RU2763933C1 - Test system for identifying a mutation in the btpkd gene of the domestic dog (canis lupus familiaris), causing polycystic kidney disease - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: described is a test system for identifying a mutation (SNP: 6:38856816; NC_006588.3:g.38856816G>A) in the BTPKD gene, causing polycystic kidney disease in dogs. The test system includes a mixture for conducting a polymerase chain reaction using the developed primers, Taqman probes of the diagnosed allele, and "plug" oligonucleotides for another allele, presented below: Primer F - CCTCAAGCCTGTCCATCTGT; Primer R - GGAGAGCCAGATGTGCTTGT; Probe mut - FAM-TCCTCGTGGCCAAGCTGCAG-BHQ1; Plug wt - CCTCGTGGCCGAGCTGCAG-NH₂; Probe wt - FAM - CCTCGTGGCCGAGCTGCAG-BHQ1; Plug mut - TCCTCGTGGCCAAGCTGCAG-NH₂.

EFFECT: invention expands the range of means of identifying mutations causing polycystic kidney disease in dogs.

1 cl, 2 dwg, 1 tbl, 1 ex

Description

The invention relates to the field of veterinary genetics and biotechnology.

There is a known mutation in the BTPKD gene (SNP: 6:38856816; NC_006588.3:g.38856816G>A) of a domestic dog (Canis lupus familiaris), which causes polycystic kidney disease.

However, to detect this mutation, it is necessary to create a test system to identify dogs carrying this mutation or dogs with polycystic disease.

The technical result is to provide a reliable diagnosis of polycystic kidney disease in dogs caused by a mutation in the BTPKD gene.

The technical result is achieved by the fact that in a test system for detecting a mutation in the BTPKD gene that causes polycystic kidney disease in dogs, it includes an amplification mixture for carrying out a polymerase chain reaction, consisting of 1x buffer with ammonium sulfate, Taq polymerase, a mixture of deoxynucleotide triphosphates (dNTP), magnesium chloride using the developed primers, Taqman probes of the diagnosed allele, as well as a stub oligonucleotide for another allele, having the following sequences:

Primer F - CCTCAAGCCTGTCCATCTGT

Primer R - GGAGAGCCAGATGTGCTTGT

Probe mut - FAM-TCCTCGTGGCCAAGCTGCAG-BHQ1

Plug wt - CCTCGTGGCCGAGCTGCAG-NH ₂

Probe wt - FAM - CCTCGTGGCCGAGCTGCAG-BHQ1

Plug mut - TCCTCGTGGCCAAGCTGCAG-NH ₂ ,

as well as control samples for the wild-type and mutant variant of the BTPKD gene fragment.

As controls, two genetic constructs were created - plasmids containing a wild-type and a mutant version of the BTPKD gene fragment. A positive control for wildtype diagnostic systems was obtained by amplifying a gene fragment obtained from healthy dog DNA and cloning it into the pJet1.2 vector; a mutant variant was prepared by synthesizing a synthetic DNA sequence followed by cloning it into the pJet1.2 vector. Heterozygous DNA for the mutation was simulated by equimolar mixing of both types of plasmids after measuring their concentration on agarose gel electrophoresis.

As a template, 1 μl of a diluted solution of a control plasmid (initial plasmid 50 gn/μl was diluted 1:10,000) with a wild-type gene fragment, a fragment of a mutant gene allele, or a mixture of both mimicking a heterozygote was used. The "advantages of cloning a PCR product into a vector" lies in the stable long-term storage of control templates in the form of a plasmid inside a bacterial strain, with an unlimited possibility of copying and production.

The reaction mixture for real-time PCR in the version with “plugs” is divided into two volumes, each of which contains: Forward primer (F), Reverse primer (R), Probe complementary to one of the alleles (wt - wild type, mut - mutant allele ), Oligonucleotide - stub, complementary to another allele. As a control, 2 types of matrices are used: for the wild allele, for the mutant allele. Detection of amplification products is carried out using the principle of cleavage of a fluorescent label at the 5' end of the oligonucleotide probe. The use of "stubs" and separate detection of alleles in two independent reaction volumes makes it possible to achieve the best balance between the specificity and efficiency of the system and fine-tune specificity by changing the ratio of probe and "stub" concentrations. Such a RT-PCR setup makes it possible to quickly establish the presence of three variants of genotypes in the studied DNA samples, and, therefore, to identify the presence or absence of a mutant allele and determine the presence, absence of pathology or carriage.

The use of different types of control in the form of templates, specific primers, probes, and plugs for different genome variants (for mutant and wild alleles) makes it possible to control the correct progress of the reaction in each tube.

When designing primers, probes, and stubs, the following requirements were met: a high degree of homology with the studied variants of the gene mutation, the absence of regions annealing "on themselves", the absence of "hairpins", which was confirmed by the results of software testing of the binding specificity of primers and hybridization probes, software testing of oligonucleotides for the possibility formation of hairpins and dimers.

The design of specific primers, probes and "stubs" was carried out using computer programs based on the analysis of nucleotide sequences published on the GeneBank resource and the selection of conditions for conducting RT-PCR using the developed primers, probes carrying a fluorochrome and a fluorescence quencher and "stubs" of the complementary part amplified fragment.

The features that distinguish the claimed technical solution are aimed at achieving a technical result and have not been identified in the study of this and related fields of science and technology and, therefore, meet the criterion of "inventive step".

The essence of the invention is illustrated in Fig. 1 "RT-PCR results for the detection of the BTPKD (3:1) mutant allele" and FIG. 2 “RT-PCR results for BTPKD (3:1) wild-type allele detection”, which shows a screenshot of the RT-PCR results in the form of graphs showing the detection options for the wild-type, mutant allele and heterozygous genotype variant.

An example of a specific use of the test system to detect mutations in the BTPKD gene in dogs.

The study consists of three stages:

1. Isolation of DNA from the biomaterial (scrapings of the enterobuccal epithelium).

2. Real-time PCR.

3. Interpretation of the obtained results.

1. For research, a sample of enterobuccal epithelium is taken from dogs. The isolation of the total DNA of a domestic dog was carried out by the method using cetyltrimethylammonium bromide (CTAB).

Buffer composition: 1.4 M NaCl, 0.02 M EDTA (ethylenediaminetetraacetic acid), 0.1M Tris-HCl pH=8.0 (hydroxymethylaminomethane hydrochloride), distilled water.

The material (scraping of buccal epithelium) was transferred into a 1.5 ml Eppendorf tube with the addition of 1 ml of extraction buffer. After that, the sample was incubated at +56°C for 40 minutes, with periodic mixing of the contents. After incubation, 0.5 ml of chloroform was added to the tube, kept for 40 minutes at room temperature, the contents of the tube were constantly stirred. Centrifuged for 5 minutes at 10,000 rpm. The upper phase was transferred into a clean 1.5 ml Eppendorf tube, 2/3 volume of isopropyl alcohol was added, and mixed. Then kept at room temperature for 30 minutes for DNA precipitation. Centrifuged for 10 minutes at 10,000 rpm. The supernatant was discarded and the precipitate was washed with 80% ethanol. Centrifuged again for 10 minutes at 10,000 rpm. After removing the supernatant, the nucleic acid precipitate was dried at room temperature, then dissolved in 60 µl of sterile deionized water, and the resulting DNA sample was stored at -20°C.

2. Approbation of the diagnostic system was carried out in the RT-PCR ANK-16 nucleic acid analyzer (Certificate of Conformity No. ROSS RU.ME01. H00423, Institute of Analytical Instrumentation, Russian Academy of Sciences, Russia). The reaction was carried out in a volume of 20 μl. Amplification mix contains: 2 µl 10 x ammonium sulfate Taq polymerase buffer, 0.125 mM deoxynucleotide triphosphate (dNTP) mixture, 0.25 µM forward primer, 0.25 µM reverse primer, 0.125 e.a/µl Taq polymerase, 2 .5 mM magnesium chloride, 0.125 µM Taqman probe of the diagnosed allele, and a 0.250 µM stub oligonucleotide for the other allele. All reagents used are manufactured by Beagle LLC, Russia. As a template, 1 μl of a diluted solution of a control plasmid (with a wild-type gene fragment, a mutant allele gene fragment, or a mixture of both mimicking a heterozygote) was added to the mixture. After initial denaturation at 94°C for 200 s, 40 cycles of amplification were time mode: denaturation - 94°C, 18 s, primer annealing - 60°C, 40 s, elongation - 72°C, 40 s.

The test system allows specifically amplifying a fragment of the BTPKD gene to determine the dog's genotype in a multiplex polymerase chain reaction.

The system consists of a set of reagents for multiplex PCR and a set of control samples.

Select the required number of disposable 1.5 ml Eppendorf type tubes, including tubes with matrices and negative control. The reaction mixture is added to all tubes and the studied DNA samples are added in the amount of 1 μl, 1 μl of the matrix - a diluted solution of the control plasmid with a wild-type gene fragment, with a fragment of the mutant allele of the gene - is added to separate tubes. Add 1 ml of distilled water to the negative control tube.

3. Interpretation of the results of the analysis.

The obtained data - fluorescent signal accumulation curves - are analyzed using the software of the used genetic analyzer for conducting PCR-RT ANK-16, according to the attached manufacturer's instructions.

Table 1 presents data that can be used to establish a significant difference in the effectiveness of a specific and non-specific reaction. Efficiency calculated by ANK-16 device software.

Thus, to identify dogs carrying (GA genotype) a mutation in the BTPKD gene (SNP: 6:38856816; NC_006588.3:g.38856816G>A), as well as animals with polycystic disease (AA gnotype), the developed test system can be used. In the presence of the wild-type (GG) genotype, i.e. a healthy animal in the graph of Fig. 2 the result will be displayed as a wt/wt graph. If the dog is a carrier of the mutant allele (GA genotype), then the detection result will correspond to the mut/wt plot shown in FIG. 1 and FIG. 2. If there is a mutation in the homozygous state (polycystic, AA genotype), the graph will correspond to that shown in Fig. 1 and FIG. 2 as mut/ mut.

The inventive test system is recommended for use in veterinary genetics, namely for the means of detecting carriage or diagnosing the disease of polycystic kidney disease caused by a mutation in the BTPKD gene in dogs of the breed English Bull Terrier, Cairn Terrier, West Highland White Terrier or Malinois, which corresponds to the level of " industrial applicability.

Claims (7)

Test system for detection of mutations (SNP: 6:38856816; NC_006588.3:g.38856816G>A) in the BTPKD (Bull Terriers Polycystic Kidney Disease) gene that causes polycystic kidney disease in dogs, including an amplification mixture for polymerase chain reaction, consisting from tenfold (10x) ammonium sulfate buffer, Taq polymerase, a mixture of deoxynucleotide triphosphates (dNTPs), magnesium chloride, as well as developed primers, developed by Taqman probes for the diagnosed allele and developed oligonucleotides-"stubs" for the other allele, presented below: Primer F - CCTCAAGCCTGTCCATCTGT Primer R - GGAGAGCCAGATGTGCTTGT Probe mut - FAM-TCCTCGTGGCCAAGCTGCAG-BHQ1 Plug wt - CCTCGTGGCCGAGCTGCAG-NH ₂ Probe wt - FAM - CCTCGTGGCCGAGCTGCAG-BHQ1 Stub mut - TCCTCGTGGCCAAGCTGCAG-NH ₂ .

Images