibrosis in dogs with CAH, before it progresses to cirrhosis, without liver biopsy.

Технический результат достигается на основе анализа относительной экспрессии cfa-miRNAs-122 и-21 в сыворотке, а также путем выделения общей РНК из образцов сыворотки собак, гистологически подтвержденных как пораженные ОГ или ХАГ, затем обратная транскрипция с последующей амплификацией в ПЦР в реальном времени (RT-PCR) с использованием праймеров, специфичных для собак, для cfa-miRNA-122-5р и cfa-miRNA-21-5р. Все анализы применяли в трех экземплярах для каждого образца, и полученный средний порог цикла (Ct) каждой тестируемой микроРНК был нормализован относительно среднего Ct cfa-miRNA-16 (стабильно экспрессируемый эндогенный контроль) и cel-miRNA-39-3р (экзогенный контроль всплеска), чтобы получить ΔCt, используя следующее уравнение ΔCt = cfa_miRNA(интересующий маркер) - 0.5 × (Ct cel miRNA_39+Ct miRNA_16), а затем полученный ΔCt использовали для определения относительного кратного изменения каждой протестированной cfa-miRNA в группах ОГ или ХАГ по сравнению с соответствующими здоровыми контролями с использованием метода 2-ΔΔCt. Согласно наблюдаемым гистологическим критериям, ПЦР в реальном времени доказала, что при относительном кратном изменении cfa-miRNA-122 ≥ 1,79 диагностируют острый гепатит, при относительном кратном изменении cfa-miRNA-122 ≥ 1,64 диагностируют хронический активный гепатит, при относительном кратном изменении cfa-miRNA-21 ≥ 1,51 диагностируют наличие хронического активного гепатита и фиброза печени у собак. Следовательно, гистологическое присутствие ОГ может быть легко идентифицировано, когда cfa-miRNA-122 активируется только в сыворотке, в то время как ХАГ идентифицируется, когда обе cfa-miRNA-122 и -21 активируются в сыворотке собак с клиническими признаками и биохимические изменения сыворотки, указывающие на печеночную недостаточность.The technical result is achieved based on the analysis of the relative expression of cfa-miRNAs-122 and-21 in serum, as well as by isolating total RNA from dog serum samples, histologically confirmed as affected by OG or CAH, then reverse transcription followed by amplification in real-time PCR ( RT-PCR) using dog-specific primers for cfa-miRNA-122-5p and cfa-miRNA-21-5p. All assays were run in triplicate for each sample and the resulting mean cycle threshold (Ct) of each miRNA tested was normalized to the mean Ct of cfa-miRNA-16 (stably expressed endogenous control) and cel-miRNA-39-3p (exogenous burst control) to obtain ∆Ct using the following equation ∆Ct = cfa_miRNA(marker of interest) - 0.5 × (Ct cel miRNA_39+Ct miRNA_16) and then the resulting ∆Ct was used to determine the relative fold change of each tested cfa-miRNA in the OG or CAH groups compared to corresponding healthy controls using the 2 -ΔΔCt method. According to the observed histological criteria, real-time PCR proved that cfa-miRNA-122 relative fold change ≥ 1.79 is diagnosed as acute hepatitis, cfa-miRNA-122 relative fold change ≥ 1.64 is chronic active hepatitis, and cfa-miRNA-122 relative fold change ≥ 1.64 is diagnosed as chronic active hepatitis; a change in cfa-miRNA-21 ≥ 1.51 diagnoses the presence of chronic active hepatitis and liver fibrosis in dogs. Therefore, the histological presence of OH can be easily identified when cfa-miRNA-122 is only activated in serum, while CAH is identified when both cfa-miRNA-122 and -21 are activated in the serum of dogs with clinical signs and serum biochemical changes. indicating liver failure.

Заявленный способ осуществляется следующим образом: После ультразвукового и гистологического исследования каждой собаки с подозрением на заболевание печени и здоровых контрольных собак образцы крови брали через головную вену у каждой собаки, а затем отделяли сыворотку и хранили при -80°С в отсутствие циклов замораживания-оттаивания до анализ cfa-miRNAs. Общая РНК, включая представляющие интерес miRNA, была выделена из каждого образца с использованием QIAzol Lysis Reagent в составе набора miRNeasy для сыворотки / плазмы (Qiagen®, Германия) в соответствии с инструкциями производителя. Для измерения эффективности выделения РНК 3,5 мкл синтетической miRNA-39 Caenorhabditis elegans (Qiagen®, Германия) добавляли в качестве дополнительного контроля к каждому образцу денатурированной сыворотки из расчета 1,6 × 108 копий / мкл рабочего раствора. В конце концор, концентрация и чистота выделенных образцов РНК были оценены путем измерения их оптической плотности при 280 нм с помощью ΝΑΝΟ photometer® NP80 (Германия), и отношения РНК (А260:А280), превышающие и/или равные 1,6, были включены в наше расследование. Выделенную РНК из каждого образца подвергали обратной транскрипции с использованием набора miScript II RT (Qiagen®, Германия) для получения комплементарной ДНК (кДНК) согласно инструкциям производителя. После этого для определения относительной экспрессии выбранных cfa-miRNA-122 и-21, а также экзогенного (cel-miRNA-39) и эндогенного эталонных генов (miRNA-16) была проведена RT-PCR на CFX-96 система® обнаружения ПЦР в реальном времени (Bio-Rad, США) с использованием разбавленной кДНК и набора miScript SYBR Green PCR (Qiagen®, Германия) согласно miScript-PCR- Система-справочник. Условия реакции ПЦР-амплификации были: 1 цикл начальной денатурации при 95°С в течение 15 минут и 45 циклов трехступенчатой ПЦР, включая 15 секунд денатурации при 94°С, фазу отжига при 55°С в течение 30 секунд и затем фазу элонгации в течение 30 секунд при 70°С. Все анализы применяли в трех экземплярах для каждого образца, и средний пороговый цикл (Ct) оценивали и использовали в последующем анализе. Наконец, полученные с помощью ПЦР значения Ct каждой протестированной cfa-miRNA были нормализованы относительно cfa-miRNA-16 в качестве эндогенного эталонного гена (из-за их относительно стабильной экспрессии), и cel-miRNA-39 в качестве экзогенного синтетического эталонного гена (добавленного во время выделения РНК) для получения ΔCt с использованием следующего уравнения: ΔCt = cfa_miRNA(интересующий маркер) - 0.5 × (Ct cel miRNA_39 + Ct miRNA_16), а затем все данные были относительно выражены как кратное изменение по сравнению с контролями с использованием сравнительного метода Ct (метод 2-ΔΔCt). Специфические прямые праймеры к интересующим cfa-miRNA, а также эндогенный референсный ген были разработаны и синтезированы компанией Evrogen (Москва, Россия) с использованием баз данных MirBase, NCBI GenBank и программы Primer-BLAST (http://www.mirbase.org/index.shtml) как показано в таблице (1), в то время как специфический прямой праймер cel-miRNA-39 и универсальный обратный праймер уже были включены в коммерчески приобретенные наборы (Qiagen®, Германия).The claimed method is carried out as follows: After ultrasound and histological examination of each dog with suspected liver disease and healthy control dogs, blood samples were taken through the cephalic vein of each dog, and then the serum was separated and stored at -80°C in the absence of freeze-thaw cycles until analysis of cfa-miRNAs. Total RNA, including miRNAs of interest, was isolated from each sample using QIAzol Lysis Reagent as part of the miRNeasy serum/plasma kit (Qiagen®, Germany) according to the manufacturer's instructions. To measure the efficiency of RNA extraction, 3.5 µl of Caenorhabditis elegans synthetic miRNA-39 (Qiagen®, Germany) was added as an additional control to each denatured serum sample at a rate of 1.6 × 10 8 copies/µl of working solution. Finally, the concentration and purity of the isolated RNA samples were evaluated by measuring their optical density at 280 nm using a NP80 photometer® (Germany), and RNA ratios (A260:A280) greater than and/or equal to 1.6 were included to our investigation. The isolated RNA from each sample was subjected to reverse transcription using the miScript II RT kit (Qiagen®, Germany) to obtain complementary DNA (cDNA) according to the manufacturer's instructions. Thereafter, RT-PCR was performed on the CFX-96 Real-PCR Detection System® to determine the relative expression of selected cfa-miRNA-122 and-21, as well as exogenous (cel-miRNA-39) and endogenous reference genes (miRNA-16). time (Bio-Rad, USA) using diluted cDNA and miScript SYBR Green PCR kit (Qiagen®, Germany) according to miScript-PCR-Reference System. PCR amplification reaction conditions were: 1 cycle of initial denaturation at 95°C for 15 minutes and 45 cycles of three-step PCR, including 15 seconds of denaturation at 94°C, an annealing phase at 55°C for 30 seconds, and then an elongation phase for 30 seconds at 70°C. All assays were run in triplicate for each sample and the mean cycle threshold (Ct) was evaluated and used in the subsequent analysis. Finally, the PCR-derived Ct values of each cfa-miRNA tested were normalized to cfa-miRNA-16 as the endogenous reference gene (due to their relatively stable expression), and cel-miRNA-39 as the exogenous synthetic reference gene (added during RNA isolation) to obtain ΔCt using the following equation: ΔCt = cfa_miRNA(marker of interest) - 0.5 × (Ct cel miRNA_39 + Ct miRNA_16) and then all data were relatively expressed as fold change from controls using a comparative method Ct (method 2 -ΔΔCt ). Specific forward primers to the cfa-miRNAs of interest, as well as an endogenous reference gene, were developed and synthesized by Evrogen (Moscow, Russia) using the MirBase, NCBI GenBank databases and the Primer-BLAST program (http://www.mirbase.org/index .shtml) as shown in Table (1), while the cel-miRNA-39 specific forward primer and universal reverse primer were already included in commercially purchased kits (Qiagen®, Germany).

Figure 00000001
Figure 00000001

Диагностическая ценность дифференциально экспрессируемых cfa-miRNA-122 и-21 для ранней диагностики и дифференциации между ОГ и ХАГ и прогнозирования фиброза печени у собак с ХАГ с высокой чувствительностью и специфичностью была определена путем расчета площади под кривой ошибок (AUC-ROC) и пороговые значения для получения оптимального процента чувствительности и специфичности. Было показано, что cfa-miRNA-122 достоверно экспрессировалась в сыворотке крови собак с ОГ (среднее кратное изменение=9,48, Ρ < 0,001) или с ХАГ (среднее кратное изменение = 4,94, Ρ < 0,01) по сравнению с контрольной группой, и выражали диагностический потенциал для дифференциации групп ОГ и ХАГ от здоровых контролей (фиг. 1, 2) с AUC 0,98 (Р < 0,0001) и 0,96 (Р < 0,001), соответственно, с высокой чувствительностью и специфичностью (91,7 и 91,7% при изменении отсечки в 1,79 раза), (83,3 и 91,7% при изменении отсечки в 1,64 раза) соответственно. При AUC 0,85 cfa-miR-122 проявляет потенциальную роль (Р < 0,01) в дифференциации ОГ от группы ХАГ с чувствительностью 83,3% и специфичностью 91,7% при изменении отсечки в 6,46 раза (фиг. 3). Принимая во внимание, что cfa-miR-21 был значительно (Р < 0,001) повышен только в сыворотке крови собак в группе ХАГ (среднее кратное изменение = 10,57) и при AUC 0,99 (Р < 0,0001, при отсечении 1,51-кратного изменения) и при AUC 0,88 (Р < 0,01, при отсечении 1,84-кратного изменения) показали потенциальную роль в дифференциации группы ХАГ от контроля (фиг. 2) и групп ОГ (фиг. 4), соответственно, с высокой чувствительностью (83,3 и 100%).) и специфичность (85% и 91,7%) соответственно.The diagnostic value of differentially expressed cfa-miRNA-122 and-21 for early diagnosis and differentiation between OH and CAH and prediction of liver fibrosis in dogs with CAH with high sensitivity and specificity was determined by calculating the area under the error curve (AUC-ROC) and threshold values. to obtain the optimal percentage of sensitivity and specificity. cfa-miRNA-122 was shown to be significantly expressed in the serum of dogs with OH (mean fold change = 9.48, P < 0.001) or CAH (mean fold change = 4.94, P < 0.01) compared with the control group, and expressed the diagnostic potential for differentiating the OH and CAH groups from healthy controls (Fig. 1, 2) with AUC 0.98 (P < 0.0001) and 0.96 (P < 0.001), respectively, with a high sensitivity and specificity (91.7 and 91.7% with a cutoff change of 1.79 times), (83.3 and 91.7% with a cutoff change of 1.64 times), respectively. At AUC 0.85, cfa-miR-122 shows a potential role (P < 0.01) in differentiating OH from the CAH group with a sensitivity of 83.3% and a specificity of 91.7% with a cutoff change of 6.46 times (Fig. 3 ). Whereas cfa-miR-21 was significantly (P < 0.001) elevated only in the serum of dogs in the CAH group (mean fold change = 10.57) and at AUC 0.99 (P < 0.0001, at cut-off 1.51-fold change) and at AUC 0.88 (P < 0.01, cut-off 1.84-fold change) showed a potential role in differentiating CAH group from control (Fig. 2) and OH groups (Fig. 4 ), respectively, with high sensitivity (83.3 and 100%) and specificity (85% and 91.7%), respectively.

Чтобы доказать диагностическую ценность предложенного метода, мы исследовали сорок пять принадлежащих клиентам собак разных пород, веса тела, пола и возраста в Инновационном ветеринарном центре (ИВЦ МВА) Московской государственной академии ветеринарной медицины и биотехнологии, Москва, Россия, в период с октября 2018 г.по сентябрь 2019 г. У тридцати собак был подтвержден первичный гепатит, когда все подозреваемые случаи были представлены в нашу клинику с повышенными гепатобилиарными ферментами, аномальной эхогенностью печени при ультразвуковом исследовании, а также гистологическими аномалиями, такими как апоптоз печени и некровоспаление у собак группы ОГ или фиброз у собак группы ХАГ. Для сравнения в качестве контрольной группы случайным образом были выбраны пятнадцать здоровых собак с нормальным биохимическим анализом крови вместе с ничем не примечательными результатами ультразвукового исследования печени и гистологическими данными во время периодического осмотра. Cfa-miRNAs -122 и -21 были определены в сыворотке крови, чтобы исследовать его эффективность в качестве биомаркеров сыворотки для ранней диагностики и дифференциации ОГ и ХАГ у собак с первичным гепатитом, что облегчает раннее прогнозирование фиброза печени у собак с ХАГ до его прогрессирования в опасный для жизни цирроз печени.To prove the diagnostic value of the proposed method, we examined forty-five client-owned dogs of different breeds, body weights, sexes, and ages at the Innovative Veterinary Center (IVC MVA) of the Moscow State Academy of Veterinary Medicine and Biotechnology, Moscow, Russia, between October 2018 and 2018. to September 2019. Thirty dogs were confirmed to have primary hepatitis when all suspected cases presented to our clinic with elevated hepatobiliary enzymes, abnormal liver echogenicity on ultrasound, and histological abnormalities such as liver apoptosis and non-hemorrhage in dogs of the OG group or fibrosis in dogs of the CAH group. Fifteen healthy dogs with normal blood chemistry were randomly selected as controls for comparison, along with unremarkable liver ultrasound and histological findings at the time of periodic examination. Cfa-miRNAs -122 and -21 were determined in serum to investigate its efficacy as serum biomarkers for early diagnosis and differentiation of OH and CAH in dogs with primary hepatitis, facilitating early prediction of liver fibrosis in dogs with CAH before it progresses to life-threatening cirrhosis of the liver.

Claims (5)

Способ дифференциальной диагностики между острым гепатитом (ОГ) и хроническим активным гепатитом (ХАГ), а также раннего прогнозирования фиброза печени у собак с ХАГ, основанный на анализе экспрессии cfa-miRNA-122 и -21 в сыворотке крови собак с первичным гепатитом, а также путем выделения общего РНК из образцов сыворотки больных собак, включающий обратную транскрипцию с последующей амплификацией в RT-PCR с использованием праймеров, специфичных для собак, включая:A method for differential diagnosis between acute hepatitis (OH) and chronic active hepatitis (CAH), as well as early prediction of liver fibrosis in dogs with CAH, based on the analysis of cfa-miRNA-122 and -21 expression in the blood serum of dogs with primary hepatitis, as well as by isolation of total RNA from serum samples of sick dogs, including reverse transcription followed by amplification in RT-PCR using dog-specific primers, including: cfa-miRNA-122 5р: 5'CAAACACCATTGTCACACTCCA'3,cfa-miRNA-122 5p: 5'CAAACACCATTGTCACACTCCA'3, cfa-miRNA-21-5p: 5'TCAACATCAGTCTGATAAGCTA'3,cfa-miRNA-21-5p: 5'TCAACATCAGTCTGATAAGCTA'3, cfa-miRNA-16-5р: 5'CGCCAATATTTACGTGCTGCTA'3,cfa-miRNA-16-5p: 5'CGCCAATATTTACGTGCTGCTA'3, при этом анализы применяют в трех экземплярах для каждого образца, и полученный средний порог цикла (Ct) каждой тестируемой микроРНК нормализуют относительно среднего Ct cfa-miRNA-16 и cel-miRNA-39-3р, чтобы получить ΔCt, используют следующее уравнение: ΔCt=cfa_miRNA-0,5×(Ct cel miRNA_39+Ct miRNA_16), затем полученный ΔCt используют для определения экспрессии каждой протестированной cfa-miRNA в группах ОГ или ХАГ по сравнению с соответствующими здоровыми контролями с использованием метода 2-ΔΔCt, и при экспрессии cfa-miRNA-122≥1,79 диагностируют острый гепатит, при экспрессии cfa-miRNA-122≥1,64 и экспрессии cfa-miRNA-21≥1,51 диагностируют наличие хронического активного гепатита и фиброза печени у собак.wherein the assays are run in triplicate for each sample and the resulting mean cycle threshold (Ct) of each microRNA tested is normalized to the mean Ct of cfa-miRNA-16 and cel-miRNA-39-3p to obtain ΔCt using the following equation: ΔCt= cfa_miRNA-0.5×(Ct cel miRNA_39+Ct miRNA_16), then the resulting ΔCt is used to determine the expression of each cfa-miRNA tested in the OG or CAH groups compared to the corresponding healthy controls using the 2 -ΔΔCt method, and when cfa- miRNA-122≥1.79 is diagnosed with acute hepatitis, with cfa-miRNA-122≥1.64 expression and cfa-miRNA-21≥1.51 expression, the presence of chronic active hepatitis and liver fibrosis in dogs is diagnosed.
RU2021107768A 2021-03-23 2021-03-23 Method for differential diagnosis of acute and chronic hepatitis in dogs based on cfa-mrna expression in blood serum RU2768154C1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
RU2021107768A RU2768154C1 (en) 2021-03-23 2021-03-23 Method for differential diagnosis of acute and chronic hepatitis in dogs based on cfa-mrna expression in blood serum

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
RU2021107768A RU2768154C1 (en) 2021-03-23 2021-03-23 Method for differential diagnosis of acute and chronic hepatitis in dogs based on cfa-mrna expression in blood serum

Publications (1)

Publication Number Publication Date
RU2768154C1 true RU2768154C1 (en) 2022-03-23

Family

ID=80819306

Family Applications (1)

Application Number Title Priority Date Filing Date
RU2021107768A RU2768154C1 (en) 2021-03-23 2021-03-23 Method for differential diagnosis of acute and chronic hepatitis in dogs based on cfa-mrna expression in blood serum

Country Status (1)

Country Link
RU (1) RU2768154C1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2530157A2 (en) * 2003-07-31 2012-12-05 Regulus Therapeutics, Inc Oligomeric compounds and compositions for use in modulation of small non-coding rnas

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2530157A2 (en) * 2003-07-31 2012-12-05 Regulus Therapeutics, Inc Oligomeric compounds and compositions for use in modulation of small non-coding rnas

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DIRKSEN K. et al. Use of Serum MicroRNAs as Biomarker for Hepatobiliary Diseases in Dogs. J Vet Intern Med. 2016; 30(6): 1816-1823. *
EMAN S.R. et al. Evaluation of hepatocyte-derived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs. Veterinary World. 2018; 11(5): 667-673. *
КРАСНОЛОБОВА Е.П. Клинико-морфологические проявления гепатопатий собак в условиях города Тюмени. Автореф. дисс. канд. вет. наук. Омск, 2015, 18 c. *
КРАСНОЛОБОВА Е.П. Клинико-морфологические проявления гепатопатий собак в условиях города Тюмени. Автореф. дисс. канд. вет. наук. Омск, 2015, 18 c. DIRKSEN K. et al. Use of Serum MicroRNAs as Biomarker for Hepatobiliary Diseases in Dogs. J Vet Intern Med. 2016; 30(6): 1816-1823. EMAN S.R. et al. Evaluation of hepatocyte-derived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs. Veterinary World. 2018; 11(5): 667-673. *

Similar Documents

Publication Publication Date Title
AU2017213457B2 (en) Micro-RNA biomarkers and methods of using same
Hulanicka et al. Plasma miRNAs as potential biomarkers of chronic degenerative valvular disease in Dachshunds
US20220259658A1 (en) miRNA MARKER FOR DIAGNOSIS AND/OR TREATMENT OF ALZHEIMER&#39;S DISEASE
CN107699617B (en) A kind of early diagnosis septicopyemia causes acute kidney injury molecular marked compound miR-452, kit and application
US20190185945A1 (en) Biomarkers of Oral, Pharyngeal and Laryngeal Cancers
CA3166628A1 (en) Method for predicting the likelihood of ectopic pregnancy (ep), viable intrauterine pregnancy (viup), or non-viable intrauterine pregnancy (nviup).
RU2768154C1 (en) Method for differential diagnosis of acute and chronic hepatitis in dogs based on cfa-mrna expression in blood serum
CN106676185B (en) MiRNA (micro ribonucleic acid) spectrum of exosome in blood for predicting occurrence of individual aneurysm and detection kit
JPWO2013179672A1 (en) Method for determining endometriosis
El‐Sebaey et al. Hepatocyte‐derived canine familiaris‐microRNAs as serum biomarkers of hepatic steatosis or fibrosis as implicated in the pathogenesis of canine cholecystolithiasis
CN106987633A (en) A kind of primer and kit for detecting colorectal cancer serum secretion type lncRNAs
US20120295264A1 (en) Method for detecting ulcerative colitis
CN115418397B (en) Biomarker for auxiliary diagnosis of dilated cardiomyopathy and application thereof
Yamaura et al. Serum miR-206 as a biomarker for drug-induced skeletal muscle injury in rats
RU2758950C1 (en) Method for diagnosing hepatic pathologies in dogs using cfa-mirnas
CN114032308A (en) Use of FAM83A, KPNA2, KRT6A and LDHA in combination as a biomarker for lung adenocarcinoma
CN114196747A (en) Biomarker related to occurrence and development of metabolic-related fatty liver disease
RU2758993C1 (en) Method for non-invasive diagnosis of myocardial fibrosis in transplanted heart
RU2760093C1 (en) Method for non-invasive diagnosis of myocardial fibrosis in cardiac transplant recipients
RU2758994C1 (en) Method for diagnosing acute transplant rejection in transplanted heart recipients
US20110229882A1 (en) Diagnosing and monitoring response to treatment of solid organ tissue disease
JPWO2013099865A1 (en) ACF detection method
JP2014039484A (en) Micro-rna useful for detecting presence of nerve lesion in mammal providing sample
RU2743223C1 (en) Method of differential diagnosis of glial brain tumors
RU2758973C1 (en) Method for diagnosing acute rejection of transplant in transplanted heart recipient