RU2763173C1 - Method for detecting the dna of the hepatitis b virus in biological material with a low viral load based on two-stage pcr with detection by three targets in real time - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: described is a method for detecting the hepatitis B virus with a low viral load by determining the DNA of the virus in a blood sample by means of PCR with detection by three targets in real time. Detection is executed in blood plasma and/or serum, a blood clot, hepatic tissues. Diagnostics is executed in two stages. At the first stage, amplification of the DNA of the virus is performed using oligonucleotide primers flanking the full genome of the virus, and at the second stage - using three pairs of oligonucleotide primers for the three regions (S gene, X gene, Core gene) of the genome of the virus, as well as one pair for a fragment of the human HPRT gene and the corresponding fluorescently labeled oligonucleotide probes complementary to the sections of the amplified fragments carrying fluorophores at the 5' end and non-fluorescent quenching agents at the 3' end. The obtained results are recorded by means of hybridisation fluorescence detection in real time. At the second stage, a positive control sample is introduced into the study, constituting a plasmid containing the nucleotide sequences of the three target regions of the HBV genome.

EFFECT: method provides an increase in the sensitivity and accuracy of diagnostics.

1 cl, 2 dwg, 2 tbl, 4 ex

Description

The invention relates to medicine, clinical laboratory diagnostics, in particular to the problem of studying infectious viral diseases, and concerns the search for new directions in the specific diagnosis of chronic viral hepatitis B.

One of the most significant health problems in the world remains hepatotropic viruses that can cause both acute and chronic diseases. The most common hepatotropic virus is the hepatitis B virus (HBV). Chronic viral hepatitis B (CHBV) is a diffuse inflammatory disease associated with the persistence of the hepatitis B virus.

In the Russian Federation, a moderate (2-7%) prevalence of HBV is shown. Long-term analysis of morbidity in the territory of the Russian Federation in the period 1999-2017. acute hepatitis B (AHB) showed a significant decrease in its level, the incidence in 2017 was less than 1 case per 100 thousand of the population (from 0.51 to 0.9 per 100 thousand of the population). Despite this, there was an upward trend in CVHB to an average of 9.28 per 100,000 population and up to 31.1 per 100,000 population in the Far Eastern District; (increase 5814 people) [Esaulenko E.V., Sukhoruk A.A., Ivanova N.V. The possibility of elimination of parenteral viral hepatitis in the territory of the Russian Federation and the North-Western Federal District. Topical issues of fundamental, clinical medicine and pharmacy. 2018. S. 230-233].

According to the classification of the European Association for the Study of the Liver (EASL), the natural course of CHBV goes through 5 stages, while chronic infection is characterized by a sustained presence of HBsAg for at least 6 months (with or without concomitant HBeAg) with the exception of the HBsAg-negative (latent or occult) form of the course of the disease [Gish RG, Given B.D., Lai CL, Locamini SA, Lau JY, Lewis DL Chronic hepatitis B: virology, natural history, current management and a glimpse at future opportunities. antiviral research. 2015; 121:47-58. DOI: 10.1016/j.antiviral.2015.06.008]. Latent hepatitis B (LBV) is defined as the stage of the disease at which HBV DNA is detected in the liver tissue with an undetectable level of HBsAg in peripheral blood serum, regardless of whether or not HBV DNA is detected by PCR in peripheral blood [RaimondoG., Allain JP, Brunetto MR, Buendia MA, Chen DS, Colombo M. et al. Statements from the Taormina expert meeting on occult hepatitis B virus infection. J. Hepatol. 2008; 49:652-7. Doi: 10.1016/j.jhep.2008.07.014]. Thus, the currently accepted estimate of the prevalence of CVHB based on the detection of HBsAg does not reflect the true prevalence of CVHB both in the population and in risk groups.

It should be noted that the development of SCV is due to the suppression of intranuclear transcription of subgenomic HBV RNA from the template of circular covalently closed HBV DNA (cccDNA), which can become a template for subgenomic and pregenomic copies of RNA, on the basis of which the viral genome and viral proteins are synthesized [Guo J.T. , Guo H. Metabolism and function of hepatitis B virus cccDNA: Implications for the development of cccDNA-targeting antiviral therapeutics. antiviral research. 2015; 122:91-100. Doi: 10.1016/j.antiviral.2015.08.005]. In most cases, with HBsAg-negative CVHB, viral replication and viral gene expression can be suppressed to such an extent that the viral load in the patient's peripheral blood is extremely low, up to the inability to detect HBV DNA by standard methods, but elimination of the virus does not occur.

Despite the low viral load, SCV is characterized by the same risk factors as in the HBsAg-positive form of CVHB, including the role of HBsAg-negative HBV in the development of liver fibrosis and hepatocellular carcinoma [Raimondo G., Pollicino T., Cacciola I., Squadrito G. Occult hepatitis B virus infection. J. Hepatol. 2007; 46:160-70. Doi: 10.1016/j.jhep.2006.10.007], the possibility of intrauterine infection of the child with HBsAg- and HBeAg-negative mother [Gui QD, Yue YF, Li SH, Zhang F. Study on intrauterine infection of hepatitis B virus in pregnant women with hepatitis B surface antigen and hepatitis B e antigen negative. Chinese Journal of Obstetrics and Gynecology. 2005; 40:99-102.], the possibility of infection of the recipient by transfusion of blood or its components from a donor with latent HBV, while the minimum infectious dose is approximately 16-100 copies [CandottiD., Assennato SM, Laperche S., Allain JP, Levicnik-Stezinar S. Multiple HBV transfusion transmissions from undetected occult infections: revising the minimal infectious dose. gut. 2019; 68(2): 313-21. Doi: 10.1136/gutjnl-2018-316490].

Since the level of viral load in the blood in HBsAg-negative HBV is extremely low (<200 IU / ml), up to the impossibility of detection by standard methods, the detection of HBV DNA in the liver tissue remains not only the “gold standard”, but also practically the only reliable method of laboratory diagnostics latent HBV. Identification and quantification of HBV circular covalently closed DNA in the liver tissue makes it possible to detect HBV with high accuracy in the latent phase of the course of the disease, as well as to preliminarily assess the level of virus replication in hepatocytes [Ostankova Yu.V., Semenov A.V., Totolyan Areg A A method for quantifying HBV circular covalently closed DNA in puncture liver biopsies. Clinical laboratory diagnostics. 2019; 64(9): 565-70. Doi: 10.18821/0869-2084-2019-64-9-565-570]. However, the need for invasive intervention makes it possible to propose the method only as an additional diagnostic in cases where puncture liver biopsy is performed according to clinical indications, but it does not make it possible to use it for a wide screening of populations, blood donors, or individual groups of patients.

A known method for detecting HBV based on polymerase chain reaction with hybridization-fluorescence detection, presented in a commercial kit "AmpliSens® HBV-FL" (FBUN TsNIIE, Moscow). The principle of testing is based on the extraction of DNA from blood plasma in conjunction with VKO and DNA amplification with hybridization-fluorescence detection "at the end point" (FEP format) or in "real time" mode (FRT format). This method allows you to detect the virus at low concentrations, up to 5 IU / ml. However, to detect the virus at such low concentrations, two DNA extraction conditions must be met: a large sample volume (1000 ml of blood plasma) is required and a specialized DNA extraction kit used in conjunction with an automatic station for nucleic acid extraction.

When using more accessible and widely used methods of DNA extraction, including commercial kits for the isolation of NC "AmpliPrime Ribo-prep" (Federal Budgetary Scientific Institution TsNIIE, Moscow), with an extraction volume of 100 µl, the limit of analytical sensitivity is 200 IU/mL and 100 IU/mL. ml for FEP and FRT formats, respectively.

There is a known method proposed in the work of foreign colleagues on the transmission of HBV from mother to child, which is a nested PCR with sequential use of two pairs of primers [Candotti D., Danso K., Allain J-P. Maternofetal transmission of hepatitis B virus genotype E in Ghana, west Africa // J. Gen. Virol. - 2007. - vol. 88. - P. 2686-2695, doi: 10.1099/vir.0.83102-0]. The sensitivity of the proposed method reached 10 IU/ml. The disadvantage of the method is the need for a large volume of blood plasma for DNA extraction (500 µl).

A common disadvantage of all the above methods is the amplification of one conservative section of HBV DNA, while in 2008 at a meeting in Taormina (Spain), a group of experts recommended the detection of at least two sections of the virus genome to confirm the detection of latent HBV [Raimondo G., Allain JP, Brunetto MR, Buendia MA, Chen DS, Colombo M. et al. Statements from the Taormina expert meeting on occult hepatitis B virus infection. J. Hepatol. 2008; 49:652-7. Doi: 10.1016/j.jhep.2008.07.014].

The closest in essence to the claimed invention and selected as a prototype is the method proposed by us earlier [Ostankova Yu.V., Semenov A.V., Totolyan Areg A. A method for detecting hepatitis B virus DNA in biological material at low viral load based pcr. Pat. 2633755 RF. Patentee Federal Budgetary Institution of Science "St. Petersburg Institute of Epidemiology and Microbiology named after A.I. Pasteur". No. 2016144898; dec. 11/15/2016; publ. 10/17/2017, Bull. fig. No. 29 - 11 pp.], which is a method for detecting hepatitis B virus DNA in biological material based on two-stage PCR followed by sequencing of amplified fragments of four regions of the virus, characterized in that asymmetric PCR with extended oligonucleotide primers is used at the first stage, namely direct primer 5'-CTGCGCACCAGCACCATGCAACTTTTTCACCTCTGC-3' and reverse primer 5'-CAGACCAATTTATGCCTACAGCCTCCT A-3', the products of which are then used for the second amplification step with one of the following nested primer pairs: pair 1 forward primer 5'-GGTC ACCATATTCTTGGGAA-3' reverse primer 5'-AATGGCACTAGTAAACTGAG-3' or pair 2 forward primer 5'-GCCTTAGAGTCTCCTGAGCA-3' reverse primer 5'-GAGGGAGTTCTTCTTCTAGG-3', or pair 3 forward primer 5'-CCATACTGCGGAACTCCTAGC-3' reverse primer 5'-CCCAAGGCACAGCTTGGAGG-3' , or pair 4 forward primer 5'-TCTAGACTCGTGGTGGACTTCTCTC-3' reverse primer 5'-AGTTCCGCAGTATGGATCGG-3'. The composition of the amplification mixture at each stage contains an uneven ratio of deoxynucleoside triphosphates and a high concentration of MgCl ₂ , at the first stage the mixture contains formamide and glycerol in the amount of 4% and 6% of the final volume, respectively, and at the second stage formamide and DMSO in the amount of 4% and 10 % of the final volume, respectively.

The disadvantage of the method lies in the impossibility of its wide application for the detection of latent HBV due to the need for electrophoretic analysis of the amplification products of the second stage of PCR and further sequencing followed by the use of a genetic analyzer (sequencer), which requires an appropriate instrumentation base and specialist qualifications.

The authors proposed a method for detecting hepatitis B virus using nested PCR using, at the first stage, oligonucleotide primers flanking the entire virus genome, and at the second stage, three pairs of oligonucleotide primers to three regions (S gene, X gene, Core gene) of the virus genome, as well as one pair to the fragment of the human HPRT gene and the corresponding oligonucleotide fluorescently labeled probes complementary to the regions of the amplified fragments carrying fluorophores at the 5'-end and non-fluorescent quenchers at the 3'-end. Register the results obtained by hybridization-fluorescent detection in real time.

EFFECT: increased sensitivity and reliability of diagnostics.

The essence of the method lies in the fact that at the first stage, the amplification of the virus DNA is carried out using oligonucleotide primers complementary to the regions of the greatest similarity of the genomes of various HBV isolates, obtaining as a result an amplification product corresponding to the entire virus genome in length. To increase sensitivity, a second polymerase chain reaction is performed using the amplification product of the first reaction, internal (nested, nested) primers for HBV, primers for the human HPRT gene, and fluorescently labeled probes complementary to the fragments amplified at the second stage.

At the first stage, the following oligonucleotide primers are used:

Forward primer: 5'-TTTTTCACCTCTGCCTAATCA-3'

Reverse primer: 5'-AAAAAGTTGCATGRTGMTGG-3'

PCR is carried out under the following conditions:

At the second stage, the amplification product of the first stage is used, as well as the following oligonucleotides, in one tube:

Pair 1:

Forward primer 5'-GATGTGTCTGCGGCGTTTTA-3'

Reverse primer 5'-GCAACATACCTTGATAGTCCAGAAGAA-3'

Probe: 5' - HEX - CCTCTICATCCTGCTGCTATGCCTCA - BHQ1-3'

Pair 2:

Forward primer 5'-GTCTGTGCCTTCTCATCTGCC-3'

Reverse primer 5'-GTCGGTCGTTGACATTGCAG-3'

Probe: 5' - ROX - TGTGCACTTCGCTTCACCTCTGC - BHQ2/RTQ2-3'

Optionally, the following reverse primer variants in pair 2 can be used:

Reverse primer with 5'-CTCAAGGTCGGTCGTTGACA-3'

Reverse primer e 5'-AGTATGCCCTCAAGGTCGGTC-3'

Pair 3:

Forward primer 5'-TTCCGGAAACTACTGTTGTTAGAC-3'

Reverse primer 5'-ATTGAGATTCCCGAGATTGAGA-3'

Probe: 5' - FAM - CCCTAGAAGAAGAACTCCCTCGCCTC - BHQ1-3'

Pair 4:

Forward primer 5'-CTTGCTCGAGATGTGATGAAGG-3'

Reverse primer 5'-CAGCAGGTCAGCAAAGAATTTATAG-3'

Probe: 5'-Cy5 - ATCACATTGTAGCCCTCTGTGTGCTCAAGG - RTQ2-3'

PCR is carried out under the following conditions:

Analyze the results using the software of the instrument used for PCR with real-time detection.

Fluorescent signal accumulation curves are analyzed for four channels:

- a signal is registered along the FAM fluorophore channel, indicating the accumulation of the amplification product of the HBV Core region DNA fragment,

- through the channel for the HEX fluorophore, a signal is recorded indicating the accumulation of the amplification product of the HBV S-region DNA fragment,

- a signal is registered along the channel for the ROX fluorophore, indicating the accumulation of the amplification product of the HBV DNA fragment of the X region.

- a signal is registered along the Cy5 fluorophore channel, indicating the accumulation of an amplification product of a human DNA fragment of the HPRT gene.

The results are interpreted based on the presence (or absence) of the intersection of the fluorescence curve with the cut-off line set at the appropriate level (set in the middle of the linear section of the increase in fluorescence of the positive control in the logarithmic scale), which determines the presence (or absence) of the Ct cycle threshold value for this sample in the corresponding column in the results table.

The result of channel amplification is considered positive if the curve intersects the threshold line once in the area of a significant increase in fluorescence, negative if the curve does not intersect with the threshold line (no Ct or Cp value), doubtful in all other cases.

The principle of interpreting the results is as follows:

- DNA extraction and amplification for the sample is considered successful if the Ct cycle threshold value is obtained on the CY5 channel.

- a sample is considered positive for HBV DNA if a Ct cycle threshold value is obtained on the CY5 channel while simultaneously obtaining a Ct cycle threshold value on the FAM, HEX, ROX channels, or any two of them.

- the sample is considered negative for HBV DNA content if the value of the Ct cycle threshold on the CY5 channel is obtained, while the Ct value on the FAM, HEX, ROX channels is simultaneously absent.

- obtaining a Ct cycle threshold on the CY5 channel while simultaneously obtaining a Ct cycle threshold value for only one FAM, HEX or ROX fluorophore may indicate the presence of HBV DNA in the sample at a load of less than 10 IU / ml. It is recommended to repeat the study of the corresponding sample with the extraction of HBV DNA from an increased plasma volume (200-1000 µl).

- the sample is considered doubtful if there is no value of the threshold cycle Ct on the CY5 channel, as well as in case of obtaining a questionable result on any of the channels. A retest of the appropriate sample is recommended.

At the second stage, the second microtube is put into operation, which includes one of two options for amplification control samples:

- a plasmid containing the nucleotide sequence of the complete genome of HBV genotype D2;

- a plasmid containing a synthetic sequence containing fragments of three HBV target regions - S, Core, X.

Both variants of the control sample are used only at the second stage of amplification, according to the composition of the amplification mixture and the amplification program, as a result, they demonstrate the simultaneous acquisition of Ct cycle threshold values on the FAM, HEX, ROX channels.

Thus, the proposed method differs from the prototype in that, at the first stage, amplification of the DNA of the complete genome of the hepatitis B virus is carried out using oligonucleotide primers complementary to the regions of the greatest similarity of the genomes of various isolates, at the second stage, the amplification of the product of the first reaction is carried out using internal (nested, nested ) primers for HBV primers, primers for the human HPRT gene and fluorescently labeled probes complementary to the fragments amplified at the second stage, followed by real-time signal detection, as well as amplification in a separate container of a control sample. The channel corresponding to the FAM fluorophore detects the amplification product of the DNA of the HBV Core region. The channel for the HEX fluorophore recorded a signal indicating the accumulation of the amplification product of the HBV S-region DNA fragment. The channel corresponding to the ROX fluorophore detects the amplification product of HBV X-region DNA. The channel for the CY 5 fluorophore recorded a signal indicating the accumulation of an amplification product of a human DNA fragment of the HPRT gene. That is, our proposed method differs from the prototype in the composition of the primers, the detection method, the presence of an internal control (DNA extraction control) and a synthetic positive control of the second stage of amplification, and the resulting change in reaction conditions.

The analytical sensitivity of the method was tested by stepwise dilution.

Were selected 10 blood plasma samples containing various concentrations of HBV. Viral load was preliminarily measured using a standardized kit for the quantitative determination of HBV DNA in clinical material by polymerase chain reaction (PCR) with real-time hybridization-fluorescence detection "AmpliSense® HBV-Mohhtop-FL" (TsNIIE, Moscow).

Each sample was diluted in steps with pre-analyzed HBV-free blood plasma (pure plasma) as follows. A 100 µl sample aliquot was added to a 1.5 ml Eppendorf microtube, 100 µl of pure plasma was added, carefully pipetted, and 100 µl of the obtained pool was transferred into a new microtube, where 100 µl of pure plasma was again added, pipetted, and 100 µl of the new pool was transferred to the third test tube, etc. up to tenfold serial dilution.

After dilution, DNA was extracted from each dilution pool of each sample using a set of reagents for RNA/DNA extraction from clinical material "RIBO-prep" (Federal Budgetary Scientific Institution of Central Research Institute, Moscow) or any other kit with similar characteristics. The resulting DNA samples were amplified according to the proposed method.

The analytical sensitivity of the method for HBV DNA isolation using the AmpliPrime RIBO-prep reagent kit (Central Research Institute of Epidemiology of Rospotrebnadzor) or any other reagents with similar characteristics was 10 IU/ml with a volume of extracted material of 100 µl, 3 IU/ml with a volume of extracted material of 500 µl.

The analytical specificity of the reagent kit was assessed by adding the following viruses to the genomic DNA/cDNA amplification reaction: hepatitis A virus, hepatitis C virus, hepatitis D virus, hepatitis E virus, hepatitis G virus, human immunodeficiency virus, Epstein-Barr virus, cytomegalovirus, virus herpes simplex types 1 and 2, herpes virus types 6 and 8, parvovirus B19, tick-borne encephalitis virus, and human genomic DNA.

When testing DNA/cDNA samples of the above viruses and human DNA, no nonspecific reactions were detected, which confirms the specificity of the developed method.

The essence of the invention is illustrated by drawings, where in Fig. Figure 1 shows fluorescence curves reflecting the dynamics of the formation of reaction products during the second stage of the proposed method - real-time PCR using TaqMan technology. The CY5 curve is marked, which is the result of amplification of the human HPRT gene, indicating the success of DNA extraction and subsequent amplification, as well as the FAM, HEX, ROX curves, which are the result of amplification of three regions of the HBV genome. In FIG. Figure 2 shows fluorescence curves reflecting the dynamics of formation of reaction products during the second stage of the proposed method using successive dilutions of a synthetic control sample. FAM, HEX, ROX curves are indicated, which are the result of amplification of three synthetic fragments of the positive HBV DNA control corresponding to three regions of the HBV genome, and the concentrations of the control sample are indicated in the format number of copies / in the reaction - 4*10 ⁶ , 4*10 ⁵ , 4*10 ⁴ , 4*10 ³ , 4*10 ² , 4*10.

Below are examples of the specific use of the proposed method.

Example 1

Blood plasma of 96 pregnant women, gestational age 10-16 weeks. All patients are seronegative for hepatitis B virus. When using standard kits, hepatitis B virus DNA was not detected in blood plasma. Using our proposed method, hepatitis B virus DNA was detected in blood plasma in 2 patients. In one case, the FAM, HEX, and ROX signals were recorded; in the other case, only the FAM signal was recorded; however, when DNA was extracted from 200 μl of plasma, all three signals were recorded. The results obtained were confirmed by detection and sequencing of HBV DNA using the method proposed by us earlier.

Example 2

Patients (n=37) of the hemodialysis center were examined. Hepatitis B virus DNA was not detected by standard methods. Using the proposed method, hepatitis B virus DNA was detected in the blood plasma of one patient. The result obtained was confirmed by the detection and sequencing of HBV DNA using the method proposed by us earlier.

Example 3

Blood serum samples obtained from 199 foreign citizens undergoing medical examination for work permits at the Migration Department in the Northwestern Federal District. The proportion of persons positive for HBV serological markers was 36.7% in the following ratios: HBsAg+ - 1.7%, anra-HBs+ - 28.3%, anti-HBcor IgG+ - 18.3%. The occurrence of paired combinations was 1.7% for HBsAg+ and anti-HBcog IgG+, 9.2% for aHTH-HBs+ and anti-HBcor IgG+. There were no seropositive patients for all three HBV markers. Using the AmpliSense® HBV-FL kit (Federal Budgetary Institution of Science, Central Research Institute of Emergencies), sensitivity 100 IU/ml, HBV DNA was detected in 1.7% of cases. When using the proposed method, the occurrence of HBV DNA was 9.2%. Among them, 7.5% of cases are latent (HBsAg-negative) HBV, including negative for all serological markers. The results obtained were confirmed by detection and sequencing of HBV DNA using the method proposed by us earlier.

Example 4

In the course of the work, plasma (serum) samples of 397 conditionally healthy individuals living in the Socialist Republic of Vietnam were examined. When analyzing the prevalence of serological markers, it was shown that the incidence of HBsAg was 12.3%, anti-HBs Ig G 38.5%, anti-HBcor Ig G 56.2%. HBV DNA was detected in all HBsAg-positive cases. Using the proposed method, the virus was identified in 58 HBsAg-negative samples (in 5 of them, when extracting DNA from 100 µl of plasma, only the FAM signal was recorded, and in 2, only the HEX and ROX signals; with an increase in the volume of the material, in all 7 cases, all three signals), which amounted to 14.6%. Thus, among conditionally healthy patients, taking into account HBsAg-positive and negative samples of HBV DNA, 26.95% were detected.

Also during 2018-2020. More than 500 studies have been carried out using the proposed method based on the two-stage PCR technology with real-time detection of three targets. Occult hepatitis B has been identified among blood donors in various geographic regions. The prevalence of occult hepatitis B virus in HIV-infected and HCV-infected patients is shown.

Claims (6)

A method for detecting hepatitis B virus DNA in a biological material based on a two-stage polymerase chain reaction (PCR) with real-time detection of three targets, characterized in that at the first stage, amplification of the virus DNA is used using oligonucleotide primers flanking the entire virus genome, and namely, forward primer 5'-TTTTTCACCTCTGCCTAATC A-3' and reverse primer 5'-AAAAAGTTGCATGRTGMTGG-3', the product of which is then used for the second stage of amplification, carried out in one tube with the following three pairs of nested primers to three regions (gene S, gene X , Core gene) of the virus genome, as well as one pair to the human HPRT gene fragment and the corresponding fluorescently labeled probes: pair 1 forward primer 5'-GATGTGTCTGCGGCGTTTTA-3', reverse primer 5'-GCAACATACCTTGATAGTCCAGAAGAA-3', probe 5'-HEX- CCTCTICATCCTGCTGCTATGCCTCA-BHQ1-3', pair 2 forward primer 5'-GTCTGTGCCTTCTCATCTGCC-3', reverse primer 5'-GTCGGTCGTTGACATTGCAG-3', or 5'-CTCAAGGTCGGTCGTT GACA-3', or 5'-AGTATGCCCTCAAGGTCGGTC-3', probe 5'-ROX-TGTGCACTTCGCTTCACCTCTGC - BHQ2/RTQ2-3', pair 3 forward primer 5'-TTCCGGAAACTACTGTTGTTAGAC-3', reverse primer 5'-ATTGAGATTCCCGAGATTGAGA-3' , probe 5'-FAM CCCTAGAAGAAGAACTCCCTCGCCTC - BHQ1-3', pair 4 forward primer 5'-CTTGCTCGAGATGTGATGAAGG-3', reverse primer 5'-CAGCAGGTCAGCAAAGAATTTATAG-3', probe 5'-Cy5-ATCACATTGTAGCCCTCTGTGTGCTCAAGG - RTQ2-3', and on at the second stage, a positive control sample is introduced into the study, which is a plasmid containing the nucleotide sequences of three target regions of the HBV genome, and the results are interpreted based on the presence or absence of the intersection of the fluorescence curve with the threshold line set at the appropriate level, which is set in the middle of the linear section of the increase in fluorescence of the positive control in a logarithmic scale, which allows to determine the presence / or absence of the value of the threshold cycle Ct for a given sample in the corresponding column in the result table ov, while the result of channel amplification is considered positive if the curve crosses the threshold line once in the region of a significant increase in fluorescence, and negative if the curve does not intersect with the threshold line (no Ct or Cp value), doubtful in all other cases, and - consider that DNA extraction and amplification for the sample were successful if the value of the Ct cycle threshold is obtained on the CY5 channel; - a sample is considered positive for HBV DNA if a Ct cycle threshold value is obtained on the CY5 channel while simultaneously obtaining a Ct cycle threshold value on the FAM, HEX, ROX channels, or any two of them; - the sample is considered negative for the content of HBV DNA if the value of the threshold cycle Ct on the CY5 channel is obtained, while the value of Ct on the FAM, HEX, ROX channels is simultaneously absent; - obtaining a Ct cycle threshold on the CY5 channel while obtaining a Ct cycle threshold value for only one FAM, HEX or ROX fluorophore may indicate the presence of HBV DNA in the sample at a load of less than 10 IU / ml, it is recommended to re-examine the corresponding sample with the extraction of HBV DNA from increased plasma volume (200-1000 µl); - the sample is considered doubtful if there is no value of the threshold cycle Ct on the CY5 channel, and also in case of obtaining a doubtful result on any of the channels, it is recommended to re-examine the corresponding sample.

Images