RU2756852C2 - Recombinant plasmid, method for its construction and yeast strain komagataella pastoris - producer of immune interferon gamma of a dog - Google Patents

Abstract

FIELD: biotechnology; genetic engineering; microbiology; veterinary medicine.

SUBSTANCE: invention relates to biotechnology, genetic engineering, microbiological industry and veterinary medicine, and it is a yeast strain - producer of secretory recombinant immune interferon gamma of a dog, containing a plasmid constructed in vitro that provides synthesis of secretory recombinant immune interferon gamma of a dog. A region of a multiple cloning site with a size of 25 bp is removed from pPICZαA plasmid by hydrolysis with XhoI and XbaI restrictases, and then a sequence of a recombinant gamma interferon gene of a dog is ligated according to these restriction sites. The recombinant gene includes a fragment of an open reading frame of the gamma interferon gene optimized for expression in yeast Komagataella pastoris. The final recombinant protein is purified by affinity chromatography, then cells of Escherichia coli bacteria are transformed with a ligase mixture and clones containing recombinant plasmid DNA pIFN-Gcf are selected.

EFFECT: invention makes it possible to create a yeast strain Komagataella pastoris, which can be used to obtain a veterinary drug based on interferon gamma of a dog (Canis familiaris) for the prevention and treatment of infectious viral diseases of pets, such as dog plague, dog parvovirus, dog parainfluenza virus, dog infectious hepatitis.

3 cl, 4 dwg, 2 ex

Description

The invention relates to biotechnology, genetic engineering, microbiological industry and veterinary medicine and is a yeast strain - producer of secretory recombinant immune interferon gamma dog, containing constructed in vitro plasmid, which provides the synthesis of secretory recombinant immune interferon gamma dog.

Currently, the number of domestic dogs in Russia and the world is growing rapidly, and therefore the problem of prevention and treatment of viral diseases of domestic animals is becoming especially acute. The most dangerous highly lethal viral diseases of dogs are dog plague, canine parvovirus, canine parainfluenza virus, and infectious canine hepatitis. Interferon-based therapy, in particular interferon gamma, can be an effective method of treatment. The immune interferon, interferon gamma, belongs to a vast group of evolutionarily related proteins called interferons. The formation of interferon gamma occurs in T-lymphocytes and NK-cells (natural killer cells) under the influence of viruses and tumor cells, respectively. Gamma interferon activates specific cellular immunity, stimulates the cytotoxicity of macrophages, and increases the body's resistance to various infections. The use of authentic canine interferon gamma potentially has far fewer side effects on the immune system of dogs and related species compared to the use of similar human proteins. However, systematic studies of the spectrum of biological action of authentic gamma-interferon of the dog Canis familiaris, as well as its use as a drug, are difficult, since at present there are no preparations of gamma-interferon for dogs in Russia.

A promising approach for the production of Canis familiaris gamma-interferon in significant quantities is the use of microorganisms as producers of this preparation. The use of Escherichia coli bacteria for these purposes is risky, since this bacterium is a conditionally pathogenic microorganism, and preparations of interferon gamma obtained from bacterial cells may contain endotoxins. The foregoing indicates that it is promising to create strains producing dog interferon gamma based on other microorganisms, in particular, yeast [1]. The use of non-pathogenic microorganisms (yeast) that do not contain toxic and pyrogenic factors, as producers of animal proteins, allows the use of recombinant proteins in veterinary practice. The yeast Komagataella pastoris (Pichia pastoris) looks especially promising in this case, since it combines such important parameters as non-pathogenicity, ease of cultivation and low cost of the final product, as well as the absence of immunogenic alpha-1,3-mannose bonds in the composition of glycoproteins.

The patent JP 11266868 [2] was adopted as a prototype. In this case, the yeast Saccharomyces cerevisiae is used as a producer organism for the production of gamma interferon in a dog. For the cultivation of yeast, media of a relatively simple composition are used; methods for increasing the level of production and secretion of recombinant proteins have been developed for them. The disadvantage of this expression system is the hyperglycosylation of secreted glycoproteins [3]. In addition, it is known that recombinant glycoproteins contain mannose residues linked by alpha-1-3 bonds, which are strong antigenic determinants [4]. This circumstance limits the use of recombinant glycoproteins synthesized by the yeast S. cerevisiae as drugs. Dog interferon gamma is a glycoprotein, therefore, the expression system based on the yeast S. cerevisiae is not applicable for its production.

The claimed invention is free from the indicated drawback due to the fact that the yeast Komagataella pastoris is used as a producer. Therefore, the production of gamma interferon from dogs using the yeast Komagataella pastoris, which does not have this limiting factor, is promising.

The aim of the proposed object of the invention is to create a strain of yeast Komagataella pastoris, which can be used to obtain a veterinary drug based on interferon gamma dog (Canis familiaris) for the prevention and treatment of infectious viral diseases of domestic animals, such as canine distemper, canine parvovirus, canine parainfluenza virus, infectious hepatitis in dogs.

Plasmid pIFN-Gcf, which provides the synthesis of gamma-interferon of the dog by the yeast cells transformed by it, consists of the following elements:

- XhoI-XbaI - a fragment of plasmid DNA of the yeast vector pPICZαA with a size of 3568 bp. (from which the region of the multiple cloning site of 25 bp between the recognition sites of the restriction enzymes XhoI and XbaI has been removed), including the gene for resistance to zeocin, the bacterial replication initiation region; a fragment of the 5'-non-coding region of the yeast gene AOX1 size of 940 bp, containing a region that provides activation of the transcription of this gene in the presence of methanol as a carbon source in the culture medium; a fragment of the AOX1 gene with a size of 342 bp, containing the region of termination of the transcription of this gene;

- XhoI-XbaI - a 449 bp fragment containing the coding part of the canine interferon gamma gene;

The pIFN-Gcf plasmid DNA scheme is depicted in FIG. 1, where XhoI and XbaI are the recognition sites of the corresponding restriction endonucleases. The total size of the plasmid pIFN-Gcf is 3949 bp.

To achieve the goal, the following method is used for constructing a plasmid that provides the synthesis of gamma-interferon of a dog in yeast cells. From the plasmid pPICZαA (Invitrogen) using the restriction enzymes XbaI and XhoI, a 25 bp fragment of the multiple cloning site is excised, after which the vector is dephosphorylated. - obtained by treatment with restriction enzymes XbaI and XhoI of the intermediate vector pAL2T-IFN-Gcf, constructed earlier by ligating the PCR product of the canine interferon gamma gene fragment with the linearized vector pAL2T (Evrogen). The nucleotide sequence of the canine interferon gamma gene (SEQ ID NO: 1) was optimized for expression in Komagataella pastoris yeast by replacing native mammalian codons with those most commonly found in the yeast.

The resulting ligase mixture is used to transform cells of strain XL1Blue (Evrogen), followed by sowing on a low-salt LB medium with the addition of zeocin. Using restriction and PCR analysis, the presence of the plasmid pIFN-Gcf in transformants is proved.

After integration of the specified sequence into the vector pPICZαA, the open reading frame of the final recombinant canine interferon gamma protein contains: the secretion signal αMF-factor of the yeast Saccharomyces cerevisiae, a fragment of the open reading frame of the canine interferon gamma gene, optimized for expression in Komagataella pastoris yeast by replacing native mammals codons for the most commonly found in this yeast species, as well as the cMus epitope sequences and Hisx6 tags for the purification of the final recombinant protein by affinity chromatography (SEQ ID NO: 2).

The choice of the plasmid design for the production of gamma interferon in dogs is due to the following reasons. Plasmid pIFN-Gcf was obtained on the basis of the yeast integrative vector pPICZαA. As a result of transformation with a linearized plasmid and subsequent homologous recombination, the expression cassette is inserted into the chromosome of the yeast Komagataella pastoris, which ensures stable maintenance of the cloned interferon gamma gene. The plasmid contains a gene for resistance to zeocin, which makes it possible to selectively select bacterial and yeast transformants on a selective medium with the addition of zeocin.

Expression of the canine interferon gamma gene in the pIFN-Gcf plasmid is under the control of the AOX1 gene promoter, which contains regions that activate transcription in the presence of methanol in the culture medium, as well as the region of transcription initiation. The AOX1 gene promoter is one of the most powerful yeast promoters. The expression level of genes under the control of the AOX1 promoter is efficiently regulated by carbon sources. Transcription of the AOX1 gene is completely blocked when growing yeast on a medium with glucose; on a medium with glycerol, only the basal level of gene expression is observed. The use of methanol as the only carbon source significantly enhances the expression of the AOX1 gene and, therefore, genes under the control of the AOX1 promoter. This allows you to regulate the synthesis of canine interferon gamma in yeast cells. Regulated expression of the cloned gene can significantly reduce the metabolic load on the yeast cell.

Strain Y-3486-IFN-Gcf is used as a producer of gamma-interferon. Strain Y-3486-IFN-Gcf was obtained by transformation of the yeast strain Komagataella pastoris Y-3486 (wt) (VKPM) with the pIFN-Gcf plasmid. Strain Y-3486 does not carry the gene for resistance to zeocin, which makes it possible to selectively select transformants carrying the pIFN-Gcf plasmid.

The strain of the yeast Komagataella pastoris Y-3486-IFN-Gcf is characterized by the following features.

Cultural and morphological characteristics.

On complete yeast medium forms creamy colonies, smooth, shiny, pasty consistency, cells from round to oval (2.0-4.0) × (2.2-5.8) microns. On a liquid medium it forms a sediment and a film. The culture has a characteristic methylotrophic yeast odor.

Cells grow well in YEPD complete yeast medium: 2% peptone, 1% yeast extract, 2% glucose, or 1% glycerol.

In addition, cells grow well on the SC mineral medium: 1.34% Yeast Nitrogen Base (Difco, USA), 2% glucose (1% glycerol, 0.5% methanol), as well as other synthetic yeast media.

Physiological and biochemical signs.

Cells grow in the range from 4 to 35 ° C. The optimum growing temperature is 30 ° C. When growing under aerobic conditions, the cells slightly alkalize the medium. The optimum pH for growth is 4.5-6.5.

Cells can use many simple compounds as a carbon source, such as glucose, glycerol, methanol.

Cells can use mineral salts in the ammonium form, amino acids, and urea as a source of nitrogen.

The cells are capable of aerobic growth.

The essential characteristic of the strain is its resistance to zeocin.

The method of obtaining plasmid pIFN-Gcf is illustrated by the following example.

EXAMPLE 1.

The nucleotide sequence of the recombinant canine interferon gamma gene (SEQ ID NO: 1) was obtained by chemical synthesis and includes a fragment of the open reading frame of the canine interferon gamma gene, optimized for expression in the yeast Komagataella pastoris by replacing the native mammalian codons with the most common codons in the data yeast, as well as cMus epitope sequences and Hisx6 tags for purification of the final recombinant protein by affinity chromatography. The optimized sequence was ligated into the pUC57 intermediate vector and provided in this form by the gene synthesis company (Evrogen).

The following PCR primers (5 '-> 3') were used to amplify the indicated fragment of the dog interferon gamma gene (5 '-> 3'): forward primer CTCGAGAAAAGACAAGCTATGTTCTT containing an XhoI restriction site and reverse primer TCTAGACCCTTAGAAGCTCTTCTACCTCTXbaI containing a restriction site.

PCR reaction mode:

1 cycle: 95 ° С - 3 min.

30 cycles:

95 ° С - 30 sec.

55 ° C - 30 sec.

72 ° C - 60 sec.

1 cycle: 72 ° С - 3 min.

Next, electrophoresis of the PCR reaction product was carried out in 0.7% agarose gel in TBE buffer (0.1 M tris-borate buffer, pH 8.3, containing 1 mM EDTA). The molecular marker 1 kb NL001 (Evrogen) was used to control the size of the amplified DNA fragment during electrophoresis. The result of the check - an electropherogram of the PCR products during amplification of a fragment of the canine interferon gamma gene - is shown in FIG. 2, where 1 is a PCR product sample, M is a DNA molecular weight marker. The size of the PCR product corresponds to the calculated 449 bp.

Isolation of the PCR fragment of the dog interferon gamma gene from the agarose gel is carried out according to the method developed by the company QIAGEN. A strip of gel with a DNA fragment is placed in a test tube and QX1 solution (300 μl per 100 mg of gel) is added. The sample is heated to 50 ° C, QIAEX reagent (10 μl per 5 μg DNA) is added and incubated at 50 ° C for 10 minutes, stirring occasionally. Then centrifuged for 30 seconds at 15000 rpm, the supernatant is discarded, the precipitate is extracted twice with solutions QX2 and QX3, the supernatant is removed by centrifugation at 15000 rpm for 30 seconds. The precipitate is air-dried, dissolved in 20 μl of TE buffer, centrifuged for 30 seconds at 15000 rpm, the supernatant is transferred to a new tube.

The isolated PCR fragment of the dog interferon gamma gene is ligated with a linearized vector pAL2T (Evrogen). For this 10 μl reaction mixture (2 μl 5X Quick ligation buffer, 1 μl pAL2-T vector (50 ng / μl), 1 μl Quick-TA T4 DNA ligase, 3 μl PCR product (50 ng / μl), 3 μl water ) were incubated for 30 minutes at 22 ° C. The ligation product is the pAL2T-IFN-Gcf plasmid.

The resulting ligation mixture is used to transform competent Escherichia coli bacteria. 200 μl of competent cells with the addition of 1-2 μl of ligation mixture are incubated for 15-20 minutes on ice. Then, a heat shock is carried out for 60-90 seconds, with the cells returning to ice for 2 minutes. After adding LB medium (1% peptone, 0.5% yeast extract, 1% sodium chloride), incubation is carried out for one hour. An aliquot of 100 μl is plated onto solid LB medium with ampicillin. Colonies of transformants are selected after incubation for 12 hours at 37 ° C.

Cells of Escherichia coli bacteria containing the pAL2T-IFN-Gcf plasmid are grown at 37 ° C overnight in 1 L of LB culture medium (1% peptone, 0.5% yeast extract, 1% sodium chloride) containing ampicillin at a concentration of 50 mg / l. Cells are harvested by centrifugation at 5000 rpm for 10 minutes at 4 ° C, suspended in 20 ml of 25 mM Tris-chloride buffer (pH 8.0) containing 10 mM EDTA and 50 mM glucose, 30 mg of lysozyme is added and incubated for 10 minutes at room temperature. Then add 40 ml of 0.2M sodium hydroxide containing 1% sodium dodecyl sulfate, gently mix and incubate for 10 minutes at 4 ° C. The solution is neutralized by adding 30 ml of 3M sodium acetate (pH 5.0) and incubated for 10 minutes at 4 ° C. Then centrifuged at 14000 rpm for 40 minutes at 4 °. 0.6 volume of isopropyl alcohol is added to the supernatant, incubated for 20 minutes at room temperature and centrifuged at 14000 rpm for 20 minutes at 20 ° C. The resulting precipitate is washed with 70% ethyl alcohol, dried in vacuum and dissolved in 4 ml of distilled water. Then add 4.2 g of cesium chloride and 0.36 ml of a solution of ethidium bromide (10 mg / ml). The resulting solution is incubated for 1 hour at 4 ° C, then centrifuged at 15,000 rpm for 15 minutes. The supernatant is centrifuged at 70,000 rpm for 16 hours in a TL 100 centrifuge (Beckman). After centrifugation, a band of plasmid DNA is selected (the lower of two bands fluorescent in ultraviolet light), ethidium bromide is extracted twice with an equal volume of iso-amyl alcohol, diluted twice with distilled water, and plasmid DNA is precipitated with two volumes of ethyl alcohol and 1/15 volume of 3 M acetate sodium (pH 5.0). The precipitate is collected by centrifugation at 10,000 rpm for 10 minutes, washed with 70% ethyl alcohol and dissolved in 0.5-1 ml of TE buffer (10 mM Tris-chloride buffer, pH 8.0, containing 1 mM EDTA).

The concentration of plasmid DNA is determined by the absorbance of the solution at a wavelength of 260 nm. The purity of the preparation is controlled by electrophoresis in 0.7% agarose gel in TBE buffer (0.1 M tris-borate buffer, pH 8.3, containing 1 mM EDTA).

Hydrolysis of plasmid pAL2T-IFN-Gcf with restriction endonucleases XbaI and XhoI is carried out in 10 mM Tris-chloride buffer (pH 8.0) containing 100 mM potassium chloride, 5 mM magnesium chloride, 0.02% Triton X-100 and 0.1 mg / ml bovine serum albumin. To 5 μg of plasmid DNA in a volume of 20 μl add 5 units. each restriction enzyme, after which the sample is incubated for 2 hours at 37 ° C. Next, the restriction products are separated by electrophoresis in agarose gel and the fragment corresponding to the insert of the synthetic dog interferon gamma gene is isolated. Isolation of the insert DNA fragment from the agarose gel is carried out according to the above QIAGEN method.

Similarly, the plasmid pPICZαA is treated with restriction enzymes XbaI and XhoI. Additionally, the restriction product is dephosphorylated with alkaline phosphatase AnP (NEB). To do this, add to 20 μl of the reaction mixture: 2 μl of tenfold buffer, 1-3 μl of plasmid DNA (50 ng / μl), deionized water - up to 20 μl, 1 μl (5 units) of alkaline phosphatase. Incubated for 30 minutes at 37 ° C. The reaction is stopped by heating to 80 ° C for 2 minutes. The DNA is purified by gel filtration on spin columns followed by precipitation with 96% ethanol to remove phosphatase.

To obtain plasmid pIFN-Gcf, ligation of 1 μg of dephosphorylated linearized vector pPICZαA, digested with restriction enzymes XbaI and XhoI, and 3 μg insert of the target gene digested with restriction enzymes XbaI and XhoI, in 10 μl 70 mM Tris-chloride buffer containing 5 mM dithiothreitol, 5 mM magnesium chloride, 1 mM ATP, adding 10 units. Phage T4 DNA ligase and incubating at 14 ° C overnight.

The resulting ligase mixture is used to transform cells of Escherichia coli XL1-Blue recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F'proAB lacI ^q ZΔM15 Tn10 (Tet ^r )] (Evrogen). For this, Escherichia coli cells are grown in 100 ml of LB medium at 37 ° C until the culture reaches a cell suspension density corresponding to 0.4-0.6 units. optical density at a wavelength of 550 nm. The cell suspension is cooled in an ice bath, centrifuged at 5000 rpm for 10 minutes at 4 ° C. The cells are suspended in 100 ml of 10 mM sodium chloride, collected by centrifugation under the same conditions. Then the cells are suspended in 50 ml of 75 mM calcium chloride, kept in an ice bath for 40 minutes, precipitated by centrifugation under the same conditions and suspended in 1 ml of 75 mM calcium chloride. Glycerol is added to a suspension of competent cells to a final concentration of 15%, aliquoted and stored at -70 ° C. Before transformation, the suspension of competent cells is thawed in an ice bath, a ligase mixture is added and incubated in an ice bath for 40 minutes. Then the cells are exposed to heat shock at 42 ° C for 2 minutes, after which they are incubated in 1.5 ml of LB medium at 37 ° C for 1 hour. Cells are harvested by centrifugation at 5000 rpm for 10 minutes and plated on Petri dishes with low-salt LB medium containing 0.5% NaCl, 2% agar and 25 μg / ml zeocin. The dishes are incubated at 37 ° C for 12-16 hours.

Plasmid DNA was isolated from the grown individual transformant clones using the technique used to obtain plasmid pAL2T-IFN-Gcf, except that Escherichia coli cells were grown in 10 ml LB, and, accordingly, the volumes of all solutions were reduced by 100 times, and carried out PCR check for the presence of a target gene insert. For this, primers are used for the 5'-AOX1 promoter and 3'-AOX1 in the plasmid: (5 '-> 3'): forward primer GACTGGTTCCAATTGACAAGC, corresponding to the 5'-AOX1 promoter, and reverse primer GCAAATGGCATTCTGACATCC1, corresponding to the term 3'-AOX ... The result of the check - PCR electrophoretogram for 4 samples on the matrix of the plasmid pIFN-Gcf - is shown in Fig. 3, where 1, 2, 3, 4 are samples of PCR products, M is a DNA molecular weight marker. The size of the PCR product corresponds to the calculated size of 945 bp.

PCR reaction mode:

1 cycle: 95 ° С - 3 min.

30 cycles:

95 ° С - 30 sec.

55 ° C - 30 sec.

72 ° C - 90 sec.

1 cycle: 72 ° С - 2 min.

The plasmid pIFN-Gcf is preparatively isolated from the thus identified clone, as described for the plasmid pAL2T-IFN-Gcf, and digested with the restriction enzyme PmeI in a single buffer (50 mM sodium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg / ml bovine serum albumin, pH 7.9 at 25 ° C) (NEB). The PmeI fragment of plasmid pIFN-Gcf, 3949 bp in size, was isolated according to the method described above from QIAGEN, excluding the heating step, and used to transform yeast cells, as described in example 2.

EXAMPLE 2.

To obtain a strain of the yeast Komagataella pastoris Y-3486-IFN-Gcf -producer of secretory recombinant immune interferon gamma dog, yeast cells of the strain Komagataella pastoris Y-3486 (wt) are transformed with the plasmid pIFN-Gcf.

Yeast cells are grown in 100 ml of YEPD medium at 30 ° C until the culture reaches an optical density corresponding to 2-4 absorbance units at a wavelength of 600 nm. The cells are washed twice with sterile water, then suspended in 0.3 ml of 100 mM lithium acetate solution and incubated at 30 ° C for 30 minutes. To 50 μl of the resulting cell suspension add 0.1-1 μg of plasmid DNA, 50 μg of salmon sperm DNA, previously denatured by heating (10 minutes at 100 ° C) and 0.3 ml of a solution of 100 mM lithium acetate containing 40% polyethylene glycol 4000. Then the sample is incubated for 30 minutes at 30 ° C and 20 minutes at 42 ° C, placed in an ice bath for 15 seconds and centrifuged for 10 seconds at 10,000 rpm. The cells are suspended in 1 ml of sterile water and plated on solid YPD complete yeast medium containing 100 μg / ml zeocin. Transformant clones grow in 2-3 days.

To analyze the production of dog interferon gamma by cells of transformants, they are grown at 30 ° C in 100 ml of BMGY liquid medium (2% peptone, 1% yeast extract, 1% glycerol, 10 ml of 1 M potassium phosphate buffer, pH 6.0, 1, 34% Yeast Nitrogen Base (Difco, USA) until the stationary growth phase for 2 days The cells are harvested by centrifugation at 5000 rpm for 10 minutes, the supernatant is discarded, and the entire biomass is transferred into 100 ml of liquid BMMY medium (2% peptone, 1% yeast extract, 0.5% methanol, 10 ml of 1 M potassium phosphate buffer, pH 6.0, 1.34% Yeast Nitrogen Base (Difco, USA) to induce the expression of the interferon gamma gene. carried out at 30 ° C for 4 days.After the induction, samples of the culture liquid are taken, from which the protein is concentrated by precipitation with 80% ammonium sulfate solution.The separation of proteins is carried out in 15% polyacrylamide gel under de-aiding conditions (electrode buffer: 25 mM Tris, 192 mM glycine , 0.1% sodium dodecyl sulfate, pH 8.3; gel buffer: 375 mM t rice-chloride buffer, pH 8.8). In parallel, the separation of proteins of the control strain (wild-type strain Y-3489), grown under identical conditions, is carried out. Lactate dehydrogenase (35.0 kDa), restriction endonuclease Bsp98I (25.0 kDa), (3-lactoglobulin (18.4 kDa), lysozyme (14.4 kDa) are used as molecular weight standards. Among the secreted proteins of the producer strain Y -3486-IFN-Gcf, an additional protein band with a molecular weight of about 19.4 kDa appears, which corresponds to the calculated mass of recombinant dog interferon gamma (SEQ ID NO: 2), calculated by the service https://sciencegateway.org/tools/proteinmw.htm The results of electrophoresis of the culture fluid proteins are shown in Fig. 4, where 1 - proteins from the culture fluid of the Y-3486-IFN-Gcf protein strain, M - protein molecular weight marker, -K - proteins from the culture fluid of the wild-type Y-3486 protein strain ...

The level of synthesis of recombinant canine interferon gamma is determined by comparing the intensity of staining of the band of the recombinant protein with the band of the marker protein of the corresponding weight. Β-lactobulin was taken as a concentration marker (molecular weight 18.4 kDa, concentration 0.1 mg / ml). According to the data obtained, the Y-3486-IFN-Gcf strain synthesized about 527 mg / l of yeast culture.

The proposed strain of the yeast Komagataella pastoris Y-3486-IFN-Gcf turned out to be an effective producer of recombinant dog interferon gamma and can be used to obtain a veterinary drug for the prevention and treatment of infectious viral diseases in domestic animals. Sources of information used:

1. Celik E., Calik P. Production of recombinant proteins by yeast cells // Biotechnol. Adv. 2012. V. 30 (5). P. 1108-1118.

2. Patent JP 11266868 (prototype).

3. Kukuruzinska M.A., Lennon K. Diminished activity of the first N-glycosylation enzyme, dolichol-P-dependent N-acetylglucosamine-l-P transferase (GPT), gives rise to mutant phenotypes in yeast // Biochim. Biophys. Acta. 1995. V. 1247. P. 51-59

4. Ballou C.E. A study of the immunogenicity of three yeast mannans // J. Biol. Chem. 1970. V. 245. P. 1197-1203.

Claims (6)

1. Recombinant plasmid DNA pIFN-Gcf, providing the biosynthesis of secretory recombinant interferon gamma of the dog, having a size of 3949 bp. and consisting of the following elements: - XhoI-XbaI - a 3568 bp fragment of the plasmid DNA of the yeast vector pPICZαA. (from which the region of the multiple cloning site of 25 bp between the recognition sites of the restriction enzymes XhoI and XbaI has been removed), including the gene for resistance to zeocin, the bacterial replication initiation region; a fragment of the 5'-non-coding region of the yeast gene AOX1 size of 940 bp, containing a region that provides activation of the transcription of this gene in the presence of methanol as a carbon source in the culture medium; a fragment of the AOX1 gene with a size of 342 bp, containing the region of termination of the transcription of this gene; - XhoI-XbaI - a 449 bp fragment containing the coding part of the canine interferon gamma gene; - unique recognition sites for the following restriction enzymes: XhoI - 1185 bp; HindIII - 873 bp; XbaI - 628 bp; HpaI - 1496 bp; BsrGI - 3125 bp; PmeI - 414 bp 2. A method of constructing a recombinant plasmid DNA pIFN-Gcf according to claim 1, providing the synthesis of secretory recombinant dog interferon gamma in Komagataella pastoris yeast cells, consisting in the fact that from the plasmid pPICZαA by digestion with restriction enzymes XhoI and XbaI, the region of the multiple cloning site of 25 bp is removed. and then ligate at these restriction sites the sequence of the recombinant canine interferon gamma gene, including a fragment of the open reading frame of the interferon gamma gene, optimized for expression in Komagataella pastoris yeast by replacing the codons native to mammals with the most frequently found in these yeasts, as well as the cMus epitope sequences and Hisx6 tags for purification of the final recombinant protein by affinity chromatography, then the ligase mixture is used to transform Escherichia coli bacteria cells and select clones containing the recombinant plasmid DNA pIFN-Gcf. 3. Recombinant strain of yeast Komagataella pastoris Y-3489-IFN-Gcf - producer of recombinant dog interferon gamma obtained by transformation of the yeast strain Komagataella pastoris Y-3489 (VKPM) plasmid pIFN-Gcf according to claim 1.

Images