RU2766707C1 - Drug for treatment of tissue fibrosis based on components of secretome of mesenchymal stromal cells, method for obtaining and applying remedy - Google Patents

Abstract

FIELD: molecular biology; cellular biology; medicine; pharmacology.

SUBSTANCE: invention relates to the field of molecular and cellular biology, medicine and pharmacology, in particular to a drug for the treatment of tissue fibrosis, a method for its preparation and a method for the treatment of fibrosis caused by tissue damage using the specified drug. The drug contains a fraction of extracellular vesicles in the secretome of mesenchymal stromal cells (hereinafter – MSC) or an isolated fraction of extracellular vesicles isolated from the secretome of MSC having surface markers HSP70, CD9, CD81 and CD63, as well as a diameter size from 20 to 420 nm, in the amount of 1-3*10^10 particles per ml. Extracellular vesicles carry special microRNA in their composition. To implement the method for obtaining the specified drug, human MSC are first cultured to 90% of confluent or monolayer in a medium that supports the growth of undifferentiated human mesenchymal cells. Then, cells are washed with a buffer solution, and MSC are conditioned in a serum-free and animal-free growth medium that supports cell viability of at least 70% and that is suitable for therapeutic use, for 2-7 days. After that, the cultivation medium containing secretion products of human MSC is selected, cell residues are removed from it, and it is purified from low-molecular components, followed by concentration using ultrafiltration. Next, the specified medium is evaluated for the content of the fraction of extracellular vesicles with surface markers, the size and number of particles per ml are determined, as well as the presence of the specified microRNA in their composition is evaluated. At the same time, 10 kDa filters are used to obtain a fraction of extracellular vesicles in human MSC secretome, and 1000 kDa filters are used to obtain an isolated fraction of extracellular vesicles isolated from MSC secretome, with an acceptable error value of no more than 5%.

EFFECT: present invention makes it possible to expand the arsenal of means that effectively suppress tissue fibrosis or prevent the development of tissue fibrosis.

28 cl, 16 dwg, 4 tbl, 10 ex

Description

The field of technology to which the invention belongs

The invention relates to medicine and pharmacology and can be used to obtain drugs and biomaterials for the treatment of tissue fibrosis, including preventing the progression and stimulating the reversal of fibrotic changes, after damage of various origins (mechanical, thermal, chemical), including pulmonary fibrosis in interstitial lung diseases and viral pneumonia.

State of the art

From the prior art (Mansouri N. et al. Mesenchymal stromal cell exosomes prevent and revert experimental pulmonary fibrosis through modulation of monocyte phenotypes // JCI insight. - 2019. - Vol. 4. - No. 21.) there is a method for obtaining exosomes using a commercial kit from human bone marrow MSCs, where isolated exosomes have surface markers CD9, CD63, the average size of exosomes was 35-150 nm, as well as a method for treating bleomycin-induced pulmonary fibrosis using the above exosomes. However, this work does not disclose information regarding the miRNA profile for the obtained exosomes and does not show the contribution of non-coding RNAs to the implementation of antifibrotic effects. In addition, obtaining bone marrow MSCs is less promising in terms of its availability and safety for the donor.

Also, a method for obtaining exosomes using the ultrafiltration method from the secretome of MSCs from adipose tissue of C57BL/6 mice is known from the prior art, where the isolated exosomes have surface markers CD9, CD63, CD81, the average size of the exosomes was 145 nm and 285 nm, as well as a method of treatment silica-induced lung fibrosis using the above exosomes (Bandeira E. et al. Therapeutic effects of adipose-tissue-derived mesenchymal stromal cells and their extracellular vesicles in experimental silicosis // Respiratory research. - 2018. - T. 19. - No. 1. - S. 1-10.). However, this work does not disclose information regarding the microRNA profile for the obtained exosomes and does not show the contribution of non-coding RNAs to the implementation of antifibrotic effects, and the presence of bimodality in the average sizes of exosomes indicates the presence of a mixture of two types of particles, which can be either a mixture of two types of extracellular vesicles and contamination when analyzing the size of exosomes.

The prior art is known for the treatment of a disease associated with fibrosis, which includes the use in an effective amount of at least one microRNA selected from the group: hsa-miR-452-3p, hsa-miR-224-3p, hsa-miR- 378i, hsa-miR-10b-5p, hsa-miR-99a-3p, hsa-miR-105-3p, hsa-miR-224-5p, hsa-miR-10b-3p, hsa-miR-338-5p, hsa-miR-767-5p, hsa-miR-196b-5p, hsa-miR-148a-3p, hsa-miR-452-5p, hsa-miR-873-5p, hsa-miR-873-3p, hsa- let-7a-3p, hsa-miR-208b-3p, hsa-miR-582-3p, hsa-miR-196a-5p, hsa-miR-99b-3p, hsa-miR-320d, hsa-let-7e- 3p, hsa-miR-183-5p, hsa-miR-532-5p, hsa-miR-30c-2-3p, novel_mirl8, hsa-miR-3529-3p, hsa-miR-3074-5p, hsa-miR- 423-5p, hsa-let-7f-l-3p, hsa-let-7c-3p, hsa-miR-378c, hsa-miR-486-5p, hsa-miR-185-3p, hsa-miR-320e, hsa-miR-182-5p, novel_mir78, hsa-miR-340-3p, hsa-miR-24-2-5p, hsa-miR-330-3p, hsa-miR-192-3p, hsa-miR-26a- 2-3p, hsa-miR-26b-3p, hsa-miR-99a-5p, hsa-miR-148b-3p, hsa-miR-374a-3p, hsa-miR-30a-3p, novel-mir32, hsa- miR-17-3p, hsa-miR-193b-5p, hsa-let-7i-5p and hsa-miR-19b-3p; also known is a method for treating a disease associated with fibrosis, which includes the use in an effective amount of at least two microRNAs selected from the group: hsa-miR-452-3p, hsa-miR-224-3p, hsa-miR-378i, hsa-miR-10b-5p, hsa-miR-99a-3p, hsa-miR-105-3p, hsa-miR-224-5p, hsa-miR-10b-3p, hsa-miR-338-5p, hsa- miR-767-5p, hsa-miR-196b-5p, hsa-miR-148a-3p, hsa-miR-452-5p, hsa-miR-873-5p, hsa-miR-873-3p, hsa-let- 7a-3p, hsa-miR-208b-3p, hsa-miR-582-3p, hsa-miR-196a-5p, hsa-miR-99b-3p, hsa-miR-320d, hsa-let-7e-3p, hsa-miR-378a-3p, hsa-miR-183-5p, hsa-miR-532-5p, hsa-miR-30c-2-3p, novel_mirl8, hsa-miR-3529-3p, hsa-miR-3074- 5p, hsa-miR-423-5p, hsa-let-7f-l-3p, hsa-let-7c-3p, hsa-miR-378c, hsa-miR-486-5p, hsa-miR-185-3p, hsa-miR-320e, hsa-miR-182-5p, novel_mir78, hsa-miR-340-3p, hsa-miR-24-2-5p, hsa-miR-330-3p, hsa-miR-192-3p, hsa-miR-26a-2-3p, hsa-miR-26b-3p, hsa-miR-99a-5p, hsa-miR-148b-3p, hsa-miR-374a-3p, hsa-miR-30a-3p, novel-mir32, hsa-miR-17-3p, hsa-miR-193b-5p, hsa-let-7i -5p and hsa-miR-19b-3p; and also known is a method for treating a disease associated with fibrosis, which includes the use of a therapeutically effective amount of exosomes obtained from the conditioned medium of hepatocytes (WO 2019043709 A1, 2017). However, the above known methods do not provide information about the characteristics of the cells from which the conditioned medium, exosomes or miRNAs are obtained, except that the cells used are primarily isolated hepatocytes. At the same time, it is known from the prior art that initially isolated cells are heterogeneous, and can also be contaminated with other types of cells (for example, resident cells of the immune system). Also, there is no information in the known technical solution, which describes that the miRNAs used in the methods are used as part of exosomes or extracellular vesicles, or as part of a pharmaceutical composition.

A composition is known from the prior art that includes two, three or four microRNAs from the group: hsa-miR-1246, hsa-miR-4492, hsa-miR-4488 and hsa-miR-4532, for the treatment of, among other things, idiopathic pulmonary fibrosis (EP 2956146 B1 (2013)). However, this technical solution does not indicate the source and method for obtaining the above miRNAs, which is critical for the implementation of the purpose, namely the treatment of fibrosis.

The prior art method for obtaining exosomes from human bone marrow MSCs using the ultracentrifugation method, where the isolated exosomes have surface markers CD63, CD81, and which contain, among other microRNAs - miR-21-5p, miR-34a-5p, miR-196a -5p, miR-199b-5p (Shentu TP et al. Thy-1 dependent uptake of mesenchymal stem cell-derived extracellular vesicles blocks myofibroblastic differentiation // Scientific reports. - 2017. - V. 7. - No. 1. - С .1-11.). However, in this work, the authors demonstrated the effect of exosomes on the transition of fibroblasts to myofibroblasts, but did not show any effect on fibrotic processes in vivo, which does not allow us to consider the described approach as an antifibrotic agent.

A pharmaceutical composition is known from the prior art, which includes polynucleotides, including those characterized by the sequences miR-143-3p UGAGAUGAAGCACUGUAGCUC (SEQ ID NO: 58) and miR-145-5p GUCCAGUUUUCCCAGGAAUCCCU (SEQ ID NO: 59), where the polynucleotides can be enclosed in exosomes secreted by immortalized cells or, among others, adipose tissue stem cells (WO 2019169380 A1, 2018). However, this technical solution does not specify the characteristics of the exosomes that include the aforementioned miRNAs, as well as the characteristics (for example, surface markers or other characteristics) of the cells from which these exosomes are obtained. From the prior art it is known that these parameters can vary significantly depending on the cells producing exosomes.

Closest to the claimed is a method for obtaining secretome , including enriched with exosomes, human bone marrow MSCs and mature lung cells, with surface markers characteristic of epithelial and mesenchymal cells, using the ultrafiltration method, where the isolated exosomes have surface markers CD9, CD63, CD81, and the average size of exosomes was 114.67 +/-2.5 nm, and which contain, among others, microRNAs - hsa-miR-10a-5p, as well as a method for the treatment of idiopathic pulmonary fibrosis using the above secretome components, including exosomes, MSCs or mature cells lungs on a model of bleomycin-induced pulmonary fibrosis (Dinh PUC et al. Inhalation of lung spheroid cell secretome and exosomes promotes lung repair in pulmonary fibrosis //Nature communications. - 2020. - V. 11. - No. 1. - P. 1 -fourteen.). Thus, among the common features of this agent with the claimed one, it is possible to distinguish similar methods for obtaining the agent (conditioning of human MSCs at 75% confluent in a serum-free medium for 3 days, enrichment with the fraction of extracellular vesicles using ultrafiltration, characterization of extracellular vesicles by size, surface markers and morphology based on the results of transmission microscopy, assessment of the composition of miRNAs in vesicles by RNA sequencing), as well as a general experimental model of bleomycin-induced pulmonary fibrosis, in which the antifibrotic effect of cell secretome was studied. However, there are a number of significant differences. First, in this work, bone marrow MSCs and mature lung cells were used, the production of which requires the use of invasive and painful methods and is less promising in terms of its availability and safety for the donor. Secondly, it is not known which medium was used for cultivating MSCs in this work and how specific it is for maintaining the properties of MSCs. It is known that the composition of the growth medium for MSCs affects the qualitative and quantitative composition of the secretome of these cells. Thirdly, the method for obtaining the conditioned medium (secretome) of MSCs included filtration through 0.22 μm filters for purification, which leads to cutoff and damage to the fraction of extracellular vesicles larger than 200 nm. Then, in this work, ultrafiltration concentration was performed using 100 kDa filters, which led to the loss of a part of extracellular vesicles of a larger size, the contribution of which to the antifibrotic effect of the secretome was not determined by the authors. In their work, Dinh et al. demonstrated the advantage of exosomes derived from the secretome of lung cells compared to bone marrow MSCs, which indicates that the effectiveness of exosome action on the target depends on the tissue specificity of exosome donor and acceptor cells. Probably, the absence of significant differences in the antifibrotic effect of MSC secretome components enriched in extracellular vesicles compared with the negative control (according to the Ashcroft scale when assessing histological changes in the lungs) is probably associated with differences in the method of secretome production. An important difference is the fact that in the work of Dinh et al., the microRNA content in extracellular vesicles was shown only by RNA sequencing, the accuracy and specificity of which is relatively low, and was not validated by PCR analysis. The contribution of certain miRNAs to the antifibrotic effects of the cell secretome has not been established in any way. In addition, Dinh et al described only an approach to the treatment of pulmonary fibrosis with a specific route of administration (inhalation) of cell secretome components, including exosomes.

The technical problem to be solved by the claimed invention is the creation of a new drug for the treatment of tissue fibrosis, aimed at preventing the development of fibrotic processes in tissues and stimulating the reversion of these processes, which has a complex effect on at least fibroblasts and myofibroblasts as key cellular mediators of fibrosis. .

Disclosure of invention

The technical result of the claimed invention is to obtain an agent that effectively suppresses tissue fibrosis or prevents the development of tissue fibrosis, in particular, the lungs, due to the balanced action of the components of the conditioned medium (CS) of human mesenchymal stromal cells (MSCs) or its individual fractions, at least extracellular vesicles, on tissue fibroblasts or myofibroblasts, in particular, fibroblasts or myofibroblasts of the lungs, which leads to a full structural and functional restoration of damaged tissues without the development of fibrotic complications, a reduction in the healing time of injuries and an increase in the quality of life of patients. The effectiveness of the agent is ensured, at least, due to the content of extracellular vesicles in the composition of the drug, containing microRNA regulating fibrotic processes (SEQ ID NO 1 - SEQ ID NO 61), suppressing the differentiation of fibroblasts induced by the profibrogenic stimulus transforming growth factor beta (TGF-beta ), and stimulating the redifferentiation of TGF-beta-activated myofibroblasts into normal fibroblasts. Unlike the prototype, the claimed invention uses adipose tissue MSCs rather than bone marrow MSCs and mature lung cells, which require invasive and painful methods and are less promising in terms of their availability and safety for the donor. It should also be taken into account that it is adipose tissue that is considered one of the main sources of extracellular vesicles circulating in the human body. Unlike the prototype, for the claimed agent, pronounced antifibrotic effects are shown both in in vitro models of fibroblast differentiation (at least two types - dermal and pulmonary) into myofibroblasts, and in animal models of pulmonary fibrosis and fibrosis in the outcome of skin wound healing.

The technical problem is solved by a method for obtaining an agent that effectively suppresses fibrosis or prevents the development of fibrosis, including the cultivation of primary human adipose tissue MSCs of 2-5 passages or linear immortalized human MSCs of 15-25 passages in a serum-free and devoid of animal products growth medium containing 1% antibiotic antimycotic, 1% glutamine, 1% pyruvate, as well as in other culture media, including those with additives that maintain cell viability of at least 90% and are suitable for therapeutic use, for 2-7 days, selection of the culture medium and its removal of debris by centrifugation at a speed of 5000 g at a temperature of +2-+6°C for 10 minutes, followed by the selection of the supernatant, its fractionation by ultrafiltration on a centrifuge or tangential ultrafiltration using filters to obtain a fraction containing extracellular vesicles of human MSCs, in a concentration of at least 1-3*10^1 0 particles per ml of fraction minus the content of particles to the background control sample, determined by tracking nanoparticles (Nanoparticle Tracking Analysis, NTA), or its fractionation and concentration by ultrafiltration in a centrifuge or tangential ultrafiltration using filters that allow obtaining a fraction depleted in the content of extracellular human MSC vesicles and enriched with soluble protein factors at a concentration not less than five times in relation to the amount of protein in the conditioned MSC medium (CS-MSC) before fractionation, which is established by methods of analyzing the content of total protein or individual proteins in the mixture, or in the form of a complete CS- MSC upon reaching a concentration not less than five times in relation to the amount of protein in CM-MSC before fractionation, which is established by methods of analyzing the content of total protein or individual proteins in the mixture. The drug can be lyophilized in 8-14 stages at a pressure of 0.013 kPa, a temperature of -40°C to -5°C, a lyophilization time of not more than 36 hours at the maximum freeze drying load, or a similar freeze drying method.

Unlike the prototype, in the claimed invention, MSCs are grown in a specific medium that supports the growth of undifferentiated human mesenchymal cells (AdvanceSTEM Cell Culture Media containing 9-11% additives to the growth medium AdvanceSTEM Stem Cell Growth Supplement, HyClone, USA) or similar, capable of supporting growth of undifferentiated MSCs for at least 5 passages for human adipose tissue MSCs and at least 25 passages for linear immortalized MSCs (hereinafter referred to as MSC growth medium). Cultivation can be carried out in culture flasks or dishes (Corning or similar), while cells are grown on a flat substrate with a starting density of 5-15*103/cm ² in a growth medium in a volume of 0.1-0.2 ml/cm ² under conditions of CO ₂ incubator at 37±1°C, 5% CO ₂ content and relative humidity ≥ 95% until reaching 90% confluent, with a complete change of medium 1 time in 3 days. To obtain CS-MSCs, cells are washed three times with Hanks' solution with a volume of 0.2 ml/cm ^{2 of} the populated surface, for at least 10 minutes at room temperature, controlling the quality of washing 1 hour after applying the serum-free conditioning medium, which is serum-free and devoid of products. animal-derived growth media containing 1% antibiotic/antimycotic, 1% glutamine, 1% pyruvate, or similar culture media, including supplements that maintain cell viability of at least 70% and are suitable for therapeutic use. In contrast to the prototype, the present invention uses a method of purification and concentration by centrifugation and further ultrafiltration using filters of 1000 kDa (with a margin of error of not more than 5%), which made it possible to maintain the maximum number of extracellular vesicles in the secretome and enrich them with the claimed agent.

The technical problem is solved by a drug for the prevention or prophylaxis of fibrotic phenomena in tissues, which has a complex effect on at least fibroblasts and myofibroblasts, contains concentrations of extracellular vesicles or proteins in amounts not less than 95% of those indicated for each type of fraction above and demonstrates a specific activity of 95% or more from the parent drug before lyophilization, which is determined by analyzing the ability of the drug to suppress the differentiation of fibroblasts induced by TGF-beta stimulation into myofibroblasts, and also to stimulate the redifferentiation of myofibroblasts obtained by induction of TGF-beta differentiation into fibroblasts, measured by immunocytochemistry, Western-Blot, PCR or similar.

Thus, the technical result is achieved due to the fact that the agent for the prevention or prophylaxis of fibrotic phenomena in tissues, which has a complex effect, at least on fibroblasts and myofibroblasts, is obtained by cultivating human MSCs in a serum-free medium devoid of animal components, with a potentially safe for clinical use with a composition that maintains cell viability during the selected conditioning period, by collecting a conditioned medium containing biologically active factors and extracellular vesicles secreted by cells into the culture medium, purifying the resulting medium and fractionating it by centrifugation and ultrafiltration and stabilizing it by lyophilization. The resulting lyophilisate, diluted in sterile saline, can be used as a drug, including in the form of inhalation or injection forms.

The effectiveness of the proposed agent implies the presence of a whole range of effects aimed at preventing or preventing fibrotic phenomena in tissues, such as the differentiation of fibroblasts into myofibroblasts. At the same time, the need to contain excessive fibrosis for the physiological restoration of damaged tissue is an urgent task. The use of human CS-MSCs will provide a comprehensive solution to the problems arising from excessive tissue fibrosis after damage of various origins, including those induced by the penetration of living and non-living foreign agents into the body. Complete tissue repair after various injuries without fibrotic complications, including by reducing the number of myofibroblasts in the tissue, can be achieved by introducing CM-MSC or its fractions containing a combination of growth factors, extracellular vesicles that carry certain microRNAs, or other biologically active components secreted by human MSCs. This solution makes it possible to obtain the optimal combination of active components of various nature secreted by human cells, which contributes to the prevention or prevention of excessive tissue fibrosis, in a medium that does not contain animal proteins and bacterial fragments, as well as to ensure a balanced effect of products secreted by cells due to the presence of products of various nature and the mechanism of action of the factors presented in different fractions of CS-MSCs.

To obtain a conditioned environment in the claimed invention, human multipotent mesenchymal stem/stromal cells (MSCs) are used, which are responsible for the repair and regeneration of tissues and organs both in normal conditions and in injuries. One of the most accessible sources of MSCs in humans is adipose tissue. MSCs can be easily isolated by enzymatic processing of adipose tissue samples obtained from cosmetic liposuction or during surgical removal of fat deposits. Cultivation of isolated AT MSCs results in a relatively homogeneous population of multipotent stromal fibroblast-like cells. It should also be taken into account that it is adipose tissue that is considered one of the main sources of extracellular vesicles circulating in the human body.

In the claimed invention, MSCs obtained independently by any method known from the prior art (for example, from surgical biopsies, lipoaspirate, etc.) can be used, as well as in the form of commercial preparations of MSCs that have a quality certificate and are intended, including for clinical use. applications, such as the ATCC product (ATCC® PCS-500-011), which is human MSCs isolated from lipoaspirate, cultured up to 2 passages and subjected to cryopreservation, or similar, in particular immortalized human adipose tissue MSC lines (ATCC® SCRC -4000™).

Previously, in models of bleomycin-induced pulmonary fibrosis, it was shown that local administration of CM-MSC enriched in extracellular vesicles contributed to the resolution of fibrosis. Thus, mice that were injected with CM-MSC enriched in extracellular vesicles showed a better condition compared to control animals. In the pulmonary fibrosis prevention model, mice injected with CM-MSC enriched in extracellular vesicles also showed better condition compared to control animals. According to the data of our studies and the works of other scientific teams, the main mechanism underlying the antifibrotic effect of MSCs is the production by these cells of a wide range of biologically active components of various nature, acting both individually and as part of extracellular vesicles, and contributing to a balanced restoration of damaged tissue. Unlike the prototype, the present invention presents the antifibrotic effects of the MSC secretome components in different models of fibrosis and with different routes of administration, and for pulmonary fibrosis, data are presented on the effectiveness of not only treating fibrosis of the lung tissue, but also preventing the development of fibrosis, which may be necessary for prevention of the development of fibrotic complications of interstitial pneumonia, including viral ones, including coronavirus infections.

Most protocols for isolating and culturing adipose tissue MSCs use a medium supplemented with fetal calf serum (FES) or fetal bovine serum (FBS). These serums contain an essential cocktail of growth factors, hormones and vitamins to promote cell adhesion and proliferation under in vitro culture conditions. At the same time, more and more information is accumulating that cells grown using animal sera are potentially unsafe, in particular, there is a risk of infection with prions or viruses in cell cultures when cultured using animal sera, as well as the possibility of an immune response from the recipient's body. . In addition, it was shown that long-term cultivation in the presence of PBS significantly changes the properties of cells of various origins. Thus, bone marrow mesenchymal cells cultured in the presence of PBS are characterized by transcriptome instability, including changes in the expression of genes responsible for cell cycle regulation, apoptosis, and cell adhesion.

A distinctive feature of the claimed invention is the use of a specialized medium that supports the growth and functional properties of undifferentiated human MSCs at the stages preceding MSC conditioning: AdvanceSTEM Cell Culture Media (HyClone, USA) with the addition of a solution of antibiotics Penicillin-Streptomycin (HyClone, USA) and additives to the medium growth of AdvanceSTEM Stem Cell Growth Supplement (HyClone, USA), which are taken at the following ratio of components, vol.%:

AdvanceSTEM Cell Culture Media - 89-91;

Antibiotic solution Penicillin-Streptomycin - 0.95-1.05;

Additives to the growth medium AdvanceSTEM Stem Cell Growth Supplement - 9.5-10.5.

MSCs are isolated from human subcutaneous adipose tissue and cultured in the growth medium prepared according to the above scheme up to passage 4-5, or a line of immortalized MSCs 15-25 passages is used. Then the cells are thoroughly washed from the components of the growth medium with Hanks' solution (PanEco or similar) and placed in a serum-free and animal-free growth medium, as the latter, DMEM with a low glucose content (HyClone, USA) or another growth medium that maintains the viability of MSCs is used. human (not less than 70%) during the entire period of conditioning and suitable for therapeutic use. The specified cell conditioning medium is added in a volume of 0.1-0.2 ml/cm ² and cultured in a CO ₂ incubator at 37+1°C, 5% CO ₂ content and relative humidity ≥ 95% for 2- 7 days. CM-MSC containing all human MSC secretion products is collected in sterile centrifuge containers, cell debris is removed by centrifugation, and the resulting supernatant is subjected to concentration or fractionation, followed by concentration using tangential filtration or ultrafiltration on centrifuge filters. With the use of appropriate equipment and aseptic conditions, it is possible to obtain a sterile product of KS-MSC, as well as its individual fractions. The resulting product for storage can be subjected to lyophilization to obtain the final product (lyophilizate of the conditioned medium containing the secretion products of human MSCs, or its individual fractions), which contains, among other things, key biologically active components, according to which the standardization of the final product is carried out. Thus, the detected concentrations of extracellular vesicles or proteins should not be less than 95% of those indicated for each type of fraction before lyophilization, and specific activity should be present at 95% or more from the initial fraction of the product before lyophilization, which is established by analyzing the ability of the drug to suppress differentiation fibroblasts induced by TGF-beta stimulation into myofibroblasts, as well as stimulate the redifferentiation of myofibroblasts obtained by induction of TGF-beta differentiation into fibroblasts, measured by immunocytochemistry, Western-Blot, PCR or the like.

Another technical feature of the claimed invention is the ability not only to concentrate, but, if necessary, to simultaneously purify the conditioned medium using the Minim II tangential flow filtration system (Life Sciences, USA) or similar, using ultrafiltration cassettes (Minimate TFF capsule, PALL) or similar, as well as using centrifuge filters (Vivaspin, Sartorius) or similar, which can significantly increase the purity of the obtained fractions and get rid of undesirable components of the medium, in particular, antibiotics. In contrast to the prototype, for which the method for obtaining a conditioned medium (secretome) of MSCs included filtration through 0.22 μm filters for purification, which leads to cutoff and damage to the fraction of extracellular vesicles larger than 200 nm, and concentration by ultrafiltration was carried out using filters on 100 kDa, which led to the loss of a part of extracellular vesicles of a larger size, the contribution of which to the antifibrotic effect of the secretome was not determined by the authors, in the present invention, a purification and concentration method was used by centrifugation and further ultrafiltration using a 1000 kDa filter (with a margin of error not more than 5%), which made it possible to preserve the maximum number of extracellular vesicles in the secretome and enrich the claimed agent with them. In addition, in the description of the prototype, its antifibrotic effects after all stages of processing have not been tested in any in vitro models, and statistically significant efficacy in an animal model of pulmonary fibrosis has not been shown (for bone marrow MSCs).

In specific examples, microRNAs included in the extracellular vesicles and/or conditioned medium for the treatment of tissue fibrosis can be represented by one or more miRNAs, characterized by the sequences of SEQ ID NO: 1-61. Unlike the prototype, in which the content of some microRNAs in extracellular vesicles is shown only by RNA sequencing, the accuracy and specificity of which is relatively low, and has not been validated using PCR analysis, and the contribution of certain microRNAs to the antifibrotic effects of cell secretome has not been established in any way, in the present The invention presents data on the validation of the representation of fibrosis-associated miRNAs in extracellular vesicles as part of the MSC secretome and provides data on a direct assessment of the contribution of individual microRNAs to the implementation of the antifibrotic effects of the MSC secretome.

As a result of the implementation of this invention, a drug based on human MSC secretion products is obtained, which can be used as a drug for the treatment of tissue fibrosis, including preventing the progression and stimulating the reversal of fibrotic changes, after damage of various origins, which has a complex effect, at least on fibroblasts and myofibroblasts. At the same time, fibrosis can be caused by mechanical, chemical or thermal damage to tissues; or develops as a result of viral pneumonia, in particular caused by coronaviruses; or develops as a result of occupational lung diseases.

Brief description of the drawings

The invention is illustrated by the following drawings.

In FIG. 1 shows the characterization of extracellular vesicles (EV-MSCs) released from mesenchymal stromal cells (MSCs) after 48 hours of conditioning. Positions in figure 1 indicate: 1 - Particle size distribution of explosives: in the sample (red) and in the control aliquot of CS-MSC after 30 min of conditioning (gray) for non-concentrated (A) and 5-fold concentrated (B) samples measured with using the nanoparticle trajectory analysis (NTA) method, 2 - Image of BB-MSCs (BBs are indicated by arrows), transmission electron microscopy, 3 - Expression of vesicular markers in the sample of BB-MSCs and MSC lysate, Western blot.

In FIG. 2 are images illustrating the ability of fibroblasts to capture BB-MSCs. Immunofluorescence analysis (BB + siRNA - FAM (green), PKH26 (red), DAPI (blue)). Positions in figure 2 indicate: 1 - Images obtained using wide-field microscopy, 2 - Image obtained using confocal microscopy, 3 - Image obtained using confocal microscopy, sagittal section.

In FIG. 3 is a graph illustrating the ability of BB-MSCs added simultaneously with TGFβ to prevent TGFβ-induced increase in alpha-actin expression in fibroblasts. Analysis of expression in cultured control fibroblasts without serum (- TGFβ), in fibroblasts after exposure to TGFβ (+ TGFβ), TGFβ with BB-MSCs (+ TGFβ + BB-MSCs) and TGFβ with RF-MSCs (+ TGFβ + RF-MSCs) . Positions in figure 3 are: - RT-PCR, alpha-actin (n = 9), 2 - Western blot, alpha-actin (n = 3). The columns indicate the median values for each factor. Planks are limited to the 25th and 75th percentiles. The levels of significance of the differences are shown above the bars. The groups were compared using the Mann-Whitney U-test.

In FIG. 4 are photographs illustrating the ability of BB-MSCs added simultaneously with TGFβ to prevent TGFβ-induced stress fibril formation in fibroblasts. Immunofluorescence analysis (alpha-actin (green), phalloidin (red), DAPI (blue)) of alpha-actin content in cultured control fibroblasts without serum (- TGFβ), in fibroblasts after exposure to TGFβ (+ TGFβ), TGFβ with BB-MSCs (+ TGFβ + BB-MSC) and TGFβ with RF-MSC (+ TGFβ + RF-MSC).

In FIG. 5 are photographs illustrating the ability of BB-MSCs added simultaneously with TGFβ to prevent TGFβ-induced focal junction formation in fibroblasts. Immunofluorescent analysis (vinculin (green), phalloidin (red), DAPI (blue)) of vinculin content in cultured control fibroblasts without serum (- TGFβ), in fibroblasts after exposure to TGFβ (+ TGFβ), TGFβ with BB-MSCs (+ TGFβ + BB-MSC) and TGFβ with RF-MSC (+ TGFβ + RF-MSC).

In FIG. 6 presents data illustrating the ability of BB-MSCs added simultaneously with TGFβ to prevent TGFβ-induced increase in type I collagen expression in dermal fibroblasts and reduce their contractile activity. Analysis of collagen expression in cultured control fibroblasts without serum (- TGFβ), in fibroblasts after exposure to TGFβ (+ TGFβ), TGFβ with BB-MSC (+ TGFβ + BB-MSC) and TGFβ with RF-MSC (+ TGFβ + RF-MSC ). Positions in figure 6 are marked: 1 - RT-PCR, type I collagen (n=9). The columns indicate the median values for each factor. Planks are limited to the 25th and 75th percentiles. 2 - Collagen gel contraction, plot (n=3), data displayed as mean ± standard deviation (SD). 3 - Collagen gel contraction, representative macrophotographs. The black contour is the border of the hole, the red one is the size of the collagen disk. The levels of significance of the differences are shown above the bars. The groups were compared using the Mann-Whitney U-test.

In FIG. 7 are photographs illustrating the ability of BB-MSCs added simultaneously with TGFβ to prevent TGFβ-induced stress fibril formation and increase in alpha-actin and type I collagen expression in lung fibroblasts. A - Immunofluorescent analysis (alpha-actin (green), phalloidin (red), DAPI (blue)) of alpha-actin content in cultured control fibroblasts without serum (- TGFβ), in fibroblasts after exposure to TGFβ (+ TGFβ), TGFβ with BB -MSC (+ TGFβ + BB-MSC), TGFβ with RF-MSC (+ TGFβ + RF-MSC) and TGFβ with KS-MSC (+ TGFβ + KS-MSC). B - RT-PCR, alpha-actin (n=3), data are displayed as mean ± standard deviation (SD). C - B - RT-PCR, type I collagen (n=3), data are displayed as mean ± standard deviation (SD). The levels of significance of the differences are shown above the bars. The groups were compared using the Mann-Whitney U-test.

In FIG. 8 presents data illustrating the ability of BB-MSCs added to myofibroblasts to stimulate their dedifferentiation into fibroblasts. Analysis of expression in cultured control myofibroblasts after addition of DMEM control medium (TGFβ -> DMEM), in fibroblasts after exposure to BB-MSCs (TGFβ -> BB-MSCs) and RF-MSCs (TGFβ -> RF-MSCs). Positions in figure 8 indicate: 1 - Western blot, alpha-actin (n = 3), The columns indicate the median values for each factor. Planks are limited to the 25th and 75th percentiles. 2 - Immunocytochemical analysis. Scale bar - 100 µm. 3 - Collagen gel contraction, plot (n=3), data displayed as mean ± standard deviation (SD). 4 - Collagen gel contraction, representative macrophotos. The black contour is the border of the hole, the red one is the size of the collagen disk. The levels of significance of the differences are shown above the bars. The groups were compared using the Mann-Whitney U-test.

In FIG. 9 presents data illustrating the analysis of the RNA profile in VV-MSCs by RNA sequencing. Positions in figure 9 denoted 1 - Different types of RNA, presented in BB-MSCs. The miRNA cluster is marked with a red oval. 2 - Variability of miRNA representation in donor BB-MSCs obtained from adipose tissue according to the Venn diagram. 3 - The most common miRNAs in BB-MSCs (top 10). 4 - Representation of miRNAs associated with fibrosis in BB-MSCs based on the analysis of their predicted target gene.

In FIG. 10 presents data illustrating that extracellular vesicles stimulate resolution of pulmonary fibrosis in a mouse model of bleomycin-induced lung fibrosis. The analysis was performed in groups after the addition of control medium DMEM (DMEM) or the introduction of BB-MSC 1 day or two weeks after the administration of bleomycin. Positions in figure 10 are marked 1 - Results of clinical examination. 2 - Results of the study of bronchoalveolar lavage. 3. MRI results.

In FIG. 11 are photographs illustrating that extracellular vesicles stimulate resolution of lung fibrosis in a mouse model of bleomycin-induced lung fibrosis. The analysis was performed in groups after the addition of control medium DMEM (DMEM) or the introduction of BB-MSC 1 day or two weeks after the administration of bleomycin. Positions in figure 11 are marked: 1 - introduction after 1 day. 2 - introduction after 14 days. A - Van Gieson staining. B - staining according to Verkhgof.

In FIG. 12 are photographs illustrating that conditioned MSC media promote wound healing in a mouse deep skin wound model. Hematoxylin-eosin staining. The analysis was carried out in groups on the 3rd day after application to the wound of the reference drug Levomikol (A), the control medium DMEM (DMEM) (B) or the introduction of KS-MSC (C). Insets are marked: G - Clusters of fibroblasts. D - Beginning of angiogenesis.

In FIG. 13 are photographs illustrating that conditioned MSC media promote wound healing in a mouse deep skin wound model. Hematoxylin-eosin staining. The analysis was carried out in groups on the 7th day after application to the wound of the reference drug Levomikol (A), the control medium DMEM (DMEM) (B) or the introduction of KS-MSC (C). The inset shows: G - Migration of fibroblasts to the wound area.

In FIG. 14 are photographs illustrating that conditioned MSC media promote wound healing in a mouse deep skin wound model. Hematoxylin-eosin staining. The analysis was carried out in groups on the 14th day after application to the wound of the reference drug Levomikol (A), the control medium DMEM (DMEM) (B) or the introduction of KS-MSC (C). Marked on the inset: G - Angiogenesis.

In FIG. 15 are photographs illustrating that MSC conditioned media promotes scarless wound healing in a mouse deep skin wound model. Macro photos. The analysis was carried out in groups on the 21st day after application to the wound of the reference drug Levomikol (A), the control medium DMEM (DMEM) (B) or the introduction of KS-MSC (C).

In FIG. 16 are photographs illustrating that MSC conditioned media stimulates scarless wound healing and skin derivative formation in a mouse deep skin wound model. Hematoxylin-eosin staining. The analysis was carried out in groups on the 21st day after application to the wound of the reference drug Levomikol (A), the control medium DMEM (DMEM) (B) or the introduction of KS-MSC (C). Marked on the inset: D - Derivatives of the skin.

Implementation of the invention

Below is a more detailed description of the claimed invention. The present invention may be subject to various changes and modifications, clear to a person skilled in the art based on reading this description. Such changes do not limit the scope of claims.

Example 1 Obtaining human adipose tissue MSCs (AT MSCs)

MSCs are isolated from the subcutaneous fat of healthy donors of both sexes. Cells are isolated from material obtained during minimally invasive surgery under local anesthesia or during elective surgical operations. Surgical material (15 g of adipose tissue taken from the umbilical region or other area of subcutaneous fat localization) is placed in a disposable tube with HBSS buffer (HyClone) containing a 5-fold concentration of the antibiotic penicillin-streptomycin 500 units/ml (HyClone). Under sterile conditions of the culture box, the biopsy specimen is fragmented to a homogeneous mass using sterile instruments, after which it is subjected to enzymatic treatment in a solution containing AdvanceSTEM medium (HyClone) / 500 U / ml of the antibiotic penicillin-streptomycin (HyClone), 200 U / ml of type I collagenase and dispase (40 units/ml) (Worthington Biochemical) (the ratio of the volume of enzymes and fat should be 1:1:1), at 37°C for 30-45 minutes with constant stirring. At the end of the incubation, an equal volume of MSC growth medium is added to the sample and filtered through nylon membranes with a pore size of 100 μm (BD). The filtered suspension is centrifuged for 5 min at 200g, after which the supernatant is completely removed. The cell pellet is treated with erythrocyte lysis buffer (BD) until the solution turns red, and then centrifuged for 5 min at 200g. The supernatant is completely removed, and the precipitated cells are resuspended in the MSC growth medium. Mesenchymal cells are cultured using AdvanceSTEM support expansion and maintenance of undifferentiated human MSCs (HyClone) in combination with 10% AdvanceSTEM Stem Cell Growth Supplement (HyClone) and 100 U/mL antibiotic (HyClone). This medium was developed by the manufacturer (HyClone) for the cultivation of undifferentiated MSCs, in particular cells derived from adipose tissue, without the addition of serum (http://www.thermo.com).

Selected resuspended MSCs are seeded at a concentration of 200 thousand ml in Petri dishes and cultivated in growth medium in an incubator at 37°C and at 5% CO ₂ concentration. Upon reaching 80% of the monolayer of MSCs in the adipose tissue, the cells are passaged 1:4.

Example 2. Obtaining conditioned medium MSCs from human adipose tissue

To obtain a conditioned medium, AT MSCs are increased to 2-5 passages. Human AT MSCs are added in an amount of 5-15*10 ³ /cm ² to culture containers for growing eukaryotic cells, after attachment, culture vessels with cells are washed with Hanks saline solution (Paneko, Russia) (in an amount of 0.1-0.2 ml / cm ² three times for 10 minutes) and fill them with fresh growth medium for conditioning in the amount of 0.1-0.2 ml/cm ² . As the latter, a universal growth medium for different cell types DMEM with Low Glucose (HyClone, USA) is used, with the addition of a solution of antibiotics Penicillin-Streptomycin (HyClone, USA) (1.00±0.05 ml per 100±5 ml of medium). The cells are then cultured in a CO ₂ incubator at 37+1° C., 5% CO ₂ and ≥ 95% relative humidity for 2 days.

As culture containers for growing eukaryotic cells, culture flasks or Petri dishes (Corning or similar) are used, while the cells are grown on a flat substrate with a density of 5-15*10 ³ /cm ² .

The conditioned medium containing all secretion products of human AT MSCs is collected in sterile containers for centrifugation, centrifuged at 300 g (5000±10) rpm, temperature (6±2)°C, for 10 minutes to remove cell debris. The resulting supernatant is taken into new sterile containers with a volume of 100 μl - 50 ml.

Example 3. Obtaining the conditioned medium of human adipose tissue MSCs enriched in the fraction of extracellular vesicles

A fraction of the conditioned medium enriched in extracellular vesicles is obtained using a Minim II tangential flow filtration system (Life Sciences) using ultrafiltration cassettes (Minimate TFF capsule, PALL, USA, 10 kDa) or similar. To do this, the supply reservoir is filled with 100 ml of conditioned medium. The pump capacity is set at the level of 90-120 ml/min, the pressure is not more than 2 atmospheres, the filtrate flow rate is not more than 20-30 ml/min. Carry out 1 round of cleaning, replenishing the volume by adding Hank's solution to the supply reservoir. After that, the pump is turned off, the return hose is transferred to a vessel for collecting the purified solution, the pump is turned on and the supply tank is drained. To displace the remains of the purified medium, Hanks' solution is added to the supply tank, the pump is turned on, and the purified medium is collected under visual control until the entire solution leaves the system.

Amicon centricons (10 kDa, 50 ml, Sigma, Italy) or their analogs can also serve as an analogue of the Minim II tangential flow filtration system (Life Sciences). To remove low molecular weight components, the conditioned medium is transferred to the upper tank of the centricon. After that, the centricon is placed in a pre-chilled centrifuge (6 ± 2) ° C and centrifuged at a speed of 3000 g ± 500 g for 10-60 minutes until the minimum volume of medium (200 ± 50 μl) remains in the upper reservoir. After that, the concentrated purified conditioned medium is brought to its previous volume by adding DMEM with Low Glucose (HyClone, USA), with the addition of Penicillin-Streptomycin antibiotic solution (HyClone, USA) (1.00±0.05 ml per 100±5 ml of medium).

Amicon centricons (1000 kDa, 50 ml, Sigma, Italy) or their analogs are used to obtain a conditioned medium enriched in the fraction of extracellular vesicles. For concentration, the purified conditioned medium is transferred to the top tank of the centricon. After that, the centricon is placed in a pre-chilled centrifuge (6±2)°C and centrifuged at a speed of 3000 g ± 500 g for 10-60 minutes until the minimum volume of medium (100±50 µl) remains in the upper reservoir. After that, the concentrated purified conditioned medium enriched in the fraction of extracellular vesicles is adjusted to the required volume by adding DMEM with Low Glucose (HyClone, USA), with the addition of Penicillin-Streptomycin antibiotic solution (HyClone, USA) (1.00±0.05 ml per 100 ±5 ml of medium).

Example 4. Methods for assessing the quality of the conditioned medium of MSCs enriched with extracellular vesicles

Evaluation of the content of extracellular vesicles (EV) in concentrated conditioned adipose tissue MSCs is carried out by the following methods. The characterization of BB-MSCs was performed using a method that allows analyzing the trajectories of nanoparticles (Nanoparticle tracking analysis, NTA, see item 1 below), transmission electron microscopy (TEM, see item 2 below) and Western blot analysis (see below item 3). Thus, according to the results of the analysis, explosives isolated by ultrafiltration showed a round or cup-shaped shape with an average diameter of about 114 nm (size range from 10 to 490 nm). The number of particles is not less than 3.12±0.5×10 ⁹ particles/ml of non-concentrated CS-MSC and not less than 1.53±0.2×10 ¹⁰ particles/ml of 5-fold concentrated CS-MSC. Western blot analysis of exosomal markers showed that the samples were positive for typical exosomal markers including HSP70, CD9, CD81 and CD63 (FIG. 1).

one. Nanoparticle Trajectory Analysis (NTA)

To determine the size and shape of particles contained in the conditioned medium of MSCs enriched with extracellular vesicles, the nanoparticle trajectory analysis method was used using a Nanosight LM10 instrument (Nanosight Ltd., UK) or similar.

NTA characterization of explosives was performed using a Nanosight LM10 (Nanosight Ltd., UK) equipped with a 405 nm, 65 mW laser with passive temperature reading and a highly sensitive Andor Luca EMCCD type camera. All measurements were performed in accordance with the recommendations of ASTM E2834-12 [ASTM E2834-12(2018), Standard Guide for Measurement of Particle Size Distribution of Nanomaterials in Suspension by Nanoparticle Tracking Analysis (NTA); ASTM International: West Conshohocken, PA, USA, 2018, doi:10.1520/E2834-12R18] using the protocol [Silachev, DN; Goryunov, KV; Shpilyuk, M.A.; Beznoschenko, OS; Morozova, NY; Kraevaya, EE; Popkov, V.A.; Pevzner, I. B.; Zorova, L.D.; Evtushenko, EA; et al. Effect of MSCs and MSC-Derived Extracellular Vesicles on Human Blood Coagulation. Cells 2019, 8 , 258, doi:10.3390/cells8030258], optimized for BB for a specific Nanosight instrument configuration. Due to the weak fluorescent background of CM-MSCs, minor adjustments were made to the lower and higher thresholds (910 and 10920 instead of 715 and 10725, respectively).

Since EVs are not the only particles that can be detected by NTA even in serum-free conditioned medium, two types of samples were analyzed by NTA: CM-MSC aliquots after 30 min incubation with fresh serum-free medium (DMEM LG) and in the subsequent 48 h incubation. The sample after 30 min of incubation with cells served as a control for random particles in the medium before the release of the explosive. Both unconcentrated and concentrated CM-MSC samples were analyzed.

Each sample was measured in 16–20 repetitions to achieve a total number of measured trajectories of at least 5000 pcs. The sizes and concentrations of particles from individual measurements were summarized in a single table, for which a histogram of particle size distribution was built with a step of 20 nm and the average size and total concentration of all particles were calculated. Confidence intervals for measuring the average size and concentration were calculated from the values for individual measurements using Student's statistics with 95% two-sided probability (Glantz S. Medical and biological statistics. - M .: Practice, 1998. - 459 p.)

2. Transmission electron microscopy (TEM)

To determine the size and shape of the particles contained in the conditioned medium of MSCs enriched with extracellular vesicles, the method of transmission electron microscopy was used using a JEOL JEM-1011 TEM with an ORIUS SC1000W digital camera or analogues. TEM imaging was performed on HF-MSCs deposited on carbon-coated grids, glow-discharged with an Emitech K100X in air and stained with 1% uranyl acetate solution twice for 30 s. Images were taken at 80 kV using a JEOL JEM-1011 TEM with an ORIUS SC1000W digital camera.

3. Western blotting

Analysis of protein markers characteristic of extracellular vesicles was performed using Western blotting using a set of antibodies for detection of the corresponding marker proteins (HSP70, CD81, CD63, CD9; EXOAB-KIT-1, System Biosciences, USA) or similar. For this purpose, the explosive pellet was lysed in Lamley's buffer. The amount of protein in the lysate was determined using the amide black protein analysis method. Samples were subjected to SDS-PAGE gel electrophoresis and transferred to a PVDF membrane. The membrane was incubated with primary antibodies to extracellular vesicle markers (HSP70, CD81, CD63, CD9; EXOAB-KIT-1, System Biosciences, USA) overnight at 4°C. After washing in TBST, blots were incubated with secondary antibodies labeled with peroxidase (HRP) (P-RAM Iss, P-RAQ Iss, Imtek, Russia) for 1 hour. Labeled proteins were visualized using a ChemiDoc™ Touch imaging system (Bio-Rad Laboratories, USA) using an enhanced chemiluminescence (ECL) kit (Pierce, USA).

Example 5. Method for assessing the absorption of particles of the conditioned medium of MSCs enriched with extracellular vesicles, fibroblasts in vitro

In order to find out whether BB-MSCs can be absorbed by the cells under study, extracellular vesicles were used, into which a fluorescent oligonucleotide was loaded according to the method described below, which is a short nucleotide sequence (14-22 base pairs) connected with a fluorescent dye. Such extracellular vesicles were added to human skin fibroblasts whose membranes were labeled with the lipophilic dye pkh26 (Sigma) (Basalova et al., 2020). After 48 hours, the accumulation of particles in the cells was observed using wide-field and confocal microscopy.

So, after 12 hours, individual green fluorescent clusters begin to appear in the cells, and after 24-48 hours of incubation of cells with BB-MSCs, wide-field microscopy showed that most cells (78 ± 7%) accumulate extracellular vesicles in the perinuclear zone.

In order to make sure that the EVs were indeed taken up by the cells and not adhered to the membrane surface, the cell culture was analyzed after 48 hours using confocal microscopy. It was shown that the signal from extracellular vesicles is indeed localized in the perinuclear zone under the cell membrane, which indicates the ability of the fibroblast cell culture to capture EVs (Fig. 2).

Transfection of BB-MSCs with labeled oligonucleotides

BB-MSCs were transfected using an Exo-Fect™ Exosome Transfection Kit (EXFT20A-1, System Biosciences) or similar. The protocol described in the manufacturer's instructions was used. To detect uptake of BB-MSCs by target cells, BB-MSCs were transfected with FAM-labeled mimic (fluorescein) (miRCURY LNA miRNA mimic negative control (YM00479902-ADB), Qiagen). For this, 10 µl of Exo-Fect solution, 20 µl of FAM-labeled mimic (20 pmol), 70 µl of sterile PBS, and 50 µl of a concentrated suspension of BB-MSCs were mixed under sterile conditions of a laminar flow hood. The resulting mixture was stirred by inverting the tube three times, incubated at 37°C for 10 min, and then the reaction was stopped by moving the tube to ice and adding ExoQuick ^TC polymer in a volume of 30 μl. The resulting mixture was stirred by inverting the tube 6 times. After further incubation at 4°C for 30 min with polymer, the transfected BB-MSCs were centrifuged at 13,000 rpm for 10 min and dissolved in DMEM LG (Gibco) supplemented with 1% penicillin-streptomycin (Gibco) to a concentration of 5× and added to the studied cells.

Uptake of BB-MSCs transfected with FAM-labeled oligonucleotides (Qiagen) by PKH26-labeled fibroblasts (PKH26GL, Sigma) at 4, 8, 24 and 48 hours was assessed using wide-field and confocal microscopy (Leica TCS SP5). Dermal fibroblasts after incubation with unlabeled BB-MSCs were used as a negative control.

PKH26GL cell culture labeling

Human dermal fibroblast cell culture was washed twice with Hanks solution for 5 minutes and fixed in 4% paraformaldehyde on PBS for 7 minutes under traction.

2 ml of Diluent C (CGLDIL, Sigma, USA) was taken into a clean polypropylene tube and 4 µl of PKH26 solution (P9691, Sigma, USA) was immediately added, the mixture was vortexed for 10 sec. The resulting solution was added to the fixed cells in a volume sufficient to cover the surface. Incubated 1-5 minutes. After incubation, the PKH26 solution was removed and a 1% BSA solution in PBS was added for 1 minute to inhibit the reaction. The BSA solution was removed and then PBS was added for further microscopy.

Example 6 . Methods for assessing the ability of conditioned MSC medium enriched with extracellular vesicles to suppress fibroblast differentiation into myofibroblasts and induce myofibroblast dedifferentiation into fibroblasts in vitro

To study the ability of extracellular vesicles of MSCs (EV-MSCs) to influence the differentiation of fibroblasts into myofibroblasts, an EV-enriched fraction was isolated from the conditioned medium of MSCs (KS-MSCs) and its effect on the previously developed in vitro model of TGFbeta-induced differentiation of dermal fibroblasts was evaluated ( DF) under serum-free conditions (Basalova et al., 2020).

It is known that one of the key signs of fibroblast differentiation into myofibroblasts is an increase in the expression of smooth muscle alpha actin and its incorporation into stress fibrils. As shown earlier, the addition of TGFbeta alone caused an increase in the synthesis of alpha-actin and its incorporation into microfilaments, which contributed to the acquisition of the myofibroblast phenotype by these cells. However, the addition of BB-MSCs to cells prevented the increase in alpha-actin mRNA in DF caused by TGFbeta. Moreover, the use of the BB-MSC fraction resulted in a decrease in alpha-actin mRNA below the level observed in the negative control group (0.6±0.05, p<0.05). The addition of a fraction of soluble factors of MSC secretome (RF-MSC) also led to a significant decrease in the expression of alpha-actin mRNA (0.8±0.03, p<0.05)

The introduction of TGFbeta increased the level of alpha-actin protein by more than 2 times in DF compared with the negative control group (2.9±0.1 versus 1.13±0.03, p<0.05). Whereas the addition of RF-MSC or BB-MSC caused a decrease in the level of expression of this protein (0.4±0.13 and 0.25±0.15 versus 1.13±0.03, p<0.05) even below the level observed in the control cells (Fig. 3).

It should be noted that the addition of RF-MSCs and BB-MSCs to the culture also prevented morphological changes in DF caused by TGFbeta. Thus, TGFbeta contributed to the formation of stress fibrils and the inclusion of alpha actin in their composition. Simultaneous addition of the BB-MSC enriched fraction together with TGFbeta inhibited the formation of stress fibrils and incorporation of alpha-actin into them (Fig. 4).

Another important feature of the contractile phenotype of myofibroblasts is the presence of a large number of focal contacts. Incubation of cells with TGFβ causes a partial intracellular redistribution of vinculin and its localization in the zone of focal contacts. In cells, which simultaneously with TGFβ were added with CS-MSC fractions, both containing soluble factors and a fraction enriched in extracellular vesicles, vinculin was not redistributed and this protein was predominantly localized in the perinuclear zone. This intracellular distribution of vinculin was also observed in cells not treated with TGF-β (FIG. 5).

To test the hypothesis that the factors contained in the conditioned medium of MSCs can affect the differentiation of fibroblasts, in vitro tests were used that reflect the functional activity of myofibroblasts - the ability to overproduce the extracellular matrix and its contraction.

The effect of MSC secretome on the expression of type I collagen by myofibroblasts was analyzed. It was shown that the addition of a fraction of KS-MSC containing soluble factors and a fraction enriched in extracellular vesicles tended to decrease the content of type I collagen mRNA (Fig. 6).

We also evaluated the effect of CM-MSC fractions on the ability of myofibroblasts to contract the collagen gel. It was shown that myofibroblasts, whose differentiation was induced by the addition of TGFβ, contracted collagen gel by more than 4 times compared with control cells (contractile activity 87.7±1.4% vs. 48.3±14.6%, p<0.05). In contrast, cells that received CM-MSC fractions simultaneously with TGFβ had a reduced ability to contract collagen gel (37.1±7.7% for BB-MSC and 23.1±4.1% for RF-MSC, p<0.05) (Fig. 6).

Thus, the data obtained indicate that the components of the MSC secretome, both extracellular vesicles and soluble factors, are able to suppress the functional activity of myofibroblasts.

In a lung fibroblast differentiation model, when comparing CM-MSC fractions enriched in BB, RF, or both fractions together, it was shown that the addition of BB-MSC to cells prevented an increase in alpha-actin mRNA in lung fibroblasts caused by TGFbeta, reducing its amount by 4, 3 times compared to the positive control group. The addition of the RF-MSC fraction also led to a significant decrease in the expression of alpha-actin mRNA by 1.5 times. The most effective for the inhibition of differentiation was the addition simultaneously with TGFbeta of a fraction containing two types of components - BB-MSCs and RF-MSCs; when these components were added, mRNA expression decreased by 20.9 times compared with the positive control group. Similar results were obtained when assessing the expression of collagen type 1 mRNA (Fig. 7).

One of the negative consequences of fibroproliferative diseases is the accumulation of cells with the morphology and function of fibroblasts. For effective therapy, it is necessary to find a way that causes dedifferentiation of myofibroblasts.

Using immunoblotting, it was found that the addition of CS-MSC fractions to myofibroblasts, both containing soluble factors and a fraction enriched in extracellular vesicles, caused a decrease in the content of alpha-actin in cells by more than 2 times compared to differentiated myofibroblasts.

Using immunofluorescent staining, it was found that the addition of a CS-MSC fraction containing soluble factors and a fraction enriched with extracellular vesicles to myofibroblasts caused a decrease in the incorporation of α-actin into stress fibrils.

The addition of CS-MSC fractions also caused a decrease in the ability of myofibroblasts to compress the collagen gel. At the same time, the fraction of extracellular vesicles had the most pronounced effect (contractile activity 18±9% for BB-MSCs and 78±6% for RF-MSCs versus 98±3% for control cells). Thus, secretion of MSCs can be used to reverse fibrotic processes (Fig. 8).

Induction of fibroblast differentiation in vitro

To create an in vitro model of fibrosis, a model was used to induce differentiation of human skin fibroblasts, human lung fibroblasts, mouse lung fibroblasts into myofibroblasts by adding 5 ng/ml TGFβ to the culture medium (R&D). For this, human skin fibroblasts of 3-10 passages were planted in the well of a 24-well plate at the rate of 2×10 ⁵ cells/well. Through culture knocks, cells were deprived in DMEM LG (Gibco) containing 1% HyClone Penicillin-Streptomycin 100X Solution (HyClone) overnight. After deprivation, the medium in the cells was changed to a fraction enriched with BB-MSCs or RF-MSCs (500 μl per well). As a differentiation inducer, 5 ng/ml TGFbeta (R&D, USA) was added simultaneously. DMEM LG without FBS and without TGFbeta was used as a negative control ("-TGFbeta"group); DMEM LG without FBS with 5 ng/ml TGFbeta was used as a positive control ("+TGFbeta" group). Cells were placed in CO ₂ -incubator at 37°C and analyzed after 4 days.

To create a model of myofibroblast dedifferentiation, human skin fibroblasts of 3-10 passages were planted in the well of a 24-well plate at the rate of 2×10 ⁵ cells/well. Through culture knocks, cells were deprived in DMEM LG (Gibco) containing 1% HyClone Penicillin-Streptomycin 100X Solution (HyClone) overnight. After deprivation, the medium in the cells was changed to DMEM LG supplemented with 5 ng/ml TGFbeta (R&D, USA). After 4 days of incubation in culture, the medium was changed to a fraction enriched in BB-MSC or RF-MSC (500 μl per well). DMEM LG without FBS and without TGFbeta was used as a control ("-TGFbeta" group). Cells were placed in a CO ₂ incubator at 37° C. and analyzed after 3-4 days.

Immunocytochemical study of cell cultures

Cells were fixed with 4% paraformaldehyde in phosphate buffered saline (PBS) for 15 minutes at room temperature and permeabilized with 0.1% Triton X-100 for 10 minutes at room temperature. After blocking non-specific binding with 10% normal goat serum in 1% BSA (Abcam, UK), cells were incubated with antibodies to α-alpha-smooth muscle actin (ab32575; Abcam), vinculin (Sigma, V4139), rabbit IgG (NSC-2025; Santa Cruz Biotechnology, USA) or Alexa 594-phalloidin (A12381; Molecular probe, USA) overnight at 4°C. Antibody detection was performed using secondary antibodies conjugated to Alexa 488 (A11037; Invitrogen, USA) for 1 hour at room temperature in the dark. The nuclei were stained with DAPI (D9542, Sigma). Images were obtained using an inverted microscope with a fluorescence module and a camera (Leica DMi8, Leica DFC 7000 T camera, Leica Microsystems GmbH, Germany) and processed using FIJI software (GitHub Inc., USA).

In vitro collagen gel contraction model

The protocol described by Ngo (Ngo et al. 2006) was used to run this model.

Human skin fibroblasts of 3-10 passages that reached ≈80% confluence were washed with Versen's solution (PanEco) and treated with a solution of 0.25% trypsin and 0.02% EDTA (Gibco) in order to detach the cells from the plastic. After detachment, the required concentration of the cell suspension was determined by counting in a Goryaev chamber, and the required amount was precipitated from the suspension by centrifugation in a culture medium containing no growth additives. 400 μl of the test substance and 5 ng/ml TGFβ (R&D) were added to the precipitated cells (80 thousand cells/well). DMEM (Gibco), positive DMEM (Gibco) supplemented with 5 ng/ml TGFβ (R&D) was used as a negative control. Next, 0.2 ml of collagen (3 mg/ml in 0.1% acetic acid, Imtek) was added to the resulting suspension, and 4-5 μl of 1 M NaOH was quickly added to equalize the pH level. The suspension was quickly transferred to the well of a 24-well plate and applied gently. Then the gel was left at room temperature for 20–30 min for polymerization, after which DMEM (Gibco) culture medium was added in an amount of 500 µl and the gel was carefully detached from the well edges to initiate contraction. Next, the tablet was placed in an incubator at 37°C and 5% concentration of CO ₂ . The change in disc diameter was visually assessed after 24 hours, representative photographs of the discs were taken using the camera of a mobile device. The area of the well and disc was measured using the ImageJ program. The area of the disc was normalized to the area of the bottom of the well.

Immunoblotting

DF or IV pellet were lysed in Lamley's buffer. The amount of protein in the lysate was determined using the method of analysis of bovine serum albumin (BSA), subjected to polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate (SDS-PAGE) and transferred to a polyvinylidene fluoride membrane (PVDF). The membrane was incubated with primary antibodies to alpha actin (a-SMA) (ab32575, Abcam), type I collagen (ab34710, Abcam), Bcl2 (sc-509, Santa Cruz Biotechnology), MMP2 (ab97779, Abcam), vinculin (V4139 , Sigma) overnight at 4°C. After washing in Tween transfer buffer supplemented with 0.05% Tween-20 (TBST), blots were incubated with peroxidase-labeled secondary antibodies (HRP) (P-RAM Iss, P-RAQ Iss, Imtek, Russia) for 1 hour . Labeled proteins were visualized using a ChemiDoc™ Touch imaging system (Bio-Rad Laboratories, USA) using an enhanced chemiluminescence (ECL) kit (Pierce, USA).

Isolation of RNA

Total RNA was isolated from cultured fibroblasts using the miRNeasy Mini Kit (Qiagen) according to the instructions supplied with the kit. To do this, the well with cultured cells was washed 2 times with PBS, 2 ml for 1-2 minutes, and then the cells were dissolved in 350 μl of lysing solution (RLT, Qiagen) and incubated at room temperature for 5 minutes. Then, 1.5 volumes of 96% ethanol relative to the test sample was added to the cell solution, mixed, and applied to a column with a sorbing membrane. Nucleic acids were precipitated on the column by centrifugation at 8000g for 15 s. Next, the genomic DNA was removed using RNase-free DNase I (RNase-Free DNase Set, Qiagen). To do this, 80 µl of a DNase I solution in RDD buffer from the kit was applied and incubated for 15 min at RT. After that, the column was washed with 700 µl of RWT buffer from the kit using centrifugation at 8000g for 15 s at room temperature. Next, the column was washed twice with 500 µl of RPE buffer from the kit using centrifugation at 8000g for the first time for 15 s, and for the second time for 2 min. Then the column was transferred to a new centrifuge tube and the remaining buffer solution was dried by centrifugation at 12000g for 1 min. The dried column was transferred to a new centrifuge tube and the RNA was eluted in 30-50 µl of deionized sterile RNase-free water by centrifugation at 8000g for 1 min. The concentration of isolated total RNA was determined on a NanoDrop 1000 spectrophotometer (Thermo Scientific, USA) using ND-1000 V 3.7.1 software (Thermo Scientific, USA). The quality of the isolated RNA was also monitored using a NanoDrop 1000 spectrophotometer. To do this, we analyzed the ratios of absorption values at wavelengths of 260 nm and 280 nm, as well as at wavelengths of 260 nm and 230 nm. For the subsequent reverse transcription procedure, RNA samples were taken with the following parameters: 260 nm / 280 nm = 2, 260 nm / 230 nm = 1.8-2.2.

real time PCR

To determine the mRNA content of smooth muscle actin and collagen, cDNA synthesis was performed using the MMLV RT kit (Evrogen, Russia) according to the user manual attached to the kit. To do this, a mixture was collected containing 1–6 μl of the RNA template (RNA concentration 0.5–2 μg), 1–3 μl of the primer, and 0–7 μl of sterile, RNase-free water. The mixture was gently stirred and centrifuged. The mixture was heated for 2 min at 70°C and the tubes were placed on ice. After that, 11 µl of the premix 0-2 µl of sterile RNase-free water, 4 µl of 5x first strand synthesis buffer, 2 µl of dNTP mix (10 mM each), 2 µl of DTT (20 mM), 1-3 µl of MMLV revertase. The mixture was gently stirred and centrifuged. The reaction mixture was incubated for 30-60 min at 37-42°C, then at 70°C for 10 min. The reaction was carried out in a Nexus Mastercycler® gradient hot-lid PCR cycler (Eppendorf, Germany). All manipulations were carried out with gloves and under a laminar to avoid contamination. The resulting cDNA was then stored at -20°C.

Real-time PCR was performed using a prepared reaction mixture containing DNA polymerase, SYBR Green I intercalating dye, and ROX reference dye (Evrogen) according to the manufacturer's protocols on a QuantStudio™ 5 Real-Time PCR System (Applied Biosystems, USA). 5 µl of qPCRmix-HS SYBR+LowROX (Evrogen), 9 µl of sterile water, 1 µl of primer mixture (concentration of forward and reverse primers in the mixture of 5 µM each) and 10 µl of cDNA were added to one PCR reaction to a final concentration of 50 ng of cDNA per reaction . To control nonspecific annealing of primers (non template control, NTC), 10 µl of sterile water was added to the reaction instead of cDNA.

PCR mode: 95°C for 5 min, then 40 cycles 95°C - 20 sec, n°C - 20 sec (where n is the temperature empirically selected for each pair of primers), 70°C - 20 sec. Primers were selected using the PrimerBank oligonucleotide sequence database (http://pga.mgh.harvard.edu/primerbank/) or using the Primer-BLAST tool (http://www.ncbi.nlm.nih.gov/tools/primer- blast/).

As primers, unique complementary pairs of oligodeoxynucleotides to the analyzed genes with sequences (SEQ ID NO 62 - SEQ ID NO 67) were used, the synthesis of which was carried out using standard technology and equipment used to solve similar problems in genetic engineering [Sambrook J et al., Molecular Cloning - A laboratory Manual, Cold Spring Harbor Laboratory Press, New York, (1989)], [Watson, JD, Oilman, M., Witkowski, J., Zoller, M. Recombinant DNA, Scientific American Books, New York, 1992].

Primer sequences:

Collagen type I type (Col1A1) (SEQ ID NO 62): CCCAGCCACAAAGAGTCTACA,

arr. (SEQ ID NO 63) GTTTCCACACGTCTCGGTCA

Smooth muscle actin (ACTA2) (SEQ ID NO 64): CAATGAGCTTCGTGTTGCCC,

arr. (SEQ ID NO 65) TCTCCAGAGTCCAGCACGAT

60S acidic ribosomal protein P0 (RPLP0) (SEQ ID NO 66): GCTGCTGCCCGTGCTGGTG

arr. (SEQ ID NO 67) TGGTGCCCCTGGAGATTTTAGTGG

The content of the studied mRNAs was normalized according to the level of the signal obtained for the RPLP0 cDNA (the gene for the acidic ribosomal housekeeping protein). After PCR with real-time detection, the obtained data on the threshold cycle values for each gene were processed according to the formula:

N \u003d 2 ^ (-ΔCt), ΔСt \u003d Сt ₁ -Сt _hk , where Сt ₁ is the value of the threshold cycle for the gene under study, Сt _hk is the value of the threshold cycle of the housekeeping genes (RPLP0), N is the result in relative units.

Example 7. Method for assessing the content of non-coding RNAs in the conditioned medium of MSCs enriched with extracellular vesicles

Using high throughput RNA sequencing (RNA-seq), several classes of RNA were found to be present in BB-hTERT-MSCs. Using KEGG gene clustering, the most representative 3,000 genes found in VV-MSCs were found to include clusters associated with focal adhesion (79 genes), ECM formation (only 27 collagens represented by 27 genes), and receptor-ECM interaction (39 genes), the PI3K-Akt signaling pathway (90 genes), the TGFbeta signaling pathway (17), and other processes involved in the regulation of fibrosis.

Among non-coding RNAs, one of the most represented and annotated classes were microRNAs (miRNAs). Out of 2652 miRNAs, 270 were found in BB-MSCs. Most of them were also found in EVs secreted by MSCs from the adipose tissue of healthy donors. However, some inter-donor variability was observed; thus, only 170 miRNAs were present in all three biological replicates. The most abundant miRNAs in BB-MSCs are shown in Fig. 9, including siRNA-21, siRNA-155, siRNA-92a, and others with identified specific target genes involved in the development of fibrosis. According to the results of cluster analysis, it was shown that among the targets of the detected miRNAs there were several factors associated with fibrosis. Most of the genes contribute significantly to specific processes associated with the development of fibrosis, such as ECM remodeling, Wnt, PDGF, and TGFbeta signaling pathways. Similar results were obtained when analyzing common targets of 170 siRNAs matching between three MSC donors: 117 genes were associated with fibrosis, 63 genes with TGFbeta signaling, and 76 genes with ECM formation and remodeling (Fig. 9).

High throughput RNA sequencing method

RNA from EVs secreted by hTERT MSCs and primary MSCs (number of donors n = 3) was isolated using the miRNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. The amount and purity of the isolated RNA was determined on a Nanodrop spectrophotometer (Thermo Scientific) at a ratio of 260/230 nm. Mass parallel sequencing libraries for miRNA analysis were built and analyzed (Illumina, USA). Before analyzing the RNA-seq data, the adapter sequences for SNA / Illumina 1.9 / TruSeq Small RNA were first removed using the cutadapt-1.16 program, then additional purification was performed using the Trimmomatic-0.38 program. Quality control was performed using the FastQC program.

The RNA-seq analysis of the miRNA array was performed using the sRNAtoolbox program (parameters: miRNAs: miRBase v22; ncRNA: (Ensembl release 91 (ncRNA)); length of the seed: 20; number of allowed mismatches: 2; phred score: 20). miRNAs associated with the development of fibrosis and their representation in VV-MSCs were assessed using the TargetScan 7.2, HMDD, miR2Disease, and miRwayDB databases. The prediction of mRNA functions was facilitated by the use of the Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases. Clustering of the GO and KEGG genes was performed using the David 6.8 resource. Quality control, mapping, and normalization of RNA-seq data of the mRNA array were performed using the BrowserGenome 1.0 service (genome hg38 GENCODE 22). Keyword analysis was conducted using scripts using the following commands: while read line; grep; awk sed; sort(uniq). Common predictive miRNA targets were analyzed using the miRNet service.

The raw data is available as PRJNA592301 (ncbi/sra).

Example 8 Method for Assessing Fibrosis-Associated MicroRNAs in Conditioned MSC Medium Enriched with Extracellular Vesicles

Using the real-time PCR method for the main miRNAs associated with fibrosis, it was shown that 60 out of 84 studied miRNAs associated with fibrosis are expressed at the level detected by real-time PCR in BB-MSCs. Only in EVs secreted by primary MSCs, 12 miRNAs are expressed, only in EVs secreted by immortalized linear MSCs (hTERT-MSCs)-2. 10 miRNAs are not expressed in any of the studied cell types. A more detailed list of miRNAs is presented in the table below (Table 1).

Table 1. List of microRNAs involved in the regulation of fibrosis, identified by RNA sequencing and validated by real-time PCR, which are presented in EVs secreted by human MSCs

Expressed in BB-MSCs and BB-hTERT-MSCs Expressed only in BB-MSCs Expressed only in BB-hTERT-MSCs not expressed miR-92a-3p miR-451a miR-216a-5p miR-132-3p miR-874-3p miR-377-3p miR-133a-3p miR-1-3p miR-7-5p miR-302b-3p miR-142-3p miR-744-5p miR-26b-5p miR-200a-3p miR-663a miR-211-5p miR-208a-3p miR-661 miR-200b-3p miR-217 miR-590-5p miR-150-5p miR-223-3p miR-5692a miR-148a-3p miR-325 miR-503-5p miR-141-3p miR-32-5p miR-5011-5p miR-122-5p miR-372-3p miR-491-5p let-7d-5p miR-449b-5p miR-107 miR-449a miR-382-5p miR-378a-3p miR-375 miR-34a-5p miR-338-5p miR-335-5p miR-328-3p miR-324-5p miR-324-3p miR-31-5p miR-30a-5p miR-29c-3p miR-29b-3p miR-29a-3p miR-27b-3p miR-27a-3p miR-26a-5p miR-25-3p miR-23a-3p miR-21-5p miR-215-5p miR-20a-5p miR-204-5p miR-203a-3p miR-19b-3p miR-19a-3p miR-199b-5p miR-199a-5p miR-196a-5p miR-195-5p miR-194-5p miR-192-5p miR-18a-5p miR-16-5p miR-15b-5p miR-155-5p miR-146b-5p miR-146a-5p miR-145-5p miR-143-3p miR-129-5p miR-126-3p miR-125b-5p miR-10b-5p miR-10a-5p miR-106a-5p miR-17-5p miR-101-3p

Isolation of siRNA-enriched RNA

Total miRNA-enriched RNA was isolated from conditioned MSC medium enriched with extracellular vesicles using the miRNeasy Mini Kit (Qiagen) according to the instructions supplied with the kit. To do this, the conditioned MSC medium enriched with extracellular vesicles was concentrated according to example 3 and dissolved in 700 μl of lysis solution (QIAzol Lysis Reagent, Qiagen) by vigorous vortexing for 1 min and incubation at room temperature for 5 min. Thereafter, the lysates were resuspended through an insulin syringe 5 times according to the manufacturer's protocol. Then, 140 μl of chloroform was added to the vesicle lysate, mixed by vigorous vortexing for 15 s, and incubated at room temperature for 3 min. At the end of the incubation, a water-soluble fraction with a volume of 350 ± 50 μl was separated by centrifugation at 12000g for 15 min at 4°C and transferred to a new centrifuge tube. The water-soluble fraction was mixed with 1.5 volumes of 96% ethanol relative to the volume of the test sample and applied to a column with a sorbing membrane from the kit. Nucleic acids were precipitated on the column by centrifugation at 8000g for 15 s. Next, the genomic DNA was removed using RNase-free DNase I (RNase-Free DNase Set, Qiagen). To do this, 80 µl of a DNase I solution in RDD buffer from the kit was applied and incubated for 15 min at RT. After that, the column was washed with 700 µl of RWT buffer from the kit using centrifugation at 8000g for 15 s at room temperature. Next, the column was washed twice with 500 µl of RPE buffer from the kit using centrifugation at 8000g for the first time for 15 s, and for the second time for 2 min. Then the column was transferred to a new centrifuge tube and the remaining buffer solution was dried by centrifugation at 12000g for 1 min. The dried column was transferred to a new centrifuge tube and the RNA was eluted in 30-50 µl of deionized sterile RNase-free water by centrifugation at 8000g for 1 min. The concentration of isolated total RNA was determined on a NanoDrop 1000 spectrophotometer (Thermo Scientific, USA) using ND-1000 V 3.7.1 software (Thermo Scientific, USA). The quality of the isolated RNA was also monitored using a NanoDrop 1000 spectrophotometer. To do this, we analyzed the ratios of absorption values at wavelengths of 260 nm and 280 nm, as well as at wavelengths of 260 nm and 230 nm. For the subsequent reverse transcription procedure, RNA samples were taken with the following parameters: 260 nm / 280 nm = 2, 260 nm / 230 nm = 1.8-2.2.

reverse transcription

Reverse transcription was performed using the miScript II RT Kit (Qiagen) as described in the manufacturer's protocol. For this, a master mix was prepared containing 4 µl of 5x miScript HiSpec Buffer (mature miRNA profiling using miScript miRNA PCR Arrays or quantification of mature miRNAs only using miScript Primer Assays) or 5x miScript HiFlex Buffer (f mature miRNAs in parallel with precursor miRNAs, mRNAs and/ or other noncoding RNAs using miScript Primer Assays, miScript Precursor Assays and/or QuantiTect® Primer Assays), 2 µl 10x miScript Nucleics Mix, 2 µl miScript Reverse Transcriptase Mix, 1-12 µl RNA sample (containing at least 100 ng and no more 2 µg RNA) and 1-11 µl RNase-free water.

The prepared master mix was placed into 100 µl tubes for reverse transcription. Amplification was carried out using a Nexus Mastercycler® gradient device (Eppendorf, Germany) in the mode of 37°C - 60 min, 95°C - 5 min. The resulting cDNA was used immediately or stored at -20°C.

real time PCR

Real-time PCR was performed using the miScript miRNA PCR Array Human Fibrosis (Qiagen). To do this, a master mix was prepared in a PCR box containing 1375 µl of 2x QuantiTect SYBR Green PCR Master Mix, 275 µl of 10x miScript Universal Primer, 1000 µl of RNase-free water, and 100 µl of a cDNA sample containing 48–96 ng of cDNA.

After pipetting, the resulting mixture was dropped into wells of a 96-well miScript miRNA PCR Array plate, 25 µl each. The tablet was centrifuged for 1 minute at 1000g. The plate was placed in a QuantStudio 5 PCR system (Thermo Fisher Scientific). Real-time PCR was performed using the following mode:

95°C - 15 min, then 40 cycles 94°C - 15 sec, 55°C - 30 sec, 70°C - 30 sec.

The content of the studied miRNAs was normalized according to the level of the signal obtained for the SNORD61, SNORD95, SNORD96A, SNORD68, SNORD72, RNU6B/RNU6-2 cDNA. After PCR with real-time detection, the obtained data on the threshold cycle values for each gene were processed according to the formula:

N = 2^(-ΔCt), ΔСt = Сt ₁ -Сt _hk , where Сt ₁ is the value of the threshold cycle for the gene under study, Сt _hk are the average values of the threshold cycles of SNORD61, SNORD95, SNORD96A, SNORD68, SNORD72, RNU6B/RNU6-2 , N - result in relative units.

Example 9 Methods for Assessing the Ability of MSC Conditioned Medium Enriched with Extracellular Vesicles to Resolve Pulmonary Fibrosis in a Pulmonary Fibrosis Model

In the experiments, mice of the C57Bl/6N line, males and females aged from 9 to 20 weeks of their own breeding, were used. The mice were kept in the vivarium of the translational medicine laboratory of the FFM, Moscow State University in accordance with GOST 33215-2014 Guidelines for keeping and caring for laboratory animals (Rules for equipping premises and organizing procedures).

The bleomycin preparation (Bleocin Nippon Kayaku Co., Ltd., Japan, Reg. No. P N0113322/01)) was prepared for administration under sterile laminar flow hood conditions based on physiological saline and was administered to mice endotracheally at a concentration of 3 mg/kg (in volume 30 µl). To test the hypothesis about the effect of BB-MSCs on the early stages of fibrosis development, BB-MSCs 10x were administered one day after the administration of bleomycin (prevention group, (Bleomycin 3 mg/kg, BB-MSCs 10x, n=5). To test the hypothesis about effect of BB-MSC on the treatment of already formed fibrosis, BB-MSC 10x was administered 14 days after the administration of bleomycin (prevention group, (Bleomycin 3 mg/kg, BB-MSC 10x, n=5). As a control for these groups, two groups using DMEM LG + 1% penicillin-streptomycin when administered 1 and 14 days after the administration of bleomycin (n=5 in each group) BB-MSC fraction and DMEM LG were administered in a volume of 30 μl intratracheally.

To assess the condition of the animals, the dynamics of the weight of the animals after the administration of bleomycin was used, and, in addition, the manifestation of signs of trouble was noted: low mobility, hunched posture of the animal, and the presence of characteristic wheezing during breathing. Changes in the clinical condition of the animals were assessed using a special scoring scale. All mice underwent MRI scanning at 0, 7, 14, 21 days from the start of the experiment. On the 22nd day after the administration of the drug, the mice were euthanized, the lungs were removed, fixed in 10% neutral formalin and sent for histological examination.

Histochemical analysis of lung tissue

The tissue fixed with 10% neutral formalin was embedded in paraffin. The resulting blocks were cut on a microtome (section thickness 1 μm, interval between slices 50 μm), the sections were mounted on polylysine-coated glass (Menzel-Glaserpolysineslides, Thermo FS). Sections were deparaffinized in toluene and decreasing concentration of alcohols to water. To analyze the severity of fibrotic changes, sections were stained with hematoxylin and eosin (Dako) according to the manufacturer's protocol. The degree of collagen formation was assessed by histochemical staining according to Van Gieson, staining for elastic fibers was performed using Verkhgof's iron hematoxylin, according to the manufacturer's protocol. The resulting stained sections were embedded in Canadian balsam and analyzed using a Leica DM600B microscope (LeicaMicrosystemsGmbH, Germany). Fragments of the resulting sections were imaged using a Leica DFC 420C digital camera (LeicaMicrosystemsGmbH, Germany). Images were rated on an Ashcroft scoring scale from 0 (normal) to 8 (complete fibrous occlusion in the visual field) (Hübner et al., 2008).

bronchoalveolar lavage

Bronchoalveolar lavage was taken from mice to assess the inflammatory response induced by damage to the lung tissue. For its isolation, mice were euthanized, a small incision was made in the trachea, where a silicone tube was inserted, fixed on a syringe needle with a diameter of 23G. The contents of the bronchi and lungs were washed out with 0.5 ml of phosphate-buffered saline with the addition of 10% FBS (Gibco, USA). Flushing was performed 4-6 times for each animal to increase the number of obtained cells. For each mouse, 15 μl of the resulting suspension was placed on a glass slide and dried for 24 hours. The resulting preparations were stained with Giemsa solution for 12 hours, embedded in Canadian balsam, and analyzed using a Leica DM600B microscope (LeicaMicrosystemsGmbH, Germany). Images of fragments of obtained smears were obtained using a digital camera Leica DFC 420C (LeicaMicrosystemsGmbH, Germany). On each preparation, 10 random fields of vision were examined at a magnification of 20X. In each field of view, the average number of lymphocytes and macrophages was counted. For further analysis, the structure of the cellular composition was expressed as a percentage of the total number of cells in the sample.

Assessment of the clinical condition of animals

The well-being of mice was assessed daily by the following parameters: body weight and its percentage change from baseline, appearance, behavior in the home cage, external signs of respiratory distress, evoked behavior, total score for the indicated day (Table 2). The higher the animal's score on the scale, the worse was its condition at the time of examination. To quantify the distress, we took the maximum score accumulated by the 21st day of the experiment. For animals that survived to this date, the total score calculated on that day was selected. Proceeding from the consideration that death is the maximum degree of trouble for the animal, for mice that died before 21 days, we took the total score equal to 11 - the maximum on our scale.

Table 2. Mouse Clinical Assessment Form Parameter Points 1. Body weight No more than 5% loss 0 5 to 10% reduction one More than 10% reduction 2 2. Appearance Normal 0 Lack of grooming, ruffled coat and/or mucosal discharge one hunched posture 2 Same with closed eyes 3 3. Behavior in the home cage Normal 0 Suppressed activity, but reaction to stimuli is present one No activity, does not respond to stimuli 2 4. Clinical signs Normal respiratory rate, no wheezing 0 Forced inhalation/exhalation, wheezing is not audible one Forced inhalation / exhalation, wheezing is clearly audible 2 5. Invoked Behavior Normal 0 Slightly suppressed or slightly exaggerated reaction one Very weak reaction, pre-coma, posture is not restored 2

The assessment of the condition was carried out simultaneously with the procedure for weighing the animals. First you need to observe the intact animal and evaluate the parameters 2-4. After weighing and returning the mouse to the home cage, evaluate parameter 5. Parameter 1 is evaluated based on the results of weighing (100% is the weight of the animal before the introduction of substances - see card on the cage).

The decision to euthanasia is made with a total score of 10-11 based on the ability to perfuse the lungs to preserve histological data.

MR scan

MRI was performed using a ClinScan 7T instrument, Bruker Biospin, USA. To obtain MRI images, the animals were anesthetized with an air mixture of oxygen/isoflurane (98%/2%). Vital activity was monitored using a respiratory cycle monitor. Lung imaging was performed in T2 weighted mode with fat suppression using a Turbo Spin Echo sequence with the following parameters: TR = 1175 ms, TE = 55 ms, Echo train length = 8, FOV 42x60 mm, base resolution 216x384.

The obtained images were analyzed using the ImageJ program (National Institutes of Health, Bethesda, MA, USA). Only images of sections that passed through the chest in the frontal plane were used. For each mouse, several frontal sections were taken, which, presumably, passed through the lungs (n=3-10). On the images, the projection zone of the lungs was manually identified, with the exception of the mediastinal organs and the main vessels. To correct signal intensity variations between images and obtain normalized values, an additional section of muscle tissue was isolated in each image. For each area, the area, the average signal intensity, its maximum and minimum values, and the standard deviation were estimated.

Clinical examination results

After processing the data on the clinical condition of the animals, the following results were obtained: In the BB-MSC fibrosis treatment group, the median of the maximum accumulated score in control animals is 7, and in the experimental animals it is 1. This indicates that the condition of mice treated with conditioned MSC medium enriched BB, better than those who received control DMEM.

In the fibrosis prevention group, the median maximum accumulated score in control animals is 9, and in experimental animals it is 5. This also suggests that the condition of mice treated with conditioned MSC medium enriched with BB is better than those that received DMEM, however, these the animals performed worse than those in the fibrosis treatment group (FIG. 10).

BAL results

After counting the cells in the lung lavage fluid samples, the following structure of the cell composition was obtained. Lymphocytes are the most predominant type of immune cells in the samples, since their percentage in the group average is more than 70%. Their decrease indirectly indicates a decrease in the intensity of inflammation. In the "treatment" group, with the introduction of BB-MSC, there is a tendency to reduce lymphocytic infiltration (70% of the cells counted in lavage are lymphocytes), while in the remaining groups, the number of lymphocytes ranges from 85 to 92%.

The second cell type studied was macrophages, and their proportion in the cellular composition of the lavage fluid differed significantly between some of the groups. There was a trend towards a change in the number of macrophages in the fibrosis treatment group between the experimental group treated with CS and the control group. In the control group, there were 15% of macrophages, and in the experimental group - 27%. The normal proportion of macrophages was taken as the values in mice of the negative control group treated with PBS instead of bleomycin. Macrophages in the focus of inflammation play a role both in the development of fibrosis and inflammation, and in the resorption of the focus of fibrosis. A change in their proportion indicates both an increase in the intensity of inflammation and the process of resorption of the focus of fibrosis (Fig. 10).

MRI results

Data on signal intensity on MRI images were obtained for each of the groups in the form of a spread of Delta values - a change in the relative signal intensity compared to the first MRI, separately - for each of the subsequent MRI. In the fibrosis treatment group, the general dynamics is similar - an increase in relative intensity by the third MRI and a decrease by the fourth, but the medians differ: in order - 0.18 0.32 and 0.14 for the control group and 0.28 0.34 and 0.16 in the experimental group. In general, the values are higher in the experimental subgroup than in the control subgroup. In the fibrosis prevention group, the dynamics is different - in the experimental subgroup, the Delta values are stable (medians in order - 0.26 0.29 0.28), and in the control subgroup, the values are stable on the 2nd and 3rd MRI, but there was a decline to the fourth group (medians on order - 0.17 0.14 0.09) (Fig. 10).

Histological analysis results

The results of histological analysis of lung sections of mice from different experimental groups are presented in Table. 3 and in FIG. 11. It can be noted that when using IV-MSCs in the "treatment" group, the histological assessment of the severity of fibrosis is 1 point less than in the control group, and in the "prevention" group - by 0.5.

Table 3. The results of histological assessment of the level of fibrosis according to the Ashcroft scale in the experimental groups Treatment groups Experimental groups Ashcroft histological score (median) Established Fibrosis Treatment Group CS MSC 1.5 Control 2.5 Fibrosis Prevention Group CS MSC 2.5 Control 3

Example 10 Methods for Assessing the Ability of MSC Conditioned Medium Enriched with Extracellular Vesicles and Soluble Components to Resolve Fibrosis in a Deep Skin Wound Model

Characteristics of the experimental groups

Experimental studies were carried out on a line of outbred white mice containing 51 mature individuals. All animals were of the same age (3-5 months), the average weight of one individual was 25-30 g. The experiment was carried out after preliminary adaptation of mice in the vivarium for 10 days. The mice were kept on a normal vivarium diet. After injury, each mouse was kept in a separate cage.

The experimental animals of the line were divided into several groups depending on the method of wound treatment (Table 4).

Table 4. Distribution of mice into groups depending on the method of wound treatment Group number Local wound treatment Absolute number of individuals, n No. 1 Bandage with levomekol (positive control) 17 No. 2 Wound chipping with conditioned MSC medium at a concentration of 5x 17 No. 3 Wound injection with DMEM culture medium (negative control) 17 Total 51

Experiment scheme

During the experiment, we were guided by the European Convention for the Protection of Vertebrate Animals Used for Experiments or for Other Scientific Purposes No. 123 dated March 18, 1986 and Order of the Ministry of Health of the USSR No. 755 dated August 12, 1975 “On measures to further improve the organizational forms of work using experimental animals.

Anesthetization of animals was carried out with the drug Avertin. The drug was administered intraperitoneally at a dose of 20 µl/1 g of animal weight. The consumption of the drug per white mouse was 0.5-0.6 ml. The formation of the wound was carried out by excising the skin in the selected area with a scalpel. The edges of the wound were sutured to a plastic ring 12 mm in diameter to prevent constriction.

Depending on the group, local wound treatment was performed as follows (Table 4):

In group 1 (positive control), the wound was covered with a thin layer of Levomekol preparation and covered with a dry sterile gauze bandage, which was fixed to the plastic ring with single sutures. The wound was dressed twice a day for the first three days by changing the dressing.

In group No. 2 (experiment-injection), a concentrated (5x) conditioned medium in a volume of 400 μl was injected into the bottom and surrounding soft tissues of the wound by microinjection (which corresponded to 0.4-1.2 * 10^10 extracellular vesicles). Then the wound was covered with a gauze bandage, which was fixed to the plastic ring with single sutures. In this group, wound dressing was not performed.

In group No. 3 (negative control), 400 µl of DMEM culture medium (Gibco) was injected into the bottom and surrounding soft tissues of the wound by microinjection. Then the wound was covered with a gauze bandage, which was fixed to the plastic ring with single sutures. In this group, wound dressing was not performed.

The mice were withdrawn from the experiment on the 3rd, 7th, 14th and 28th days. On the 3rd, 7th and 14th days, 5 individuals were taken out, on the 28th day, 2 individuals were taken out. The conclusion was made by the method of dislocation of the spinal cord in the cervical region. The following were chosen as criteria for evaluating the effectiveness of the impact of the conditioned environment on the healing of the skin wound: the severity of the inflammatory reaction in the wound and surrounding soft tissues, the speed and usefulness of the restoration of the skin. The nature of the wound discharge, edema and hyperemia of the surrounding tissues, the formation of a scab, the speed and fullness of the recovery of the skin were also assessed macroscopically. In the course of microscopic examination, the presence and nature of cell infiltration, vascular growth, the degree of epithelialization, and restoration of skin derivatives were assessed.

For microscopic examination, layer-by-layer tissue fragments at the selected time points were removed from the wound area, capturing the edges, and fixed in 10% formalin solution. After standard histological wiring and embedding in paraffin, histological sections were prepared. Sections were stained with hematoxylin and eosin to obtain an overview picture. The degree of collagen formation was assessed using histochemical staining according to Van Gieson. The resulting stained sections were embedded in Canadian balsam and analyzed using a Leica DM600B microscope (Leica Microsystems GmbH, Germany). Fragments of the resulting sections were imaged using a Leica DFC 420C digital camera (Leica Microsystems GmbH, Germany). The images were processed using the ImageJ program.

Results (Fig. 12-16).

To test the hypothesis that human MSC secretion can influence regenerative processes, a skin wound model in mice was used. Immediately after the wound was inflicted, the conditioned MSC medium was injected into it. Healing was assessed 3, 7, 14 and 28 days after wound application and application of the conditioned medium or reference drug.

3 days after the wound was applied, which corresponds to the stage of inflammation, changes characteristic of this phase were observed in all groups. In the wounds, on which the conditioned MSC medium was applied, exudation and hyperemia of the surrounding tissues were less pronounced than in the control groups, the presence of islands of granulation tissue and swelling of the wound edges were noted. This picture indicated the end of inflammation. Microscopic examination of animals in the group with the introduction of conditioned medium MSCs, observed a less pronounced infiltration of leukocytes. The predominant types of leukocytes were lymphocytes and macrophages. Diapedesis of erythrocytes in such wounds was also less pronounced and was observed only in 2 out of 5 animals. Moreover, in such wounds, single newly formed vessels were found as early as 3 days after injury, and the beginning of growth of the marginal epithelial layer was also observed. The infiltrate of such wounds, in addition to leukocytes, included fibroblasts, the nuclei of which contained weakly condensed chromatin, which may indicate a high synthetic activity of these cells. Thus, the introduction of a medium containing MSC secretion products into the wound caused an accelerated completion of inflammation and the appearance of such signs of the onset of the reparative process as the accumulation of fibroblasts in the wound, the growth of the marginal epithelial layer, and neovasculogenesis.

7 days after the application of the wound, signs characteristic of the phase of early proliferation of the wound process were observed. In wounds where the conditioned MSC medium was introduced, intensive growth of granulation tissue was noted (in 3 out of 5 animals), the formation of a large number of loops of thin-walled vessels, soft tissues were infiltrated with fibroblasts and inflammatory cells. Active growth of the marginal epithelial layer under the scab was also observed. In the control groups, a slight formation of granulation tissue penetrated by small vessels was observed, a weak growth of the epithelial layer under the scab, and the appearance of fibroblasts in the outer layers of the wound were noted.

The proliferation phase of the wound process usually ends with the formation of a full-fledged granulation tissue in the bottom of the wound. The restoration of blood supply in the area of damage, in turn, creates a favorable microenvironment for the migration and proliferation of epidermal and dermal cells, which leads to the restoration of the integrity of the epidermis in the wound area.

14 days after application, in wounds treated with Levomekol ointment, epithelialization was not complete. In the granulation tissue, polymorphonuclear leukocytes, macrophages and thin-walled vessels predominated; a pronounced picrinophilia of collagen fibers was noted, which extended to the entire depth of the dermis. It should be emphasized that the arrangement pattern of collagen fibers generally corresponded to that observed in the dermis.

In wounds that were treated with DMEM medium, which did not contain MSC secretion products, growth of the epithelial layer under the eschar and partial exfoliation of the eschar were also noted. Leukocyte infiltration and picrinophilia of collagen fibers were absent, and the arrangement of collagen fibers corresponded to the norm. Despite the fact that in 2 out of 5 animals the epithelialization of the wound was almost complete 14 days after application, and thickening of the epidermis containing all cell layers was noted at the site of the wound, the tissue microrelief in such areas was not visualized. The absence of microrelief of the epithelium in the wound indicates the continuation of their epithelialization.

In the wounds where the conditioned MSC medium was introduced, a pronounced growth of the marginal epithelial layer under the scab was noted, most of the wound was covered with neoepithelium (in 3 out of 5 mice, the wound was completely covered with epithelium). Histological examination showed complete epithelialization of the wound, granulation tissue containing a large number of thin-walled vessels was determined in the wound zone. The epidermis is thickened, the microrelief was not visualized, all layers of cells were formed. Infiltration by inflammatory cells and picrinophilia of collagen fibers were absent, the location of collagen fibers corresponded to the norm.

After 28 days, in animals of the control groups (whose wounds were treated with Levomekol ointment or DMEM medium, which does not contain MSC secretion products), complete wound healing with scar formation was noted. At the same time, skin derivatives were formed weakly or completely absent.

In the wounds where the conditioned MSC medium was introduced, the restoration of the skin without the formation of scar tissue was noted. In addition, a partial restoration of the hairline was observed. Histological examination, as well as in animals of the control groups, showed complete epithelialization of the wound. In contrast to the wounds of animals in the control groups, the formation of sebaceous glands and hair follicles, as well as the formation of a microrelief, was noted in the wounds treated with the conditioned MSC medium.

Thus, the introduction of a conditioned medium containing human MSC secretion products reduces the time of wound healing, accelerates wound epithelialization, the formation of skin derivatives, and prevents the formation of scar tissue. These results indicate that MSCs produce factors that not only stimulate skin regeneration, but also prevent the formation of scar (fibrous) tissue.

--->

SEQUENCE LIST

<110> Federal State Budgetary Educational Institution of Higher Professional Education "Lomonosov Moscow State University" (MGU)

<120> AGENT FOR TREATMENT OF TISSUE FIBROSIS BASED ON COMPONENTS OF SECRETOME OF MESENCHYMAL STROMALE CELLS, METHOD FOR PRODUCING AND APPLICATION OF THE AGENT

<160> SEQ ID NO:1

<210> 1

<211> 24

<212> human microRNA

<213> natural sequence

<223> miR-7-5p

<400> 1

1 uggaagacua

<160> SEQ ID NO:2

<210> 2

<211> 23

<212> human microRNA

<213> Natural sequence

<223> miR-10b-5p

<400> 2

1 UACCCUGUAG AACCGAAUUU GUG

<160> SEQ ID NO:3

<210> 3

<211> 23

<212> human microRNA

<213> Natural sequence

<223> miR-10a-5p

<400> 3

1 UACCCUGUAG AUCCGAAUUU GUG

<160> SEQ ID NO:4

<210> 4

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-15b-5p

<400> 4

1 UAGCAGCACA UCAUGGUUUA CA

<160> SEQ ID NO:5

<210> 5

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-16-5p

<400> 5

1 uagcagcacg uaaauauugg cg

<160> SEQ ID NO:6

<210> 6

<211> 23

<212> human microRNA

<213> Natural sequence

<223> miR-17-5p

<400> 6

1 CAAAGUGCUU ACAGUGCAGG UAG

<160> SEQ ID NO:7

<210> 7

<211> 23

<212> human microRNA

<213> Natural sequence

<223> miR-18a-5p

<400> 7

1 UAAGGUGCAU CUAGUGCAGA UAG

<160> SEQ ID NO:8

<210> 8

<211> 23

<212> human microRNA

<213> Natural sequence

<223> miR-19a-3p

<400> 8

1 UGUGCAAAUC UAUGCAAAAC UGA

<160> SEQ ID NO:9

<210> 9

<211> 23

<212> human microRNA

<213> Natural sequence

<223> miR-19b-3p

<400> 9

1 UGUGCAAAUC CAUGCAAAAC UGA

<160> SEQ ID NO:10

<210> 10

<211> 23

<212> human microRNA

<213> Natural sequence

<223> miR-20a-5p

<400> 10

1 UAAAGUGCUU AUAGUGCAGG UAG

<160> SEQ ID NO:11

<210> 11

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-21-5p

<400> 11

1 UAGCUUAUCA GACUGAUGUU GA

<160> SEQ ID NO:12

<210> 12

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-23a-3p

<400> 12

1 GGGGUUCCUG GGGAUGGGAU UU

<160> SEQ ID NO:13

<210> 13

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-25-3p

<400> 13

1 CAUUGCACUU GUCUCGGUCU GA

<160> SEQ ID NO:14

<210> 14

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-26a-5p

<400> 14

1 UUCAAGUAAU CCAGGAUAGGCU

<160> SEQ ID NO:15

<210> 15

<211> 21

<212> human microRNA

<213> Natural sequence

<223> miR-27a-3p

<400> 15

1 UUCACAGUGG CUAAGUUCCG C

<160> SEQ ID NO:16

<210> 16

<211> 21

<212> human microRNA

<213> Natural sequence

<223> miR-27b-3p

<400> 16

1 UUCACAGUGG CUAAGUUCUG C

<160> SEQ ID NO:17

<210> 17

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-29a-3p

<400> 17

1 UAGCACCAUC UGAAAUCGGU UA

<160> SEQ ID NO:18

<210> 18

<211> 23

<212> human microRNA

<213> Natural sequence

<223> miR-29b-3p

<400> 18

1 uagcaccauu ugaaaucagu guu

<160> SEQ ID NO:19

<210> 19

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-29c-3p

<400> 19

1 UAGCACCAUU UGAAAUCGGUUA

<160> SEQ ID NO:20

<210> 20

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-30a-5p

<400> 20

1 UGUAAACAUC CUCGACUGGA AG

<160> SEQ ID NO:21

<210> 21

<211> 21

<212> human microRNA

<213> Natural sequence

<223> miR-31-5p

<400> 21

1 AGGCAAGAUG CUGGCAUAG U

<160> SEQ ID NO:22

<210> 22

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-34a-5p

<400> 22

1 UGGCAGUGUC UUAGCUGGUU GU

<160> SEQ ID NO:23

<210> 23

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-92a-3p

<400> 23

1 uauugcacuu gucccggccu gu

<160> SEQ ID NO:24

<210> 24

<211> 21

<212> human microRNA

<213> Natural sequence

<223> miR-101-3p

<400> 24

1 UACAGUACUG UGAUAACUGA A

<160> SEQ ID NO:25

<210> 25

<211> 23

<212> human microRNA

<213> Natural sequence

<223> miR-106a-5p

<400> 25

1 AAAAGUGCUU ACAGUGCAGG UAG

<160> SEQ ID NO:26

<210> 26

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-125b-5p

<400> 26

1 UCCCUGAGAC CCUAACUUGUGA

<160> SEQ ID NO:27

<210> 27

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-126-3p

<400> 27

1 ucguaccgug aguaauaaug cg

<160> SEQ ID NO:28

<210> 28

<211> 21

<212> human microRNA

<213> Natural sequence

<223> miR-129-5p

<400> 28

1 CUUUUUGCGG UCUGGGCUUG C

<160> SEQ ID NO:29

<210> 29

<211> 21

<212> human microRNA

<213> Natural sequence

<223> miR-143-3p

<400> 29

1 UGAGAUGAAG CACUGUAGCU C

<160> SEQ ID NO:30

<210> 30

<211> 23

<212> human microRNA

<213> Natural sequence

<223> miR-145-5p

<400> 30

1 GUCCAGUUUU CCCAGGAAUC CCU

<160> SEQ ID NO:31

<210> 31

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-146a-5p

<400> 31

1 UGAGAACUGA AUUCCAUGGG UU

<160> SEQ ID NO:32

<210> 32

<211> 23

<212> human microRNA

<213> Natural sequence

<223> miR-146b-5p

<400> 32

1 UGAGAACUGA AUUCCAUAGG CUG

<160> SEQ ID NO:33

<210> 33

<211> 24

<212> human microRNA

<213> Natural sequence

<223> miR-155-5p

<400> 33

1 UUAAUGCUAA UCGUGAUAGG GGUU

<160> SEQ ID NO:34

<210> 34

<211> 21

<212> human microRNA

<213> Natural sequence

<223> miR-192-5p

<400> 34

1 CUGACCUAUG AAUUGACAGC C

<160> SEQ ID NO:35

<210> 35

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-194-5p

<400> 35

1 UGUAACAGCA ACUCCAUGUG GA

<160> SEQ ID NO:36

<210> 36

<211> 21

<212> human microRNA

<213> Natural sequence

<223> miR-195-5p

<400> 36

1 uagcagcaca gaaauauugg c

<160> SEQ ID NO:37

<210> 37

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-196a-5p

<400> 37

1 uagguaguuu cauguuguug gg

<160> SEQ ID NO:38

<210> 38

<211> 23

<212> human microRNA

<213> Natural sequence

<223> miR-199a-5p

<400> 38

1 CCCAGUGUUC AGACUACCUG UUC

<160> SEQ ID NO:39

<210> 39

<211> 23

<212> human microRNA

<213> Natural sequence

<223> miR-199b-5p

<400> 39

1 CCCAGUGUUU AGACUAUCUG UUC

<160> SEQ ID NO:40

<210> 40

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-203a-3p

<400> 40

1 GUGAAAUGUU UAGGACCACU AG

<160> SEQ ID NO:41

<210> 41

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-204-5p

<400> 41

1 UUCCCUUUGU CAUCCUAUGC CU

<160> SEQ ID NO:42

<210> 42

<211> 21

<212> human microRNA

<213> Natural sequence

<223> miR-215-5p

<400> 42

1 AUGACCUAUG AAUUGACAGA C

<160> SEQ ID NO:43

<210> 43

<211> 23

<212> human microRNA

<213> Natural sequence

<223> miR-324-3p

<400> 43

1 CCCACUGCCC CAGGUGCUGC UGG

<160> SEQ ID NO:44

<210> 44

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-324-5p

<400> 44

1 CGCAUCCCCU AGGGCAUUGG UG

<160> SEQ ID NO:45

<210> 45

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-328-3p

<400> 45

1 CUGGCCCUCU CUGCCCUUCC GU

<160> SEQ ID NO:46

<210> 23

<211> 46

<212> human microRNA

<213> Natural sequence

<223> miR-335-5p

<400> 46

1 UCAAGAGCAA UAACGAAAAA UGU

<160> SEQ ID NO:47

<210> 47

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-338-5p

<400> 47

1 AACAAUAUCC UGGUGCUGAG UG

<160> SEQ ID NO:48

<210> 48

<211> 64

<212> human microRNA

<213> Natural sequence

<223> miR-375

<400> 48

1 CCCCGCGACG AGCCCCUCGC ACAAACCGGA CCUGAGCGUU UUGUUCGUUC

51 GGCUCGCGUGAGGC

<160> SEQ ID NO:49

<210> 49

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-378a-3p

<400> 49

1 ACUGGACUUG GAGUCAGAAG GC

<160> SEQ ID NO:50

<210> 50

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-382-5p

<400> 50

1 GAAGUUGUUC GUGGUGGAUU CG

<160> SEQ ID NO:51

<210> 51

<211> 91

<212> human microRNA

<213> Natural sequence

<223> miR-449a

<400> 51

1 CUGUGUGUGA UGAGCUGGCA GUGUAUUGUU AGCUGGUUGA AUAUGUGAAU

51 GGCAUCGGCU AACAUGCAAC UGCUGUCUUA UUGCAUAUAC A

<160> SEQ ID NO:52

<210> 52

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-449b-5p

<400> 52

1 aggcagugua uuguuagcug gc

<160> SEQ ID NO:53

<210> 53

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-491-5p

<400> 53

1 AGUGGGGAAC CCUUCCAUGA GG

<160> SEQ ID NO:54

<210> 54

<211> 23

<212> human microRNA

<213> Natural sequence

<223> miR-503-5p

<400> 54

1 UAGCAGCGGG AACAGUUCUG CAG

<160> SEQ ID NO:55

<210> 55

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-590-5p

<400> 55

1 GAGCUUAUUC AUAAAAGUGC AG

<160> SEQ ID NO:56

<210> 56

<211> 89

<212> human microRNA

<213> Natural sequence

<223> miR-661

<400> 56

1 GGAGAGGCUG UGCUGUGGGG CAGGCGCAGG CCUGAGCCCU GGUUUCGGGC

51 UGCCUGGGUC UCUGGCCUGC GCGUGACUUU GGGGUGGCU

<160> SEQ ID NO:57

<210> 57

<211> 93

<212> human microRNA

<213> Natural sequence

<223> miR-663a

<400> 57

1 CCUUCCGGCG UCCCAGGCGG GGCGCCGCGG GACCGCCCUC GUGUCUGUGG

51 CGGUGGGAUC CCGCGGCCGU GUUUUCCUGG UGGCCCGGCC AUG

<160> SEQ ID NO:58

<210> 58

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-744-5p

<400> 58

1 UGCGGGGCUA GGGCUAACAG CA

<160> SEQ ID NO:59

<210> 59

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-874-3p

<400> 59

1 CUGCCCUGGC CCGAGGGACC GA

<160> SEQ ID NO:60

<210> 60

<211> 21

<212> human microRNA

<213> Natural sequence

<223> miR-5011-5p

<400> 60

1 UAUAUAUACA GCCAUGCACU C

<160> SEQ ID NO:61

<210> 61

<211> 22

<212> human microRNA

<213> Natural sequence

<223> miR-5692a

<400> 61

1 caaauaauac cacagugggu gu

<160> SEQ ID NO:62

<210> 62

<211> 21

<213> Artificial sequence, primer

<223> Collagen type I (Col1A1)

<400> 62

1 CCCAGCCACA AAGAGTCTAC A

<160> SEQ ID NO:63

<210> 63

<211> 20

<213> Artificial sequence, primer

<223> Collagen type I (Col1A1)

<400> 63

1 GTTTCCACAC GTCTCGGTCA

<160> SEQ ID NO:64

<210> 64

<211> 20

<213> Artificial sequence, primer

<223> Smooth muscle actin (ACTA2)

<400> 64

1 CAATGAGCTT CGTGTTGCCC

<160> SEQ ID NO:65

<210> 65

<211> 20

<213> Artificial sequence, primer

<223> Smooth muscle actin (ACTA2)

<400> 65

1 TCTCCAGAGT CCAGCACGAT

<160> SEQ ID NO:66

<210> 66

<211> 19

<213> Artificial sequence, primer

<223> 60S acidic ribosomal protein P0 (RPLP0)

<400> 66

1 GCTGCTGCCC GTGCTGGTG

<160> SEQ ID NO:67

<210> 67

<211> 24

<213> Artificial sequence, primer

<223> 60S acidic ribosomal protein P0 (RPLP0)

<400> 67

1 TGGTGCCCCCT GGAGATTTTTA GTGG

<---

Claims (28)

1. A drug for the treatment of tissue fibrosis, containing a fraction of extracellular vesicles in the secretome of mesenchymal stromal cells (MSCs) or an isolated fraction of extracellular vesicles isolated from the secretome of MSCs, having surface markers HSP70, CD9, CD81 and CD63, as well as a diameter size of 20 up to 420 nm, in the amount of 1-3*10^10 particles per ml, carrying in its composition microRNA with a sequence selected from SEQ ID NO 1-61. 2. The agent according to claim 1, characterized in that the extracellular vesicles contain at least miR-21-5p with the sequence of SEQ ID NO 11 and miR-29c-3p with the sequence of SEQ ID NO 19. 3. The agent according to claim 2, characterized in that miR-129-5p with the sequence SEQ ID NO 28 is present in the extracellular vesicles. 4. The agent according to claim 3, characterized in that miR-92a-3p with the sequence SEQ ID NO 23 is present in the extracellular vesicles. 5. The agent according to claim 4, characterized in that microRNAs with nucleotide sequences of SEQ ID NO: 1, 4-8, 10, 12-18, 20-22, 24-27, 29-36, 38 are present in the extracellular vesicles -46, 48, 50-61. 6. A method for obtaining an agent according to claim 1 for the treatment of tissue fibrosis, including the following stages: cultivation of human MSCs up to 90% confluent or monolayer in a medium that supports the growth of undifferentiated human mesenchymal cells, washing the cells with a buffer solution, conditioning MSCs in serum-free and devoid of animal products origin of a growth medium that maintains cell viability of at least 70% and is suitable for therapeutic use for 2-7 days, selection of a cultivation medium containing secretion products of human AT MSCs, removal of cell residues from it and purification from low molecular weight components, followed by concentration using ultrafiltration, evaluation of the specified environment for the content of the fraction of extracellular vesicles with surface markers HSP70, CD9, CD81 and CD63, determination of the size and number of particles per ml, as well as the assessment of the presence in their composition of microRNA with a sequence selected from SEQ ID NO 1-61, to get medicine va according to claim 1, while to obtain a fraction of extracellular vesicles in the human MSC secretome, 10 kDa filters are used, and to obtain an isolated fraction of extracellular vesicles isolated from the MSC secretome, 1000 kDa filters are used, with an allowable error of not more than 5%. 7. The method according to claim 6, characterized in that in order to obtain a fraction of extracellular vesicles in the human MSC secretome, cell cultivation is carried out for 5-7 days. 8. The method according to claim 6, characterized in that to obtain an isolated fraction of extracellular vesicles isolated from the MSC secretome, having surface markers HSP70, CD9, CD81 and CD63, as well as a diameter size from 20 to 420 nm, in the amount of 1-3 *10^10 particles per ml, carrying in its composition microRNA with a sequence selected from SEQ ID NO 1-61, cell cultivation is carried out for 2-3 days. 9. The method according to claim 6, characterized in that MSCs are primarily isolated human MSCs cultured up to 2-5 passages. 10. The method according to claim 6, characterized in that MSCs are isolated from adipose tissue. 11. The method according to claim 6, characterized in that the MSCs are immortalized human adipose tissue MSCs. 12. The method according to claim 6, characterized in that the medium that supports the growth of undifferentiated human mesenchymal cells is a solution containing a basic medium - AdvanceSTEM Cell Culture Media, and an additive - AdvanceSTEM Stem Cell Growth Supplement, while the additive is taken in a volume of 9 -11% for 100% base environment volume. 13. The method according to claim 6, characterized in that the Hanks solution is used as a buffer solution for washing cells from the components of the growth medium, while washing the cells is carried out by placing cells three to five times in the said solution at the rate of 0.1-0.2 ml solution per cm ² cells for 5-10 minutes. 14. The method according to claim 6, characterized in that low-glucose DMEM without phenol red or another growth medium is used as a basal conditioning medium that maintains the viability of human MSCs throughout the entire conditioning period. 15. The method according to claim 6, characterized in that the removal of cell residues from the culture medium is carried out by centrifugation. 16. The method according to claim 6, characterized in that the cultivation medium is purified by its ultrafiltration with the removal of low molecular weight compounds weighing less than 10 kDa with an allowable error of not more than 5%. 17. The method according to claim 15, characterized in that the centrifugation is carried out at 5000±10 rpm, a temperature of 6±2°C for 10±1 minutes. 18. The method according to claim 6, characterized in that the purification from low molecular weight components, followed by fractionation and concentration, is carried out using a tangential flow filtration system that removes low molecular weight components of a given filter size. 19. The method according to claim 18, characterized in that Minim II is used as a tangential flow filtration system using Minimate TFF capsule, PALL ultrafiltration cassettes. 20. The method according to claim 6, characterized in that the purification from low molecular weight components, followed by fractionation and concentration, is carried out by ultrafiltration using Amicon centricons (Sigma, Italy). 21. A method for treating fibrosis caused by tissue damage using the agent according to claim 1, obtained by the method according to claim 6, by introducing into the area of fibrosis in order to prevent the progression and stimulate the reversal of fibrotic changes. 22. The method of treatment according to claim 21, characterized in that fibrosis is caused by mechanical, chemical or thermal tissue damage. 23. The method of treatment according to claim 21, characterized in that fibrosis develops in the tissues of the lungs. 24. The method of treatment according to claim 23, characterized in that the fibrosis is idiopathic pulmonary fibrosis. 25. The method of treatment according to claim 23, characterized in that fibrosis develops as a result of interstitial lung diseases. 26. The method of treatment according to claim 23, characterized in that fibrosis develops as a result of viral pneumonia. 27. The method of treatment according to claim 26, characterized in that fibrosis develops as a result of viral pneumonia caused by coronaviruses. 28. The method of treatment according to claim 23, characterized in that fibrosis develops as a result of occupational lung diseases.

Images