RU2760788C1 - Precision method for comparative rapid evaluation of effectiveness of antimicrobial substances against the conditionally pathogenic species pseudomonas aeruginosa - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to biotechnology, in particular to laboratory diagnostics, and is intended to quantify the effectiveness of antibacterial drugs and new chemical compounds against the conditionally pathogenic species Pseudomonas aeruginosa.

EFFECT: invention increases the accuracy of assessment and reduces study duration.

1 cl, 2 dwg, 2 ex

Description

The invention relates to the field of medical microbiology, in particular to laboratory diagnostics, and is intended for quantitative assessment of the effectiveness of antibacterial drugs and new chemical compounds in relation to the opportunistic species Pseudomonas aeruginosa.

For many centuries, infectious diseases have been and remain the most dangerous human diseases due to their ability to involve a large number of healthy people in the process within a short period of time. According to the World Health Organization (WHO) in 2013, more than 33 million 225 thousand infectious diseases are registered in the Russian Federation (in 2012 - 31 million 477 thousand). In 2013, 1.9 million people died in Russia, 31,808 (1.7%) from infectious diseases, 33,255,000 cases of infectious diseases were registered, the death rate was 0.096%. Every year the number of patients suffering from infectious diseases increases and does not tend to decrease. In this regard, the question arises of the need to improve the methods for the rapid identification of the pathogen and the precise determination of its sensitivity to drugs, which in turn is necessary for the selection of adequate antibiotic therapy. This requires the development of new unified, accelerated, highly sensitive and highly specific methods for determining the antibacterial efficacy of both original synthetic drugs and new chemical compounds and their derivatives obtained in a number of already proven classes of chemical compounds. The main task of the introduction of these methods is to reduce the time for determining the effectiveness of antimicrobial drug, increase the accuracy and simplicity of the research procedure.

To date, the overwhelming majority of methods for determining the effectiveness of chemical compounds of both synthetic and natural origin are focused on the study of phenotypic traits, which in turn implies high labor intensity, material consumption and duration of the methods used.

A known method for determining the sensitivity of microorganisms to antimicrobial drugs by exposure to laser radiation on samples with various antimicrobial drugs and subsequent measurement of the fluorescence intensity of the samples at different time intervals. Under similar conditions, exposure to laser radiation and measurement of the fluorescence intensity of samples without antimicrobial drugs and comparison of the normalized fluorescence intensities of samples with antimicrobial drugs [patent RU 2321855, 2006]. The disadvantage of this method lies in the laboriousness, high cost of research and the impossibility of quickly obtaining data. It should be noted that this method does not differ in high accuracy and reliability of the results obtained. This is due to the dependence of the experimental results on many factors: stability of laser radiation, environmental pollution, mains voltage, climatic conditions, etc.

A known method for determining the profile of antibiotic resistance of bacteria to increase the effectiveness of antibiotic therapy. The method involves: obtaining a highly purified nucleic acid of a bacterium, visualizing a nucleic acid of a bacterium, obtaining a restriction map of a nucleic acid, comparing a restriction map of a nucleic acid with a database of restriction maps and determining the antibiotic resistance of bacteria by comparing regions of a given nucleic acid with the corresponding regions in the used database. In the future, taking this into account, the optimal antibacterial drugs are selected [patent WO 137139, 2009]. The described method has a number of disadvantages: laboriousness associated with the need to isolate highly purified nucleic acid of bacteria, and timeconsuming, which consists in the duration of the procedure for drawing up and comparing restriction maps, laboriousness.

One of the main conditions for the development of new methods for assessing the effectiveness of antibacterial drugs against both gram-positive and gram-negative bacteria is the ability to obtain accurate quantitative data (precision) that have both high sensitivity and productivity.

The prototype of the invention is a method for determining the sensitivity of microorganisms of the genus Salmonella to antibacterial drugs in the course of an experiment involving incubation of microorganisms of a certain type (final concentration of about 1000 cells / ml) with a test antibacterial drug at a known concentration at 37 ° C for 24 hours. After incubation, aptamers (final concentration 100 nM), including a fluorescent label and specific to the tested species of living microorganisms, are added to the samples. Re-incubate for 20 minutes. The sample is examined by flow cytometry according to the fluorescence intensity of the aptamers, determined from the graphs. As a result, values are obtained showing the proportion of bacteria bound or not bound to aptamers, and thus the number of living or non-living microorganisms in the sample is established [patent RU 2518372, 2012]. It should be noted that the implementation of this method requires the presence of expensive and difficult to operate equipment and consumables. Despite the reduction in labor costs in comparison with standard methods of determination, the proposed method is time-consuming, since it requires more prolonged cultivation with subsequent identification of the culture.

The objective of the present invention is to develop a unified, highly sensitive and specific, non-laborious method for rapid assessment of the effectiveness of antimicrobial compounds against the opportunistic species Pseudomonas aeruginosa with the possibility of obtaining quantitative data.

The technical result when using the invention is to increase the accuracy of the assessment by obtaining quantitative criteria of efficiency, reducing the duration of the study.

The proposed method for assessing the effectiveness of antibacterial drugs, as well as new chemical compounds against Pseudomonas aeruginosa is carried out as follows.

A pure culture of Pseudomonas aeruginosa is used, to obtain which clinical material is taken from infected patients and the clinical material is inoculated on selective agar for Pseudomonas spp. (Pseudomonas Agar (For Pyocyanin)), designed for the selective isolation and enumeration of all Pseudomonas spp., Originally described by King et al., And subsequently recommended by the American Pharmacopoeia Committee for the determination of pseudomonad production of pyocyanin, a water-soluble pigment. On the medium, the production of pyocyanin is stimulated and the formation of fluorescein is suppressed. The pyocyanin diffuses into the medium, causing a blue color around the colonies of the pseudomonads. Some strains produce a small amount of pigment and therefore have a bluish-green coloration.

Further, in accordance with the Clinical Guidelines for Determining the Sensitivity of Microorganisms to Antimicrobial Drugs, approved at an expanded meeting of the Interregional Association for Clinical Microbiology and Antimicrobial Chemotherapy (XVI International Congress on Antimicrobial Chemotherapy MAKMAX / ESCMID, May 21-23, 2014, Moscow), using sterile water or in the study of poorly soluble compounds of the corresponding diluent (deoxymethyl sulfoxide (DMSO)), working solutions of the tested antibacterial substance are prepared from the stock solution. The concentration of the working solution is calculated based on the required maximum concentration in the series of serial dilutions, taking into account the dilution factor of the drug during subsequent inoculation. Then the working solution in an amount of 0.5 ml is introduced into the first tube containing 0.5 ml of sterile water or solvent using a micropipette with a sterile tip. Mix thoroughly and transfer 0.5 ml of antibacterial solution with a new sterile tip into a second tube containing initially 0.5 ml of sterile water or solvent. The procedure is repeated until the entire required series of serial two-fold dilutions has been prepared. Remove 0.5 ml of liquid from the last tube. Thus, a number of test tubes with solutions of antibacterial drugs are obtained, the concentrations of which differ in adjacent test tubes by a factor of 2.

For inoculation, a standard microbial suspension of a pure culture of Pseudomonas aeruginosa is used, equivalent to 0.5 McFarland turbidity standard, prepared using the method of direct suspension in sterile isotonic solution or a diluent of the material of colonies of an 18-24-hour pure agar culture of bacteria grown on a dense selective nutrient medium for pseudomonas (Pseudomonas Agar (For Pyocyanin)). For this, 5 morphologically similar colonies are collected with a sterile bacteriological loop and the resulting material is suspended in a sterile isotonic solution or diluent. The bacterial suspension is brought to an optical density of 0.5 according to the McFarland turbidity standard. This corresponds to a concentration of 1-2 × 10 ⁸ CFU / ml by adding a microbial mass to the suspension or diluting it with a sterile isotonic solution or diluent.

Within 15 minutes after preparation, 5 μl of inoculum is added to each tube (or well of a polystyrene plate) containing 90 μl of nutrient broth and 10 μl of an appropriate dilution of an antibacterial drug, and into one tube (or well of a polystyrene plate) with 100 μl of nutrient broth without antibiotic (positive control). The final concentration of the microorganism in each tube will reach the required one - approximately 5 × 10 ⁶ CFU / ml. All tubes (or wells of a polystyrene plate) with the tested strains are closed and incubated in a normal atmosphere at 37 ° C for 2 hours in a thermostatted shaker.

After the cultivation time has elapsed, DNA is extracted from the contents of the tubes using a kit for isolating DNA from clinical samples ("Lysis solution", JSC "Vector-Best", Russia). The purified DNA serves as a template for real-time quantitative PCR.

To obtain quantitative data by PCR, a panel of calibration samples and a positive control sample of Pseudomonas aeruginosa are constructed.

A calibration sample was constructed using the pAL-TA plasmid (3.0 kb) as a DNA template with an insert of the Pseudomonas aeruginosa 16S rRNA gene region (270 bp), resulting in the pAL-TAPseudAer16S plasmid. Cloning is carried out according to Maniatis T. et al. [Maniatis, T. Methods of genetic engineering. Molecular cloning. Translation from English. language edited by A.A. Baeva and K.G. Scriabin / T. Maniatis, E. Fritsch, J. Sambrook. - Moscow: Mir, 1984, - 479 s]. The total DNA isolated using the Chelex100 ion exchange resin is used as a template for classical PCR in order to accumulate a region of the 16S rRNA gene of Pseudomonas aeruginosa (270 bp). Amplification is carried out on a Tertsik MS-2 thermal cycler (DNA-Technology, Russia) using a pair of species-specific primers to the selected site of the following structure:

5 'agaaagtgggggatcttcggacctca 3'

5 'tgttggtaacgtcaaaacagcaaggtattaactt 3'.

Isolation of the desired amplified site from the reaction mixture is carried out using a DNA purification kit (Cytokin, St. Petersburg). The resulting fragment was cloned using the vector plasmid pAL-TA. For this, a ligation reaction mixture is prepared in a sterile microcentrifuge tube, including a DNA vector and a cloned fragment in an equimolar ratio, a ligation buffer (final concentration 66 mM Tris-HCl, pH 7.5, 5 mM MgCl ₂ , 5 mM dithiothreitol, 1 mM ATP) and DNA ligase of phage T4 (1 unit / μg DNA) (Fermentas, Lithuania). The reaction is carried out at 4-10 ° C overnight.

For transformation, the culture of Escherichia coli XL1 -Blue is grown in a liquid nutrient medium LB at 37 ° C for 16-20 hours. Then bacterial cells are precipitated by centrifugation and the resulting sediment is resuspended in 1/2 of the initial volume of 10 mM CaCl ₂ solution. The resulting solution was incubated for 20 min at room temperature, centrifuged and resuspended in 1/50 of the original volume of 50 mM CaCl ₂ . After 12-24 hours of storage at 2 ° -4 ° C, 0.2 ml of the cell suspension is mixed with 10 μl of the ligation mixture and incubated for 30-60 minutes on ice. Next, the transformation mixture is transferred for 2 min to a water bath (42 ° C) (heat shock), 1 ml of LB medium is added to the suspension, incubated for 1 h at 37 ° C on a shaker or stirring every 15 minutes. Then the mixture is centrifuged for 2 min (4000 rpm), 100 μl of the supernatant containing the transformed cells is taken, and plated on plates with agar LB medium containing the antibiotic ampicillin (Serva, Germany) at a concentration of 100 μg / ml, and also IPTG (isopropyl-beta-galactopyranoside, final concentration 200 mg / ml) and X-gal (5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside, final concentration 20 mg / ml). The dishes are incubated for 16-20 hours in a thermostat at 37 ° C. Colorless colonies are selected from the total number of grown colonies and are already plated on solid nutrient medium LB.

Plasmid DNA is isolated from the grown colorless colonies and, using them as templates, classical PCR is performed to confirm the presence of a gene insert. Separation of amplification products is carried out electrophoretically in a 1.7% horizontal agarose gel (Sigma, USA), followed by visualization after staining with ethidium bromide with ultraviolet light in a photo documentation system. As an electrolyte for electrophoresis, a 50-fold tris-acetate buffer (2 M Tris-base, pH = 8.0; 1.56 M acetic acid, pH 7.6; 50 mM EDTA, pH = 8.0) is used.

One of the "positive" colonies is subcultured for accumulation on plates with agar medium LB containing the antibiotic ampicillin (final concentration 100 μg / ml) and placed in a thermostat at 37 ° C overnight. Most of the grown colonies are removed with a bacteriological loop and transferred to an Eppendorf tube (1.5 ml). Then the plasmid is isolated from bacterial cells using the alkaline method (lysis) using the following buffers: 1) for cell separation - 1M Tris-HCl, 1M EDTA, sucrose; 2) for cell lysis - 10% SDS, 5M NaOH; 3) to neutralize impurities - 5M potassium acetate, 1.56M acetic acid. The resulting plasmid is purified from enzymes, ions and RNA. For this, the DNA preparation is treated with RNAase (final concentration 50 μg / ml) for 16-20 hours at 4 ° -10 ° C. Then the plasmid is dissolved in 25 μl of bidistilled water and preparative electrophoresis (elution) is performed by mixing 25 μl of the plasmid and 20 μl of a mixture of dyes (bromophenol blue, xylene cyanol, 30% glycerol). After elution, DNA is extracted from excised fragments of agarose gel containing DNA of the required length using a DNA purification kit (Cytokin, St. Petersburg).

The purity and concentration of the DNA preparation is determined spectrophotometrically using a NanoDrop 1000 fiber optic spectrophotometer (Thermo Scientific, USA). For spectrophotometric analysis, 1 μL of the sample is applied to a stationary module of the device. The movable module of the device is lowered onto the top of the drop, as a result of which a column of liquid is formed from the sample between the movable and stationary modules. The instrument measures the light absorption in the sample column. The measured concentration of double-stranded DNA is 88.4 ng / μl (2.5 x 10 ¹⁰ copies of DNA / ml).

A positive control sample is obtained by the method described above by inserting a region of the 16S rRNA gene of the opportunistic microorganism Pseudomonas aeruginosa into the pAL-TA vector (Evrogen, Moscow), followed by transformation and production of the plasmid in E. coli XL1-Blue cells.

For the production of PCR in real time, a selected and tested pair of species-specific primers for the DNA regions of Pseudomonas aeruginosa is used

(Ps.aer F_Prl 5 'agaaagtgggggatcttcggacctca 3' and

Ps.aer R_Pr2 5 'tgttggtaacgtcaaaacagcaaggtattaactt 3')

and the reaction mixture PCR-Mix SYBR Green I (SINTOL LLC). PCR is carried out using a detecting amplifier CFX96 Touch "REAL TIME" (Bio-Rad, USA). Results are recorded using Bio-Rad CFX Manager software. The instrument is calibrated with three dilutions of calibration samples prepared by tenfold serial dilutions of the plasmid pAL-TAPseudAerl6S of known concentration. The amplification reaction is carried out in 25 μl of a mixture containing 10 μl of 2.5 × PCR-Mix SYBR Green I reaction mixture, 8 μl of ddH ₂ O, 2 μl of each of a pair of primers and 3 μl of total DNA. Amplification mode: initial denaturation at 95 ° C for 5 min; 35 cycles, including denaturation at 95 ° С - 10 sec, annealing of primers at 59 ° С - 25 sec, elongation at 72 ° С - 30 sec; terminal elongation 72 ° С - 30 sec.

The absolute determination of the level of transcript representation is carried out using a standard curve obtained using calibration samples with different concentrations, and with subsequent determination of the number of copies of Pseudomonas aeruginosa DNA in the test sample by extrapolation to the obtained standard curve.

The absolute number of DNA copies is calculated by the formula:

where:

N ₀ - concentration of matrices of the test sample (GE / sample);

N _or - standard initial concentration (GE / sample);

E - efficiency of RT-PCR;

Ct _or - threshold cycle for a standard sample;

Ct ₀ - threshold cycle for the test sample.

The interpretation of the obtained data of quantitative molecular genetic analysis is carried out taking into account the initial number of DNA copies of the Pseudomonas aeruginosa culture. If the value of the number of DNA copies coincides or differs by no more than 2 times from the initial number of DNA copies of the culture in the nutrient broth before cultivation, the result is interpreted as "positive", the effectiveness of the antibacterial drug is assessed as high, expressed in the complete suppression of the growth of the culture in the nutrient broth ... If the value of the number of DNA copies differs from the initial number of copies of the culture's DNA by more than 2 times, the effectiveness of the antibacterial drug is assessed as low, expressed in partial or complete resistance of the strain to the test compound. Such a quantitative analysis of the antimicrobial activity of several antibacterial drugs at once makes it possible to compare them with each other and choose the most effective one.

The invention is illustrated by the following figures: FIG. 1 shows a graph of the amplification of regions of the 16S rRNA genes of Pseudomonas aeruginosa after short-term cultivation of the microorganism in working solutions of amikacin (antibiotic concentration - from 256 to 1 μg / ml); in fig. 2 is a graph of amplification of Pseudomonas aeruginosa 16S rRNA gene regions after short-term cultivation of the microorganism in working solutions of gentamicin (antibiotic concentration - from 256 to 1 μg / ml).

Method for comparative assessment of the effectiveness of antimicrobial substances against opportunistic species Pseudomonas aeruginosa. illustrated by the following examples.

Example 1.

Using the proposed express testing methodology, a quantitative assessment of the effectiveness of the antibacterial preparation amikacin, which belongs to the pharmacological group of III generation aminoglycosides and is active against both gram-negative and gram-positive aerobic bacteria, was carried out.

At the first stage of the study, successive two-fold dilutions of the antibiotic working solution were performed. In the resulting series of test tubes with solutions of the antibacterial drug, the concentrations in adjacent test tubes differed by a factor of 2 and amounted to 256, 128, 64, 32, 16, 8, 4, 2, 1 μg / ml, respectively. The next step was to prepare a standard microbial suspension of a pure culture of Pseudomonas aeruginosa, equivalent to 0.5 McFarland turbidity standard. For this, several colonies of a pure 18-24-hour culture of bacteria grown on a dense non-selective nutrient medium were added to a sterile isotonic solution. Thus, the concentration of the pure culture of the microorganism was 1.5 × 10 ⁸ CFU / ml.

Then a culture mixture was prepared, consisting of a working dilution of amikacin, a pure culture of Pseudomonas aeruginosa, and a nutrient broth. For this, 5 μl of pure culture within 15 minutes after preparation was introduced into each tube containing 90 μl of nutrient broth and 10 μl of the corresponding dilution of the antibacterial drug. The final concentration of the bacteria Pseudomonas aeruginosa in each tube reached the required concentration - approximately 1.5⋅10 ⁶ CFU / ml. All tubes with the tested strains were closed and incubated in a normal atmosphere at 37 ° C for 2 h.

At the end of the cultivation time, DNA was extracted from the contents of the tubes using a kit for isolating DNA from clinical samples ("Lysis solution", JSC "Vector-Best", Russia). Then, the isolated DNA was used for performing quantitative PCR in real time. The PCR analysis was optimized by using tenfold dilutions of the recombinant plasmid pAL-TAPseudAerl6S (double-stranded DNA concentration 88.4 ng / μl (2.5 × 10 ¹⁰ DNA copies / ml)), constructed by inserting a region of the 16S rRNA gene of the opportunistic microorganism Pseudomonas aeruginosa into the pAL-TA vector (Evrogen, Moscow) with subsequent transformation and plasmid production in E. coli XL 1-Blue cells. Also, when performing quantitative PCR in real time, a positive control sample for the bacterium Pseudomonas aeruginosa, constructed as described above, was used.

To set up PCR in real time, a selected and tested pair of species-specific primers were used for Pseudomonas aeruginosa DNA regions (Ps.aer F_Prl 5 'agaaagtgggggatcttcggacctca 3' and Ps.aer R_Pr2 5 'tgttggtaacagtgtcaa' SINTOL LLC). PCR was performed using a CFX96 Touch "REAL TIME" detecting amplifier (Bio-Rad, USA). The results were recorded using the Bio-Rad CFX Manager software. The amplification reaction was carried out in 25 μl of a mixture containing 10 μl of 2.5 × PCR-Mix SYBR Green I reaction mixture, 8 μl of ddH ₂ O, 2 μl of each of a pair of primers, and 3 μl of total DNA. Amplification mode: initial denaturation at 95 ° C for 5 min; 35 cycles, including denaturation at 95 ° С - 10 sec, annealing of primers at 59 ° С - 25 sec, elongation at 72 ° С - 30 sec; terminal elongation 72 ° С - 30 sec.

(N₀ - концентрация матриц исследуемого образца (ГЭ/образец), N_or - стандартная начальная концентрация (ГЭ/образец), Е -эффективность РТ-ПЦР, Ct_or - пороговый цикл для стандартного образца, Ct₀ - пороговый цикл для исследуемого образца) было рассчитано количество копий ДНК в исследуемых образцах, прошедших культивирование в присутствии антибиотика в концентрациях от 256,0 до 1,0 мкг/мл, а также измерено количество копий ДНК чистой культуры до культивирования. Концентрация чистой культуры в бульоне до культивирования составила 8,50×10⁶ ГЭ/образец. Были получены следующие результаты оценки эффективности рабочих растворов амикацина с различными концентрациями в отношении исследуемого клинического штамма бактерий Pseudomonas aeruginosa, выделенного из клинического материала больных с бактериальной инфекцией: 256 мкг/мл - 8,53×10⁶ ГЭ/образец, 128 мкг/мл - 9,33×10⁶ ГЭ/образец, 64 мкг/мл - 1,38×10⁷ ГЭ/образец, 32 мкг/мл - 1,70×10⁷ ГЭ/образец, 16 мкг/мл - 2,30×10⁷ ГЭ/образец, 8 мкг/мл - 3,03×10⁷ ГЭ/образец, 4 мкг/мл - 1,79×10⁷ ГЭ/образец, 2 мкг/мл - 1,0×10⁷ ГЭ/образец, 1 мкг/мл - 3,43×10⁷ ГЭ/образец (фиг. 1).In accordance with the proposed method according to the formula

(N ₀ is the concentration of matrices of the test sample (GE / sample), N _or is the standard initial concentration (GE / sample), E is the efficiency of RT-PCR, Ct _or is the threshold cycle for the standard sample, Ct ₀ is the threshold cycle for the test sample. ), the number of DNA copies in the test samples that were cultured in the presence of an antibiotic at concentrations from 256.0 to 1.0 μg / ml was calculated, and the number of DNA copies of a pure culture was measured before cultivation. The concentration of the pure culture in the broth before cultivation was 8.50 × 10 ⁶ GE / sample. The following results of evaluating the effectiveness of working solutions of amikacin with various concentrations against the studied clinical strain of bacteria Pseudomonas aeruginosa isolated from clinical material of patients with bacterial infection were obtained: 256 μg / ml - 8.53 × 10 ⁶ GE / sample, 128 μg / ml - 9.33 × 10 ⁶ GE / sample, 64 μg / ml - 1.38 × 10 ⁷ GE / sample, 32 μg / ml - 1.70 × 10 ⁷ GE / sample, 16 μg / ml - 2.30 × 10 ⁷ GE / sample, 8 μg / ml - 3.03 × 10 ⁷ GE / sample, 4 μg / ml - 1.79 × 10 ⁷ GE / sample, 2 μg / ml - 1.0 × 10 ⁷ GE / sample, 1 μg / ml - 3.43 × 10 ⁷ GE / sample (Fig. 1).

Thus, our proposed method for assessing the effectiveness of medicinal compounds against clinically significant strains made it possible to conclude that the use of the antibiotic amikacin at concentrations of 256 μg / ml, 128 μg / ml, 64 μg / ml, 32 μg / ml contributes to a significant suppression of bacterial growth of Pseudomonas aeruginosa than lower antibiotic concentrations because the number of DNA copies differs by no more than 2 times from the initial number of DNA copies of the culture in the nutrient broth before cultivation, the effectiveness of the antibacterial drug at these concentrations is estimated as high, expressed in the complete suppression of the culture growth in the nutrient broth. Accordingly, lower concentrations of the antibiotic (16 μg / ml, 8 μg / ml, 4 μg / ml, 2 μg / ml) are estimated to be ineffective against the selected strain of microorganisms, since the number of DNA copies of microorganisms in the nutrient broth in the presence of an antibiotic after a short cultivation is more than 2 times the number of DNA copies of the culture in the nutrient broth before cultivation.

Example 2.

The proposed rapid testing technique was used to quantify the effectiveness of the antibacterial preparation gentamicin, which belongs to the aminoglycoside group and has a bactericidal effect against many gram-positive and gram-negative bacteria.

At the first stage of the study, successive two-fold dilutions of the antibiotic working solution were performed. In the resulting series of test tubes with solutions of the antibacterial drug, the concentrations in adjacent test tubes differed by a factor of 2 and amounted to 256, 128, 64, 32, 16, 8, 4, 2, 1 μg / ml, respectively. The next step was to prepare a standard microbial suspension of a pure culture of Pseudomonas aeruginosa, equivalent to 0.5 McFarland turbidity standard. For this, several colonies of a pure 18-24-hour culture of bacteria grown on a dense non-selective nutrient medium were added to a sterile isotonic solution. Thus, the concentration of the pure culture was 1.5 × 10 ⁸ CFU / ml.

Then, a culture mixture was prepared, consisting of a working dilution of gentamicin, a pure culture of Pseudomonas aeruginosa, and a nutrient broth. For this, 5 μl of bacterial culture within 15 minutes after preparation was introduced into each tube containing 90 μl of nutrient broth and 10 μl of the corresponding dilution of the antibacterial drug. The final concentration of the bacterium Pseudomonas aeruginosa in each tube reached the required concentration - approximately 1.5⋅10 ⁶ CFU / ml. All tubes with the tested strains were closed and incubated in a normal atmosphere at 37 ° C for 2 h.

At the end of the cultivation time, DNA was extracted from the contents of the tubes using a kit for isolating DNA from clinical samples ("Lysis solution", JSC "Vector-Best", Russia). Then, the isolated DNA was used for performing quantitative PCR in real time. The PCR analysis procedure was optimized by using tenfold dilutions of the recombinant plasmid pAL-TAPseudAerl6S (double-stranded DNA concentration 88.4 ng / μl (2.5 × 10 ¹⁰ DNA copies / ml)), constructed by inserting a region of the 16S rRNA gene of the opportunistic Pseudomonas microorganism aeruginosa into the pAL-TA vector (Evrogen, Moscow) with subsequent transformation and plasmid production in E. coli XL 1-Blue cells. Also, when performing quantitative PCR in real time, a positive control sample for the bacterium Pseudomonas aeruginosa, constructed as described above, was used.

To set up PCR in real time, a selected and tested pair of species-specific primers were used for Pseudomonas aeruginosa DNA regions (Ps.aer F_Prl 5 'agaaagtgggggatcttcggacctca 3' and Ps.aer R_Pr2 5 'tgttggtaacagtgtcaa' LLC SINTOL). PCR was performed using a CFX96 Touch "REAL TIME" detecting amplifier (Bio-Rad, USA). The results were recorded using the Bio-Rad CFX Manager software. The amplification reaction was carried out in 25 μl of a mixture containing 10 μl of 2.5 × PCR-Mix SYBR Green I reaction mixture, 8 μl of ddH ₂ O, 2 μl of each of a pair of primers, and 3 μl of total DNA. Amplification mode: initial denaturation at 95 ° C for 5 min; 35 cycles, including denaturation at 95 ° С - 10 sec, annealing of primers at 59 ° С - 25 sec, elongation at 72 ° С - 30 sec; terminal elongation 72 ° С - 30 sec.

(N₀ - концентрация матриц исследуемого образца (ГЭ/образец), N_or - стандартная начальная концентрация (ГЭ/образец), Е - эффективность РТ-ПЦР, Ct_or - пороговый цикл для стандартного образца, Ct₀ - пороговый цикл для исследуемого образца) было рассчитано количество копий ДНК в исследуемых образцах, прошедших культивирование в присутствии антибиотика в концентрациях от 256,0 до 1,0 мкг/мл, а также измерено количество копий ДНК чистой культуры до культивирования. Концентрация чистой культуры в бульоне до культивирования составила 8,50×10⁶ ГЭ/образец. Для разведений 256, 128, 64, 32, 16, 8, 4, 2, 1 мкг/мл полученные концентрации составили 8,9×10⁶ ГЭ/образец, 16,5×10⁶ ГЭ/образец, 14,3×10⁶ ГЭ/образец, 1,3×10⁷ ГЭ/образец, 1,35×10⁷ ГЭ/образец, 1,86×10⁷ ГЭ/образец, 1,67×10⁷ ГЭ/образец, 4,71×10⁷ ГЭ/образец, 3,09×10⁷ ГЭ/образец соответственно (фиг. 2).In accordance with our proposed method according to the formula

(N ₀ is the concentration of matrices of the test sample (GE / sample), N _or is the standard initial concentration (GE / sample), E is the RT-PCR efficiency, Ct _or is the threshold cycle for the standard sample, Ct ₀ is the threshold cycle for the test sample. ), the number of DNA copies in the test samples that were cultured in the presence of an antibiotic at concentrations from 256.0 to 1.0 μg / ml was calculated, and the number of DNA copies of a pure culture was measured before cultivation. The concentration of the pure culture in the broth before cultivation was 8.50 × 10 ⁶ GE / sample. For dilutions 256, 128, 64, 32, 16, 8, 4, 2, 1 μg / ml, the obtained concentrations were 8.9 × 10 ⁶ GE / sample, 16.5 × 10 ⁶ GE / sample, 14.3 × 10 ⁶ GE / sample, 1.3 × 10 ⁷ GE / sample, 1.35 × 10 ⁷ GE / sample, 1.86 × 10 ⁷ GE / sample, 1.67 × 10 ⁷ GE / sample, 4.71 × 10 ⁷ GE / sample, 3.09 × 10 ⁷ GE / sample, respectively (Fig. 2).

The results of the proposed method for evaluating the effectiveness of working solutions of gentamicin with various concentrations in relation to the investigated clinical strain of bacteria Pseudomonas aeruginosa, isolated from clinical material of patients with bacterial infection, made it possible to make sure that working solutions of the antibiotic at concentrations of 256 μg / ml, 128 μg / ml , 64 μg / ml and 32 μg / ml, 16 μg / ml show rather high activity against the tested Pseudomonas aeruginosa strain, since the number of DNA copies differs by no more than 2 times from the initial number of culture DNA copies in the nutrient broth before cultivation, the effectiveness of the antibacterial drug in these concentrations is estimated as high, expressed in the complete suppression of the growth of the culture in the nutrient broth. Accordingly, lower concentrations of the antibiotic (8 μg / ml, 4 μg / ml, 2 μg / ml) are estimated to be ineffective against the selected strain of microorganisms, since the number of DNA copies of microorganisms in the nutrient broth in the presence of an antibiotic after a short cultivation is more than 2 times the number of DNA copies of the culture in the nutrient broth before cultivation.

Claims (8)

A method for quantifying the effectiveness of antibacterial drugs and new chemical compounds against Pseudomonas aeruginosa, comprising obtaining biological material from a patient with a bacterial infection caused by Pseudomonas aeruginosa; obtaining a pure culture of the microorganism Pseudomonas aeruginosa; short-term cultivation of the studied bacterial strain in various concentrations of antibacterial substance, characterized in that the isolation of bacterial DNA from the culture liquid is carried out; quantitative real-time PCR using a panel of designed calibration samples with a known concentration, and the calibration sample was constructed using pAL-TA plasmid with an insert of the 16S rRNA gene region of Pseudomonas aeruginosa as a DNA template, resulting in the pAL-TAPseudAer16S plasmid, after which determines the number of copies of Pseudomonas aeruginosa DNA in the test sample according to the formula:

where N ₀ is the concentration of matrices of the test sample (GE / sample), N _or - standard initial concentration (GE / sample), E - efficiency of RT-PCR, Ct _or - threshold cycle for a standard sample, Ct ₀ - threshold cycle for the test sample; if the value of the number of DNA copies coincides or differs by no more than 2 times from the initial number of DNA copies of the culture in the nutrient broth before cultivation, the result is interpreted as "positive", the effectiveness of the antibacterial drug is assessed as high, expressed in the complete suppression of the growth of the culture in the nutrient broth ; when the value of the number of DNA copies differs from the initial number of copies of the culture's DNA by 2 or more times, the effectiveness of the antibacterial drug is assessed as low, expressed in partial or complete resistance of the strain to the test compound.

Images