RU2736827C2 - Compositions containing bacillus recombinant cells and another biological control agent - Google Patents

Abstract

FIELD: biochemistry.SUBSTANCE: invention relates to a composition for enhancing plant growth and promoting viability of a plant comprising recombinant exosporia-producing Bacillus cells of a Bacillus cereus family, which express fused protein, as well as at least one biological control agent selected from a group consisting of Bacillus subtilis QST713 and Bacillus firmus I-1582 in a synergistically effective amount. Also disclosed is a seed coated with said composition. Invention also relates to a method of treating a plant, a portion of plants or a locus surrounding a plant, for enhancing plant growth, as well as to promote plant viability, using said composition.EFFECT: invention allows to effectively enhance plant growth and promote viability of a plant.17 cl, 1 dwg, 8 tbl, 4 ex

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the priority of US Provisional Application No. 62/051,911, filed September 17, 2014, the entire contents of which are incorporated herein by reference.

LINK TO ELECTRONIC SEQUENCE LIST

An official copy of the sequence listing is filed electronically via EFS-Web as an ASCII-formatted sequence listing with a file titled “BCS149057WO_ST25.txt” that was created on September 14, 2015, 152 kilobytes in size, and filed simultaneously with the application. The sequence listing contained in the ASCII-formatted document is part of the description and is therefore incorporated by reference in its entirety.

BACKGROUND OF THE INVENTION

The technical field to which the invention relates

The present invention relates to a composition comprising (I) recombinant exospore-producing Bacillus cells that express a fusion protein comprising: (a) at least one plant growth promoting protein or peptide; and (b) a targeting sequence that localizes the fusion protein to exospores of Bacillus cells; and (ii) at least one additional biological control agent selected from the preferred microorganisms disclosed in this application, and / or a mutant of a specific strain of microorganism disclosed in this application, having all the identification characteristics of the corresponding strain, and / or at least one a metabolite produced by an appropriate strain that exhibits the ability to improve plant growth and / or viability and / or activity against insects, mites, nematodes and / or phytopathogens in synergistically effective amounts. In addition, the present invention relates to the use of this composition, as well as to a method for enhancing plant growth, promoting plant vitality, and / or reducing the total damage to plants and plant parts.

State of the art

урожайность и/или лучшее качество растения или его продуктов.In the protection of crops, there is a constant need for applied formulations that improve the vitality and / or growth of plants. Healthier plants in general provide

yield and / or better quality of the plant or its products.

To promote the vitality of the plant, fertilizers are used all over the world, both based on inorganic and organic substances. Fertilizer can be a single substance or composition, and used to provide plants with nutrients. The big breakthrough in the use of fertilizers was the development of the nitrogen fertilizer Justus von Liebig around 1840. However, fertilization can lead to soil acidification and destabilize the nutrient balance of the soil, including depleting mineral reserves and enriching salts and heavy metals. Additionally, over-fertilization can lead to changes in soil fauna as well as contamination of surface water and groundwater. In addition, harmful substances such as nitrate can enrich plants and fruits in large quantities.

Additionally, insecticides and fungicides are used worldwide for pest control. Synthetic insecticides or fungicides are often nonspecific and therefore may act on organisms other than the target organisms, including other naturally occurring beneficial organisms. Due to their chemical nature, they can also be toxic and biodegradable. Users around the world are becoming more and more aware of the potential environmental and health impacts associated with chemical residues, especially in food. This leads to increasing user pressure to reduce the use or at least the amount of chemical (i.e., synthetic) pesticides. Thus, there is a need to manage the food chain while still providing an opportunity for effective pest control.

Another problem arising from the use of synthetic insecticides or fungicides is the fact that repeated and monopoly application of the insecticide or fungicides often leads to the selection of resistant pests or microorganisms. Under normal conditions, such strains are also cross-resistant to other active ingredients that have the same mode of action. Thus, effective control of pathogens with these active compounds is no longer possible. However, it is difficult and expensive to develop active ingredients with novel mechanisms of action.

The use of biological control agents (BCA) is an alternative to fertilizers and synthetic pesticides. In some cases, the effectiveness of BCA is not at the same level as for fertilizers or for conventional insecticides and fungicides, especially in the case of severe infection pressure. Therefore, under certain conditions, the biological control agents, their mutants and the metabolites produced by them, especially at low application rates, are not entirely satisfactory. Thus, there is an ongoing need to develop new alternative plant health and / or plant protection agents that, in some cases, at least help to meet the above requirements.

Summary of the invention

In view of the above, it is especially an object of the present invention to provide compositions that have an increased ability to improve plant growth and / or increase plant vitality, or that exhibit increased activity against insects, mites, nematodes and / or phytopathogens.

Thus, it has been found that these objects are achieved by the compositions according to the invention, as defined below. By using a) recombinant exospore-producing Bacillus cells that express a fusion protein comprising: (i) at least one plant growth promoting protein or peptide selected from the group consisting of an enzyme involved in the production or activation of a plant growth promoting compound; an enzyme that degrades or modifies a bacterial, fungal, or plant food source; and a protein or peptide that protects the plant from a pathogen or pest; and (ii) a targeting sequence that localizes the fusion protein to exospores of Bacillus cells; and b) at least one preferred strain described herein, different from said recombinant Bacillus cells according to the invention, in the ability to enhance, preferably in a superadditive manner, (I) plant growth, plant yield and / or plant viability and / or (II) activity against insects, mites, nematodes and / or phytopathogens.

References in this application to targeting sequences, exospore proteins, exospore protein fragments, fusion proteins, and recombinant exospore-producing Bacillus cells that express such fusion proteins are not to be construed as stand alone embodiments of the invention. Instead, for the entire present invention, references to targeting sequences, exospore proteins, exospore protein fragments, fusion proteins, and recombinant exospore-producing Bacillus cells that express such fusion proteins are to be considered as described and claimed only in combination (and preferably in synergistic combination) with one or more of the preferred biological control agents described herein. In addition, references to "preferred microorganisms described in this application" or "to preferred biological control agents described or disclosed in this application" encompass biological control agents and microorganisms, including their strains, mutants and metabolites, as described in paragraphs [000183 ] - [000226] below.

The present invention is directed to a composition comprising a) recombinant exospore-producing Bacillus cells that express a fusion protein comprising: (i) at least one plant growth promoting protein or peptide selected from the group consisting of an enzyme involved in the production or activation of a compound, stimulating plant growth, and an enzyme that degrades or modifies a bacterial, fungal or plant food source or a protein or peptide that protects a plant from a pathogen; and (ii) a targeting sequence that localizes the fusion protein to exospores of Bacillus cells; and b) at least one additional and other preferred biological control agent described in this application, and / or a mutant of a specific strain of microorganism, disclosed in this application, having all the identification characteristics of the corresponding strain, and / or at least one metabolite produced an appropriate strain that is active against insects, mites, nematodes and / or phytopathogens in synergistically effective amounts.

In some embodiments, the targeting sequence comprises an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; a targeting sequence comprising amino acids 1-35 of SEQ ID NO: 1; targeting sequence containing amino acids 20-35 of SEQ ID NO: 1; a targeting sequence containing amino acids 22-31 of SEQ ID NO: 1; a targeting sequence containing amino acids 22-33 of SEQ ID NO: 1; a targeting sequence containing amino acids 20-31 of SEQ ID NO: 1; targeting sequence containing SEQ ID NO: 1; or an exospore protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 2.

In other embodiments, the recombinant Bacillus cells are cells of a member of the Bacillus cereus family, such as Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus Bacillus gaemokensishenstehenstehenstepus wee, and combinations thereof. In a further embodiment, the recombinant Bacillus cells are Bacillus thuringiensis BT013A cells.

In certain aspects, the fusion protein includes an enzyme involved in the production or activation of a plant growth promoting compound selected from the group consisting of acetoin reductase, indole-3-acetamide hydrolase, tryptophan monooxygenase, acetolactate synthetase, α-acetolactate decarboxylase , pyruvate decarboxylase, diacetyl reductase, butanediol dehydrogenase, aminotransferase, tryptophan decarboxylase, amine oxidase, indole-3-pyruvate decarboxylase, indole-3-acetaldehyde dehydrogenase, side chain oxidase, nitryl hydrophanase, peptide tryptophanase , adenosine phosphate isopentenyl transferase, phosphatase, adenosine kinase, adenine phosphoribosyl transferase, CYP735A, 5'-ribonucleotide phosphohydrolase, adenosine nucleosidase, zeatin cis-trans-isomerase-O-glucosylacetase CK cis-hydroxylase, CK N-glycosyltransferase, 2,5-ribonucleotide phosphohydrolase, adenosine nucleosidase, purine nucleoside phosphorylase, zeatin reductase, hydroxylamine reduct 3u, 2-oxoglutarate dioxygenase, gibberellin 2B / 3B hydrolase, gibberellin 3-oxidase, gibberellin 20-oxidase, chitosanase, chitinase, β-1,3-glucanase, β-1,4-glucanase, β-1,6-glucanase , aminocyclopropane-1-carboxylic acid deaminase, and an enzyme involved in the production of nod factor.

In other aspects, the fusion protein includes an enzyme that degrades or modifies a bacterial, fungal, or plant food source selected from the group consisting of cellulase, lipase, lignin oxidase, protease, glycoside hydrolase, phosphatase, nitrogenase, nuclease, amidase, nitrate reductase , nitrite reductase, amylase, ammonium oxidase, ligninase, glucosidase, phospholipase, phytase, pectinase, glucanase, sulfatase, urease, xylanase, and siderophore.

In some embodiments, the fusion protein is expressed under the control of a sporulation promoter native to the targeting sequence, an exospore protein, or an exospore protein fragment of the fusion protein. The fusion protein can be expressed under the control of a highly expressed sporulation promoter. In certain aspects, the highly expressed sporulation promoter comprises a sporulation-specific sigma-K polymerase promoter sequence. In other aspects, the sporulation promoter comprises a nucleotide sequence having at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97 % identity, at least 98% identity, or at least 99% identity to the nucleotide sequence of any of SEQ ID NOS: 85-103. In some embodiments, the sporulation promoter comprises a nucleotide sequence having 100% identity to a nucleotide sequence of any of SEQ ID NOS: 85-103.

In other embodiments, the at least one biological control agent is a Bacillus subtilis or Bacillus amyloliquefaciens strain that produces fengicin or a plipastatin-type compound, an iturin-type compound, and / a surfactin-type compound. For reference, see the following review article: Ongena, M., et al., “Bacillus Lipopeptides: Versatile Weapons for Plant Disease Biocontrol,” Trends in Microbiology, Tom 16, No. 3, March 2008, pp. 115-125 . strains of Bacillus, capable of producing lipopeptides include Bacillus subtilis QST713, strain Bacillus amyloliquefaciens D747 (available as BACSTAR ^® by Etec Crop Solutions, NZ and also available as DOUBLE NICKEL ™ from Certis, US); Bacillus subtilis MBI600 ( available as SUBTILEX ^® by Becker Underwood, US EPA Reg №71840-8);. Bacillus subtilis Y1336 (available as BIOBAC ^® WP of Bion-Tech, Taiwan registered as a biological fungicide in Taiwan under the registration number 4764, 5454, 5096 and 5277 ); Bacillus amyloliquefaciens, especially strain FZB42 (available as RHIZOVITAL ^® from ABiTEP, DE);. and Bacillus subtilis var amyloliquefaciens FZB24 available from Novozymes Biologicals Inc. (Salem, Virginia) or Syngenta Crop Protection, LLC (Greensboro, North Carolina ) in in the form of a fungicide TAEGRO ^® or TAEGRO ^® ECO (EPA Registration No. 70127-5).

In still other embodiments, the at least one biological control agent is selected from the group consisting of Bacillus pumilus strain QST2808, Bacillus subtilis strain QST713, Bacillus subtilis strain QST30002, Bacillus subtilis strain QST30004, Streptomyces R microflavus microflavus strain 50 microns , strain Bacillus firmus I-1582, their mutants having all the identification characteristics of the respective strains, and at least one metabolite produced by the respective strains, which is active against insects, ticks, nematodes and / or phytopathogens.

In some embodiments, a composition of the present invention comprises a) recombinant exospore-producing Bacillus cells that express a fusion protein comprising: (i) at least one plant growth promoting protein or peptide selected from the group comprising an enzyme involved in production, or activation of a compound that stimulates plant growth, and an enzyme that degrades or modifies a bacterial, fungal or plant food source; or a protein or peptide that protects the plant from a pathogen; and (ii) a targeting sequence that localizes the fusion protein to exospores of Bacillus cells; and b) Bacillus firmus strain 1-1582 in a synergistically effective amount.

In some embodiments, a composition of the present invention comprises a) recombinant exospore-producing Bacillus cells that express a fusion protein comprising: (i) at least one plant growth promoting protein or peptide selected from the group comprising an enzyme involved in production, or activation of a compound that stimulates plant growth, and an enzyme that degrades or modifies a bacterial, fungal or plant food source or at least one protein or peptide that protects the plant from a pathogen; and (ii) a targeting sequence that localizes the fusion protein to exospores of Bacillus cells; and b) Bacillus subtilis strain QST713 in a synergistically effective amount.

In some embodiments, a composition of the present invention comprises a) recombinant exospore-producing Bacillus cells that express a fusion protein comprising: (i) at least one plant growth promoting protein or peptide selected from the group comprising an enzyme involved in production, or activation of a compound that stimulates plant growth, and an enzyme that degrades or modifies a bacterial, fungal or plant food source or at least one protein or peptide that protects the plant from a pathogen; and (ii) a targeting sequence that localizes the fusion protein to exospores of Bacillus cells; and b) Bacillus pumilus strain QST2808 in a synergistically effective amount.

In still other embodiments of the invention, the composition further comprises c) at least one fungicide and / or d) at least one insecticide. At least one fungicide and / or at least one insecticide can be synthetic. In one aspect of such an embodiment, the biological control agent and additional insecticide of such a composition comprises Bacillus firmus strain I-1582 and clothianidin, respectively.

In a preferred aspect of the above-described embodiments of the invention (I) the biological control agent is Bacillus subtilis QST713 or mutants that have all the identification characteristics of Bacillus subtilis QST713 and / or a sequence that is at least 95% identical or at least 98% identical to Bacillus subtilis QST713; (Ii) the targeting sequence comprises an amino acid

a sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; (III) the plant growth promoting protein or peptide comprises an endoglucanase, phospholipase or chitosinase, preferably with a sequence that is at least 95% identical with SEQ ID NOs: 107, 108 and 109, respectively; and (iv) recombinant cells of a member of the Bacillus cereus family include Bacillus thuringiensis or Bacillus mycoides cells. In yet another preferred embodiment, the recombinant cells of a member of the Bacillus cereus family are Bacillus thuringiensis BT013A cells.

In a preferred aspect of the above-described embodiments of the invention (I) the biological control agent is Bacillus firmus I-1582 or mutants that have all the identification characteristics of Bacillus firmus I-1582 and / or a sequence identical at least 95% or at least 98% with Bacillus firmus 1-1582; (Ii) the targeting sequence comprises an amino acid sequence having at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 54%; (III) a plant growth promoting protein or peptide comprises an endoglucanase, phospholipase or chitosinase, preferably with a sequence identical at least 95% or at least 98% with SEQ ID NOs: 107, 108 and 109, respectively; and (iv) recombinant cells of a member of the Bacillus cereus family include Bacillus thuringiensis or Bacillus mycoides cells. In yet another preferred embodiment, the recombinant cells of a member of the Bacillus cereus family are Bacillus thuringiensis BT013A cells. In yet another aspect of this embodiment, the composition further comprises clothianidin.

In a preferred aspect of the above-described embodiments (I) the biological control agent is Bacillus pumilus QST2808 or mutants that have all of the identification characteristics of Bacillus pumilus QST2808 and / or a sequence that is at least 95% identical or at least 98% identical to Bacillus pumilus QST2808; (Ii) the targeting sequence comprises an amino acid

a sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; (III) a plant growth promoting protein or peptide comprises an endoglucanase, phospholipase or chitosinase, preferably with a sequence identical at least 95% or at least 98% with SEQ ID NOs: 107, 108 and 109, respectively; and (iv) recombinant cells of a member of the Bacillus cereus family include Bacillus thuringiensis or Bacillus mycoides cells. In yet another preferred embodiment, the recombinant cells of a member of the Bacillus cereus family are Bacillus thuringiensis BT013A cells.

In some aspects, the composition further comprises at least one excipient selected from the group consisting of modifying agents, solvents, spontaneous promoters, carriers, emulsifiers, dispersants, anti-freeze agents, thickeners, and adjuvants.

In other aspects, the invention relates to a seed treated with any of the compositions described herein.

In addition, the present invention relates to the use of the described compositions as fungicide and / or insecticide. In certain aspects, the disclosed compositions are used to reduce the overall damage to plants and plant parts as well as the loss of harvested fruits or vegetables caused by insects, mites, nematodes and / or phytopathogens. In other aspects, the described compositions are used to enhance plant growth and / or promote plant vitality.

Additionally, the present invention relates to a method of treating a plant, a part of a plant, such as a seed, root, rhizome, corm, bulb or tuber, and / or a locus at or near which a plant or plant parts grow, such as soil, to enhance growth plants and / or promoting plant viability, comprising the step of simultaneous or sequential use on a plant, a plant part and / or plant loci: a) recombinant exospore-producing Bacillus cells that express a fusion protein comprising: (i) at least one plant growth promoting a protein or peptide selected from the group consisting of an enzyme involved in the production or activation of a plant growth promoting compound; an enzyme that degrades or modifies a bacterial, fungal, or plant food source; and a protein or peptide that protects the plant from a pathogen; and (ii) a targeting sequence that localizes the fusion protein to exospores of Bacillus cells; and b) at least one biological control agent described in this application, and / or a mutant of a specific strain of microorganism disclosed in this application, having all the identifying characteristics of the corresponding strain, and / or at least one metabolite produced by the corresponding strain, and / or at least one metabolite produced by an appropriate strain that is active against insects, mites, nematodes and / or phytopathogens in a synergistically effective amount.

In another embodiment, the present invention provides a method of reducing the total damage to plants and plant parts, as well as the loss of harvested fruits or vegetables caused by insects, mites, nematodes and / or phytopathogens, comprising the step of simultaneous or sequential use on a plant, a plant part such as seeds, root, rhizome, corm, bulb or tuber, and / or locus at or near which the plant or plant parts grow, such as soil: a) recombinant exospore-producing Bacillus cells that express a fusion protein comprising: (I) at least one plant growth promoting protein or peptide selected from the group consisting of an enzyme involved in the production or activation of a plant growth promoting compound; an enzyme that degrades or modifies a bacterial, fungal, or plant food source; and a protein or peptide that protects the plant from a pathogen; and (ii) a targeting sequence that localizes the fusion protein to exospores of Bacillus cells; and b) at least one biological control agent described in this application, and / or a mutant of a specific strain of microorganism disclosed in this application, having all the identifying characteristics of the corresponding strain, and / or at least one metabolite produced by the corresponding strain, and / or at least one metabolite produced by an appropriate strain that is active against insects, mites, nematodes and / or phytopathogens in a synergistically effective amount.

In the above paragraphs, the term "include" or any derivative thereof (eg, including, includes) may be replaced by "consist of" or an applicable corresponding derivative thereof.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 shows the amino acid sequence alignment of the amino-terminal portion of the Bacillus anthracis BclA strain and with the corresponding region from various exospore proteins from members of the Bacillus cereus family.

DETAILED DESCRIPTION

In general, "pesticidal" refers to the ability of a substance to increase mortality or inhibit the growth rate of plant pests. The term is used in this application to describe the property of a substance to be active against insects, mites, nematodes and / or phytopathogens. In the context of the present invention, the term "pests" includes insects, mites, nematodes and / or phytopathogens.

As used in this application, "biological control" is defined as the control of a pathogen and / or insect and / or mite and / or nematode by using a second organism. Known biological control mechanisms include bacteria that fight root rot by increasing competition with fungi for area or nutrients on the root surface. Bacterial toxins such as antibiotics are used to combat pathogens. The toxin can be isolated and used directly on the plant, or bacterial species can be administered so that they produce the toxin in situ. Other biological control options include the use of certain fungi that produce components active against the target phytopathogen, insect, mite or nematode, or attack by the target pest / pathogen. "Biological control", as used in connection with the present invention, can also encompass microorganisms that have a beneficial effect on plant vitality, growth, vigor, stress response or yield. Uses include spray application, soil application and seed dressing.

The term "metabolite" refers to any compound, substance, or fermentation by-product of said microorganism that has pesticidal, fungicidal or nematicidal activity or the ability to increase plant viability or increase plant yield. The term "mutant" refers to a variant of the parental strain as well as methods of producing a mutant or variant in which the pesticidal activity is greater than that expressed by the parental strain. "Parental strain" is defined herein as the parental strain prior to mutagenesis or deposited strain. To obtain such mutants, the parent strain can be treated with a chemical such as N-methyl-N'-nitro-N-nitrosoguanidine, ethyl methanesulfone, or by irradiation using gamma, X-ray, or UV irradiation, or by other methods. well known to those skilled in the art.

"Variant" is a strain having all the identification characteristics of accession numbers NRRL or ATCC as indicated in this text and can be identified as having a genome that hybridizes under high stringency conditions to the genome of accession numbers NRRL or ATCC.

"Hybridization" refers to a reaction in which one or more polynucleotides interact to form a complex that is stabilized by hydrogen bonds between the bases of nucleotide residues. Hydrogen bonding can occur by Watson-Crick base pairing, Hoogstein binding, or any other sequence-specific method. The complex can include two chains forming a duplex structure, three or more chains forming a multi-chain complex, a single self-hybridizing chain, or any combination thereof. Hybridization reactions can be carried out under different "stringency" conditions. In general, low stringency hybridization reactions are carried out at about 40 ° C in 10 X SSC or equivalent ionic strength / temperature solution. Moderate stringency hybridization is typically carried out at about 50 ° C in 6 X SSC, and the high stringency hybridization reaction is typically carried out at about 60 ° C in 1 X SSC.

A variant of the specified accession number NRRL or ATCC can also be defined as a strain having a genomic sequence that has more than 85%, more preferably more than 90%, or more preferably more than 95% sequence identity with the genome of the specified accession number NRRL or ATCC. A polynucleotide or polynucleotide region (or polypeptide or polypeptide region) having a certain percentage (e.g., 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%) of "sequence identity" to another sequence means that, when aligned, the percentage of bases (or amino acids) is the same when comparing the two sequences. This alignment and percent homology or sequence identity can be determined using software known in the art, for example, as described in Current Protocols in Molecular Biology (FM Ausubel et al., Ed., 1987) Supplement 30, section 7.7. 18, Table 7.7.1.

NRRL is an acronym for the Agricultural Research Service Culture Collection, which is located at the National Center for Agricultural Utilization Research, Agricultural Research Service, U.S. Department of Agriculture, 1815 North University Street, Peoria, Illinois 61604, U.S.A.

ATCC is an abbreviation for American Type Culture Collection, which has the address ATCC Patent Depository, 10801 University Boulevard, Manassas, Virginia 10110, U.S.A.

CNCM is an abbreviation for the National Collection of Cultures of Microorganisms Collection (Nationale de Cultures de Microorganismes), Institute Pasteur, France, which has the address of Institut Pasteur, 25 Rue du Docteur Roux, F-75724 Paris Cedex 15, France.

All strains described in this application and having an access number, in which the prefix is NRRL, ATCC or CNCM, have been deposited with the above-described appropriate depository institution in accordance with the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the purpose of patent procedure.

"An enzyme involved in the production or activation of a plant growth promoting compound" includes any enzyme that catalyzes any step in a biological synthetic pathway for a compound that promotes plant growth or alters the structure of a plant, or any enzyme that catalyzes the conversion of an inactive or less active a derivative compound that stimulates plant growth or alters the structure of a plant to an active or more active form of the compound Such compounds include, for example, but are not limited to low molecular weight plant hormones such as auxins and cytokinins, biologically active peptides, and small molecules that stimulate plant growth, synthesized by bacteria or fungi in the rhizosphere (for example, 2,3-butanediol).

"A protein or peptide that enhances the immune system of a plant" as used herein includes any protein or peptide that has a beneficial effect on the immune system of a plant.

The term "plant growth promoting protein or peptide" as used herein includes any protein or peptide that enhances plant growth in a plant exposed to the protein or peptide.

The terms "plant growth promoting" and "plant growth promoting" are used interchangeably herein and refer to the ability to enhance or enhance at least one of the characteristics of a plant: height, weight, leaf size, root size, or stem size, to increase protein yield from a plant or increase the yield of a grain of protein from a plant.

A “protein or peptide that protects a plant from a pathogen” as used herein includes any protein or peptide that renders a plant exposed to a protein or peptide less susceptible to infection by a pathogen.

“A protein or peptide that enhances plant stress tolerance” as used herein includes any protein or peptide that makes a plant exposed to a protein or peptide more resistant to stress.

The term "plant-binding protein or peptide" refers to any peptide or protein capable of binding specifically or nonspecifically to any part of a plant (e.g. roots or aerial parts of a plant such as foliage, stems, flowers or fruits) or plant material ...

The term "targeting sequence" as used herein refers to a polypeptide sequence that results in the localization of a longer polypeptide or protein to the exospores of a member of the Bacillus cereus family.

Recombinant Bacillus Exospore-Producing Cells Expressing Fusion Proteins

The fusion proteins comprise a targeting sequence, an exospore protein, or an exospore protein fragment that (s) targets the fusion protein to an exospore of a member of the Bacillus cereus family and: (a) a plant growth stimulating protein or peptide; (b) a protein or peptide that protects the plant from the pathogen; (c) a protein or peptide that enhances the plant's resistance to stress; (d) a protein or peptide that binds to a plant; or (e) a protein or peptide that enhances the plant's immune system. When expressed in bacteria members of the Bacillus cereus family, these fusion proteins target the exospore layer of the spore and are physically positioned so that the protein or peptide is released to the outside of the spore.

This Bacillus exospore imaging system (BEMD) can be used to deliver peptides, enzymes, and other proteins to plants (eg, leaves, fruits, flowers, stems, or roots of plants) or to a plant growth medium such as soil. Peptides, enzymes, and proteins delivered to the soil or other plant growth medium in this way continue to exist and are active in the soil for a long period of time. The introduction of recombinant exospore-producing Bacillus cells expressing the fusion proteins described herein into the soil or rhizosphere of a plant results in a beneficial enhancement of plant growth under many different soil conditions. The use of BEMDs to create these enzymes enables them to continue to exhibit their beneficial effects on the plant and rhizosphere during the first months of plant life.

Targeting sequence, exospore proteins, and exospore protein fragments

For ease of reference, the SEQ ID NOS numbers for the peptide and protein sequences referred to herein are listed in Table 1 below.

AA = amino acids

*IN. anthracis Sterne strain BclA has 100% sequence identity with B. thuringiensis BclA. Thus, SEQ ID NOS: 1, 2, and 59 also represent amino acids 1-41 from B. thuringiensis BclA, full-length B. thuringiensis BclA, and amino acids 1-196 from B. thuringiensis BclA, respectively. Likewise, SEQ ID NO: 60 also represents a methionine residue plus amino acids 20-35 from B. thuringiensis BelA. ** hypothetical protein TIGR03720 of B. mycoides has 100% sequence identity with B. mycoides hypothetical protein WP003189234. Thus, SEQ ID NOs: 57 and 58 also represent amino acids 1-136 of B. mycoides WP003189234 hypothetical protein and B. mycoides WP003189234 full-length hypothetical protein, respectively.

Bacillus is a genus of rod-shaped bacteria. The Bacillus cereus family of bacteria includes the species Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus toyoiensis, and Bacillus weihenstephensis. Under stressful environmental conditions, bacteria of the Bacillus cereus family undergo sporulation and form oval endospores, which can remain dormant for a long period of time. The outer layer of endospores is known as exospore and includes a basal layer surrounded by an outer hairline of hair-like protrusions. The filaments on the hairy pile are mainly formed by the collagen-like glycoprotein BclA, while the basal layer is composed of several different proteins. Another collagen-like protein, BclB, is also present in exospores and is displayed on endospores of members of the Bacillus cereus family.

It has been shown that BclA, a major component of the superficial pile, is attached on exospores with its amino terminus (N-terminus) located on the basal layer and its carboxy terminus (C-terminus) extending outward from the spore.

It has previously been discovered that certain sequences from the N-terminal regions from BclA and BclB can be used to target a peptide or protein to exospores of Bacillus cereus endospores (see Published US Patent Applications Nos. 2010/0233124 and 2011/0281316, and Thompson, et al., "Targeting of the BclA and BclB Proteins to the Bacillus anthracis Spore Surface," Molecular Microbiology, 70 (2): 421-34 (2008), the entire contents of each of them are thus incorporated herein by reference). It was also found that the BetA / BAS3290 protein from Bacillus anthracis is localized to the exospore.

It was found that amino acids 20-35 from BclA from the Bacillus anthracis Sterne strain are sufficient to target exospores. The sequence alignment of amino acids 1-41 from BclA (SEQ ID NO: 1) with the corresponding N-terminal regions of several other exosporic proteins of the Bacillus cereus family and proteins of the Bacillus cereus family having related sequences are shown in Figure 1. As can be seen in Figure 1, there is a highly homologous region among all proteins in the region corresponding to amino acids 20-41 of BclA. However, in these sequences, the amino acids corresponding to amino acids 36-41 of BclA contain a secondary structure and are not required for localization of the fusion protein to exospores. The conserved region of the targeting sequence from BclA (amino acids 20-35 of SEQ ID NO: 1) are shown in bold in Figure 1 and corresponds to the minimum targeting sequence required for localization to exospore. The more highly conserved region containing amino acids 25-35 of BclA within the targeting sequence is underlined in the sequences in Figure 1 and represents the recognition sequence for ExsFA / BxpB / ExsFB and homologues that target and assemble the described proteins on the surface of the exospore Amino acid sequences, shown in SEQ ID NOS: 3, 5, and 7 in Figure 1 are amino acids 1-33 of the Bacillus anthracis strain BetA / BAS3290, methionine followed by amino acids 2-43 of the Bacillus anthracis strain BAS4623 and amino acids 1-34 of the Bacillus anthracis BclB strain , respectively. (For BAS4623, it was found that replacing valine present at position 1 in the native protein with methionine results in better expression.) As can be seen in Figure 1, each of these sequences contains a conserved region corresponding to amino acids 20-35 from BclA ( SEQ ID NO: 1; in bold), and a more highly conserved region corresponding to amino acids 20-35 from BclA (underlined).

Additional proteins from members of the Bacillus cereus family also contain a conserved targeting site. In particular, in Figure 1, SEQ ID NO: 9 is amino acids 1-30 of Bacillus anthracis strain BAS1882, SEQ ID NO: 11 is amino acids 1-39 of the Bacillus weihenstephensis KBAB4 2280 gene product, SEQ ID NO: 13 is amino acids 1 -39 of Bacillus weihenstephensis KBAB4 3572 gene product, SEQ ID NO: 15 is amino acids 1-49 of Bacillus cereus VD200 exospore leader peptide, SEQ ID NO: 17 is amino acids 1-33 of Bacillus cereus VD166 exospore leader peptide, SEQ ID NO: 19 represents amino acids 1-39 of the hypothetical IKG protein 04663 Bacillus cereus VD200, SEQ ID NO: 21 represents amino acids 1-39 of the β-propeller protein Bacillus weihenstephensis KBAB4 YVTN, SEQ ID NO: 23 represents amino acids 1-30 of the hypothetical protein bcerkbab4_2363 represents Bacillus weihenstephensis ID KBAB4, SEQ ID NO: 25 represents amino acids 1-30 of the hypothetical bcerkbab4_2131 protein of Bacillus weihenstephensis KBAB4, SEQ ID NO: 27 is amino acids 1-36 of the collagen triple helix repeat, Bacillus weihenstephensis KBAB4, SEQ ID NO: 29 is amino acids 1-39 Bacillus_482 of the hypothetical protein bmyco16 , SEQ ID NO: 31 is amino acids 1-30 of the hypothetical bmyc0001_22540 protein of Bacillus mycoides 2048, SEQ ID NO: 33 is amino acids 1-21 of the hypothetical bmyc0001_21510 protein of Bacillus mycoides 2048, SEQ ID NO: 35 is amino acids 1-22 of collagen protein triple helical repeat of Bacillus thuringiensis 35646, SEQ ID NO: 43 p is amino acids 1-35 of the hypothetical protein WP 69652 Bacillus cereus, SEQ ID NO: 45 are amino acids 1-41 of Bacillus cereus exospore leader WP016117717, SEQ ID NO: 47 are amino acids 1-49 of Bacillus cereus exospore peptide WP002105192, SEQ ID NO: 49 is hypothetical amino acids 1-38 Bacillus cereus WP87353 protein, SEQ ID NO: 51 are amino acids 1-39 of Bacillus cereus exospore peptide 02112369, SEQ ID NO: 53 are amino acids 1-39 of Bacillus cereus exospore protein WP016099770, SEQ ID NO: 55 are amino acids 1-36 the hypothetical Bacillus thuringiensis YP006612525 protein, and SEQ ID NO: 57 is amino acids 1-136 of the Bacillus mycoides hypothetical TIGR03720 protein. As shown in Figure 1, each of the N-terminal regions of these proteins contains a region that is conserved with amino acids 20-35 from BclA (SEQ ID NO: 1) and a more highly conserved region corresponding to amino acids 25-35 from BclA.

Any portion of BclA that includes amino acids 20-35 can be used as a targeting sequence. Additionally, full-length exospore proteins or fragments of exospore proteins can be used to target the fusion proteins to exospores. Thus, full length BclA or a fragment from BclA that includes amino acids 20-35 can be used to target exospores. For example, full length BclA (SEQ ID NO: 2) or a medium sized fragment from BclA lacking a carboxy terminus, such as SEQ ID NO: 59 (amino acids 1-196 from BclA), can be used to target fusion proteins to exospores. Medium sized fragments, such as the fragment from SEQ ID NO: 59, have less secondary structure than full length BclA and have been found to be useful as a targeting sequence. The targeting sequence can also include shorter regions from BclA, which include amino acids 20-35 such as SEQ ID NO: 1 (amino acids 1-41 of BclA), amino acids 1-35 of SEQ ID NO: 1, amino acids 20-35 of SEQ ID NO: 1, or SEQ ID NO: 60 (methionine residue linked to amino acids 20-35 of BclA). Even shorter fragments from BclA, which include only some of amino acids 20-35, also exhibit the ability to target the fusion proteins to exospores. For example, a targeting sequence may include amino acids 22-31 of SEQ ID NO: 1, amino acids 22-33 of SEQ ID NO: 1, or amino acids 20-31 of SEQ ID NO: 1.

Alternatively, any portion of BetA / BAS3290, BAS4623, BclB, BAS1882, KBAB4 2280 gene product, KBAB4 3572 gene product, B. cereus VD200 exospore leader peptide, B. cereus VD166 exospore leader peptide, B. cereus VD200 hypothetical protein IKG_04663, YV cereus VD200 YV β-propeller protein B. weihenstephensis KBAB4, hypothetical protein bcerkbab4_2363 B. weihenstephensis KBAB4, hypothetical protein bcerkbab4_2131 B. weihenstephensis KBAB4, triple helical repeat containing collagen, B. weihenstephens1 hypothetical protein_60 b. mycoides 2048, hypothetical protein bmyc0001_21510 B. mycoides 2048, collagen triple helical repeat protein B. thuringiensis 35646, hypothetical protein WP 69652 B. cereus, exospore leader WP016117717 B. cereus, exospore peptide WP002105192 B. cereus, hypothetical protein WP87353 B. cereus, exospore peptide 02112369 B. cereus, exospore protein WP016099770 B. cereus, hypothetical protein YP006612525 B. thuringiensis, or hypothetical protein YP006612525 B. thuringiensis TIGR03720 B. mycoides, which includes amino acids corresponding to amino acids 20-35 of BclA, can serve as a targeting sequence. As can be seen in Figure 1, amino acids 12-27 from BetA / BAS3290, amino acids 23-38 from BAS4623, amino acids 13-28 from BclB, amino acids 9-24 from BAS1882, amino acids 18-33 of KBAB4 gene product 2280, amino acids 18-33 the product of the KBAB4 gene 3572, amino acids 28-43 of the leader peptide of B. cereus VD200 exospore, amino acids 12-27 of the leader peptide of B. cereus VD166, amino acids 18-33 of the hypothetical IKG protein 04663 B. cereus VD200, amino acids 18-33 YVTN of β-propeller protein B. weihenstephensis KBAB4, amino acids 9-24 of the hypothetical protein bcerkbab4_2363 B. weihenstephensis KBAB4, amino acids 9-24 of the hypothetical triplet protein bcerkbab4_2131 B. weihenstephens4-30 collagen-containing repeat B. weihenstephensis KBAB4, amino acids 18-33 of the hypothetical protein bmyco0001_21660 B. mycoides 2048, amino acids 9-24 of the hypothetical protein bmyc0001_22540 B. mycoides 2048, amino acids 1-15 of the hypothetical protein bmyc0001_21510, B. mycoides 2048 collagen protein triple helical repeat B. thuringiensis 35646, amino acids 14-29 of the hypothetical protein WP 69652 B. cereus, amino acids 20-35 of the exospore leader WP016117717 B. cereus, amino acids 28-43 of the exospore peptide WP002105192 B. cereus, amino acids 17-32 of the hypothetical protein WP87353 B. cereus, amino acids 18-33 of the exospore peptide 02112369 B. cereus, amino acids 18-33 of B. cereus exospore protein WP016099770, amino acids 15-30 of B. thuringiensis hypothetical protein YP006612525, and amino acids 115-130 of B. mycoides hypothetical protein TIGR03720 correspond to amino acids 20-35 from BclA. Thus, any portion of these proteins that includes the above corresponding amino acids can serve as a targeting sequence.

In addition, any amino acid sequence containing amino acids 20-35 of BclA, or any of the above corresponding amino acids, can serve as a targeting sequence.

Thus, the targeting sequence may include amino acids 1-35 from SEQ ID NO: 1, amino acids 20-35 from SEQ ID NO: 1, SEQ ID NO: 1, SEQ ID NO: 60, amino acids 22-31 from SEQ ID NO: 1, amino acids 22-33 of SEQ ID NO: 1, or amino acids 20-31 of SEQ ID NO: 1. Alternatively, the targeting sequence consists of amino acids 1-35 of SEQ ID NO: 1, amino acids 20-35 of SEQ ID NO : 1, SEQ ID NO: 1, or SEQ ID NO: 60. Alternatively, the targeting sequence may be composed of amino acids 22-31 from SEQ ID NO: 1, amino acids 22-33 from SEQ ID NO: 1, or amino acids 20-31 from SEQ ID NO: 1. Alternatively, the exospore protein may include a full-length BclA (SEQ ID NO: 2), or the exospore protein fragment may include a medium-sized fragment from BclA lacking a carboxy terminus, such as SEQ ID NO: 59 ( amino acids 1-196 from BclA). Alternatively, the exospore protein fragment may consist of SEQ ID NO: 59.

The targeting sequence may also include amino acids 1-27 from SEQ ID NO: 3, amino acids 12-27 from SEQ ID NO: 3, or SEQ ID NO: 3, or the exospore protein may include full length BetA / BAS3290 (SEQ ID NO: 4) ... It was also found that the methionine residue linked to amino acids 12-27 of BetA / BAS3290 can be used as a targeting sequence. Thus, the targeting sequence can include SEQ ID NO: 61. The targeting sequence can also include amino acids 14-23 of SEQ ID NO: 3, amino acids 14-25 of SEQ ID NO: 3, or amino acids 12-23 of SEQ ID NO: 3.

The targeting sequence may also include amino acids 1-38 from SEQ ID NO: 5, amino acids 23-38 from SEQ ID NO: 5, or SEQ ID NO: 5, or the exospore protein may include full length BAS4623 (SEQ ID NO: 6).

Alternatively, the targeting sequence may include amino acids 1-28 from SEQ ID NO: 7, amino acids 13-28 from SEQ ID NO: 7, or SEQ ID NO: 7, or the exospore protein may include full length BclB (SEQ ID NO: 8).

The targeting sequence may also include amino acids 1-24 from SEQ ID NO: 9, amino acids 9-24 from SEQ ID NO: 9, or SEQ ID NO: 9, or the exospore protein may include full length BAS1882 (SEQ ID NO: 10). The methionine residue linked to amino acids 9-24 of BAS1882 can also be used as a targeting sequence. Thus, the targeting sequence may include SEQ ID NO: 69.

The targeting sequence may also include amino acids 1-33 from SEQ ID NO: 11, amino acids 18-33 from SEQ ID NO: 11, or SEQ ID NO: 11, or the exospore protein may include the full length B. weihenstephensis KBAB4 2280 gene product (SEQ ID NO: 12). The methionine residue linked to amino acids 18-33 of the B. weihenstephensis KBAB4 2280 gene product can also be used as a targeting sequence. Thus, the targeting sequence may include SEQ ID NO: 62.

The targeting sequence may also include amino acids 1-33 from SEQ ID NO: 13, amino acids 18-33 from SEQ ID NO: 13, or SEQ ID NO: 13, or the exospore protein may include the full length B. weihenstephensis KBAB4 3572 gene product (SEQ ID NO: 14). The methionine residue linked to amino acids 18-33 of the B. weihenstephensis gene KBAB4 3572 can also be used as a targeting sequence. Thus, the targeting sequence may include SEQ ID NO: 63.

Alternatively, the targeting sequence may include amino acids 1-43 from SEQ ID NO: 15, amino acids 28-43 from SEQ ID NO: 15, or SEQ ID NO: 15, or the exospore protein may include the full length B. cereus VD200 exospore leader peptide (SEQ ID NO: 16).

The targeting sequence may also include amino acids 1-27 from SEQ ID NO: 17, amino acids 12-27 from SEQ ID NO: 17, or SEQ ID NO: 17, or the exospore protein may include the full length exospore leader peptide from B. cereus VD166 (SEQ ID NO: 18). The methionine residue associated with amino acids 12-27 of the leader peptide of the B. cereus VD166 exospore can also be used as a targeting sequence. Thus, the targeting sequence may include SEQ ID NO: 64.

The targeting sequence may also include amino acids 1-33 of SEQ ID NO: 19, amino acids 18-33 of SEQ ID NO: 19, or SEQ ID NO: 19, or the exospore protein may include the full length B. cereus VD200 hypothetical IKG_04663 protein (SEQ ID NO: 20).

Alternatively, the targeting sequence includes amino acids 1-33 of SEQ ID NO: 21, amino acids 18-33 of SEQ ID NO: 21, or SEQ ID NO: 21, or the exospore protein can include the full length YVTN β-propeller protein B. weihenstephensis KBAB4 ( SEQ ID NO: 22). The methionine residue linked to amino acids 18-33 of the YVTN β-propeller protein of B. weihenstephensis KBAB4 can also be used as a targeting sequence. Thus, the targeting sequence may include SEQ ID NO: 65.

The targeting sequence may also include amino acids 1-24 from SEQ ID NO: 23, amino acids 9-24 from SEQ ID NO: 23, or SEQ ID NO: 23, or the exospore protein may include the full-length hypothetical bcerkbab4_2363 B. weihenstephensis KBAB4 (SEQ ID NO: 24). The methionine residue associated with amino acids 9-24 of the hypothetical bcerkbab4_2363 protein of B. weihenstephensis KBAB4 can also be used as a targeting sequence. Thus, the targeting sequence may include SEQ ID NO: 66.

The targeting sequence includes amino acids 1-24 of SEQ ID NO: 25, amino acids 9-24 of SEQ ID NO: 25, or SEQ ID NO: 25, or the exospore protein may include the full-length hypothetical bcerkbab4_2131 B. weihenstephensis KBAB4 (SEQ ID NO: 26). The methionine residue linked to amino acids 9-24 of the hypothetical B. weihenstephensis KBAB4 protein bcerkbab4_2131 can also be used as a targeting sequence. Thus, the targeting sequence may include SEQ ID NO: 67.

Alternatively, the targeting sequence includes amino acids 1-30 of SEQ ID NO: 27, amino acids 15-30 of SEQ ID NO: 27, or SEQ ID NO: 27, or the exospore protein may include a full length triple helical repeat containing collagen, B. weihenstephensis KBAB4 (SEQ ID NO: 28).

The targeting sequence may also include amino acids 1-33 from SEQ ID NO: 29, amino acids 18-33 from SEQ ID NO: 29, or SEQ ID NO: 29, or the exospore protein may include the full length hypothetical bmyco0001_21660 B. mycoides 2048 (SEQ ID NO: 30).

The targeting sequence may also include amino acids 1-24 from SEQ ID NO: 31, amino acids 9-24 from SEQ ID NO: 31, or SEQ ID NO: 31, or the exospore protein may include the full length hypothetical bmyc0001_22540 B. mycoides 2048 (SEQ ID NO: 32). The methionine residue associated with amino acids 9-24 of the hypothetical bmyc0001_22540 protein of B. mycoides 2048 can also be used as a targeting sequence. Thus, the targeting sequence may include SEQ ID NO: 68.

Alternatively, the targeting sequence comprises amino acids 1-15 of SEQ ID NO: 33, SEQ ID NO: 33, or the exospore protein comprises the full length hypothetical bmyc0001_21510 B. mycoides 2048 (SEQ ID NO: 34) protein.

The targeting sequence may also include amino acids 1-16 of SEQ ID NO: 35, SEQ ID NO: 35, or the exospore protein may include the full length collagen triple helical repeat protein of B. thuringiensis 35646 (SEQ ID NO: 36).

The targeting sequence may include amino acids 1-29 of SEQ ID NO: 43, amino acids 14-29 of SEQ ID NO: 43, or SEQ ID NO: 43, or the exospore protein may include the full length B. cereus hypothetical protein WP_69652 (SEQ ID NO: 44).

Alternatively, the targeting sequence may include amino acids 1-35 from SEQ ID NO: 45, amino acids 20-35 from SEQ ID NO: 45, or SEQ ID NO: 45, or the exospore protein may include the full length exospore leader WP016117717 B. cereus (SEQ ID NO: 46). The methionine residue associated with amino acids 20-35 of exospore leader WP016117717 B. cereus can also be used as a targeting sequence. Thus, the targeting sequence may include SEQ ID NO: 70.

The targeting sequence may include amino acids 1-43 from SEQ ID NO: 47, amino acids 28-43 from SEQ ID NO: 47, or SEQ ID NO: 47, or the exospore protein may include the full length B. cereus exospore peptide WP002105192 (SEQ ID NO: 48).

The targeting sequence may include amino acids 1-32 from SEQ ID NO: 49, amino acids 17-32 from SEQ ID NO: 49, or SEQ ID NO: 49, or the exospore protein may include the full length B. cereus hypothetical protein WP87353 (SEQ ID NO: 50).

Alternatively, the targeting sequence may include amino acids 1-33 of SEQ ID NO: 51, amino acids 18-33 of SEQ ID NO: 51, or SEQ ID NO: 51, or the exospore protein may include the full length B. cereus exospory 02112369 peptide (SEQ ID NO: 52).

The targeting sequence may include amino acids 1-33 from SEQ ID NO: 53, amino acids 18-33 from SEQ ID NO: 53, or SEQ ID NO: 53, or the exospore protein may include the full length B. cereus exospore protein WP016099770 (SEQ ID NO: 54).

Alternatively, the targeting sequence may include acids 1-30 from SEQ ID NO: 55, amino acids 15-30 from SEQ ID NO: 55, or SEQ ID NO: 55, or the exospore protein may include the full length B. thuringiensis hypothetical protein YP006612525 (SEQ ID NO: 56).

The targeting sequence may also include amino acids 1-130 from SEQ ID NO: 57, amino acids 115-130 from SEQ ID NO: 57, or SEQ ID NO: 57, or the exospore protein may include the full length hypothetical B. mycoides TIGR03720 protein (SEQ ID NO: : 58).

Additionally, it can be readily seen from the sequence alignment in Figure 1 that while amino acids 20-35 from BclA are conserved and amino acids 25-35 are more conserved, variance can occur to some extent in this region without affecting ability targeting sequence to target the protein to exospores. Figure 1 shows the percent identity of each of the respective amino acids of each sequence to amino acids 20-35 from BclA ("20-35% Identity") and to amino acids 25-35 from BclA ("25-35% Identity"). Thus, for example, compared to amino acids 20-35 from BclA, the corresponding amino acids from BetA / BAS3290 are approximately 81.3% identical, the corresponding amino acids from BAS4623 are approximately 50.0% identical, the corresponding amino acids from BclB are approximately 43 identical, 8%, the corresponding amino acids from BAS1882 are approximately 62.5% identical, the corresponding amino acids of the KBAB4 2280 gene product are approximately 81.3% identical, and the corresponding amino acids of the KBAB4 3572 gene product are approximately 81.3% identical. The sequence identities above this region for the remaining sequences are shown in Figure 1.

With respect to amino acids 25-35 from BclA, the corresponding amino acids from BetA / BAS3290 are approximately 90.9% identical, the corresponding amino acids from BAS4623 are approximately 72.7% identical, the corresponding amino acids from BclB are approximately 54.5% identical, the corresponding amino acids from BAS1882 are approximately 72.7% identical, the corresponding amino acids of the KBAB4 2280 gene product are approximately 90.9% identical, and the corresponding amino acids of the KBAB4 3572 gene product are approximately 81.8% identical. The sequence identities above this region for the remaining sequences are shown in Figure 1.

Thus, the targeting sequence may include an amino acid sequence having at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, where the identity with amino acids 25-35 is at least about 54%. Alternatively, the targeting sequence consists of an amino acid sequence of 16 amino acids having at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, where the identity with amino acids 25-35 is at least about 54%.

The targeting sequence can also include an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, where the identity with amino acids 25-35 is at least about 63%. Alternatively, the targeting sequence consists of an amino acid sequence of 16 amino acids having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, where the identity with amino acids 25-35 is at least about 63%.

The targeting sequence can also include an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, where the identity with amino acids 25-35 is at least about 72%. Alternatively, the targeting sequence consists of an amino acid sequence of 16 amino acids having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, where the identity with amino acids 25-35 is at least about 72%.

The targeting sequence can also include an amino acid sequence having at least about 56% identity with amino acids 20-35 of SEQ ID NO: 1, where the identity with amino acids 25-35 is at least about 63%. Alternatively, the targeting sequence consists of an amino acid sequence of 16 amino acids having at least about 56% identity with amino acids 20-35 of SEQ ID NO: 1, where the identity with amino acids 25-35 is at least about 63%.

Alternatively, the targeting sequence may include an amino sequence having at least about 62% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 72%. The targeting sequence may also include an amino acid sequence of 16 amino acids having at least about 62% identity to amino acids 20 to 35 of SEQ ID NO: 1, wherein the identity to amino acids 25 to 35 of SEQ ID NO: 1 is at least approximately 72%.

The targeting sequence may include an amino acid sequence having at least 68% identity with amino acids 20-35 of SEQ ID NO: 1, where the identity with amino acids 25-35 is at least about 81%. Alternatively, the targeting sequence consists of an amino acid sequence of 16 amino acids having at least 68% identity with amino acids 20-35 of SEQ ID NO: 1, where the identity with amino acids 25-35 is at least about 81%.

The targeting sequence can also include an amino sequence having at least about 75% identity to amino acids 20-35 of SEQ ID NO: 1, where the identity to amino acids 25-35 is at least about 72%. Alternatively, the targeting sequence consists of an amino acid sequence of 16 amino acids having at least about 75% identity to amino acids 20 to 35 of SEQ ID NO: 1, wherein the identity to amino acids 25 to 35 of SEQ ID NO: 1 is at least least about 72%.

The targeting sequence can also include an amino sequence having at least about 75% identity to amino acids 20-35 of SEQ ID NO: 1, where the identity to amino acids 25-35 is at least about 81%. Alternatively, the targeting sequence consists of an amino acid sequence of 16 amino acids having at least about 75% identity to amino acids 20 to 35 of SEQ ID NO: 1, wherein the identity to amino acids 25 to 35 of SEQ ID NO: 1 is at least least about 81%.

The targeting sequence can also include an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, where the identity with amino acids 25-35 is at least about 81%. Alternatively, the targeting sequence consists of an amino acid sequence of 16 amino acids having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, where the identity with amino acids 25-35 is at least about 81%.

The targeting sequence may include an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, where the identity with amino acids 25-35 is at least about 90%. Alternatively, the targeting sequence consists of an amino acid sequence of 16 amino acids having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, where the identity with amino acids 25-35 is at least about 90%.

One skilled in the art will understand that variants of the above-described sequences can also be used as a targeting sequence, provided that the targeting sequence includes amino acids 20-35 from BclA, corresponding amino acids from BetA / BAS3290, BAS4263, BclB, BAS1882, product the KBAB4 2280 gene, or the KBAB 3572 gene product, or a sequence containing any of the above sequences identical to amino acids 20-35 and 25-35 of BclA is present.

In addition, it has been found that certain exospore proteins of the Bacillus cereus family lacking regions having homology to amino acids 25-35 of BclA can also be used to target a peptide or protein to exospores of a member of the Bacillus cereus family. In particular, the fusion proteins may include an exospore protein comprising SEQ ID NO: 71 (B. mycoides InhA), an exospore protein comprising SEQ ID NO: 72 (B. anthracis Sterne BAS1141 (ExsY)), an exospore protein comprising SEQ ID NO : 73 {V. anthracis Sterne BASH44 (BxpB / ExsFA)), exospore protein containing SEQ ID NO: 74 (B. anthracis Sterne B AS 1145 (CotY)), exospore protein containing SEQ ID NO: 75 (B. anthracis Sterne BAS1140), protein exospory containing SEQ ID NO: 76 (B. anthracis H9401 ExsFB), exospore protein containing SEQ ID NO: 77 (B. thuringiensis HD74 InhA1), exospore protein containing SEQ ID NO: 78 (B. cereus ATCC 10876 ExsJ) , an exospore protein containing SEQ ID NO: 79 (B. cereus ExsH), an exospore protein containing SEQ ID NO: 80 (B. anthracis Ames YjcA), an exospore protein containing SEQ ID NO: 81 (B. anthracis YjcB), an exospore protein containing SEQ ID NO: 82 (B. anthracis Sterne BclC), an exospore protein containing SEQ ID NO: 83 (Bacillus thuringiensis serovar konkukian strain 97-27 acid phosphatase), or an exospore protein containing SEQ ID NO: 84 ( B. thuringiensis HD74 InhA2). The inclusion of an exospore protein containing SEQ ID NO: 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, or 84 in the fusion proteins described herein will result in targeting on exospores of a representative of the family B. cereus.

Moreover, exospore proteins having a high degree of sequence identity to any of the full-length exospore proteins or exospore protein fragments described above can also be used to target a peptide or protein to exospores of a member of the Bacillus cereus family. Thus, the fusion protein may include an exospore protein comprising an amino acid sequence having at least 85% identity with any of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 59, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, and 84. Alternatively, the fusion protein may include an exospore protein having at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with any of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 59, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, and 84.

Alternatively, the fusion protein can include an exospore protein fragment containing an amino acid sequence having at least 85% identity with SEQ ID NO: 59. Alternatively, the fusion protein can include an exospore protein fragment containing an amino acid sequence having at least 90% identity at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 59.

In any of the targeting sequences, exospory proteins, or exospore protein fragments described herein, the targeting sequence, exospore protein, or exospore protein fragment may include the amino acid sequence of GXT at its carboxy terminus, where X is any amino acid.

In any of the targeting sequences, exospory proteins, and exospore protein fragments described herein, the targeting sequence, exospory protein, or exospory protein fragment may include an alanine residue at a position in the targeting sequence that corresponds to amino acid 20 of SEQ ID NO: 1.

Fusion proteins

The fusion proteins may include a targeting sequence, an exospore protein, or an exospore protein fragment, and at least one plant growth promoting protein or peptide. A plant growth promoting protein or peptide may include a peptide hormone, a non-hormonal peptide, an enzyme involved in the production or activation of a plant growth promoting compound, or an enzyme that degrades or modifies a bacterial, fungal, or plant food source. The targeting sequence, exospore protein, or exospore protein fragment can be any of the targeting sequences, exospory proteins, or exospore protein fragments described herein.

The fusion proteins can include a targeting sequence, an exospore protein, or an exospore protein fragment, and at least one protein or peptide that protects the plant from a pathogen. The targeting sequence, exospore protein, or exospore protein fragment can be any of the targeting sequences, exospory proteins, or exospore protein fragments described herein.

The fusion protein can be prepared using standard cloning and molecular biology techniques known in the art. For example, a gene encoding a protein or peptide (for example, a gene encoding a plant growth promoting protein or peptide) can be amplified by polymerase chain reaction (PCR) and ligated to DNA encoding any of the above targeting sequences to form a DNA molecule that encodes the fusion protein. The DNA molecule encoding the fusion protein can be cloned into any suitable vector, for example, a plasmid vector. The vector suitably includes a multiple cloning site into which a DNA molecule encoding a fusion protein can be easily inserted. The vector also suitably contains a selectable marker, such as an antibiotic resistance gene, such that the bacterium transformed, transfected or matted with the vector can be easily identified and isolated. If the vector is a plasmid, then the plasmid suitably also includes an origin of replication. The DNA encoding the fusion protein is suitably under the control of a sporulation promoter that will induce expression of the fusion protein on the exospory of a B. cereus endospore (eg, the native bclA promoter from a B. cereus family). Alternatively, the DNA encoding the fusion protein can be integrated into the chromosomal DNA of a B. cereus family member.

The fusion protein may also include additional polypeptide sequences that are not part of the targeting sequence, exospore protein, exospore protein fragment, or plant growth promoting protein or peptide, protein or peptide that protects the plant from a pathogen, protein or peptide that enhances plant stress resistance. or a protein or peptide that binds to a plant. For example, the fusion protein may include labels or markers to facilitate purification or visualization of the fusion protein (eg, a polyhistidine tag or a fluorescent protein such as GFP or YFP) or visualization of recombinant exospore-producing Bacillus spore cells expressing the fusion protein.

Expression of fusion proteins on exospores using targeting sequences, exospore proteins, and exospore protein fragments described herein is enhanced by the absence of a secondary structure at the amino termini of these sequences, which allows the fusion proteins to fold natively and retain activity. Proper folding can be further enhanced by the inclusion of a short amino acid linker between the targeting sequence, exospore protein, exospore protein fragment, and fusion partner protein.

Thus, any of the fusion proteins described herein may include an amino acid linker between a targeting sequence, exospore protein, or exospore protein fragment and a plant growth promoting protein or peptide, protein or peptide that protects the plant from a pathogen, protein or peptide, which enhances the resistance to stress of plants, or a protein or peptide that binds to the plant.

The linker can include a polyalanine linker or a polyglycine linker. You can also use a linker containing a mixture of both alanine and glycine residues. For example, if the targeting sequence comprises SEQ ID NO: 1, then the fusion protein may have one of the following structures:

Without linker: SEQ ID NO: 1 - Protein fusion partner

Alanine linker: SEQ ID NO: 1-An-Protein fusion partner

Glycine Linker: SEQ ID NO: 1-Gn-Protein Fusion Partner

Mixed alanine and glycine linker: SEQ ID NO: 1 - (A / G) n - Fusion partner protein

where An, Gn, and (A / G) n represent any number of alanines, any number of glycines, or any number of alanines and glycines, respectively. For example, n can be from 1 to 25, and is preferably from 6 to 10. If the linker comprises a mixture of alanine and glycine residues, any combination of glycine and alanine residues can be used. In the above structures, a “fusion partner protein” is a plant growth promoting protein or peptide, a protein or peptide that protects a plant from a pathogen, a protein or peptide that enhances plant stress resistance, or a protein or peptide that binds to a plant.

Alternatively or additionally, the linker may include a protease recognition site. The inclusion of a protease recognition site allows for targeted removal, when exposed to a protease that recognizes a protease recognition site, stimulates the growth of a protein or peptide, a protein or peptide that protects a plant from a pathogen, a protein or peptide that enhances plant stress resistance, or a protein or peptide, binding to the plant.

Proteins and Peptides That Stimulate Plant Growth

As noted above, the fusion proteins may include a targeting sequence, an exospore protein, or an exospore protein fragment, and at least one plant growth promoting protein or peptide. For example, a plant growth promoting protein or peptide may include a peptide hormone, a non-hormonal peptide, an enzyme involved in the production or activation of a plant growth promoting compound, or an enzyme that degrades or modifies a bacterial, fungal, or plant food source.

For example, if a plant growth promoting protein or peptide comprises a peptide hormone, then the peptide hormone may include phytosulfokine (eg, phytosulfokine-α), clavate 3 (CLV3), systemin, ZmlGF, or SCR / SP11.

If the plant growth promoting protein or peptide includes a non-hormonal peptide, the non-hormonal peptide may include RKN 16D10, Hg-Syv46, eNOD40 peptide, melitin, mastoparan, Mas7, RHPP, POLARIS, or Kunitz trypsin inhibitor (KTI).

A plant growth promoting protein or peptide may include an enzyme involved in the production or activation of a plant growth promoting compound. An enzyme involved in the production or activation of a plant growth promoting compound can be any enzyme that catalyzes any step in a biological synthetic pathway for a compound that stimulates plant growth or alters plant structure, or any enzyme that catalyzes the conversion of an inactive or less active a derivative compound that stimulates plant growth or alters the structure of a plant to an active or more active form of the compound.

The plant growth promoting compound may include a compound produced by bacteria or fungi in the rhizosphere, for example 2,3-butanediol.

Alternatively, the plant growth promoting compound may include a plant growth hormone such as cytokinin or a cytokinin derivative, ethylene, auxin or auxin derivative, gibberellic acid or a gibberellic acid derivative, abscisic acid or abscisic acid derivative, or jasmonic acid or jasmonic acid derivative.

If the plant growth promoting compound includes cytokinin or a cytokinin derivative, then the cytokinin or cytokinin derivative may include kinetin, cis-zeatin, trans-zeatin, 6-benzylaminopurine, dihydroxyseatin, N6- (D2-isopentenyl) adenine, ribosyl- ( D2-isopentenyl) adenosine, 2-methylthio-cis-ribosyl zeatin, cis-ribosyl zeatin, trans-ribosyl zeatin, 2-methylthio-trans-ribosyl zeatin, ribosyl zeatin-5-monophosphate, N6-methylaminopurin-2-ribosyl zeatin, N6-methylaminopurin'-riboxin 4-hydroxy-3-methyl-trans-2-butenylaminopurine, ortho-topolin, meta-topolin, benzyladenine, ortho-methyltopoline, meta-methyltopoline, or a combination thereof.

If the plant growth promoting compound comprises an auxin or auxin derivative, the auxin or auxin derivative may include active auxin, inactive auxin, conjugated auxin, naturally occurring auxin, or synthetic auxin, or a combination thereof. For example, an auxin or auxin derivative may include indole-3-acetic acid, indole-3-pyruvic acid, indole-3-acetaldoxime, indole-3-acetamide, indole-3-acetonitrile, indole-3-ethanol, indole-3- pyruvate, indole-3-acetaldoxime, indole-3-butyric acid, phenylacetic acid, 4-chlorindole-3-acetic acid, glucose conjugated auxin, or a combination thereof.

An enzyme involved in the production or activation of a compound that stimulates plant growth may include the following enzymes: acetoin reductase, indole-3-acetamide hydrolase, tryptophan monooxygenase, acetolactate synthetase, α-acetolactate decarboxylase, pyruvate decarboxylase, diacetyl- reductase, butanediol dehydrogenase, aminotransferase (for example, tryptophan aminotransferase), tryptophan decarboxylase, amine oxidase, indole-3-pyruvate decarboxylase, indole-3-acetaldehyde dehydrogenase, side chain oxidase of tryptophanase, nitrile nitrile adase -isopentenyl transferase, phosphatase, adenosine kinase, adenine phosphoribosyltransferase, CYP735A, 5'-ribonucleotide phosphohydrolase, adenosine nucleosidase, zeatin cis-trans isomerase, zeatin O-glycosyltransferase, CG-cytosfera -hydroxylase, SC N-glycosyltransferase, 2,5-ribonucleotide phosphohydrolase, adenosine nucleosidase, purine nucleoside phosphorylase, zeatin reductase, hydroxylamine reductase, 2-ok co-glutarate dioxygenase, gibberellin 2B / 3B hydrolase, gibberellin 3-oxidase, gibberellin 20-oxidase, chitosinase, chitinase, β-1,3-glucanase, β-1,4-glucanase, β-1,6-glucanase, aminocyclopropane deaminase 1-carboxylic acid, or an enzyme involved in the production of a nod factor (e.g. nodA, nodB, or nodI).

If the enzyme includes a protease or peptidase, then the protease or peptidase can be a protease or peptidase that cleaves proteins, peptides, pro-proteins, or preproproteins, forming a biologically active peptide. The biologically active peptide can be any peptide that exhibits biological activity.

Examples of biologically active peptides include RKN 16D10 and RHPP.

A protease or peptidase that cleaves proteins, peptides, pro-proteins, or prepro-proteins, forming a biologically active peptide, may include subtilisin, acidic protease, alkaline protease, proteinase, endopeptidase, exopeptidase, thermolysin, papain, pepsin, trypsin, pronase, protease, glutamine protease, aspartate protease, cysteine protease, threonine protease, or metalloprotease.

A protease or peptidase can degrade proteins in a protein-rich flour (such as soy flour or yeast extract).

The plant growth promoting protein can also include an enzyme that degrades or modifies a bacterial, fungal, or plant food source. Such enzymes include cellulases, lipases, lignin oxidases, proteases, glycoside hydrolases, phosphatases, nitrogenases, nucleases, amidases, nitrate reductase, nitrite reductase, amylase, ammonium oxidase, ligninase, glucosidase, phospholipase, phytase, pectinase, sulfatases, ureases, xylanases, and siderophores. The inclusion in a plant growth medium, or application to a plant, seed, or area surrounding a plant or plant seed, of fusion proteins containing enzymes that degrade or modify a bacterial, fungal, or plant food source can facilitate the processing of nutrients in the vicinity of plants and result in increasing the absorption of nutrients by the plant or by beneficial bacteria or fungi near the plant.

Suitable cellulases include endocellulases (e.g., endogluconase such as Bacillus subtilis endoglucanase, Bacillus thuringiensis endoglucanase, Bacillus cereus endoglucanase, or Bacillus clausii endoglucanase, exocellulase, βma-subtilase β-glucose , β-glucosidase of Bacillus thuringiensis, β-glucosidase of Bacillus cereus, or B-glucosidase of Bacillus clausii).

The lipase may include Bacillus subtilis lipase, Bacillus thuringiensis lipase, Bacillus cereus lipase, or Bacillus clausii lipase.

In one embodiment, the lipase includes a Bacillus subtilis lipase. Bacillus subtilis lipase can be PCR amplified using the following primers: ggatccatggctgaacacaatcc (forward, SEQ ID NO: 37) and ggatccttaattcgtattctggcc (reverse, SEQ ID NO: 38).

In another embodiment, the cellulase is a Bacillus subtilis endoglucanase. Bacillus subtilis endoglucanase can be PCR amplified using the following primers: ggatccatgaaacggtcaatc (forward, SEQ ID NO: 39) and ggatccttactaatttggttctgt (reverse, SEQ ID NO: 40).

In yet another embodiment, the fusion protein comprises an E. coli PtrB protease. The E. coli PtrB protease can be PCR amplified using the following primers: ggatccatgctaccaaaagcc (forward, SEQ ID NO: 41) and ggatccttagtccgcaggcgtagc (reverse, SEQ ID NO: 42).

In certain embodiments, the fusion protein comprises an endoglucanase that is derived from the nucleotide sequence in SEQ ID NO: 104.

The amino acid sequence for an exemplary endoglucanase that may be fused to a targeting sequence, exospore protein, or exospore protein fragment and optionally a linker sequence such as a poly A linker is a fusion protein provided as SEQ ID NO: 107.

In other embodiments, the fusion protein comprises a phospholipase that is derived from the nucleotide sequence shown in SEQ ID NO: 105.

The amino acid sequence for an exemplary phospholipase that can be fused to a targeting sequence, exospore protein, or exospore protein fragment and optionally a linker sequence such as a poly A linker is a fusion protein provided as SEQ ID NO: 108.

In yet other embodiments, the fusion protein comprises a chitosanase that is derived from the nucleotide sequence set forth in SEQ ID NO: 106. An amino acid sequence for an exemplary chitosanase that can be fused to a targeting sequence, exospore protein, or exospore protein fragment, and optionally , a linker sequence such as a poly A linker in the fusion protein is provided as SEQ ID NO: 109.

To create fusion constructs, genes can be fused to the native bclA promoter of Bacillus thuringiensis DNA. encoding the first 35 amino acids from BclA (amino acids 1-35 of SEQ ID NO: 1) using the splicing overlapping extension (SOE) technique. The correct amplicons were cloned into E. colilBacillus in the pHP13 shuttle vector, and the correct clones were screened by DNA sequencing. Correct clones were electroporated into Bacillus thuringiensis (Cry-, plasmid-) and screened for chloramphenicol resistance. The correct transformants were grown in Brain Heart Infusion Broth overnight at 30 ° C, seeded on nutrient agar plates, and incubated at 30 ° C for 3 days. Fusion-expressing spores (BEMD spores) can be harvested from the plate by washing in phosphate buffered saline (PBS) and purified by centrifugation and additional washing in PBS.

In such fusion proteins, an endoglucanase, phospholipase, or chitosinase may include a nucleotide sequence encoding an amino acid sequence having at least 85% identity with SEQ ID NO: 107, 108, or 109, respectively.

In such fusion proteins, an endoglucanase, phospholipase, or chitosinase may include an amino acid sequence having at least 90% identity with SEQ ID NO: 107, 108, or 109, respectively.

In such fusion proteins, an endoglucanase, phospholipase, or chitosinase may comprise an amino acid sequence having at least 95% identity with SEQ ID NO: 107, 108, or 109, respectively.

In such fusion proteins, an endoglucanase, phospholipase, or chitosinase may include an amino acid sequence having at least 98% identity with SEQ ID NO: 107, 108, or 109, respectively.

In such fusion proteins, an endoglucanase, phospholipase, or chitosinase may include an amino acid sequence having at least 99% identity with SEQ ID NO: 107, 108, or 109, respectively.

Suitable lignin oxidases include lignin peroxidases, laccases, glyoxal oxidases, ligninases, and manganese peroxidases.

The protease may include subtilysin, acidic protease, alkaline protease, proteinase, peptidase, endopeptidase, exopeptidase, thermolysin, papain, pepsin, trypsin, pronase, carboxylase, serine protease, glutamine protease, aspartate protease, cysteine , or metalloprotease.

Phosphatase may include phosphorus monoefirgidrolazu, fosforomonoesterazu (e.g., PhoA4), phosphorus diefirgidrolazu, phosphodiesterase, triphosphoric monoefirgidrolazu, fosforilangidrid hydrolase, pyrophosphatase, phytase (e.g., Bacillus subtilis phytase or phytase EE148 Bacillus thuringiensis VT013A) trimetafosfatazu or triphosphatase.

The nitrogenase may include a nitrogenase of the Nif family (eg, PaeniBacillus massiliensis NifBDEHKNXV).

Proteins and Peptides that protect plants from pathogens

The fusion proteins can include a targeting sequence, an exospore protein, or an exospore protein fragment, and at least one protein or peptide that protects the plant from a pathogen.

A protein or peptide can include a protein or peptide that stimulates the immune response of the plant. For example, a protein or peptide that stimulates a plant's immune response may include a protein or peptide that enhances the plant's immune system. A protein or peptide that enhances the plant's immune system can be any protein or peptide that has a beneficial effect on the plant's immune system. Suitable proteins and peptides that enhance the plant's immune system include harpins, α-elastins, β-elastins, systemins, phenylalanine ammonium lyase, elicitins, defensins, cryptogeins, flagellin proteins, and flagellin peptides (eg, flg22).

Alternatively, the protein or peptide that protects the plant from the pathogen can be a protein or peptide that has antibacterial activity, antifungal activity, or both bacterial and antifungal activity. Examples of such proteins and peptides include bacteriocins, lysozymes, lysozyme peptides (eg, LysM), siderophores, non-ribosomal active peptides, conalbumins, albumin, lactoferrins, lactoferrin peptides (eg, LfcinB), streptavidin, and TasA.

A protein or peptide that protects a plant from a pathogen can also be a protein or peptide that has insecticidal activity, helminthic activity, insect control or caterpillar control, or a combination thereof. For example, a protein or peptide that protects a plant from a pathogen may include an insecticidal bacterial toxin (such as a VIP insecticidal protein), an endotoxin, a Cry toxin (such as a Cry toxin from Bacillus thuringiensis), a protein or peptide, a protease inhibitor (such as a trypsin inhibitor or a sharp-headed protease inhibitor), cysteine protease, or chitinase. If the Cry toxin is a Cry toxin from Bacillus thuringiensis, the Cry toxin can be a Cry5B protein or a Cry21A protein. Cry5B and Cry21A have both insecticidal and nematicidal activities.

The protein that protects the plant from the pathogen may include an enzyme. Suitable enzymes include proteases and lactonases. Proteases and lactonases can be specific for a bacterial signaling molecule (eg, bacterial lactone homoserine signaling molecule).

If the enzyme is a lactonase, then the lactonase may include 1,4-lactonase, 2-pyrone-4,6-dicarboxylate lactonase, 3-oxoadipate enol-lactonase, actinomycin lactonase, deoxylimonate A-ring-lactonase, gluconolactonase L-rhamnono-1 , 4-lactonase, limonin-D-ring-lactonase, steroid-lactonase, triacetate-lactonase, or xylono-1,4-lactonase.

The enzyme can also be an enzyme that is specific for a cellular component of a bacterium or fungus. For example, the enzyme may include β-1,3-glucanase, β-1,4-glucanase, β-1,6-glucanase, chitosinase, chitinase, chitosinase-like enzyme, luticase, peptidase, proteinase, protease (e.g., alkaline protease , acidic protease, or neutral protease), mutanolysin, stafolysin, or lysozyme.

Proteins and Peptides that increase plant stress resistance

The fusion proteins may include a targeting sequence, an exospore protein, or an exospore protein fragment, and at least one protein or peptide that enhances plant stress resistance.

For example, a protein or peptide that enhances plant stress tolerance includes an enzyme that degrades a stress-related compound. Stress-related compounds include, but are not limited to, aminocyclopropane-1-carboxylic acid (ACC), reactive oxygen species, nitric oxide, oxylipins, and phenolic resins. Specific reactive oxygen species include hydroxyl, hydrogen peroxide, oxygen, and superoxide. An enzyme that degrades a stress-related compound may include superoxide dismutase, oxidase, catalase, aminocyclopropane-1-carboxylic acid deaminase, peroxidase, antioxidant enzyme, or antioxidant peptide.

A protein or peptide that enhances plant stress tolerance may also include a protein or peptide that protects the plant from environmental stress. Environmental stress can include, for example, drought, flooding, heat, frost, salt, heavy metals, low pH, high pH, or a combination of both. For example, a protein or peptide that protects a plant from environmental stress may include a protein that induces the formation of ice microcrystals, prolinease, phenylalanine ammonium lyase, isochorismate synthase, isochorismatpyruvate lyase, or choline dehydrogenase.

Plant-Binding Proteins and Peptides

The fusion proteins can include a targeting sequence, an exospore protein, or an exospore protein fragment, and at least a protein or peptide that binds to a plant. A protein or peptide that binds to a plant can be any protein or peptide that is capable of binding specifically or nonspecifically to any part of a plant (eg, a root of a plant or an aerial part of a plant such as a leaf, stem, flower or fruit) or plant material. Thus, for example, a protein or peptide that binds to a plant can be a protein or peptide that binds to a root, or a protein or peptide that binds to leaves.

Suitable plant-binding proteins and peptides include adhesins (e.g., ricadgesin), flagellins, omptins, lectins, expansins, biofilm structural proteins (e.g. TasA or YuaB), pilus proteins, curlus proteins, intimins, invasins, agglutinins, and afimbins. ...

Recombinant Bacillus That Express Fusion Proteins

The fusion proteins described herein can be expressed using recombinant exospore-producing Bacillus cells. The fusion protein can be any of the fusion proteins described above.

Recombinant Bacillus exospore-producing cells can co-express two or more of any of the fusion proteins described above. For example, recombinant exospore-producing Bacillus cells can co-express at least one fusion protein that includes a protein or peptide that binds to a plant, together with at least one fusion protein containing a plant growth promoting protein or peptide, at least one fusion protein containing a protein or peptide that protects the plant from a pathogen, or at least one protein or peptide that enhances plant stress resistance.

Recombinant Bacillus exospore-producing cells may include Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus weihenstephensois, Bacillus combination thereof. For example, recombinant Bacillus exospore-producing cells may include Bacillus cereus, Bacillus thuringiensis, Bacillus pseudomycoides, or Bacillus mycoides. In particular, recombinant exospore-producing Bacillus cells may include Bacillus thuringiensis or Bacillus mycoides.

To create recombinant exospore-producing Bacillus cells expressing the fusion protein, any member of the Bacillus cereus family can be conjugated, transduced or transformed with a vector encoding the fusion protein using standard techniques known in the art (e.g., by electroporation). Thereafter, the bacteria can be screened to identify transformants using any method known in the art. For example, if the vector includes an antibiotic resistance gene, then the bacterium can be screened for antibiotic resistance. Alternatively, the DNA encoding the fusion protein can be integrated into the chromosomal DNA of a member of the B. cereus host family. The recombinant exospory-producing Bacillus cells can subsequently be subjected to conditions that will induce sporulation. Suitable conditions for inducing sporulation are known in the art. For example, recombinant exospore-producing Bacillus cells can be seeded on agar plates and incubated at about 30 ° C. for several days (eg, 3 days).

Inactivated strains, non-toxic strains, or genetically treated strains of any of the above species may also suitably be used. For example, you can use Bacillus thuringiensis, which lacks Cry toxin. Alternatively or additionally, once recombinant B. cereus spores expressing the fusion protein have been created, they can be inactivated to prevent further germination immediately after use. Any method for inactivating bacterial spores that is known in the art can be used. Suitable methods include, but are not limited to, heat treatment, gamma irradiation, X-ray irradiation, UV-A irradiation, UV-B irradiation, chemical treatment (for example, treatment with glutaraldehyde, formaldehyde, hydrogen peroxide, acetic acid, bleach, or any combination of them), or a combination of them. Alternatively, spores originating from non-toxinogenic strains or genetically or physically inactivated strains can be used.

Recombinant Bacillus exospore-producing cells having plant growth stimulating effects and / or other beneficial properties

Many strains of members of the Bacillus cereus family have inherent beneficial properties. For example, some strains have stimulating effects on plant growth. Any of the fusion proteins described in this application can be expressed in such strains.

For example, recombinant exospore-producing Bacillus cells may include a bacterial strain that promotes plant growth.

A bacterial strain that stimulates plant growth may include a bacterial strain that produces an insecticidal toxin (e.g., Cry toxin), produces a fungicidal compound (e.g., β-1,3-glucanase, chitosinase, luticase, or a combination thereof), produces a nematicidal compound (e.g. , Cry toxin), produces a bactericidal compound that is resistant to one or more antibiotics, includes one or more freely replicating plasmids associated with plant roots, colonizing plant roots, forming biofilms, solubilizing nutrients, secreting organic acids, or any combination thereof ...

For example, if the recombinant exospore-producing Bacillus cells include a bacterial strain that promotes plant growth, the bacterial strain that promotes plant growth may include Bacillus mycoides BT155 (NRRL No. B-50921), Bacillus mycoides EE118 (NRRL No. B-50918), Bacillus mycoides EE141 (NRRL No. B-50916), Bacillus mycoides BT46-3 (NRRL No. B-50922), member of the Bacillus cereus family EE128 (NRRL No. B-50917), Bacillus thuringiensis BT013A (NRRL No. B-50924 ), or a member of the Bacillus cereus family EE349 (NRRL No. B-50928). Bacillus thuringiensis BT013A is also known as Bacillus thuringiensis 4Q7. Each of these strains was deposited with the United States Department of Agriculture (USDA) Agricultural Research Service (ARS), located at 1815 North University Street, Peoria, Illinois 61604, USA, March 10, 2014, and is identified by the NRRL deposit number indicated in parentheses.

These plant growth-promoting strains have been isolated from rhizospheres of various vigorous plants and have been identified according to their 16S rRNA sequences and biochemical analyzes. The strains have been identified, at least up to their generic name, using generally accepted biochemical and morphological indicators. Biochemical tests to confirm gram-positive strains such as Bacillus include growth on PEA medium and nutrient agar, microscopic examination, growth in 5% and 7.5% NaCl medium, growth at pH 5 and pH 9, growth at 42 ° C and 50 ° C, the ability to produce acid when fermented with cellobiose, lactose, glycerin, glucose, sucrose, d-mannitol and starch; produce a fluorescent pigment; hydrolyze gelatin; recover nitrate; produce catalase, hydrolyze starch; oxidase reaction, urease production and mobility.

For example, recombinant exospore-producing Bacillus cells containing a bacterial strain that stimulates plant growth may include Bacillus mycoides BT155, Bacillus mycoides EE141, or Bacillus thuringiensis BT013A. Recombinant Bacillus exospore producing cells can express any of the fusion proteins described herein, for example, a fusion protein comprising a targeting sequence from SEQ ID NO: 60 and a non-hormonal peptide (for example, a Kunitz trypsin inhibitor (KTI)), an enzyme involved in production or activation of a plant growth promoting compound (eg chitosinase), a protein or peptide that binds to a plant (eg TasA); a protein or peptide that protects a plant from a pathogen (eg, TasA); or an enzyme that degrades or modifies a bacterial, fungal, or plant food source (eg, a phosphatase such as PhoA or phytase or endoglucanase).

Promoters

In any of the recombinant exospore-producing Bacillus cells described herein, the fusion protein can be expressed under the control of a promoter that is native to the targeting sequence, exospore protein, or exospore protein fragment of the fusion protein. For example, if the fusion protein includes a targeting sequence derived from B. anthracis Sterne BclA (e.g., amino acids 20-35 from SEQ ID NO: 1, amino acids 1-35 from SEQ ID NO: 1, SEQ ID NO: 1, or SEQ ID NO: 60) or if the fusion protein includes a full-length BclA (SEQ ID NO: 2) or a fragment of a full-length BclA (for example, SEQ ID NO: 59), then the fusion protein can be expressed under the control of a promoter that is normally associated with the BclA gene in the genome of B. anthracis Sterne (eg, the promoter from SEQ ID NO: 85).

Alternatively, the fusion protein can be expressed under the control of a highly expressed spore promoter. In some cases, a promoter that is native to a targeting sequence, exospore protein, or exospore protein fragment will be a highly expressed spore promoter. In other cases, a promoter that is native to a targeting sequence, exospore protein, or exospore protein fragment will not be a highly expressed spore promoter. In the latter cases, it may be beneficial to replace the native promoter with a highly expressed sporulation promoter. Expression of the fusion protein under the control of a highly expressed sporulation promoter provides increased expression of the fusion protein on the exospory of a member of the Bacillus cereus family.

A highly expressed spore promoter may include one or more sporulation-specific sigma-K polymerase promoter sequences.

Suitable highly expressed sporulation promoters for use in expressing fusion proteins in members of the Bacillus cereus family include those shown in Table 2 below:

In the promoter sequences listed in Table 2 above, the locations of the sporulation-specific sigma-K polymerase promoter sequences are indicated in bold and underlined. The Cry1A promoter (B. thuringiensis HD-73; SEQ ID NO: 90) has a total of four sigma-K sequences, two of which overlap each other as indicated by double underlining in Table 2.

Preferred highly expressed sporulation promoters for use in expressing fusion proteins in members of the Bacillus cereus family include Bet A promoter (B. anthracis Sterne; SEQ ID NO: 86), BclA promoter (B. anthracis Sterne; SEQ ID NO: 85), operon 1 promoters and 2 BclA cluster glycoside transferase (B. anthracis Sterne; SEQ ID NOS: 101 and 102), and the YVTN β-propeller protein promoter (B. weihenstephensis KBAB 4; SEQ ID NO: 89).

In any of the recombinant exospory-producing Bacillus cells described herein, the fusion protein can be expressed under the control of a spore promoter containing a nucleotide sequence having at least 80%, at least 90%, at least 95%, at least 98% at least 99%, or 100% identity to the nucleotide sequence of any of SEQ ID NOS: 85-103.

If the sporulation promoter contains a nucleotide sequence having at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identity with a nucleotide sequence of any of SEQ ID NOS: 85 -103, then the promoter sequence or sequences of sigma-K polymerase specific for spore formation preferably have 100% identity with the corresponding nucleotides from SEQ ID NO: 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, or 103. For example, as indicated in Table 2 above, the BclA promoter from B. anthracis Sterne (SEQ ID NO: 85) has sigma-K polymerase promoter sequences, specific for sporulation, at nucleotides 24-32, 35-43, and 129-137. Thus, if the sporulation promoter comprises a sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 85, then it is preferred that the nucleotides of the spore promoter corresponding to nucleotides 24-32, 35-43, and 129-137 of SEQ ID NO: 85, are 100% identical to nucleotides 24-32, 35-43, and 129-137 of SEQ ID NO: 85.

In any of the methods described herein for promoting plant growth, plant growth in a plant growth medium containing recombinant exospore-producing Bacillus cells and at least one additional biological control agent selected from the preferred microorganisms described herein exhibits enhanced growth versus plant growth in an identical plant growth medium that contains recombinant exospore-producing Bacillus cells.

In any of the compositions and methods described herein for promoting plant growth, recombinant exospore-producing Bacillus cells may include any of the recombinant plant growth promoting bacteria strains described above.

In any of the compositions and methods for promoting plant growth described herein, the fusion protein can be expressed under the control of any of the promoters described above.

Synthetic factors of nodule formation and plant growth stimulators

In some embodiments, the compositions comprising recombinant exospore-producing Bacillus cells that express the fusion protein and at least one of the biological control agents described herein further comprise a synthetic nodulation factor and / or a plant growth promoter. A non-limiting example of such a synthetic compound is a compound of general formula (I)

wherein:

n is 2 or 3;

A represents -C (O) -;

B represents phenylene;

C represents -O-;

D is a linear hydrocarbon chain containing 11 carbons, which is saturated or unsaturated between carbons 4 and 5;

E and G are independently selected from the group consisting of substituent NHR20;

R1, R2, R3, R4, R5, R6, R7, and R9 are H;

R8 is selected from the group consisting of H, fucosyl, methyl fucosyl, SO ₃ H, SO ₃ Li, SO ₃ Na, SO ₃ K, and SO ₃ N (C _1-8 -alkyl) ₄ ;

R20 is C (O) C _1-6 alkyl; and

any agriculturally acceptable geometric and / or optical isomer, enantiomer and / or diastereoisomer, tautomer, salt, N-oxide, sulfoxide or sulfone thereof.

The salt can be selected from the group consisting of lithium, sodium, potassium and tetraalkylammonium salts.

In certain embodiments, E and G are NHC (O) CH ₃ .

In other embodiments, R8 is selected from the group consisting of H, SO ₃ H, SO ₃ Li, SO ₃ Na, SO ₃ K, SO ₃ N (C _1-8 alkyl) _4, and a substituent of the formula:

Where:

R26 is selected from the group consisting of H and CH ₃ ; and

R27 and R28 are independently selected from the group consisting of H, C (O) CH ₃ , SO ₃ H, SO ₃ Li, SO ₃ Na, SO ₃ K, and SO ₃ N (C _1-8 alkyl) ₄ .

In some aspects, R26, R27, and R28 are all hydrogen. Additional non-limiting examples of synthetic nodule forming factor and / or plant growth promoter that can be used in the present invention include compounds of structural formulas:

in which, if present, M is selected from the group consisting of H ⁺ , Li ⁺ , Na ⁺ , K ⁺ and (C _1-8 alkyl) ₄ N ⁺ .

In certain aspects, the synthetic nodulation factor and / or plant growth promoter is a compound selected from the group consisting of:

и

and

Additional biological control agents

Biological control agents can include, in particular, bacteria, fungi or yeast, protozoa, viruses, entomopathogenic nematodes, inoculants and plants and / or their mutants having all the identification characteristics of the respective strain and / or at least one metabolite produced by the corresponding strain which is active against insects, mites, nematodes and / or phytopathogens. The present invention relates to combinations of the above-described recombinant Bacillus cells with the preferred biological control agents described in this application, and / or to mutants of specific strains of microorganisms described in this application, where the mutants have all the identification characteristics of the corresponding strain, and / or at least one a metabolite produced by a suitable strain that is active against insects, mites, nematodes and / or phytopathogens or promotes plant growth and / or enhances plant viability.

Bacterial cells, spores and metabolites in the culture broth resulting from fermentation ("whole broth" or "fermentation broth") of the preferred microorganisms described in this application can be used directly or concentrated using generally known industrial methods such as centrifugation, filtration and evaporation , or processed into anhydrous powder and granules, for example, by spray drying, drum drying and lyophilization.

The terms "whole broth" and "fermentation broth", as used herein, refer to the culture broth resulting from fermentation prior to any subsequent processing. Whole broth encompasses the microorganism and its constituents, unused raw substrates, and metabolites produced by the microorganism during fermentation. The term "broth concentrate" as used in this application refers to a whole broth (fermentation broth) that has been concentrated using conventional industrial methods as described above, but remains in liquid form. The term "solid fermentation components", as used in this application, refers to dried fermentation broth. The term "fermentation product" as used herein refers to whole broth, broth concentrate and / or solid fermentation components. Compositions according to the present invention include fermentation products. In some embodiments, the concentrated fermentation broth is washed, for example, by a diafiltration process, to remove remaining fermentation broth and metabolites.

In another embodiment, the fermentation broth or broth concentrate can be dried with or without the addition of carriers, inert components, or additives using conventional drying processes or techniques such as spray drying, lyophilization, tray drying, fluid bed drying, drum drying. dryer or evaporation.

In accordance with the invention, biological control agents, which are generalized under the term "bacteria", include spore-forming, root-colonizing bacteria, or bacteria and their metabolites, useful as biological insecticides, nematicides, miticides, or fungicides or soil improvers that improve vitality and plant growth. The following bacteria are used or used in accordance with the invention.

Strains of B. cereus, including the strain CNCM 1-1562 (Wed Patent US №6,406,690), Bacillus firmus, Bacillus pumilus, particularly strain GB34 (products known as YIELD SHIELD ^®), and a strain QST2808 (products known as SONATA ^® QST2808) Bacillus subtilis, in particular a strain GB03 (products known as KODIAK ^®), QST713 strain (products known as SERENADE ^® QST713), strain AQ30002 (also called QST30002; NRRL Accession No. B-50421, known from WO 2012 /. 087980, which is incorporated by reference in this application), strain AQ30004 (also called QST30004; accession number NRRL. B-50455, known from WO 2012/087980, which is incorporated herein by reference), strain AQ743 (accession number NRRLB-21665 ), strain AQ153 (Accession number ATCC 55614 as described in WO 98/21964), (1.79) Streptomyces galbus strain AQ 6047 (Accession number NRRL 30232), (1.91) Rhodococcus globerulus AQ719 (Accession number NRRLB-21663), (1.92 ) Bacillus sp.AQ175 (Accession number ATCC 55608), (1.93) Bacillus sp.AQ 177 (Accession No. Accession ATCC 55609), (1.94) Bacillus sp.AQ178 (Accession number ATCC 53522), (1.95) Streptomyces sp. strain described in WO 02/26041 A2 (Accession number NRRLB-30145), (1.96) Streptomyces microflavus strain NRRL B -50550, (1.97) Streptomyces microflavus strain M (Accession No. 091013-02), Hugerotin-containing fermentation products of Streptomyces as described in WO2014 / 059275, and Streptomyces galbus QST6047 described in US Pat. No. 6,682,925.

In a preferred embodiment, the following bacteria are used in combination with the exospore-producing Bacillus cells described above:

Bacillus firmus, especially strain I-1582 (products known as Bionem, Votivo, Flocter),

Bacillus pumilus, particularly strain GB34 (products known as YIELD SHIELD ^®), and a strain QST2808 (products known as SONATA ^® QST2808),

Bacillus subtilis, in particular a strain GB03 (products known as KODIAK ^®), QST713 strain (products known as SERENADE ^® QST713); access number NRRL. B-50455, known from WO 2012/087980, which is incorporated herein by reference), or B. subtilis strain var. amyloliquefaciens FZB24 (products known as TAEGRO ^®), AQ743 strain (accession number NRRLB-21665), AQ153 strain (Accession Number ATCC 55614, as described in WO 98/21964),

In one embodiment, a composition according to the present invention comprises a combination of at least one of the preferred biological control agents described herein and at least one additional biological control agent selected from the group consisting of Bacillus chitinosporus AQ746 (Accession No. NRRLB-21618) , Bacillus mycoides AQ726 (Accession number NRRLB-21664), Bacillus pumilus QST2808 (Accession number NRRLB-30087), Bacillus pumilus AQ717 (Accession number NRRLB-21662), Bacillus sp. AQ175 (ATCC accession number 55608), Bacillus sp. AQ177 (ATCC accession number 55609), Bacillus sp. AQ178 (Accession number ATCC 53522), Bacillus subtilis AQ743 (Accession number NRRLB-21665), Bacillus subtilis AQ713 (Accession number NRRLB-21661), Bacillus subtilis AQ153 (Accession number ATCC 55614), Muscodor albus RRL 620 (Accession number) roseus A3-5 (Accession number NRRL30548), Rhodococcus globerulus AQ719 (Accession number NRRLB-21663), Streptomyces galbus (Accession number NRRL30232), Streptomyces sp. (Accession number NRRLB-30145), Bacillus subtilis AQ30002 (Accession number NRRLB-50421), and Bacillus subtilis AQ30004 (Accession number NRRLB-50455) and / or a mutant of these strains having all the identification characteristics of the corresponding strain, and / or at least one metabolite produced by an appropriate strain that is active against insects, mites, nematodes and / or phytopathogens.

The following specified further biological control agents are known in the art:

Bacillus chitinosporus AQ746 (Accession number NRRLB-21618) is known from WO 98/21966 A2. It is specifically active against nematodes and insects and produces non-exotoxic, non-proteinaceous, active metabolites in its supernatant. These metabolites are active in relation to nematodes and cockroaches, but inactive in relation to flies, grass rootworm or small scoop.

Bacillus mycoides AQ726 (Accession number NRRLB-21664) and its water-soluble metabolites kill or arrest insects such as the larvae of the cereal root worm and aphids (WO 99/09820 A1).

As described in WO 00/58442 A1, Bacillus pumilus QST2808 (Accession No. NRRLB-30087) is capable of inhibiting a wide range of fungal plant diseases in vivo. Commercially available preparations of this strain are sold under the trade names SONATA ^® plus and BALLAD ^® from Bayer CropScience LP (North Carolina, USA ).

Bacillus pumilus AQ717 (NRRL access B-21662) is known from WO 99/10477 A1. It produces a metabolite that exhibits pesticidal activity against cereal root worms, nematodes and scoopers.

Bacterial strains Bacillus sp. AQ175 (ATCC accession number 55608), Bacillus sp. AQ177 (ATCC accession number 55609) and Bacillus sp. AQ178 (ATCC accession number 53522) described in WO 98/21967 A1 are effective for controlling and protecting plants from aerial fungal and bacterial infections.

The metabolite-producing Bacillus subtilis strain AQ743 (Accession number NRRLB-21665) kills or stops the growth of the cereal rootworm larvae, the larvae of the little scoop, adult flies and nematodes (cf. WO 99/09819).

Bacillus subtilis AQ713 (Accession number B-21661), also referred to as Bacillus subtilis QST713, exhibit broad fungicidal and bactericidal activity and is also active against cereal rootworm (WO 98/50422 A1). A commercially available preparation of the strain available under the trade names ^{SERENADE ® MAX, SERENADE SOIL ®,} SERENADE ® ASO, SERENADE ® EOT and RHAPSODY ^® from Bayer CropScience LP (North Carolina, USA ). Product SERENADE ^® (US EPA Registration №69592-12) contains a patented strain of Bacillus subtilis (QST713 strain) and many different lipopeptides that act synergistically, destroying disease-causing pathogens and providing improved antimicrobial activity. SERENADE ^{® is} used to protect plants such as vegetables, fruits, walnut and vine crops against diseases such as red bacterial root rot, gray rot, sour rot, rust, sclerotinia, powdery mildew, bacterial spot and white rot. SERENADE ^® products available either in liquid form or anhydrous preparations which can be employed as leaf and / or soil treatment. Copies of the US EPA Master Labels for SERENADE ^® products, including SERENADE ^® ASO, SERENADE ^® MAX and SERENADE SOIL, are publicly available from the National Pesticide Information Retrieval System's (NPIRSv ) USEPA / OPP Pesticide Product Label System (PPLS).

SERENADE ^® ASO (aqueous suspension-organic) contains 1.34% anhydrous QST713 as active ingredient and 98.66% other ingredients. SERENADE ^® ASO also formulated into a preparation which contains at least 1 × ¹⁰ September CFU / g QST713, while a certain maximum number of QST713 should be 3.3 × October ¹⁰ CFU / g. For more information, see. US EPA Master Labels for SERENADE ^® ASO from January 4, 2010, which is incorporated herein by reference.

SERENADE ^® MAX contains 14.6% anhydrous QST713 as active ingredient and 85.4% other ingredients. SERENADE ^® MAX prepared as a preparation which contains at least 7,3 × September ¹⁰ CFU / g of QST713, while determining the maximum number shall be QST713 7,9 × October ¹⁰ CFU / g. For more information, see. US EPA Master Label for SERENADE ^® MAX, which is incorporated herein by reference.

Bacillus subtilis AQ153 (ATCC Accession No. 55614) as described in WO 98/21964 A1 is effective for inhibiting the growth of plant pathogenic bacteria and fungi.

WO 02/02082898 A1 describes endopathogenic fungi, including Muscodor albus 620, also known as Muscodor albus QST20799 (Accession number NRRL30547) and Muscodor roseus A3-5 (Accession number NRRL30548), which produce a mixture of labile antibiotics with activity against fungi, bacteria, insects and nematodes.

Rhodococcus globerulus AQ719 (Accession No. NRRLB-21663) produces metabolites that exhibit pesticidal activity against cereal root worms (US Pat. No. 6,027,723 A).

WO 01/79480 A2 describes a strain of Streptomyces galbus (Accession No. NRRL30232) which exhibits insecticidal activity against Lepidoptera.

The Streptomyces sp. Strain described in WO 02/26041 A2 (Accession No. NRRLB-30145) exhibits antifungal activity against specific plant pathogens such as Alternaria, Phytophthora, Botrytis, Rhizoctonia and Sclerotinia.

Strains Bacillus subtilis AQ30002 (also known as QST30002) (Accession number NRRLB-50421, donated October 5, 2010) and Bacillus subtilis AQ30004 (also known as QST30004) (Accession number NRRLB-50455, donated October 5, 2010) are known from WO 2012/087980 A1, which is incorporated herein by reference. As described in this reference, these BCA exhibit broad fungicidal and bactericidal activity. B19 and B20 have a mutation in the swrA gene, which results in impaired swarming ability and enhanced promotion of plant viability compared to a strain containing the wild type swrA gene. The mutation caused by these ICA forms a stronger biofilm than the wild-type strain, thus enhancing its fungicidal and bactericidal activity.

In some embodiments, the biological control agent is a Bacillus subtilis strain, such as Bacillus subtilis QST713, that produces a fengicin-type compound, an iturin-type compound, and / or a surfactin-type compound. In some aspects, the lipopeptide is a fengicin type compound such as plipastatin A1, plipastatin B1, plipastatin B2, fengicin A, fengicin B, agrastatin 1, or agrastatin 2. In other aspects, the lipopeptide is an iturin type compound such as iturin A , mycosubtilin or bacillomycin.

Other lipopeptides producing strains which are suitable for use in the compositions and methods of the present invention include the strain of Bacillus amyloliquefaciens D747 (available as BACSTAR ^® by Etec Crop Solutions, NZ and also available as DOUBLE NICKEL ™ from Certis, US); Bacillus subtilis MBI600 (available as SUBTILEX ^® by Becker Underwood, US EPA Reg №71840-8.); Bacillus subtilis Y1336 (available as BIOBAC ^® WP of Bion-Tech, Taiwan registered as a biological fungicide in Taiwan under the registration number 4764, 5454, 5096 and 5277); Bacillus amyloliquefaciens, especially FZB42 strain (available as RHIZOVITAL ^® from ABiTEP, DE); and Bacillus subtilis var. amyloliquefaciens FZB24 is available from Novozymes Biologicals Inc. (Salem, Virginia) or Syngenta Crop Protection, LLC (Greensboro, North Carolina) in the form of fungicide or TAEGRO ^® TAEGRO ^® ECO (EPA Registration №70127-5).

In some embodiments, the biological control agent in synergistic combinations according to the present invention is:

Bacillus firmus, including strain I-1582 (products known as Bionem, Votivo, Flocter) described in US Pat. No. 6,406,690 (which is incorporated herein by reference) and donated from CNCM on May 29, 1995 with accession number CNCM I -1582,

Bacillus pumilus, including strain GB34 (products known as YIELD SHIELD ^® ) and QST2808 strain (products known as SONATA ^® QST2808),

Bacillus subtilis and Bacillus amyloliquefaciens, including those that produce lipopeptides and in particular a combination of plipastatins or fengicins, surfactins and / or iturins. Also, as for Bacillus subtilis, in particular a strain GB03 (products known as KODIAK ^®, cf. US EPA, Pesticide Fact Sheet -. Bacillus subtilis GB03 1992), QST713 strain (products known as SERENADE ^® QST713), AQ30002 strain ( also called QST30002; accession number NRRL. B-50421, known from WO 2012/087980, which is incorporated herein by reference), and strain AQ30004 (also called QST30004; accession number NRRL. B-50455, known from WO 2012/087980 , which is incorporated into this application by reference).

In accordance with the invention, the biological control agents that can be included in the composition according to the invention and which are generalized under the term "fungi" or "yeast" are the following organisms and / or their mutants having all the identification characteristics of the respective strain, and / or metabolites produced by the respective strain that are active against insects, mites, nematodes and / or phytopathogens (numbering is used in the full description):

Muscodor albus, especially strain QST20799 (products known as ARABESQUE ™ or ANDANTE ™), Coniothyrium minitans, especially strain CON / M / 91-8 (products known as CONTANS ^®), Lagenidium giganteum (products known as LAGINEX ^® from AgraQuest, Inc.), Paecilomyces lilacinus, in particular 251 spores of strain P. lilacinus (products known as BIOACT ^®, Wed crop protection 2008, 27, 352-361).

In accordance with one embodiment of the present invention, the biological control agent includes not only pure cultures of the respective microorganisms, but also their suspensions in a whole broth culture or a supernatant containing a metabolite, or a purified metabolite obtained from a whole broth culture of a strain. "Whole broth culture" refers to a liquid culture containing both cells and media. "Supernatant" refers to the liquid broth that remains after the cells growing in the broth have been removed by centrifugation, filtration, sedimentation, or other methods known in the art.

The above metabolites produced by non-pathogenic microorganisms include antibiotics, enzymes, siderophores and growth promoting agents, for example, zwittermycin-A, canosamine, polyoxin, enzymes such as α-amylase, chitinases and pectinases, phytohormones and their precursors such as auxins, gibberelin-like substances, cytokinin-like compounds, lipopeptides such as iturins, plipastatins or surfactins, for example agrastatin A, bacillomycin D, bacillisin, dufficidin, macrolactin, fengicin, bacillisin and bacillaene.

In accordance with the invention, the biological control agents described in this application can be used or used at any physiological stage, such as active or resting.

Compositions in accordance with the present invention

In accordance with the present invention, the composition comprises a) recombinant exospore-producing Bacillus cells that express a fusion protein comprising: (i) at least one plant growth promoting protein or peptide selected from the group consisting of an enzyme involved in the production or activation of a compound, stimulating plant growth; an enzyme that degrades or modifies a bacterial, fungal, or plant food source; and a protein or peptide that protects the plant from a pathogen; and (ii) a targeting sequence that localizes the fusion protein to exospores of a member of the Bacillus cereus family; and b) at least one additional and other preferred biological control agent described in this application, and / or a mutant of a specific strain of microorganism, disclosed in this application, having all the identification characteristics of the corresponding strain, and / or at least one metabolite produced an appropriate strain that is active against insects, mites, nematodes and / or phytopathogens in a synergistically effective amount.

A "synergistically effective amount" in accordance with the present invention is an amount of a combination of recombinant exospore-producing Bacillus cells that express the fusion protein and at least one additional preferred biological control agent described herein that is more effective against insects, mites , nematodes and / or phytopathogens than recombinant exospore-producing Bacillus cells that express the fusion protein, or such an additional biological control agent alone. A "synergistically effective amount" in accordance with the present invention is also an amount of a combination of recombinant exospore-producing Bacillus cells that express the fusion protein and at least one additional preferred biological control agent described herein that is more effective to enhance plant growth and / or promote plant viability than recombinant exospore-producing Bacillus cells that express the fusion protein, or such an additional biological control agent alone.

The present invention includes any and every combination of each of the additional preferred biological control agents described herein with recombinant exospore-producing Bacillus cells.

In a preferred embodiment, the composition according to the present invention comprises at least one additional fungicide and / or at least one insecticide, provided that the recombinant exospore-producing Bacillus cells, insecticide and fungicide are not identical.

The term "active compound" or "active component" is used herein to refer to recombinant exospore-producing Bacillus cells, at least one additional biological control agent and / or a mutant thereof having all the identification characteristics of the corresponding strain, and / or at least one a metabolite produced by an appropriate strain that is active against insects, mites, nematodes and / or phytopathogens, at least one insecticide and at least one fungicide.

Additional additives

One aspect of the present invention provides a composition as described above further comprising at least one excipient selected from the group consisting of modifying agents, solvents, spontaneous promoters, carriers, emulsifiers, dispersing agents, anti-freeze agents, thickening agents and adjuvants. These compositions are referred to as preparations.

Thus, in one aspect, the present invention provides such formulations, and formulations prepared therefrom, as crop protection agents and / or pesticidal agents such as impregnating, dripping and spraying liquids containing the compositions of the invention. The forms used may additionally include crop protection agents and / or pesticidal agents and / or activity enhancing adjuvants such as penetrants, examples of which are vegetable oils such as, for example, rapeseed oil, sunflower oil, mineral oils such as, for example, liquid paraffins, alkyl esters of vegetable fatty acids such as rapeseed oil or methyl esters of soybean oil or alkanol alkoxylates and / or fillers such as, for example, alkyl siloxanes and / or salts, examples of which are organic or inorganic salts ammonium or phosphonium, examples of which are ammonium sulfate or diammonium hydrogen phosphate, and / or retention promoters such as dioctyl sulfosuccinate or hydroxypropyl guar polymers and / or wetting agents such as glycerin, and / or fertilizers such as, for example, ammonium, potassium or phosphate fertilizers.

Examples of typical formulations include water soluble liquids (SL), emulsifiable concentrates (EC), emulsions in water (EW), suspension concentrates (SC, SE, FS, OD), water dispersible granules (WG), granules (GR), and capsule concentrates. (CS); these and other possible drug types are described, for example, in Crop Life International and in Pesticide Specifications, Manual on Development and Use of FAO and WHO Specifications for Pesticides, FAO Plant Production and Protection Papers - 173 prepared by FAO / WHO Joint Meeting on Pesticide Specifications , 2004, ISBN: 9251048576. The formulations may include active agrochemical compounds other than one or more active compounds of the invention.

These preparations or forms used preferably include adjuvants such as modifying agents, solvents, spontaneous promoters, carriers, emulsifiers, dispersing agents, anti-freeze agents, biocides, thickeners and / or other adjuvants such as, for example, adjuvants. An adjuvant in this context is a component that enhances the biological effect of a drug, while the component itself has no biological effect. Examples of adjuvants are agents that promote retention, spreading, attachment to the surface of the sheet, or penetration.

These preparations are prepared in a known manner, for example, by mixing the active compounds with auxiliary substances such as, for example, modifying agents, solvents and / or solid carriers and / or additional auxiliary substances, such as, for example, surfactants. Formulations are prepared either in suitable plants or before or after use.

Suitable for use as adjuvants are those that are suitable for imparting to the preparation the active compound or the administration forms prepared from these preparations (such as, for example, suitable crop protection agents such as spray liquids or seed dressings) with preferred properties, such as certain physical, technical and / or biological properties.

Suitable modifying agents are, for example, water, polar and non-polar chemical liquids, for example, from the classes of aromatic and non-aromatic hydrocarbons (such as paraffins, alkylbenzenes, alkylnaphthalenes, chlorobenzenes), alcohols and polyols (which, if appropriate, can also be substituted, esterified and / or esterified), ketones (such as acetone, cyclohexanone), esters (including fats and oils) and (poly) ethers, unsubstituted and substituted amines, amides, lactams (such as N-alkylpyrrolidones) and lactones, sulfones and sulfoxides (such as dimethyl sulfoxide).

If the modifying agent used is water, it is also possible to use, for example, organic solvents as auxiliary solvents. In general, suitable liquid solvents are: aromatics such as xylene, toluene or alkylnaphthalenes, chlorinated aromatics and chlorinated aliphatic hydrocarbons such as chlorobenzenes, chloroethylenes or methylene chloride, aliphatic hydrocarbons such as cyclohexane or paraffins, for example petroleum fractions mineral and vegetable oils, alcohols such as butanol or glycol and also their ethers and esters, ketones such as acetone, methyl ethyl ketone, methyl isobutyl ketone or cyclohexanone, strongly polar solvents such as dimethylformamide and dimethyl sulfoxide, and water ...

In principle, it is possible to use all suitable solvents. Suitable solvents are, for example, aromatic hydrocarbons such as xylene, toluene or alkylnaphthalenes, for example, chlorinated aromatic or aliphatic hydrocarbons such as chlorobenzene, chloroethylene or methylene chloride, for example, aliphatic hydrocarbons such as cyclohexane, for example, paraffins, petroleum cuts mineral and vegetable oils, alcohols such as methanol, ethanol, isopropanol, butanol or glycol, for example, and also their ethers and esters, ketones such as acetone, methyl ethyl ketone, methyl isobutyl ketone or cyclohexanone, for example, strongly polar solvents such as dimethyl sulfoxide and water.

In principle, all suitable media can be used. Suitable carriers are, in particular: for example, ammonium salts and ground natural minerals such as kaolins, clays, talc, chalk, quartz, attapulgite, montmorillonite or diatomaceous earth, and ground synthetic minerals such as finely divided silica, alumina and natural or synthetic silicates, resins, waxes and / or solid fertilizers. Mixtures of such carriers can be used in a similar manner. Carriers suitable for granules include the following materials: for example, crushed and fractionated natural minerals such as calcite, marble, pumice, sepiolite, dolomite, and also synthetic granules of inorganic and organic flour, and also granules of organic material such as sawdust, paper, coconut shells, corn cobs and tobacco stalks.

You can also use liquefied gaseous modifying agents or solvents. Particularly preferred are those modifying agents or carriers which are gaseous at standard temperature and at standard pressure, examples thereof include aerosol propellants such as halogenated hydrocarbons, and also butane, propane, nitrogen and carbon dioxide.

Examples of emulsifiers and / or foaming agents, dispersing agents or wetting agents having ionic or non-ionic properties, or mixtures of these surfactants, include polyacrylic acid salts, lignosulfonic acid salts, phenolsulfonic acid or naphthalene sulfonic acid salts, ethylene oxide polycondensates with fatty alcohols or with fatty acids or with fatty amines, with substituted phenols (preferably alkyl phenols or aryl phenols), sulfosuccinic ester salts, taurine derivatives (preferably alkyl taurates), phosphoric esters of polyethoxylated alcohols or phenols, esters of fatty acids and polyhydric alcohols, and derivatives of compounds sulfates, sulfonates and phosphates, examples thereof include alkylaryl polyglycol ethers, alkyl sulfonates, alkyl sulfates, arylsulfonates, protein hydrolysates, lignin sulfite waste liquors, and methyl cellulose. The presence of a surfactant is advantageous if one of the active compounds and / or one of the inert carriers is insoluble in water and if the application is in water.

Additional auxiliaries which may be present in the preparations and in the forms used therefrom include colorants such as inorganic pigments, examples thereof include iron oxide, titanium oxide, Prussian blue, and organic colorants such as alizarin dyes, azo dyes and metal phthalocyanine dyes; and nutrients and trace elements such as salts of iron, manganese, boron, copper, cobalt, molybdenum, and zinc.

Stabilizers such as low temperature stabilizers, preservatives, antioxidants, light stabilizers, or other agents that improve chemical and / or physical stability may also be present. Additionally, foaming agents or anti-foaming agents may be present.

In addition, the preparations and the applied forms prepared therefrom may also include, as additional auxiliary substances, adhesives such as carboxymethyl cellulose, natural and synthetic polymers in the form of powder, granules or latex, such as gum arabic, polyvinyl alcohol, polyvinyl acetate, and also natural phospholipids such as cephalins and lecithins and synthetic phospholipids. Other possible excipients include mineral and vegetable oils.

Also in the preparations and the forms used made from them, additional excipients may be present. Examples of such additives include fragrances, protective colloids, binders, adhesives, thickeners, thixotropic agents, penetrants, retention promoters, stabilizers, sequestrants, complexing agents, wetting agents and dispensers. In general, the active compounds can be combined with any solid or liquid auxiliaries commonly used for the preparation of formulations.

Suitable retention promoters include all those substances that reduce dynamic surface tension, such as dioctyl sulfosuccinate, or increase viscoelasticity, such as, for example, hydroxypropyl guar polymers.

Suitable penetrants in the context of the present invention include all those substances that are typically used to enhance the penetration of active agrochemical compounds into plants. Penetrants in this context are defined in such a way that, from the (usually aqueous) solution and / or spray coating used, they are able to penetrate the cuticle of the plant and thus increase the mobility of the active compounds in the cuticle. This property can be determined using the method described in the literature (Baur, et al., 1997, Pesticide Science 51, 131-152). Examples include alcohol alkoxylates such as coconut fatty acid ethoxylate (10) or isotridecyl ethoxylate (12), fatty acid esters such as rapeseed or soybean methyl esters, fatty amine alkoxylates such as tallowamine ethoxylate (15), or ammonium and / or phosphonium salts such as, for example, ammonium sulfate or diammonium hydrogen phosphate.

The preparations preferably comprise in the range from 0.0001% to 98% by weight of the active compound, or particularly preferably in the range from 0.01% to 95% by weight of the active compound, more preferably in the range from 0.5% to 90% by weight. the weight of the active compound, based on the weight of the preparation. The content of active compound is defined as the sum of the recombinant exospore-producing Bacillus cells and an additional preferred biological control agent described in this application and / or a mutant of a preferred microorganism strain described in this application having all the identification characteristics of the corresponding strain, and / or at least one a metabolite produced by an appropriate strain that is active against insects, mites, nematodes and / or phytopathogens, and a fungicide and / or insecticide, if present.

The active compound content of the applied forms (crop protection products) prepared from the preparations can vary within wide ranges. The concentration of active compound in the forms used may typically range from 0.0001% to 95% by weight of active compound, preferably in the range from 0.0001% to 1% by weight, based on the weight of the form used. The application is carried out in a conventional manner adapted to the forms used.

In addition, in one aspect, the present invention provides a composite kit comprising recombinant exospore-producing Bacillus cells and at least one additional preferred biological control agent described herein and / or a mutant of a specific microorganism strain disclosed herein having all identifying characteristics of the corresponding strain, and / or at least one metabolite produced by the corresponding strain, which is active against insects, mites, nematodes and / or phytopathogens in a synergistically effective amount in a spatially separated device.

In a further embodiment according to the present invention, the aforementioned composite kit further comprises at least one fungicide and / or at least one insecticide, provided that the recombinant exospore producing Bacillus cells, insecticide and fungicide are not identical. The fungicide and / or insecticide may be present either in a component of a biocontrol agent composite kit based on a recombinant exospore-producing member of the Bacillus cereus family or in a composite kit component containing a preferred biological control agent described herein, which are spatially separated, or in both of these components. In one embodiment, the fungicide and insecticide are present in the biocontrol agent component based on the recombinant exospore-producing member of the Bacillus cereus family.

Moreover, the composite kit in accordance with the present invention may further comprise at least one excipient selected from the group consisting of modifying agents, solvents, spontaneous promoters, carriers, emulsifiers, dispersing agents, anti-freeze agents, thickening agents and adjuvants, as indicated below. This at least one excipient may be present either in a component of a composite kit of a biological control agent based on a recombinant exospore-producing member of the Bacillus cereus family, or in a component of a composite kit containing a preferred biological control agent described in this application, which are spatially separated, or both. components.

In a further aspect of the present invention, the composition as described above is used to reduce the total damage to plants and plant parts, as well as the loss of harvested fruits or vegetables caused by insects, mites, nematodes and / or phytopathogens.

In addition, in a further aspect of the present invention, the composition as described above increases the overall plant viability.

The term "plant vitality" generally includes various types of plant improvement that are not related to pest control. For example, beneficial properties that may be mentioned are improved crop performance, including: germination, crop yield, protein content, oil content, starch content, more developed root system, improved root growth, improved root size maintenance, improved root efficiency. improved tolerance to stress (e.g. drought, heat, salt, UV, water, cold), decreased ethylene (decreased production and / or inhibited reception), increased shoot formation, increased plant height, larger leaf blade, fewer dead basal leaves, more strong shoots, greener leaves, pigment content, photosynthetic activity, less need for absorbable substances (such as fertilizer or water), less need for seeds, more productive shoots, earlier flowering, earlier grain ripening, less plant fall (lodging ), increased growth of shoots, enhanced increased plant vigor, increased plant density and early and better germination.

With respect to the use in accordance with the present invention, improved plant vitality preferably refers to improved plant characteristics, including: crop yield, more developed root system (improved root growth), improved root size maintenance, improved root efficiency, increased shoot formation, increased plant height. , larger leaf blade, fewer dead basal leaves, stronger shoots, greener leaves, photosynthetic activity, more productive shoots, increased plant vigor, and increased plant density.

In the context of the present invention, improved plant vitality preferably specifically refers to improved plant properties selected from crop yield, better root system, improved root growth, improved root size maintenance, improved root efficiency, increased shoot growth, and increased plant height.

The effect of the composition in accordance with the present invention on the viability of a plant, as defined in this application, can be determined by comparing plants that grew in similar environmental conditions, in accordance with this part of these plants were treated with the composition in accordance with the present invention, and the other part of these plants were not treated with a composition according to the present invention. Instead, said other portion was not treated at all or was treated with a placebo (i.e., use without a composition according to the invention, such as use without all active ingredients (i.e., without recombinant exospore-producing Bacillus cells, as described herein, and without another preferred biocontrol agent as described herein), or use without recombinant exospore-producing Bacillus cells, as described herein, or use without another preferred biological control agent described herein.

The composition in accordance with the present invention can be applied in any desired manner, such as in the form of pelleting seeds, soaking the soil, and / or directly in the furrow and / or as spraying on the leaves and applied before emergence, after entry, or both. In other words, the composition can be used on a seed, plant, or harvested fruit and vegetables, or on the soil where the plant is grown or where it desires to grow (plant growth locus).

Reducing the total damage to plants and plant parts often results in healthier plants and / or increased plant vigor and yield.

Preferably, the composition according to the present invention is used for treating conventional or transgenic plants or their seeds.

The present invention also provides methods for stimulating plant growth using any of the compositions described above comprising recombinant exospore-producing Bacillus cells that express a fusion protein and at least one of the additional preferred biological control agents described herein. A method for stimulating plant growth includes applying to a plant, a part of a plant, to a locus surrounding the plant, or in which the plant will be grown (for example, soil or other growth medium), a composition comprising recombinant exospore-producing Bacillus cells that express a fusion protein comprising: (I) at least one plant growth promoting protein or peptide; and (ii) a targeting sequence, exospore protein, or exospore protein fragment, and at least one additional preferred biological control agent described herein, and / or a mutant of a specific microorganism strain disclosed in this application, having all the identification characteristics of the corresponding strain and / or at least one metabolite produced by an appropriate strain that is active against insects, mites, nematodes and / or phytopathogens in a synergistically effective amount.

In a further aspect of the present invention, there is provided a method for reducing the total damage to plants and plant parts, as well as the loss of harvested fruits or vegetables caused by insects, mites, nematodes and / or phytopathogens, comprising the step of simultaneously or sequentially using recombinant exospore-producing Bacillus cells and at least one additional preferred biological control agent described herein in a synergistically effective amount.

In one embodiment of the claimed method, the composition further comprises at least one fungicide. In one aspect, the at least one fungicide is a synthetic fungicide. In a further aspect of this embodiment, the at least one fungicide is selected from the following group: bitertanol, bixaphen, bromuconazole, carbendazim, carpropamide, dichlofluanide, fenamidone, fenhexamide, fentin acetate, fentin hydroxide, fluoropicolide, fluopyram, fluoxinosinastrobetone , iprovalicarb, isothianil, methominostrobin, ofuraz, pencycuron, penflufen, prochloraz, propamocarb, propineb, prothioconazole, pyrimethanil, spiroxamine, tebuconazole, tolylfluanide, triadimefon, triadimenol, triflazoxide, and triadimefon.

In another embodiment, the composition comprises at least one insecticide in addition to or instead of a fungicide, provided that the insecticide, fungicide, recombinant exospore-producing Bacillus cells, and the preferred biological control agent described herein are not identical.

In one embodiment, the at least one insecticide is a synthetic insecticide. In a further embodiment, at least one insecticide is selected from the following group: acetamiprid, aldicarb, amitraz, beta-cyfluthrin, carbaryl, clothianidin, cyfluthrin, cypermethrin, deltamethrin, endosulfan, ethion, ethiprole, etoprofos, fenamiphos, phenobucarbron, fenthylene , flubendiamide, fluopyram, flupiradifuron, formethanate, heptanophos, imidacloprid, metamidophos, methiocarb, methomil, niclosamide, oxydemetone-methyl, fosalon, silafluofen, spirodiclofen, spiromesifen, travaclopridumatum.

The method according to the present invention includes the following methods of use, that is, two components of the recombinant exospore-producing Bacillus cells and at least one additional preferred biological control agent described in this application can be prepared in the form of one stable composition with an agriculturally acceptable shelf life (i.e. called "solo drug"), or they are combined before or during use (so-called "combination drugs").

Unless specifically indicated otherwise, the expression "combination" refers to various combinations of recombinant exospore-producing Bacillus cells and at least one further preferred biological control agent described herein, and optionally at least one fungicide and / or at least one insecticide , in a solo formulation, in one "ready-to-mix" form, in a combined spray mixture consisting of solo formulations, such as a "tank mix", and in particular in the combined use of individual active ingredients, if applied in a sequential manner, then that is, one after the other within a suitably short period, such as a few hours or days, for example 2 hours to 7 days. The order of application of the composition in accordance with the present invention is not critical to the implementation of the present invention. Thus, the term "combination" also encompasses the presence of recombinant exospore-producing Bacillus cells and at least one further preferred biological control agent described herein, and optionally at least one fungicide and / or insecticide on or in the plant being treated or its environment, place of growth or storage, for example, after simultaneous or sequential application of recombinant exospore-producing Bacillus cells and at least one additional preferred biological control agent described in this application, and optionally at least one fungicide and / or at least least one insecticide per plant, its environment, habitat or storage location.

If recombinant exospore-producing Bacillus cells and at least one additional preferred biological control agent described in this application, and optionally at least one fungicide and / or at least one insecticide is applied or used in a sequential manner, then it is preferable to treat plants or parts plants (which include seeds and plants germinated from seeds), harvested fruits and vegetables in accordance with the following method: Firstly, at least one fungicide and / or at least one insecticide is applied to the plant or plant parts, and secondly using an additional preferred biological control agent described herein and recombinant exospore-producing Bacillus cells to the same plant or plant part. When used in this way, the amount of remaining insecticide / fungicide in the plant at harvest is minimal. The time periods between the first and second application within the growth (crop) cycle can vary and depends on the effect achieved. For example, the first application is to prevent infestation of a plant or plant parts by insects, mites, nematodes and / or phytopathogens (this is especially preferable if seed treatment is carried out) or to control infestation by insects, mites, nematodes and / or phytopathogens (this is especially preferably in the case of treating plants and plant parts) and the second use is carried out to prevent or control infestation by insects, mites, nematodes and / or phytopathogens and / or to stimulate plant growth. Control in this context means that a composition comprising recombinant exospore-producing Bacillus cells and a preferred biological control agent described herein is not capable of completely eradicating pests or phytopathogenic fungi, but is capable of maintaining infestation at an acceptable level.

The present invention also provides methods for enhancing the killing, inhibiting, preventing and / or repelling activity of the compositions according to the present invention through multiple uses. In some other embodiments, the compositions of the present invention are applied to the plant and / or plant part twice, during any desired developmental stage or under predetermined pest pressure, in the range of about 1 hour, about 5 hours, about 10 hours, about 24 hours, about two days, about 3 days, about 4 days, about 5 days, about 1 week, about 10 days, about two weeks, about three weeks, about 1 month or more. In still some embodiments, the compositions of the present invention are applied to the plant and / or plant part more than twice, for example, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, or more, during any desired developmental stages or under predetermined pest pressure, in the range of about 1 hour, about 5 hours, about 10 hours, about 24 hours, about two days, about 3 days, about 4 days, about 5 days, about 1 week, about 10 days, about two weeks, about three weeks, about 1 month or more. The intervals between each application can be varied if desired. A person skilled in the art will be able to determine the number of applications and the length of the intervals depending on the plant species, plant pest species and other factors.

By performing the above steps, an extremely low level of residues of at least one fungicide and / or at least one insecticide can be achieved on the treated plants, plant parts, and harvested fruits and vegetables.

Unless specifically indicated otherwise, the treatment of plants or plant parts (which include seeds and plants germinated from seeds), harvested fruits and vegetables with the composition in accordance with the invention is carried out directly or by affecting their environment, place of growth or storage using Common treatments such as immersion, spraying, atomization, irrigation, evaporation, dusting, fogging, scattering, foaming, staining, spreading, watering (soaking), drip irrigation. In addition, it is possible to use recombinant exospore-producing Bacillus cells, at least one additional preferred biological control agent described in this application, and optionally at least one fungicide and / or at least one insecticide in the form of a solo preparation or combination preparations using the ultra-low volume method, or inject the composition according to the present invention as a composition or in the form of plantar preparations into the soil (into the furrow).

The term "plant to be treated" encompasses every part of the plant, including its root system and material - such as soil or growth medium - that has a radius of at least 10 cm, 20 cm, 30 cm around the stem or stem of the plant being treated, or which is at least 10 cm, 20 cm, 30 cm around the root system of said plant being treated, respectively.

The number of recombinant exospore-producing Bacillus cells that are used or are used in combination with at least one additional preferred biological control agent described in this application, optionally in the presence of at least one fungicide and / or at least one insecticide, depends on the final formulation. as well as the size or type of plant, plant parts, seeds, harvested fruits and vegetables being processed. Typically, the recombinant exospore-producing Bacillus cells that are used or used in accordance with the invention are present in an amount from about 1% to about 80% (w / w), preferably from about 1% to about 60% (w / w .), more preferably from about 10% to about 50% (w / w) of its solo formulation or combination formulation with at least one additional preferred biological control agent described in this application, and optionally a fungicide and / or at least one insecticide.

Also, the amount of at least one additional preferred biological control agent described in this application, which is used or used in combination with recombinant exospore-producing Bacillus cells, optionally in the presence of at least one fungicide and / or at least one insecticide, depends on the final formulation as well as the size or type of plant, plant parts, seeds, harvested fruits and vegetables to be processed. Typically, an additional preferred biological control agent described in this application that is used or used in accordance with the invention is present in an amount of from about 0.1% to about 80% (w / w), preferably 1% to about 60% (w / w), more preferably about 10% to about 50% (w / w) of its solo formulation or combination formulation, with recombinant exospore-producing Bacillus cells, and optionally at least one fungicide and / or at least one insecticide.

The use of recombinant exospore-producing Bacillus cells can be by spraying on leaves, by soil treatment, and / or by seed dressing / pelleting. If used as a foliar application, in one embodiment, about 1/16 to about 5 gallons of whole broth is used per acre. When used as a tillage, in one embodiment, about 1 to about 5 gallons of whole broth is used per acre. When used for seed dressing, about 1/32 to about 1/4 gallons of whole broth is used per acre. For seed dressing, the final preparation used contains at least 1 × 10 ⁴ , at least 1 × 10 ⁵ , at least 1 × 10 ⁶ , 1 × 10 ⁷ , at least 1 × 10 ⁸ , at least 1 × 10 ⁹ , at least 1 x 10 ¹⁰ colony forming units per gram.

Recombinant exospore-producing Bacillus cells and at least one additional preferred biological control agent described herein and, if present, preferably also a fungicide and / or insecticide, are used or used in a synergistic weight ratio. The skilled artisan is able to establish synergistic weight ratios for the present invention using conventional techniques. The skilled artisan will understand that all of these ratios refer to the ratio within the combination formulation as well as the calculated ratio of the recombinant exospore-producing Bacillus cells described herein and at least one additional preferred biological control agent described herein if both components are used in the form of mono-preparations on the plant being treated. The skilled artisan can calculate this ratio by simple mathematical calculations, since the volume and number of recombinant exospore-producing Bacillus cells and at least one additional preferred biological control agent described herein, respectively, in a mono-preparation is known to the person skilled in the art.

The ratio can be calculated based on the amount of at least one additional preferred biological control agent described in this application at the time of application of the specified component from the combination in accordance with the invention on a plant or plant part and the amount of recombinant exospore-producing Bacillus cells shortly before (for example , 48 h, 24 h, 12 h, 6 h, 2 h, 1 h) or at the time of application of the specified component from the combination in accordance with the invention on a plant or plant part.

The application of recombinant exospore-producing Bacillus cells and at least one additional preferred biological control agent described herein to a plant or part of a plant can be carried out simultaneously or at different times as long as both components are present on or in the plant after application (s ). In cases where the recombinant exospory-producing Bacillus cells and an additional preferred biological control agent described herein are used at different times and the additional preferred biological control agent described herein is used before the recombinant exospory-producing Bacillus cells, then the skilled artisan can determine the concentration of an additional preferred biological control agent described herein on / in the plant by chemical assay known in the art at or shortly before the time of application of the recombinant exospore-producing Bacillus cells. Conversely, if the recombinant exospore-producing Bacillus cells are applied to the plant first, then the concentration of the recombinant exospore-producing Bacillus cells can be determined using assays that are also known in the art, at or shortly before the time of application of an additional preferred biological control agent. described in this application.

In particular, in one embodiment, the synergistic weight ratio of recombinant exospore-producing Bacillus cells (i.e., raw spore preparation) and at least one additional preferred biological control agent described herein is in the range of 1: 1000 to 1000: 1 ; in the range from 1: 500 to 500: 1; in the range from 1: 300 to 500: 1. Additional ratios range from 20: 1 to 1:20, such as 10: 1, 5: 1, or 2: 1. In embodiments in which the biological control agent is based on Bacillus, the weight to weight ratio will be applied to the uncooked Bacillus spore preparation. In one aspect of this embodiment, the spore preparations of both recombinant exospore-producing Bacillus cells and a Bacillus-based biological control agent are a dried spore preparation comprising at least about 1 x 10 ⁴ CFU / g, at least about 1 x 10 ⁵ cfu / g, at least about 1 x 10 ⁶ cfu / g at least about 1 x 10 ⁷ cfu / g, at least about 1 x 10 ⁸ cfu / g, at least about 1 x 10 ⁹ cfu / g, at least about 1 × 10 ¹⁰ CFU / g, and at least about 1 × 10 ¹¹ CFU / g. In another embodiment, the ratio of colony forming unit to colony forming unit of recombinant exospore-producing Bacillus cells and the preferred Bacillus-based biological control agent described herein is in the range of 1: 100,000 to 100,000 to 1, in the range of 1: 10,000 to 10,000: 1, in the range from 1: 1000 to 1000: 1, in the range from 1: 500 to 500: 1, in the range from 1: 100 to 100: 1, in the range from 1:10 to 10: 1, in the range from 1 : 5 to 5: 1, and ranges from 1: 1.

In one embodiment according to the present invention, the concentration of the biocontrol agent based on the recombinant exospore-producing member of the Bacillus cereus family after dispersion is at least 50 g / ha, for example 50 - 7500 g / ha, 50 - 2500 g / ha, 50 - 1500 g / ha; at least 250 g / ha (hectare), at least 500 g / ha, or at least 800 g / ha.

The rate of application of the composition applied or used in accordance with the present invention may vary. A trained technician can establish a suitable application rate using routine experimentation.

In a further aspect of the present invention there is provided a seed treatment using a composition as described above.

Controlling insects, mites, nematodes and / or phytopathogens by treating plant seeds has been known for a long time and is subject to continuous improvement. However, seed treatment causes a number of problems that cannot always be resolved satisfactorily. Thus, it is desirable to develop methods of protecting seeds and germinated plants that eliminate the need, or at least significantly reduce, additional delivery of crop protection compositions during storage, after sowing, or after plant germination. In addition, it is desirable to optimize the amount of active ingredient used in such a way as to provide the best possible protection for seeds and germinated plants from attack by insects, mites, nematodes and / or phytopathogens, but without causing damage to the plant itself by the active ingredient used. In particular, seed treatment methods should also take into account the inherent insecticidal and / or nematicidal properties of pest-resistant or pest-tolerant transgenic plants to achieve optimal seed and germination protection while minimizing the use of crop protection compositions.

Therefore, the present invention also relates, in particular, to a method of protecting seeds and germinated plants from attack by pests, by treating the seeds with recombinant exospore-producing Bacillus cells as defined above and at least one additional biological control agent selected from preferred microorganisms disclosed in this application, and / or a mutant of a specific strain of microorganism described in this application, having all the identification characteristics of the corresponding strain, and / or at least one metabolite produced by the corresponding strain that is active against insects, ticks, nematodes and / or phytopathogens and optionally at least one fungicide and / or optionally at least one insecticide according to the invention. The method according to the invention for protecting seeds and germinated plants from attack by pests encompasses a method in which the seeds are treated simultaneously in one operation with recombinant exospore-producing Bacillus cells and at least one additional preferred biological control agent described herein, and optionally at least one fungicide and / or at least one insecticide. It also encompasses a method in which seeds are treated at different times with recombinant exospore-producing Bacillus cells and at least one additional preferred biological control agent described herein, and optionally at least one fungicide and / or at least one insecticide.

Likewise, the invention relates to the use of a composition according to the invention for treating seeds for protecting seeds and the resulting plant from insects, mites, nematodes and / or phytopathogens.

The invention also relates to seeds that have been treated at the same time with recombinant exospore-producing Bacillus cells and at least one additional preferred biological control agent described herein, and optionally at least one fungicide and / or at least one insecticide ... The invention also relates to seeds that have been treated at various times with recombinant exospore-producing Bacillus cells and at least one additional preferred biological control agent described herein, and optionally at least one fungicide and / or at least one insecticide. In the case of seeds that have been treated at different times with recombinant exospore-producing Bacillus cells and at least one additional preferred biological control agent described herein, and optionally at least one fungicide and / or at least one insecticide, the individual active ingredients in the composition according to the invention may be present in various seed balls.

Furthermore, the invention relates to seeds which, after being treated with the composition according to the invention, are subjected to a film-coating process to prevent mechanical damage to the seeds by dust particles.

One of the advantages of the present invention is that, due to the preferred systemic properties of the compositions according to the invention, seed treatment with these compositions provides protection against insects, mites, nematodes and / or phytopathogens not only for the seeds themselves, but also for plants grown from these seeds. after germination. Consequently, it may not be necessary to treat crops directly during sowing or immediately after.

A further advantage is the fact that by treating the seeds with a composition according to the invention, germination and similarity of the treated seeds can be promoted.

Likewise, it is advantageous that the composition according to the invention can also be used, in particular on transgenic seeds.

It should also be noted that the composition according to the invention can be used in combination with signaling technology, as a result of which, for example, colonization by symbionts such as nodule bacteria, mycorrhiza and / or endophytic bacteria is improved, for example, nitrogen fixation is enhanced and / or optimized. ...

The compositions according to the invention are suitable for the protection of seeds of any plant species, suitable for agriculture, greenhouse, forestry or horticulture. More preferably, these seeds are cereal seeds (e.g. wheat, barley, rye, oats and millet), corn, cotton, soybeans, rice, potatoes, sunflowers, coffee, tobacco, canola, oilseed rape, beets (e.g. sugar beets and fodder beets), peanuts, vegetables (eg, tomatoes, cucumber, legumes, cabbage, onions and lettuce), fruit plants, lawn grasses and ornamental plants. Especially preferred is the seed treatment of cereals (such as wheat, barley, rye and oats), corn, soybeans, cotton, canola, oilseed rape and rice.

As mentioned above, the treatment of transgenic seeds with the composition according to the invention is extremely important. These seeds are plant seeds that usually contain at least one heterologous gene that controls the expression of a polypeptide having especially insecticidal and / or nematicidal properties. These heterologous genes in transgenic seeds can be derived from microorganisms such as Bacillus, Rhizobium, Pseudomonas, Serratia, Trichoderma, Clavibacter, Glomus, or Gliocladium. The present invention is particularly useful for treating transgenic seeds that contain at least one heterologous gene from Bacillus sp. Particularly preferably, the heterologous gene is of Bacillus thuringiensis origin.

For the purposes of the present invention, the composition according to the invention is applied alone or in a suitable seed preparation. The seed is usually processed under conditions in which it is stable so that no damage occurs during processing. In general, seeds can be processed any time between harvest and sowing. Typically, seeds are used that have been separated from the plant and from which the corncobs, pods, stalks, husks, hairs, or pulp have been removed. Thus, for example, you can use seeds that have been harvested, cleaned and dried to a moisture content of less than 15% by weight. Alternatively, it is also possible to use seeds which, after drying, have been treated with water, for example, and then dried again.

When treating seeds, it is generally necessary to ensure that the amount of the composition according to the invention and / or other additives to be applied to the seed is chosen so as not to adversely affect seed germination and / or that the plants that have grown from these seeds were not damaged. This is especially important in cases where the active ingredients can exhibit phytotoxic effects at certain application rates.

The compositions according to the invention can be applied directly, in other words, they do not contain additional components and have not been diluted. It is generally preferred to apply the compositions in the form of a suitable seed preparation. Suitable formulations and methods for dressing seeds are known to the skilled person and are described, for example, in the following documents: US Pat. Nos. 4,272,417 A; 4,245,432 A; 4,808,430 A; 5,876,739 A; published patent application US No. 2003/0176428 Al; WO 2002/080675 Al; WO 2002/028186 A2.

The combinations that can be used in accordance with the invention can be converted into conventional seed dressings such as solutions, emulsions, suspensions, powders, foams, slurries or other seed coating compositions, and also ULV preparations.

These preparations are prepared using a known method by mixing the composition with conventional adjuvants such as, for example, conventional modifying agents and also solvents or diluents, colorants, wetting agents, dispersing agents, emulsifiers, antifoams, preservatives, secondary thickeners, sticky fillers, giberellins, as well as water.

Colorants that may be present in seed dressings that can be used in accordance with the invention include all colorants that are commonly used for such purposes. In this context, it seems possible to use not only pigments that are poorly soluble in water, but also water-soluble dyes. Examples include colorants known under the designations Rhodamin B, C.I. Pigment Red 112 and C.I. Solvent Red 1.

Wetting agents that may be present in seed dressing preparations that can be used in accordance with the invention include all wetting agents that are commonly used in the preparation of active agrochemical ingredients. Alkyl naphthalenesulfonates such as diisopropyl or diisobutyl naphthalenesulfonates can be preferably used.

Dispersants and / or emulsifiers that may be present in seed dressings that can be used in accordance with the invention include all neoionic, anionic and cationic dispersants that are commonly used in the preparation of active agrochemical ingredients. Preferably, you can use nonionic or anionic dispersants or mixtures of nonionic or anionic dispersants. Suitable non-ionic dispersants are in particular ethylene oxide-propylene oxide block polymers, alkylphenol polyglycol ethers and also tristrylphenol polyglycol ethers, and their phosphated or sulfated derivatives. Suitable anionic dispersants are, in particular, lignosulfonates, polyacrylic acid salts, and arylsulfonate-formaldehyde condensates.

Antifoam agents that may be present in seed dressings that can be used in accordance with the invention include all foam inhibitors that are commonly used in the preparation of active agrochemical ingredients. Preferably, silicone antifoams and magnesium stearate can be used.

Preservatives that may be present in seed dressings that can be used in accordance with the invention include all substances that can be used for such purposes in agrochemical compositions. Examples include dichlorophene and benzyl alcohol semiformal.

Secondary thickeners that may be present in seed dressing preparations that can be used in accordance with the invention include all substances that can be used for such purposes in agrochemical compositions. These components preferably include cellulose derivatives, aryl acid derivatives, xanthan, modified clay, and highly dispersed silica.

Sticky fillers that may be present in seed dressings that can be used in accordance with the invention include all conventional binders that can be used in seed dressing products. Preferred mention may be made of polyvinylpyrrolidone, polyvinyl acetate, polyvinyl alcohol and tylose.

", том 2, Springer Verlag, 1970, cc. 401-412).The gibberellins which may be present in seed dressing preparations which can be used in accordance with the invention preferably include gibberellins A1, A3 (= gibberellic acid), A4 and A7, where gibberellic acid is particularly preferred. Giberellins are known (cf. R. Wegler, "Chemie der Pflanzenschutz- und

", Volume 2, Springer Verlag, 1970, pp. 401-412).

The seed dressings that can be used in accordance with the invention can be used either directly or previously diluted with water to treat any different types of seed. Thus, concentrates or preparations obtained from them by dilution with water can be used for dressing seeds of cereals such as wheat, barley, rye, oats and triticale, and also seeds of corn, rice, oilseed rape, peas, beans, cotton, sunflower and beets, or also seeds of any different varieties of vegetable crops. Seed dressing formulations that can be used in accordance with the invention, or diluted formulations thereof, can also be used for dressing the seeds of transgenic plants. In this case, additional synergistic effects may occur when interacting with substances formed during expression.

For treating seeds with seed dressing preparations that can be used in accordance with the invention, or formulations obtained therefrom by dilution with water, suitable mixing equipment includes all such equipment that can typically be used for seed dressing. More preferably, the procedure when seed dressing is carried out consists of placing the seeds in a mixer, adding the preferred desired amount of seed dressing formulations, either alone or after being diluted with water, and mixing until the formulation is uniformly distributed over the seeds. Thereafter, a drying step can be performed.

The application rate of seed dressings that can be used in accordance with the invention can vary over a relatively wide range. This is guided by the preferred number of recombinant exospore-producing Bacillus cells and at least one additional preferred biological control agent described in this application, in preparations and seeds. Application rates for the composition as a whole are in the range of 0.001 and 50 grams per kilogram of seed, preferably in the range of 0.01 and 15 grams per kilogram of seed.

In addition, the composition according to the present invention preferably has a strong microbicidal activity and can be used to combat unwanted microorganisms such as fungi and bacteria, to protect crops and to protect materials.

The invention also relates to a method for controlling undesirable microorganisms, characterized in that the composition according to the invention is applied to phytopathogenic fungi, phytopathogenic bacteria and / or their habitats.

Fungicides can be used to protect crops against phytopathogenic fungi. They are characterized by extremely good efficacy against a wide range of phytopathogenic fungi, including soil pathogens, which, in particular, are members of the classes Plasmodiophoromycetes, Peronosporomycetes (Syn. Oomycetes), Chytridiomycetes, Zygomycetes, Ascomycetes, Basidiomycetes (Sin. Firomycetes). Some fungicides are systemically active and can be used for plant protection as a foliar fungicide, seed dressing or soil fungicide. In addition, they are suitable for controlling fungi, which in particular infect wood or plant roots.

Bactericides can be used to protect crops against Pseudomonadaceae, Rhizobiaceae, Enterobacteriaceae, Corynebacteriaceae, and Streptomycetaceae.

Non-limiting examples of fungal pathogens that can be controlled according to the invention include:

diseases caused by powdery mildew pathogens, for example, Blumeria species, for example, Blumeria graminis; Podosphaera spp., for example Podosphaera leucotricha; Sphaerotheca spp., for example Sphaerotheca fuliginea; Uncinula spp., for example Uncinula necator;

diseases caused by rust pathogens, for example, Gymnosporangium species, for example, Gymnosporangium sabinae; Hemileia spp. eg Hemileia vastatrix; Phakopsora species such as Phakopsora pachyrhizi and Phakopsora meibomiae; Puccinia spp., for example Puccinia recondite, P. triticina, P. graminis, or P. striiformis or P. hordei; Uromyces spp., for example Uromyces appendiculatus;

diseases caused by pathogens from the Oomycetes group, for example, Albugo spp., for example, Algubo Candida; Bremia spp., eg Bremia lactucae; Peronospora spp., for example Peronospora pisi, P. parasitica or P. brassicae; Phytophthora species, for example Phytophthora infestans; Plasmopara species, for example Plasmopara viticola; Pseudoperonospora spp., for example Pseudoperonospora humuli or Pseudoperonospora cubensis; Pythium species, for example Pythium ultimum;

leaf spot diseases and leaf wilt diseases caused, for example, by the following pathogens: Alternaria species, for example Alternaria solani; Cercospora spp. such as Cercospora beticola; Cladiosporium spp., for example, Cladiosporium cucumerinum; Cochliobolus species, for example Cochliobolus sativus (conidial: Drechslera, Syn: Helminthosporium), Cochliobolus miyabeanus; Colletotrichum species, for example Colletotrichum lindemuthanium; Cycloconium species, for example Cycloconium oleaginum; Diaporthe species, for example Diaporthe citri; Elsinoe species, for example Elsinoe fawcettii; Gloeosporium species, for example Gloeosporium laeticolor; Glomerella spp., for example Glomerella cingulata; Guignardia spp., for example Guignardia bidwelli; Leptosphaeria species, for example Leptosphaeria maculans, Leptosphaeria nodorum; spp. Magnaporthe, for example Magnaporthe grisea; Microdochium species, for example Microdochium nivale; Mycosphaerella spp., for example, Mycosphaerella graminicola, M. arachidicola and M. fijiensis; Phaeosphaeria species, for example Phaeosphaeria nodorum; Pyrenophora spp., for example Pyrenophora teres, Pyrenophora tritici repentis; Ramularia spp., for example, Ramularia collo-cygni, Ramularia areola; Rhynchosporium species, for example Rhynchosporium secalis; Septoria species, for example Septoria apii, Septoria lycopersii; Typhula spp., for example Typhula incarnata; Venturia species, for example Venturia inaequalis;

diseases of roots and stems, caused, for example, by such pathogens: Corticium species, for example, Corticium graMuuarum; Fusarium species, for example Fusarium oxysporum; Gaeumannomyces species, for example Gaeumannomyces graminis; Rhizoctonia spp. such as, for example, Rhizoctonia solani; Sarocladium diseases, caused for example by Sarocladium oryzae; Sclerotium diseases, caused for example by Sclerotium oryzae; Tapesia spp., for example Tapesia acuformis; Thielaviopsis spp., for example Thielaviopsis basicola;

diseases of the ears and panicles (including corn cobs) caused, for example, by the following pathogens: Alternaria species, for example Alternaria spp .; Aspergillus species, for example Aspergillus flavus; Cladosporium species, for example Cladosporium cladosporioides; Claviceps spp., for example, Claviceps purpurea; Fusarium species such as Fusarium culmorum; Gibberella spp., for example Gibberella zeae; Monographella species, for example Monographella nivalis; Septoria species, for example Septoria nodorum; diseases caused by smut fungi, eg Sphacelotheca spp., eg Sphacelotheca reiliana; Tilletia spp. eg Tilletia caries, T. controversa; Urocystis spp., for example Urocystis occulta; Ustilago spp., for example Ustilago nuda, U. nuda tritici;

fruit rot caused, for example, by such pathogens: Aspergillus species, for example, Aspergillus flavus; Botrytis species, for example Botrytis cinerea; Penicillium species, for example Penicillium expansum and P. purpurogenum; Sclerotinia spp., for example, Sclerotinia sclerotiorum; Verticilium species, for example Verticilium alboatrum;

seed diseases and soil-borne spoilage, mold, lodging, rot and wilting caused, for example, by the following pathogens: Alternaria spp., caused for example by Alternaria brassicicola; Aphanomyces species, caused for example by Aphanomyces euteiches; Ascochyta spp., caused for example by Ascochyta lentis; Aspergillus spp., caused for example by Aspergillus flavus; Cladosporium spp., caused for example by Cladosporium herbarum; Cochliobolus spp., caused for example by Cochliobolus sativus; (conidial shape: Drechslera, Bipolaris Syn: Helminthosporium); Colletotrichum spp., caused for example by Colletotrichum coccodes; Fusarium spp., caused for example by Fusarium culmorum; Gibberella spp., caused for example by Gibberella zeae; Macrophomina species, caused for example by Macrophomina phaseolina; Monographella spp., caused for example by Monographella nivalis; Penicillium species, caused for example by Penicillium expansum; Phoma species, caused for example by Phoma lingam; Phomopsis spp., caused for example by Phomopsis sojae; Phytophthora spp., caused for example by Phytophthora cactorum; Pyrenophora spp., called for example Pyrenophora graMuna; Pyricularia spp., caused for example by Pyricularia oryzae; Pythium species, caused for example by Pythium ultimum; Rhizoctonia spp., caused for example by Rhizoctonia solani; Rhizopus spp., caused for example by Rhizopus oryzae; Sclerotium species, caused for example by Sclerotium rolfsii; Septoria spp., caused for example by Septoria nodorum; Typhula spp., caused for example by Typhula incarnata; Verticillium spp., caused for example by Verticillium dahliae;

cancer, galls and witch's brooms, caused for example by Nectria spp., eg Nectria galligena;

fading diseases caused, for example, by such pathogens: Monilinia species, for example, Monilinia laxa;

diseases of leaf blistering and leaf curliness caused, for example, by such pathogens: Exobasidium species, for example, Exobasidium vexans;

Taphrina species, for example Taphrina deformans;

withering diseases of woody plants, caused, for example, by the escu of grapes, caused, for example, by Phaemoniella clamydospora, Phaeoacremonium aleophilum and Fomitiporia mediterranea; etiposis, caused, for example, by Eutypa lata; Ganoderma diseases, caused for example by Ganoderma boninense; Rigidoporus diseases, caused for example by Rigidoporus lignosus;

diseases of flowers and seeds caused, for example, by Botrytis species, for example Botrytis cinerea;

diseases of plant tubers caused, for example, by Rhizoctonia spp., eg Rhizoctonia solani; Helminthosporium species, for example Helminthosporium solani;

keela, caused for example by Plasmodiophora species, such as Plamodiophora brassicae;

diseases caused by bacterial pathogens, for example, by such pathogens: Xanthomonas species, for example, Xanthomonas campestris pv. oryzae; Pseudomonas spp., for example, Pseudomonas syringae pv. lachrymans; Erwinia spp., for example Erwinia amylovora.

The following soybean diseases can be preferably controlled:

Fungal diseases on leaves, stems, pods and seeds, caused, for example, by pathogens: Alternaria leaf spot (Alternaria spec, atrans tenuissima), anthracnose (Colletotrichum gloeosporoides dematium var. (Cercospora kikuchii), damage to leaves of choanephora (Choanephora infundibulifera trispora (Syn.)), Damage to leaves of dactuliophora (Dactuliophora glycines), downy mildew (Peronospora manshurica), leaf spot caused by drechslera soycosa (Drechslera glycine) , leaf blight caused by leptosphaerulina (Leptosphaerulina trifolii), phyllosticta leaf blight (Phyllosticta sojaecola), bean and stem rot (Phomopsis sojae), powdery mildew (Microsphaera pyrenoza), leaf blight caused by glycola and cobweb rot (Rhizoc tonia solani), rust (Phakopsora pachyrhizi, Phakopsora meibomiae), scab (Sphaceloma glycines), stemphilia leaf spot (Stemphylium botryosum), target leaf spot (Corynespora cassiicola).

Fungal diseases on the roots and base of the stem, caused, for example, by pathogens: black root rot (Calonectria crotalariae), coal rot (Macrophomina phaseolina), fusarium rot or wilting, root rot, and pod and branch rot (Fysorium orthoarium Fysarce semitectum, Fusarium equiseti), root rot caused by mycoleptodiscus (Mycoleptodiscus terrestris), neocosmospora (Neocosmospora vasinfecta), bean and stem rot (Diaporthe phaseolorum), stem cancer (Diaporthe phaseolivorum) var. stems (Phialophora gregata), fungal rot (Pythium aphanidermatum, Pythium irregulare, Pythium debaryanum, Pythium myriotylum, Pythium ultimum), rhizoctonial root rot, stem destruction and black stalk (Rhizorotonia sclerotia) (Sclerotinia rolfsii), root rot caused by thielaviopsis (T hielaviopsis basicola).

The compositions according to the invention can be used for curative or protective / prophylactic control of phytopathogenic fungi. Therefore, the invention also relates to therapeutic and protective methods for controlling phytopathogenic fungi by using a composition according to the invention, which is applied to seeds, plants or plant parts, fruits or soil in which the plant grows.

The fact that the composition is well tolerated by plants at concentrations required to combat plant diseases makes it possible to treat aerial parts of plants, stem and seeds for propagation, and soil.

All plants and plant parts can be treated in accordance with the invention. By plants is meant all plants and plant populations, such as desired and undesirable wild plants, cultivars and plant varieties (which are or are not protected by the rights of the plant variety owner or breeder). Cultivars and plant varieties can be plants obtained by conventional propagation and selection methods, which can be supplemented or enhanced by one or more biotechnological methods, for example, through the use of double haploids, protoplast fusion, random and directed mutagenesis, molecular or genetic markers, or using biotechnological and genetic engineering methods. By plant parts is meant all the above-mentioned above-ground and underground parts and organs of plants, such as stalk, leaf, flower and root, thus, for example, leaves, needles, stems, branches, flowers, fruiting bodies, fruits and seeds, as well as roots are listed. , bulbs and rhizomes. Also plant parts include crop, vegetative and generative propagation material such as cuttings, bulbs, rhizomes, whiskers and seeds.

The composition according to the invention, when well tolerated by the plant, has favorable homeothermic toxicity and is well tolerated by the environment, is suitable for protecting plants and plant organs, for enhancing the harvested crop, for improving the quality of the harvested material. It can preferably be used as a crop protection composition. It is active against susceptible and resistant species under normal conditions and against all or some of the developmental stages.

Plants that can be treated in accordance with the invention include the following main crops: corn, soybeans, alfalfa, cotton, sunflower, Brassica oilseeds such as Brassica napus (e.g. canola, rapeseed), Brassica gara, B. juncea (e.g. (field) mustard) and Brassica carinata, Arecaceae sp. (e.g. oil palm, coconut), rice, wheat, sugar beet, sugarcane, oats, rye, barley, millet and sorghum, triticale, flax, nuts , grapes and grapes, and various fruits and vegetables from various botanical taxa, for example Rosaceae sp. (for example, fleshy pome fruits such as apples and pears, but also stone fruits such as apricots, cherries, almonds, plums and peaches, and berry fruits such as strawberries, raspberries, red and black currants and gooseberries), Ribesioidae sp., Juglandaceae sp., Betulaceae sp., Anacardiaceae sp., Fagaceae sp., Moraceae sp., Oleaceae sp. (e.g. olive tree), Actinidaceae sp., Lauraceae sp. (e.g. avocado, cinnamon, camphor), Musaceae sp. (e.g. banana trees and plantations), Rubiaceae sp. (e.g. coffee), Theaceae sp. (e.g. tea), Sterculiceae sp., Rutaceae sp. (e.g. lemons, oranges, tangerines, and grapefruits); Solanaceae sp. (E.g. tomato, potato, pepper, capsicum, eggplant, tobacco), Liliaceae sp., Compositae sp. (E.g. lettuce, artichoke and chicory - including root chicory, lettuce, or common chicory), Umbelliferae sp . (e.g. carrots, parsley, celera and salderias), Cucurbitaceae sp. (eg cucumbers - including gherkins, pumpkins, watermelons, pumpkin tree and melons), Alliaceae sp. (e.g. leeks and onions), Cruciferae sp. (eg white cabbage, red cabbage, broccoli, cauliflower, Brussels sprouts, Chinese cabbage, kohlrabi, horseradish, watercress and Chinese cabbage), Leguminosae sp. (for example peanuts, peas, lentils and legumes - for example, common beans and broad beans), Chenopodiaceae sp. (for example, beetroot, fodder beet, spinach, beetroot), Linaceae sp. (e.g. hemp), Cannabeacea sp. (e.g. cannabis), Malvaceae sp. (eg okra, cocoa), Papaveraceae (eg poppy), Asparagaceae (eg asparagus); useful plants and ornamental plants in gardens and forests, including sod, lawns, grass, and Stevia rebaudiana; and in each case genetically modified types of these plants.

Depending on the plant species or plant cultivars, their location and growth conditions (soil, climate, growing season, nutrition), use or application of the composition in accordance with the present invention, the treatment in accordance with the invention can also lead to super-additive ("synergistic ") actions. Thus, for example, by applying or using a composition according to the invention for a treatment according to the invention, it is likely that the application rate is reduced and / or the spectrum of activity expands and / or the activity of better plant growth is increased, the tolerance to high or low temperatures increases, the tolerance to drought increases. or water or salt content in the soil, increased flowering performance, earlier harvest, faster ripening, higher yields, larger fruits, higher plant height, greener leaves, earlier flowering, better quality and / or higher nutritional value value of harvested food, higher sugar concentration in fruits, better storage stability and / or processability of harvested food, which exceeds the effects actually expected to be obtained

At a certain application rate, the composition according to the invention for the treatment according to the invention can also have a firming effect on plants. The plant's defense system is mobilized against the attack of unwanted phytopathogenic fungi and / or microorganisms and / or viruses. Plant-strengthening substances (resistance-inducing) are, in the context of the present invention, those substances or combinations of substances that are capable of stimulating the defense system of plants in such a way that, upon subsequent inoculation with unwanted phytopathogenic fungi and / or microorganisms and / or viruses, the treated plants exhibit a significant degree of resistance to these phytopathogenic fungi and / or microorganisms and / or viruses. Thus, by using or applying a composition according to the present invention for a treatment according to the invention, plants can be protected from attack by the above pathogens for a period of time after treatment. The period of time during which the protection is carried out is generally from 1 to 10 days, preferably from 1 to 7 days, after the treatment of the plants with the active compounds.

Plants and plant cultivars, which are also preferably treated in accordance with the invention, are resistant to one or more biotic stresses, that is, said plants exhibit better protection against animals and microbial pests such as nematodes, insects, ticks, phytopathogenic fungi, bacteria, viruses and / or viroids.

Plants and plant cultivars that can also be treated in accordance with the invention are those plants that are resistant to one or more abiotic stresses, that is, which already exhibit an increased plant vitality in relation to stress tolerance. Abiotic stress conditions may include, for example, drought, exposure to cold temperatures, heat exposure, osmotic stress, flooding, increased soil salinity, increased mineral exposure, ozone exposure, exposure to light rays, limited availability of nitrogenous nutrients, limited availability of nitrogenous phosphorus, avoidance shadows. Preferably, treating these plants and cultivars with a composition according to the present invention further increases the overall plant viability (cf. above).

Plants and plant cultivars that can also be treated in accordance with the invention are those plants that are characterized by increased yield characteristics, that is, which already exhibit an increased plant vitality in relation to this characteristic. Increased yield of these plants can result, for example, from improved plant physiology, growth and development, such as water use efficiency, water retention efficiency, improved nitrogen utilization, improved carbon assimilation, improved photosynthesis, increased germination efficiency and increased maturation.

In addition, yield can be influenced by improved plant architecture (under stress and non-stress conditions), including but not limited to early flowering, flowering control for hybrid seed production, seedling vigor, plant size, number and distance of internodes, growth roots, seed size, fruit size, pod size, number of pods or spikelets, number of seeds per pod or spikelet, seed weight, increased seed coverage, reduced seed spread, reduced pod cracking, and lodging resistance. Further yield attributes include seed composition such as carbohydrate content, protein content, oil content and composition, nutritional value, reduced anti-nutritional compounds, improved processability, and better storage stability. Preferably, treating these plants and cultivars with a composition according to the present invention further increases the overall plant viability (cf. above).

Plants that can be treated in accordance with the invention are hybrid plants that already express characteristics of heterosis or hybrid vigor, resulting in overall higher yield, vigor, health and resistance to biotic and abiotic stressors. Such plants are typically obtained by crossing an inbred male sterile parent line (female parent) with another inbred male fertile parent line (male parent). Hybrid seeds are typically harvested from male sterile plants and sold to growers. Male sterile plants can be obtained multiple times (e.g. in maize) by panicle removal, that is, mechanical removal of male reproductive organs (or male flowers), but more typically male sterility is the result of genetic determinants in the plant genome. In this case, and especially if the seed is a desirable product to be harvested from hybrid plants, it is typically beneficial to ensure that male fertility is fully restored in the hybrid plants. This can be accomplished by ensuring that male parents have suitable fertility restoring genes that are capable of restoring male fertility in hybrid plants that contain the genetic determinants responsible for male sterility. Genetic determinants for male sterility can be located in the cytoplasm. Examples of cytoplasmic male sterility (CMS) are described, for example, for Brassica species. However, genetic determinants for male sterility can also be located in the nuclear genome. Male-sterile plants can also be obtained using plant biotechnology methods such as genetic engineering. Particularly preferred methods for producing male-sterile plants are described in WO 89/10396, in which, for example, a ribonuclease such as barnase is selectively expressed in tapetum cells in the stamens. Fertility can then be restored by expressing a ribonuclease inhibitor such as barstar in tapetum cells.

Plants or plant cultivars (obtained using plant biotechnology techniques such as genetic engineering) that can be treated in accordance with the invention are herbicide-tolerant plants, that is, plants that have been made tolerant to one or more herbicides. Such plants can be obtained either by genetic transformation or by selection of plants containing a mutation conferring such herbicide tolerance.

The following non-limiting examples are intended to further illustrate the present invention.

Examples of

Example 1: Formula for determining the effectiveness of a combination of multiple active ingredients

A synergistic effect of active ingredients is present if the activity of the combinations of active ingredients exceeds the total activities of the active ingredients when used individually. The estimated activity for a given combination of two active ingredients can be calculated as follows (cf. Colby, S.R., "Calculating Synergistic and Antagonistic Responses of Herbicide Combinations," Weeds 1967, 75, 20-22):

If a

X is efficiency if active component A

applied at the rate of application m ppm (or g / ha),

Y represents efficiency if active component B

applied at an application rate of n ppm (or g / ha),

E is the efficacy if active components A and B are applied at application rates of m and n ppm (or g / ha), respectively, and

then

If the actual activity exceeds the calculated value, then the activity of the combination is superadditive, that is, there is a synergistic effect. In this case, the efficiency that is actually observed must be greater than the value for the calculated efficiency (E) calculated according to the above formula.

For example, formula and analysis can be used to assess the stimulation of plant growth. In such an assay, the evaluation is carried out several days after application to plants. 100% denotes the plant weight that corresponds to that of the untreated control plant. Efficiency means in this case the additional% of plant weight compared to that of the untreated control. For example, a treatment that resulted in a plant weight of 120% compared to an untreated control plant would have an efficacy of 20%. If the effect of promoting plant growth for the combination (ie, the observed efficacy for% weight of plant seedlings treated with the combination) exceeds the calculated value, then the activity of the combination is over-additive, that is, there is a synergistic effect.

Formula and analysis can also be used to assess synergies in disease control analyzes. The degree of efficiency is indicated, expressed in%. 0% indicates efficacy that is consistent with that of control, while 100% efficacy indicates no disease is observed.

If the actual insecticidal or fungicidal activity exceeds the calculated value, then the activity of the combination is superadditive, that is, there is a synergistic effect. In this case, the efficiency that is actually observed must be greater than the value for the calculated efficiency (E) calculated according to the above formula.

A further demonstration of synergistic effect is the Tammes method (cf. "Isoboles, A Graphic Representation of Synergism in Pesticides," in Neth. J. Plant Path. 1964, 70, 73-80).

Example 2 Promotion of Plant Growth with Bacillus subtilis QST713 and Recombinant Bacillus thuringiensis Cells Expressing Phospholipase C

Experiments were performed to analyze the efficacy of a combination of a product based on Bacillus subtilis QST713 and a fermentation product of recombinant Bacillus thuringiensis cells expressing phospholipase C ("BEPC"). Corn seeds were grown in a sterile synthetic medium mixture and covered with sand in small three-inch square pots on lighted plant growth shelves in a room at 25-28 ° C and 50% humidity for approximately 14 days. Two seeds were planted in each pot. Upon cultivation, the growth medium in each pot was impregnated with the treatments described below. After 14 days, the plants were measured to determine the total plant biomass. In some experiments, the roots were analyzed using the WinRhizo Root scanner. In all tables for these examples, UTC refers to raw control. “Calculated” refers to the intended effect calculated using the Colby equation described above and “efficiency” refers to the actual observed effect.

SERENADE ^® ASO product is diluted in water (1% and 5% volume to volume), and the diluted solution was used for impregnating the growth medium. Application rate SERENADE ^® ASO relates to Bacillus subtilis QST713 number (i.e., the drug spores) contained in the product SERENADE ^® ASO, which is 1.34%. The prepared product had a minimum spore concentration of 1 × 10 ⁹ CFU / g.

A recombinant member of the Bacillus cereus family (Bacillus thuringiensis BT013A) expressing phospholipase C on its exospore (PERC) was created as follows. To create plasmids for the expression of fusion proteins in members of the Bacillus cereus family, PCR fragments were created that encode the BclA promoter (SEQ ID NO: 85), the methionine start codone, and amino acids 20-35 from BclA (SEQ ID NO: 1), followed by linker sequence with six alanines, coupled in frame with Bacillus thuringiensis BT013 Phospholipase C (SEQ ID NO: 108). These PCR fragments were digested with XhoI and ligated into the SalI site of the pSUPER plasmid to create plasmids pSUPER-BclA 20-35 Phospholipase. The PSUPER plasmid was created by fusing the pUC57 plasmid (containing the ampicillin resistance cassette) with the pBC16-1 plasmid from Bacillus (containing the tetracycline resistance cassette). This plasmid with 5.5 kb. can replicate in both E. coli and Bacillus spp. Plasmids pSUPER-BclA 20-35-Phospholipase were transformed into and expanded into dam-methylase negative E. coli strains and finally transformed into Bacillus thuringiensis BT013A.

For whole broth cultures, PERC, 15 ml cone-shaped broth containing BHI broth was inoculated with PERC and grown for 7-8 hours at approximately 30 ° C in a shaker set at 300 rpm. The next day, 250 μl aliquots from each flask were inoculated into 250 ml flasks containing 50 ml yeast extract media and grown at approximately 30 ° C. After incubation for approximately 2 days, when sporulation was at least 95% complete, the culture broth was collected and the colony forming units were calculated. The fermentation broth was diluted to 5% in 50 ml of water and the following colony forming units were used for each pot.

The experiment was repeated as described above but with 1% dilution SERENADE ^® ASO product. The results are shown in Table 4 below.

The results of measuring the volume of roots using the WinRhizo root scanner are presented in Table 5.

The results indicate a superadditive effect on the productivity of plants by combining SERENADE ^® ASO and PERC.

Example 3 Promotion of plant growth with Bacillus subtilis QST713 and recombinant Bacillus thuringiensis cells expressing endoglucanase

Experiments were performed similar to those described in example 2 using recombinant Bacillus thuringiensis cells expressing endoglucanase (SEQ ID NO: 107), referred to in these examples as BEE. Whole BEE broth cultures were created as described above, except that endoglucanase (SEQ ID NO: 107) was used instead of phospholipase. Influences combination with BEE SERENADE ^® ASO on the productivity of plants are presented in the tables below.

The above results indicate a superadditive effect on crop yield when Bacillus subtilis QST713 and BEE are used in combination.

Example 4: Facilitating Plant Growth with Bacillus firmus I-1582 and Bacillus thuringiensis Recombinant Cells

Corn seeds were grown in loamy sand in a greenhouse at 20 ° C and 70% humidity for approximately 11 days. Approximately 11 days from the time of treatment, the seedlings were cut above the soil and the fresh weight was determined.

Recombinant Bacillus thuringiensis cells expressing endoglucanase encoded by SEQ ID NO: 107 or phospholipase C encoded by SEQ ID NO: 108 and prepared as described above were used in an amount of approximately 50 μg / grain. Bacillus firmus I-1582 was also used at approximately 50 μg / grain.

It is believed that maize plants treated with recombinant Bacillus thuringiensis in combination with Bacillus firmus I-1582 will have a% seedling weight that is greater than the calculated value based on% seedling weight from corn plants treated with the two active ingredients separately, i.e. there is a synergistic effect.

--->

Sequence listing

<110> BAYER CROPSYENS LP

<120> Compositions containing recombinant BACILLUS cells

and another BIOLOGICAL COMBAT AGENT

<130> BCS149057 WO

<150> US 62 / 051,911

<151> 2014-09-17

<160> 109

<170> PatentIn version 3.5

<210> 1

<211> 41

<212> Protein

<213> Bacillus anthracis

<400> 1

Met Ser Asn Asn Asn Tyr Ser Asn Gly Leu Asn Pro Asp Glu Ser Leu

1 5 10 15

Ser Ala Ser Ala Phe Asp Pro Asn Leu Val Gly Pro Thr Leu Pro Pro

20 25 30

Ile Pro Pro Phe Thr Leu Pro Thr Gly

35 40

<210> 2

<211> 332

<212> Protein

<213> Bacillus anthracis

<400> 2

Met Ser Asn Asn Asn Tyr Ser Asn Gly Leu Asn Pro Asp Glu Ser Leu

1 5 10 15

Ser Ala Ser Ala Phe Asp Pro Asn Leu Val Gly Pro Thr Leu Pro Pro

20 25 30

Ile Pro Pro Phe Thr Leu Pro Thr Gly Pro Thr Gly Pro Phe Thr Thr

35 40 45

Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly

50 55 60

Pro Thr Gly Pro Thr Gly Pro Thr Gly Asp Thr Gly Thr Thr Gly Pro

65 70 75 80

Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr

85 90 95

Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Phe Thr Pro Thr Gly Pro

100 105 110

Thr Gly Pro Thr Gly Pro Thr Gly Asp Thr Gly Thr Thr Gly Pro Thr

115 120 125

Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Asp Thr Gly

130 135 140

Thr Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro

145 150 155 160

Thr Gly Pro Thr Gly Pro Thr Phe Thr Gly Pro Thr Gly Pro Thr Gly

165 170 175

Pro Thr Gly Ala Thr Gly Leu Thr Gly Pro Thr Gly Pro Thr Gly Pro

180 185 190

Ser Gly Leu Gly Leu Pro Ala Gly Leu Tyr Ala Phe Asn Ser Gly Gly

195 200 205

Ile Ser Leu Asp Leu Gly Ile Asn Asp Pro Val Pro Phe Asn Thr Val

210 215 220

Gly Ser Gln Phe Phe Thr Gly Thr Ala Ile Ser Gln Leu Asp Ala Asp

225 230 235 240

Thr Phe Val Ile Ser Glu Thr Gly Phe Tyr Lys Ile Thr Val Ile Ala

245 250 255

Asn Thr Ala Thr Ala Ser Val Leu Gly Gly Leu Thr Ile Gln Val Asn

260 265 270

Gly Val Pro Val Pro Gly Thr Gly Ser Ser Leu Ile Ser Leu Gly Ala

275 280 285

Pro Phe Thr Ile Val Ile Gln Ala Ile Thr Gln Ile Thr Thr Thr Pro

290 295 300

Ser Leu Val Glu Val Ile Val Thr Gly Leu Gly Leu Ser Leu Ala Leu

305 310 315 320

Gly Thr Ser Ala Ser Ile Ile Ile Glu Lys Val Ala

325 330

<210> 3

<211> 33

<212> Protein

<213> Bacillus anthracis

<400> 3

Met Ser Glu Lys Tyr Ile Ile Leu His Gly Thr Ala Leu Glu Pro Asn

1 5 10 15

Leu Ile Gly Pro Thr Leu Pro Pro Ile Pro Pro Phe Thr Phe Pro Asn

20 25 30

Gly

<210> 4

<211> 209

<212> Protein

<213> Bacillus anthracis

<400> 4

Met Ser Glu Lys Tyr Ile Ile Leu His Gly Thr Ala Leu Glu Pro Asn

1 5 10 15

Leu Ile Gly Pro Thr Leu Pro Pro Ile Pro Pro Phe Thr Phe Pro Asn

20 25 30

Gly Pro Thr Gly Ile Thr Gly Pro Thr Gly Ala Thr Gly Phe Thr Gly

35 40 45

Ile Gly Ile Thr Gly Pro Thr Gly Val Thr Gly Pro Thr Gly Ile Gly

50 55 60

Ile Thr Gly Pro Thr Gly Ala Thr Gly Leu Gly Ile Leu Pro Val Phe

65 70 75 80

Gly Thr Ile Thr Thr Asp Val Gly Ile Gly Phe Ser Val Ile Val Asn

85 90 95

Thr Asn Ile Asn Phe Thr Leu Pro Gly Pro Val Ser Gly Thr Thr Leu

100 105 110

Asn Pro Val Asp Asn Ser Ile Ile Ile Asn Thr Thr Gly Val Tyr Ser

115 120 125

Val Ser Phe Ser Ile Val Phe Val Ile Gln Ala Ile Ser Ser Ser Ile

130 135 140

Leu Asn Leu Thr Ile Asn Asp Ser Ile Gln Phe Ala Ile Glu Ser Arg

145 150 155 160

Ile Gly Gly Gly Pro Gly Val Arg Ala Thr Ser Ala Arg Thr Asp Leu

165 170 175

Leu Ser Leu Asn Gln Gly Asp Val Leu Arg Val Arg Ile Arg Glu Ala

180 185 190

Thr Gly Asp Ile Ile Tyr Ser Asn Ala Ser Leu Val Val Ser Lys Val

195 200 205

Asp

<210> 5

<211> 44

<212> Protein

<213> Bacillus anthracis

<400> 5

Met Val Lys Val Val Glu Gly Asn Gly Gly Lys Ser Lys Ile Lys Ser

1 5 10 15

Pro Leu Asn Ser Asn Phe Lys Ile Leu Ser Asp Leu Val Gly Pro Thr

20 25 30

Phe Pro Pro Val Pro Thr Gly Met Thr Gly Ile Thr

35 40

<210> 6

<211> 647

<212> Protein

<213> Bacillus anthracis

<400> 6

Val Val Lys Val Val Glu Gly Asn Gly Gly Lys Ser Lys Ile Lys Ser

1 5 10 15

Pro Leu Asn Ser Asn Phe Lys Ile Leu Ser Asp Leu Val Gly Pro Thr

20 25 30

Phe Pro Pro Val Pro Thr Gly Met Thr Gly Ile Thr Gly Ser Thr Gly

35 40 45

Ala Thr Gly Asn Thr Gly Pro Thr Gly Glu Thr Gly Ala Thr Gly Ser

50 55 60

Ala Gly Ile Thr Gly Ser Thr Gly Pro Thr Gly Asn Thr Gly Gly Thr

65 70 75 80

Gly Ser Thr Gly Pro Thr Gly Asn Thr Gly Ala Thr Gly Ser Thr Gly

85 90 95

Val Thr Gly Ser Thr Gly Val Thr Gly Ser Thr Gly Val Thr Gly Ser

100 105 110

Thr Gly Val Thr Gly Ser Thr Gly Pro Thr Gly Glu Thr Gly Gly Thr

115 120 125

Gly Ser Thr Gly Val Thr Gly Ser Thr Gly Ala Thr Gly Ser Thr Gly

130 135 140

Val Thr Gly Asn Thr Gly Pro Thr Gly Ser Thr Gly Ala Thr Gly Asn

145 150 155 160

Thr Gly Ser Ile Gly Glu Thr Gly Gly Thr Gly Ser Met Gly Pro Thr

165 170 175

Gly Glu Thr Gly Val Thr Gly Ser Thr Gly Gly Thr Gly Ser Thr Gly

180 185 190

Val Thr Gly Asn Thr Gly Pro Thr Gly Ser Thr Gly Val Thr Gly Ser

195 200 205

Thr Gly Val Thr Gly Ser Thr Gly Pro Thr Gly Ser Thr Gly Val Thr

210 215 220

Gly Ser Thr Gly Pro Thr Gly Ser Thr Gly Val Thr Gly Ser Thr Gly

225 230 235 240

Val Thr Gly Asn Met Gly Pro Thr Gly Ser Thr Gly Val Thr Gly Asn

245 250 255

Thr Gly Ser Thr Gly Thr Thr Gly Ala Thr Gly Glu Thr Gly Pro Met

260 265 270

Gly Ser Thr Gly Ala Thr Gly Thr Thr Gly Pro Thr Gly Glu Thr Gly

275 280 285

Glu Thr Gly Glu Thr Gly Gly Thr Gly Ser Thr Gly Pro Thr Gly Asn

290 295 300

Thr Gly Ala Thr Gly Ser Thr Gly Val Thr Gly Ser Thr Gly Val Thr

305 310 315 320

Gly Ser Thr Gly Val Thr Gly Glu Thr Gly Pro Thr Gly Ser Thr Gly

325 330 335

Ala Thr Gly Asn Thr Gly Pro Thr Gly Glu Thr Gly Gly Thr Gly Ser

340 345 350

Thr Gly Ala Thr Gly Ser Thr Gly Val Thr Gly Asn Thr Gly Pro Thr

355 360 365

Gly Ser Thr Gly Val Thr Gly Asn Thr Gly Ala Thr Gly Glu Thr Gly

370 375 380

Pro Thr Gly Asn Thr Gly Ala Thr Gly Asn Thr Gly Pro Thr Gly Glu

385 390 395 400

Thr Gly Val Thr Gly Ser Thr Gly Pro Thr Gly Glu Thr Gly Val Thr

405 410 415

Gly Ser Thr Gly Pro Thr Gly Asn Thr Gly Ala Thr Gly Glu Thr Gly

420 425 430

Ala Thr Gly Ser Thr Gly Val Thr Gly Asn Thr Gly Ser Thr Gly Glu

435 440 445

Thr Gly Pro Thr Gly Ser Thr Gly Pro Thr Gly Ser Thr Gly Ala Thr

450 455 460

Gly Val Thr Gly Asn Thr Gly Pro Thr Gly Ser Thr Gly Ala Thr Gly

465 470 475 480

Ala Thr Gly Ser Thr Gly Pro Thr Gly Ser Thr Gly Thr Thr Gly Asn

485 490 495

Thr Gly Val Thr Gly Asp Thr Gly Pro Thr Gly Ala Thr Gly Val Ser

500 505 510

Thr Thr Ala Thr Tyr Ala Phe Ala Asn Asn Thr Ser Gly Ser Val Ile

515 520 525

Ser Val Leu Leu Gly Gly Thr Asn Ile Pro Leu Pro Asn Asn Gln Asn

530 535 540

Ile Gly Pro Gly Ile Thr Val Ser Gly Gly Asn Thr Val Phe Thr Val

545 550 555 560

Ala Asn Ala Gly Asn Tyr Tyr Ile Ala Tyr Thr Ile Asn Leu Thr Ala

565 570 575

Gly Leu Leu Val Ser Ser Arg Ile Thr Val Asn Gly Ser Pro Leu Ala

580 585 590

Gly Thr Ile Asn Ser Pro Thr Val Ala Thr Gly Ser Phe Ser Ala Thr

595 600 605

Ile Ile Ala Ser Leu Pro Ala Gly Ala Ala Val Ser Leu Gln Leu Phe

610 615 620

Gly Val Val Ala Leu Ala Thr Leu Ser Thr Ala Thr Pro Gly Ala Thr

625 630 635 640

Leu Thr Ile Ile Arg Leu Ser

645

<210> 7

<211> 34

<212> Protein

<213> Bacillus anthracis

<400> 7

Met Lys Gln Asn Asp Lys Leu Trp Leu Asp Lys Gly Ile Ile Gly Pro

1 5 10 15

Glu Asn Ile Gly Pro Thr Phe Pro Val Leu Pro Pro Ile His Ile Pro

20 25 30

Thr Gly

<210> 8

<211> 366

<212> Protein

<213> Bacillus anthracis

<400> 8

Met Lys Gln Asn Asp Lys Leu Trp Leu Asp Lys Gly Ile Ile Gly Pro

1 5 10 15

Glu Asn Ile Gly Pro Thr Phe Pro Val Leu Pro Pro Ile His Ile Pro

20 25 30

Thr Gly Ile Thr Gly Ala Thr Gly Ala Thr Gly Ile Thr Gly Ala Thr

35 40 45

Gly Pro Thr Gly Thr Thr Gly Ala Thr Gly Ala Thr Gly Ile Thr Gly

50 55 60

Val Thr Gly Ala Thr Gly Ile Thr Gly Val Thr Gly Ala Thr Gly Ile

65 70 75 80

Thr Gly Val Thr Gly Ala Thr Gly Ile Thr Gly Val Thr Gly Pro Thr

85 90 95

Gly Ile Thr Gly Ala Thr Gly Pro Thr Gly Ile Thr Gly Ala Thr Gly

100 105 110

Pro Ala Gly Ile Thr Gly Val Thr Gly Pro Thr Gly Ile Thr Gly Ala

115 120 125

Thr Gly Pro Thr Gly Thr Thr Gly Val Thr Gly Pro Thr Gly Asp Thr

130 135 140

Gly Leu Ala Gly Ala Thr Gly Pro Thr Gly Ala Thr Gly Leu Ala Gly

145 150 155 160

Ala Thr Gly Pro Thr Gly Asp Thr Gly Ala Thr Gly Pro Thr Gly Ala

165 170 175

Thr Gly Leu Ala Gly Ala Thr Gly Pro Thr Gly Ala Thr Gly Leu Thr

180 185 190

Gly Ala Thr Gly Ala Thr Gly Ala Thr Gly Gly Gly Ala Ile Ile Pro

195 200 205

Phe Ala Ser Gly Thr Thr Pro Ala Leu Leu Val Asn Ala Val Leu Ala

210 215 220

Asn Thr Gly Thr Leu Leu Gly Phe Gly Phe Ser Gln Pro Gly Ile Ala

225 230 235 240

Pro Gly Val Gly Gly Thr Leu Thr Ile Leu Pro Gly Val Val Gly Asp

245 250 255

Tyr Ala Phe Val Ala Pro Arg Asp Gly Ile Ile Thr Ser Leu Ala Gly

260 265 270

Phe Phe Ser Ala Thr Ala Ala Leu Ala Pro Leu Thr Pro Val Gln Ile

275 280 285

Gln Met Gln Ile Phe Ile Ala Pro Ala Ala Ser Asn Thr Phe Thr Pro

290 295 300

Val Ala Pro Pro Leu Leu Leu Thr Pro Ala Leu Pro Ala Ile Ala Ile

305 310 315 320

Gly Thr Thr Ala Thr Gly Ile Gln Ala Tyr Asn Val Pro Val Val Ala

325 330 335

Gly Asp Lys Ile Leu Val Tyr Val Ser Leu Thr Gly Ala Ser Pro Ile

340 345 350

Ala Ala Val Ala Gly Phe Val Ser Ala Gly Leu Asn Ile Val

355 360 365

<210> 9

<211> 30

<212> Protein

<213> Bacillus anthracis

<400> 9

Met Asp Glu Phe Leu Ser Ser Ala Ala Leu Asn Pro Gly Ser Val Gly

1 5 10 15

Pro Thr Leu Pro Pro Met Gln Pro Phe Gln Phe Arg Thr Gly

20 25 30

<210> 10

<211> 77

<212> Protein

<213> Bacillus anthracis

<400> 10

Met Asp Glu Phe Leu Ser Ser Ala Ala Leu Asn Pro Gly Ser Val Gly

1 5 10 15

Pro Thr Leu Pro Pro Met Gln Pro Phe Gln Phe Arg Thr Gly Pro Thr

20 25 30

Gly Ser Thr Gly Ala Lys Gly Ala Ile Gly Asn Thr Glu Pro Tyr Trp

35 40 45

His Thr Gly Pro Pro Gly Ile Val Leu Leu Thr Tyr Asp Phe Lys Ser

50 55 60

Leu Ile Ile Ser Phe Ala Phe Arg Ile Leu Pro Ile Ser

65 70 75

<210> 11

<211> 39

<212> Protein

<213> Bacillus weihenstephensis

<400> 11

Met Phe Asp Lys Asn Glu Ile Gln Lys Ile Asn Gly Ile Leu Gln Ala

1 5 10 15

Asn Ala Leu Asn Pro Asn Leu Ile Gly Pro Thr Leu Pro Pro Ile Pro

20 25 30

Pro Phe Thr Leu Pro Thr Gly

35

<210> 12

<211> 299

<212> Protein

<213> Bacillus weihenstephensis

<400> 12

Met Phe Asp Lys Asn Glu Ile Gln Lys Ile Asn Gly Ile Leu Gln Ala

1 5 10 15

Asn Ala Leu Asn Pro Asn Leu Ile Gly Pro Thr Leu Pro Pro Ile Pro

20 25 30

Pro Phe Thr Leu Pro Thr Gly Pro Thr Gly Val Thr Gly Pro Thr Gly

35 40 45

Val Thr Gly Pro Thr Gly Val Thr Gly Pro Thr Gly Val Thr Gly Pro

50 55 60

Thr Gly Val Thr Gly Pro Thr Gly Val Thr Gly Pro Thr Gly Val Thr

65 70 75 80

Gly Pro Thr Gly Val Thr Gly Pro Thr Gly Val Thr Gly Pro Thr Gly

85 90 95

Val Thr Gly Pro Thr Gly Val Thr Gly Pro Thr Gly Val Thr Gly Pro

100 105 110

Thr Gly Val Thr Gly Pro Thr Gly Val Thr Gly Pro Thr Gly Glu Thr

115 120 125

Gly Pro Thr Gly Gly Thr Glu Gly Cys Leu Cys Asp Cys Cys Val Leu

130 135 140

Pro Met Gln Ser Val Leu Gln Gln Leu Ile Gly Glu Thr Val Ile Leu

145 150 155 160

Gly Thr Ile Ala Asp Thr Pro Asn Thr Pro Pro Leu Phe Phe Leu Phe

165 170 175

Thr Ile Thr Ser Val Asn Asp Phe Leu Val Thr Val Thr Asp Gly Thr

180 185 190

Thr Thr Phe Val Val Asn Ile Ser Asp Val Thr Gly Val Gly Phe Leu

195 200 205

Pro Pro Gly Pro Pro Ile Thr Leu Leu Pro Pro Thr Asp Val Gly Cys

210 215 220

Glu Cys Glu Cys Arg Glu Arg Pro Ile Arg Gln Leu Leu Asp Ala Phe

225 230 235 240

Ile Gly Ser Thr Val Ser Leu Leu Ala Ser Asn Gly Ser Ile Ala Ala

245 250 255

Asp Phe Ser Val Glu Gln Thr Gly Leu Gly Ile Val Leu Gly Thr Leu

260 265 270

Pro Ile Asn Pro Thr Thr Thr Val Arg Phe Ala Ile Ser Thr Cys Lys

275 280 285

Ile Thr Ala Val Asn Ile Thr Pro Ile Thr Met

290,295

<210> 13

<211> 39

<212> Protein

<213> Bacillus weihenstephensis

<400> 13

Met Phe Asp Lys Asn Glu Met Lys Lys Thr Asn Glu Val Leu Gln Ala

1 5 10 15

Asn Ala Leu Asp Pro Asn Ile Ile Gly Pro Thr Leu Pro Pro Ile Pro

20 25 30

Pro Phe Thr Leu Pro Thr Gly

35

<210> 14

<211> 289

<212> Protein

<213> Bacillus weihenstephensis

<400> 14

Met Phe Asp Lys Asn Glu Met Lys Lys Thr Asn Glu Val Leu Gln Ala

1 5 10 15

Asn Ala Leu Asp Pro Asn Ile Ile Gly Pro Thr Leu Pro Pro Ile Pro

20 25 30

Pro Phe Thr Leu Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly

35 40 45

Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro

50 55 60

Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Leu Thr

65 70 75 80

Gly Pro Thr Gly Pro Thr Gly Leu Thr Gly Pro Thr Gly Leu Thr Gly

85 90 95

Pro Thr Gly Pro Thr Gly Leu Thr Gly Gln Thr Gly Ser Thr Gly Pro

100 105 110

Thr Gly Ala Thr Glu Gly Cys Leu Cys Asp Cys Cys Val Phe Pro Met

115 120 125

Gln Glu Val Leu Arg Gln Leu Val Gly Gln Thr Val Ile Leu Ala Thr

130 135 140

Ile Ala Asp Ala Pro Asn Val Ala Pro Arg Phe Phe Leu Phe Asn Ile

145 150 155 160

Thr Ser Val Asn Asp Phe Leu Val Thr Val Thr Asp Pro Val Ser Asn

165 170 175

Thr Thr Phe Val Val Asn Ile Ser Asp Val Ile Gly Val Gly Phe Ser

180 185 190

Leu Thr Val Pro Pro Leu Thr Leu Leu Pro Pro Ala Asp Leu Gly Cys

195 200 205

Glu Cys Asp Cys Arg Glu Arg Pro Ile Arg Glu Leu Leu Asp Thr Leu

210 215 220

Ile Gly Ser Thr Val Asn Leu Leu Val Ser Asn Gly Ser Ile Ala Thr

225 230 235 240

Gly Phe Asn Val Glu Gln Thr Ala Leu Gly Ile Val Ile Gly Thr Leu

245 250 255

Pro Ile Pro Ile Asn Pro Pro Pro Pro Thr Leu Phe Arg Phe Ala Ile

260 265 270

Ser Thr Cys Lys Ile Thr Ala Val Asp Ile Thr Pro Thr Pro Thr Ala

275 280 285

Thr

<210> 15

<211> 49

<212> Protein

<213> Bacillus cereus

<400> 15

Met Ser Arg Lys Asp Lys Phe Asn Arg Ser Arg Met Ser Arg Lys Asp

1 5 10 15

Arg Phe Asn Ser Pro Lys Ile Lys Ser Glu Ile Ser Ile Ser Pro Asp

20 25 30

Leu Val Gly Pro Thr Phe Pro Pro Ile Pro Ser Phe Thr Leu Pro Thr

35 40 45

Gly

<210> 16

<211> 189

<212> Protein

<213> Bacillus cereus

<400> 16

Met Ser Arg Lys Asp Lys Phe Asn Arg Ser Arg Met Ser Arg Lys Asp

1 5 10 15

Arg Phe Asn Ser Pro Lys Ile Lys Ser Glu Ile Ser Ile Ser Pro Asp

20 25 30

Leu Val Gly Pro Thr Phe Pro Pro Ile Pro Ser Phe Thr Leu Pro Thr

35 40 45

Gly Ile Thr Gly Pro Thr Phe Asn Ile Asn Phe Arg Ala Glu Lys Asn

50 55 60

Val Ala Gln Ser Phe Thr Pro Pro Ala Asp Ile Gln Val Ser Tyr Gly

65 70 75 80

Asn Ile Ile Phe Asn Asn Gly Gly Gly Tyr Ser Ser Val Thr Asn Thr

85 90 95

Phe Thr Ala Pro Ile Asn Gly Ile Tyr Leu Phe Ser Ala Ser Ile Gly

100 105 110

Phe Asn Pro Thr Leu Gly Thr Thr Ser Thr Leu Arg Ile Thr Ile Arg

115 120 125

Lys Asn Leu Val Ser Val Ala Ser Gln Thr Gly Thr Ile Thr Thr Gly

130 135 140

Gly Thr Pro Gln Leu Glu Ile Thr Thr Ile Ile Asp Leu Leu Ala Ser

145 150 155 160

Gln Thr Ile Asp Ile Gln Phe Ser Ala Ala Glu Ser Gly Thr Leu Thr

165 170 175

Val Gly Ser Ser Asn Phe Phe Ser Gly Ala Leu Leu Pro

180 185

<210> 17

<211> 33

<212> Protein

<213> Bacillus cereus

<400> 17

Met Asn Glu Glu Tyr Ser Ile Leu His Gly Pro Ala Leu Glu Pro Asn

1 5 10 15

Leu Ile Gly Pro Thr Leu Pro Ser Ile Pro Pro Phe Thr Phe Pro Thr

20 25 30

Gly

<210> 18

<211> 84

<212> Protein

<213> Bacillus cereus

<400> 18

Met Asn Glu Glu Tyr Ser Ile Leu His Gly Pro Ala Leu Glu Pro Asn

1 5 10 15

Leu Ile Gly Pro Thr Leu Pro Ser Ile Pro Pro Phe Thr Phe Pro Thr

20 25 30

Gly Pro Thr Gly Ile Thr Gly Pro Thr Gly Ala Thr Gly Phe Thr Gly

35 40 45

Ile Gly Ile Thr Gly Pro Thr Gly Val Thr Gly Pro Thr Gly Ile Gly

50 55 60

Ile Thr Gly Pro Thr Gly Ala Thr Gly Pro Thr Gly Ile Gly Ile Thr

65 70 75 80

Gly Pro Thr Gly

<210> 19

<211> 39

<212> Protein

<213> Bacillus cereus

<400> 19

Met Lys Asn Arg Asp Asn Asn Arg Lys Gln Asn Ser Leu Ser Ser Asn

1 5 10 15

Phe Arg Ile Pro Pro Glu Leu Ile Gly Pro Thr Phe Pro Pro Val Pro

20 25 30

Thr Gly Phe Thr Gly Ile Gly

35

<210> 20

<211> 1056

<212> Protein

<213> Bacillus cereus

<400> 20

Met Lys Asn Arg Asp Asn Asn Arg Lys Gln Asn Ser Leu Ser Ser Asn

1 5 10 15

Phe Arg Ile Pro Pro Glu Leu Ile Gly Pro Thr Phe Pro Pro Val Pro

20 25 30

Thr Gly Phe Thr Gly Ile Gly Ile Thr Gly Pro Thr Gly Pro Gln Gly

35 40 45

Pro Thr Gly Pro Gln Gly Pro Arg Gly Leu Gln Gly Pro Met Gly Glu

50 55 60

Met Gly Pro Thr Gly Pro Gln Gly Val Gln Gly Ile Gln Gly Ser Val

65 70 75 80

Gly Pro Ile Gly Ala Thr Gly Pro Glu Gly Gln Gln Gly Pro Gln Gly

85 90 95

Leu Arg Gly Pro Gln Gly Glu Thr Gly Ala Thr Gly Pro Gly Gly Val

100 105 110

Gln Gly Leu Gln Gly Pro Ile Gly Pro Thr Gly Ala Thr Gly Ala Gln

115 120 125

Gly Ile Gln Gly Ile Gln Gly Leu Gln Gly Pro Ile Gly Ala Thr Gly

130 135 140

Pro Glu Gly Ser Gln Gly Ile Gln Gly Val Gln Gly Leu Pro Gly Ala

145 150 155 160

Thr Gly Pro Gln Gly Ile Gln Gly Ala Gln Gly Ile Gln Gly Thr Pro

165 170 175

Gly Pro Ser Gly Asn Thr Gly Ala Thr Gly Ala Thr Gly Ala Thr Gly

180 185 190

Gln Gly Ile Thr Gly Pro Thr Gly Ile Thr Gly Pro Thr Gly Ile Thr

195 200 205

Gly Pro Ser Gly Gly Pro Pro Gly Pro Thr Gly Pro Thr Gly Ala Thr

210 215 220

Gly Pro Gly Gly Gly Pro Ser Gly Ser Thr Gly Ala Thr Gly Ala Thr

225 230 235 240

Gly Asn Thr Gly Ala Thr Gly Ser Thr Gly Val Thr Gly Ala Thr Gly

245 250 255

Ser Thr Gly Pro Thr Gly Ser Thr Gly Ala Gln Gly Leu Gln Gly Ile

260 265 270

Gln Gly Ile Gln Gly Pro Ile Gly Pro Thr Gly Pro Glu Gly Ser Gln

275 280 285

Gly Ile Gln Gly Ile Pro Gly Pro Thr Gly Val Thr Gly Glu Gln Gly

290 295 300

Ile Gln Gly Val Gln Gly Ile Gln Gly Ala Thr Gly Ala Thr Gly Asp

305 310 315 320

Gln Gly Pro Gln Gly Ile Gln Gly Val Ile Gly Pro Gln Gly Val Thr

325 330 335

Gly Ala Thr Gly Asp Gln Gly Pro Gln Gly Ile Gln Gly Val Pro Gly

340 345 350

Pro Ser Gly Glu Thr Gly Pro Gln Gly Val Gln Gly Ile Gln Gly Pro

355 360 365

Met Gly Asp Ile Gly Pro Thr Gly Pro Glu Gly Pro Glu Gly Leu Gln

370 375 380

Gly Pro Gln Gly Ile Gln Gly Val Pro Gly Pro Val Gly Ala Thr Gly

385 390 395 400

Pro Glu Gly Pro Gln Gly Ile Gln Gly Ile Gln Gly Pro Val Gly Ala

405 410 415

Thr Gly Pro Gln Gly Pro Gln Gly Ile Gln Gly Ile Gln Gly Val Gln

420 425 430

Gly Ile Thr Gly Ala Thr Gly Val Gln Gly Ala Thr Gly Ile Gln Gly

435 440 445

Ile Gln Gly Glu Ile Gly Ala Thr Gly Pro Glu Gly Pro Gln Gly Val

450 455 460

Gln Gly Ala Gln Gly Ala Ile Gly Pro Thr Gly Pro Met Gly Pro Gln

465 470 475 480

Gly Val Gln Gly Val Gln Gly Ile Gln Gly Ala Thr Gly Ala Gln Gly

485 490 495

Val Gln Gly Pro Gln Gly Ile Gln Gly Ile Gln Gly Pro Thr Gly Ala

500 505 510

Thr Gly Asp Met Gly Ala Thr Gly Ala Thr Gly Glu Gly Thr Thr Gly

515 520 525

Pro Thr Gly Val Thr Gly Pro Thr Gly Val Thr Gly Pro Ser Gly Gly

530 535 540

Pro Ala Gly Pro Thr Gly Pro Thr Gly Pro Ser Gly Pro Ala Gly Val

545 550 555 560

Thr Gly Pro Ser Gly Gly Pro Pro Gly Pro Thr Gly Ala Thr Gly Ala

565 570 575

Thr Gly Val Thr Gly Asp Thr Gly Ala Thr Gly Ser Thr Gly Val Thr

580 585 590

Gly Ala Thr Gly Glu Thr Gly Ala Thr Gly Val Thr Gly Leu Gln Gly

595 600 605

Pro Gln Gly Ile Gln Gly Val Gln Gly Glu Ile Gly Pro Thr Gly Pro

610 615 620

Gln Gly Val Gln Gly Pro Gln Gly Ile Gln Gly Val Thr Gly Ala Thr

625 630 635 640

Gly Asp Gln Gly Pro Gln Gly Ile Gln Gly Pro Gln Gly Asp Ile Gly

645 650 655

Pro Thr Gly Pro Gln Gly Ile Gln Gly Pro Gln Gly Ser Gln Gly Ile

660 665 670

Gln Gly Ala Thr Gly Gly Thr Gly Ala Gln Gly Pro Gln Gly Ile Gln

675 680 685

Gly Pro Gln Gly Asp Ile Gly Leu Thr Gly Ser Gln Gly Pro Thr Gly

690 695 700

Ile Gln Gly Ile Gln Gly Glu Ile Gly Pro Thr Gly Pro Glu Gly Pro

705 710 715 720

Glu Gly Leu Gln Gly Pro Gln Gly Ile Gln Gly Ile Gln Gly Pro Val

725 730 735

Gly Ala Thr Gly Pro Glu Gly Pro Gln Gly Ile Gln Gly Ile Gln Gly

740 745 750

Val Gln Gly Ala Thr Gly Pro Gln Gly Pro Gln Gly Ile Gln Gly Ile

755 760 765

Gln Gly Val Gln Gly Ile Thr Gly Ala Thr Gly Ala Gln Gly Ala Thr

770 775 780

Gly Ile Gln Gly Ile Gln Gly Glu Ile Gly Ala Thr Gly Pro Glu Gly

785 790 795 800

Pro Gln Gly Val Gln Gly Ile Gln Gly Ala Ile Gly Pro Thr Gly Pro

805 810 815

Met Gly Ala Gln Gly Val Gln Gly Ile Gln Gly Ile Gln Gly Ala Thr

820 825 830

Gly Ala Gln Gly Val Gln Gly Pro Gln Gly Ile Gln Gly Val Gln Gly

835 840 845

Pro Thr Gly Ala Thr Gly Glu Thr Gly Ala Thr Gly Ala Thr Gly Glu

850 855 860

Gly Thr Thr Gly Pro Thr Gly Val Thr Gly Pro Thr Gly Val Thr Gly

865 870 875 880

Pro Ser Gly Gly Pro Ala Gly Pro Thr Gly Pro Thr Gly Pro Ser Gly

885 890 895

Pro Ala Gly Val Thr Gly Pro Ser Gly Gly Pro Pro Gly Pro Thr Gly

900 905 910

Ala Thr Gly Ala Thr Gly Val Thr Gly Asp Thr Gly Ala Thr Gly Ser

915 920 925

Thr Gly Val Thr Gly Ala Thr Gly Ala Thr Gly Ala Thr Gly Val Thr

930 935 940

Gly Leu Gln Gly Pro Gln Gly Ile Gln Gly Val Gln Gly Glu Ile Gly

945 950 955 960

Pro Thr Gly Pro Gln Gly Ile Gln Gly Pro Gln Gly Ile Gln Gly Val

965 970 975

Thr Gly Ala Thr Gly Ala Gln Gly Pro Gln Gly Ile Gln Gly Pro Gln

980 985 990

Gly Asp Ile Gly Pro Thr Gly Ser Gln Gly Ile Gln Gly Pro Gln Gly

995 1000 1005

Pro Gln Gly Ile Gln Gly Ala Thr Gly Ala Thr Gly Ala Gln Gly

1010 1015 1020

Pro Gln Gly Ile Gln Gly Pro Gln Gly Glu Ile Gly Pro Thr Gly

1025 1030 1035

Pro Gln Gly Pro Gln Gly Ile Gln Gly Pro Gln Gly Ile Gln Gly

1040 1045 1050

Pro Thr Gly

1055

<210> 21

<211> 39

<212> Protein

<213> Bacillus weihenstephensis

<400> 21

Met Ser Asp Lys His Gln Met Lys Lys Ile Ser Glu Val Leu Gln Ala

1 5 10 15

His Ala Leu Asp Pro Asn Leu Ile Gly Pro Pro Leu Pro Pro Ile Thr

20 25 30

Pro Phe Thr Phe Pro Thr Gly

35

<210> 22

<211> 365

<212> Protein

<213> Bacillus weihenstephensis

<400> 22

Met Ser Asp Lys His Gln Met Lys Lys Ile Ser Glu Val Leu Gln Ala

1 5 10 15

His Ala Leu Asp Pro Asn Leu Ile Gly Pro Pro Leu Pro Pro Ile Thr

20 25 30

Pro Phe Thr Phe Pro Thr Gly Ser Thr Gly Pro Thr Gly Ser Thr Gly

35 40 45

Ser Thr Gly Pro Thr Gly Ser Thr Gly Asn Thr Gly Pro Thr Gly Pro

50 55 60

Thr Gly Pro Pro Val Gly Thr Asn Leu Asp Thr Ile Tyr Val Thr Asn

65 70 75 80

Asp Ile Ser Asn Asn Val Ser Ala Ile Asp Gly Asn Thr Asn Thr Val

85 90 95

Leu Thr Thr Ile Pro Val Gly Thr Asn Pro Val Gly Val Gly Val Asn

100 105 110

Ser Ser Thr Asn Leu Ile Tyr Val Val Asn Asn Gly Ser Asp Asn Ile

115 120 125

Ser Val Ile Asn Gly Ser Thr Asn Thr Val Val Ala Thr Ile Pro Val

130 135 140

Gly Thr Gln Pro Phe Gly Val Gly Val Asn Pro Ser Thr Asn Leu Ile

145 150 155 160

Tyr Val Ala Asn Arg Thr Ser Asn Asn Val Ser Val Ile Lys Gly Gly

165 170 175

Thr Asn Thr Val Leu Thr Thr Ile Pro Val Gly Thr Asn Pro Val Gly

180 185 190

Val Gly Val Asn Ser Ser Thr Asn Leu Ile Tyr Val Thr Asn Glu Ile

195 200 205

Pro Asn Ser Val Ser Val Ile Lys Gly Gly Thr Asn Thr Val Val Ala

210 215 220

Thr Ile Pro Val Gly Leu Phe Pro Phe Gly Val Gly Val Asn Ser Leu

225 230 235 240

Thr Asn Leu Ile Tyr Val Val Asn Asn Ser Pro His Asn Val Ser Val

245 250 255

Ile Asp Gly Asn Thr Asn Thr Val Leu Thr Thr Ile Ser Val Gly Thr

260 265 270

Ser Pro Val Gly Val Gly Val Asn Leu Ser Thr Asn Leu Ile Tyr Val

275 280 285

Ala Asn Glu Val Pro Asn Asn Ile Ser Val Ile Asn Gly Asn Thr Asn

290 295 300

Thr Val Leu Thr Thr Ile Pro Val Gly Thr Thr Pro Phe Glu Val Gly

305 310 315 320

Val Asn Ser Ser Thr Asn Leu Ile Tyr Val Ser Asn Leu Asn Ser Asn

325 330 335

Asn Val Ser Val Ile Asn Gly Ser Ala Asn Thr Val Ile Ala Thr Val

340 345 350

Pro Val Gly Ser Val Pro Arg Gly Ile Gly Val Lys Pro

355 360 365

<210> 23

<211> 30

<212> Protein

<213> Bacillus weihenstephensis

<400> 23

Met Asp Glu Phe Leu Ser Phe Ala Ala Leu Asn Pro Gly Ser Ile Gly

1 5 10 15

Pro Thr Leu Pro Pro Val Pro Pro Phe Gln Phe Pro Thr Gly

20 25 30

<210> 24

<211> 160

<212> Protein

<213> Bacillus weihenstephensis

<400> 24

Met Asp Glu Phe Leu Ser Phe Ala Ala Leu Asn Pro Gly Ser Ile Gly

1 5 10 15

Pro Thr Leu Pro Pro Val Pro Pro Phe Gln Phe Pro Thr Gly Pro Thr

20 25 30

Gly Ser Thr Gly Ser Thr Gly Pro Thr Gly Ser Thr Gly Ser Thr Gly

35 40 45

Pro Thr Gly Phe Asn Leu Pro Ala Gly Pro Ala Ser Ile Thr Leu Thr

50 55 60

Ser Asn Glu Thr Thr Ala Cys Val Ser Thr Gln Gly Asn Asn Thr Leu

65 70 75 80

Phe Phe Ser Gly Gln Val Leu Val Asn Gly Ser Pro Thr Pro Gly Val

85 90 95

Val Val Ser Phe Ser Phe Ser Asn Pro Ser Leu Ala Phe Met Val Pro

100 105 110

Leu Ala Val Ile Thr Asn Ala Ser Gly Asn Phe Thr Ala Val Phe Leu

115 120 125

Ala Ala Asn Gly Pro Gly Thr Val Thr Val Thr Ala Ser Leu Leu Asp

130 135 140

Ser Pro Gly Thr Met Ala Ser Val Thr Ile Thr Ile Val Asn Cys Pro

145 150 155 160

<210> 25

<211> 30

<212> Protein

<213> Bacillus weihenstephensis

<400> 25

Met Asp Glu Phe Leu Ser Ser Thr Ala Leu Asn Pro Cys Ser Ile Gly

1 5 10 15

Pro Thr Leu Pro Pro Met Gln Pro Phe Gln Phe Pro Thr Gly

20 25 30

<210> 26

<211> 69

<212> Protein

<213> Bacillus weihenstephensis

<400> 26

Met Asp Glu Phe Leu Ser Ser Thr Ala Leu Asn Pro Cys Ser Ile Gly

1 5 10 15

Pro Thr Leu Pro Pro Met Gln Pro Phe Gln Phe Pro Thr Gly Pro Thr

20 25 30

Gly Ser Thr Gly Thr Thr Gly Pro Thr Gly Ser Ile Gly Pro Thr Gly

35 40 45

Asn Thr Gly Leu Thr Gly Asn Thr Gly Pro Thr Gly Ile Thr Gly Pro

50 55 60

Thr Gly Asp Thr Gly

65

<210> 27

<211> 36

<212> Protein

<213> Bacillus weihenstephensis

<400> 27

Met Lys Glu Arg Asp Arg Gln Asn Ser Leu Asn Ser Asn Phe Arg Ile

1 5 10 15

Ser Pro Asn Leu Ile Gly Pro Thr Phe Pro Pro Val Pro Thr Gly Phe

20 25 30

Thr Gly Ile Gly

35

<210> 28

<211> 934

<212> Protein

<213> Bacillus weihenstephensis

<400> 28

Met Lys Glu Arg Asp Arg Gln Asn Ser Leu Asn Ser Asn Phe Arg Ile

1 5 10 15

Ser Pro Asn Leu Ile Gly Pro Thr Phe Pro Pro Val Pro Thr Gly Phe

20 25 30

Thr Gly Ile Gly Ile Thr Gly Pro Thr Gly Pro Gln Gly Pro Thr Gly

35 40 45

Pro Gln Gly Pro Arg Gly Phe Gln Gly Pro Met Gly Glu Met Gly Pro

50 55 60

Thr Gly Pro Gln Gly Val Gln Gly Ile Gln Gly Pro Ala Gly Gln Met

65 70 75 80

Gly Ala Thr Gly Pro Glu Gly Gln Gln Gly Pro Gln Gly Leu Arg Gly

85 90 95

Pro Gln Gly Glu Thr Gly Ala Thr Gly Pro Gln Gly Val Gln Gly Leu

100 105 110

Gln Gly Pro Ile Gly Pro Thr Gly Ala Thr Gly Ala Gln Gly Ile Gln

115 120 125

Gly Ile Gln Gly Leu Gln Gly Pro Ile Gly Ala Thr Gly Pro Glu Gly

130 135 140

Pro Gln Gly Ile Gln Gly Val Gln Gly Val Pro Gly Ala Thr Gly Ser

145 150 155 160

Gln Gly Ile Gln Gly Ala Gln Gly Ile Gln Gly Pro Gln Gly Pro Ser

165 170 175

Gly Asn Thr Gly Ala Thr Gly Val Thr Gly Gln Gly Ile Ser Gly Pro

180 185 190

Thr Gly Ile Thr Gly Pro Thr Gly Ile Thr Gly Pro Ser Gly Gly Pro

195 200 205

Pro Gly Pro Thr Gly Ala Thr Gly Ala Thr Gly Pro Gly Gly Gly Pro

210 215 220

Ser Gly Ser Thr Gly Ala Thr Gly Ala Thr Gly Asn Thr Gly Val Thr

225 230 235 240

Gly Ser Ala Gly Val Thr Gly Asn Thr Gly Ser Thr Gly Ser Thr Gly

245 250 255

Glu Thr Gly Ala Gln Gly Leu Gln Gly Ile Gln Gly Val Gln Gly Pro

260 265 270

Ile Gly Pro Thr Gly Pro Glu Gly Pro Gln Gly Ile Gln Gly Ile Pro

275 280 285

Gly Pro Thr Gly Val Thr Gly Glu Gln Gly Ile Gln Gly Val Gln Gly

290 295 300

Ile Gln Gly Ile Thr Gly Ala Thr Gly Asp Gln Gly Pro Gln Gly Ile

305 310 315 320

Gln Gly Ala Ile Gly Pro Gln Gly Ile Thr Gly Ala Thr Gly Asp Gln

325 330 335

Gly Pro Gln Gly Ile Gln Gly Val Pro Gly Pro Thr Gly Asp Thr Gly

340 345 350

Ser Gln Gly Val Gln Gly Ile Gln Gly Pro Met Gly Asp Ile Gly Pro

355 360 365

Thr Gly Pro Glu Gly Pro Glu Gly Leu Gln Gly Pro Gln Gly Ile Gln

370 375 380

Gly Val Pro Gly Pro Ala Gly Ala Thr Gly Pro Glu Gly Pro Gln Gly

385 390 395 400

Ile Gln Gly Ile Gln Gly Pro Ile Gly Val Thr Gly Pro Glu Gly Pro

405 410 415

Gln Gly Ile Gln Gly Ile Gln Gly Ile Gln Gly Ile Thr Gly Ala Thr

420 425 430

Gly Ala Gln Gly Ala Thr Gly Val Gln Gly Val Gln Gly Asn Ile Gly

435 440 445

Ala Thr Gly Pro Glu Gly Pro Gln Gly Val Gln Gly Thr Gln Gly Asp

450 455 460

Ile Gly Pro Thr Gly Pro Met Gly Pro Gln Gly Val Gln Gly Ile Gln

465 470 475 480

Gly Ile Gln Gly Pro Thr Gly Ala Gln Gly Val Gln Gly Pro Gln Gly

485 490 495

Ile Gln Gly Ile Gln Gly Pro Thr Gly Val Thr Gly Asp Thr Gly Thr

500 505 510

Thr Gly Ala Thr Gly Glu Gly Thr Thr Gly Ala Thr Gly Val Thr Gly

515 520 525

Pro Ser Gly Val Thr Gly Pro Ser Gly Gly Pro Ala Gly Pro Thr Gly

530 535 540

Pro Thr Gly Pro Ser Gly Pro Thr Gly Leu Thr Gly Pro Ser Gly Gly

545 550 555 560

Pro Pro Gly Pro Thr Gly Ala Thr Gly Val Thr Gly Gly Val Gly Asp

565 570 575

Thr Gly Ala Thr Gly Ser Thr Gly Val Thr Gly Ala Thr Gly Val Thr

580 585 590

Gly Ala Thr Gly Ala Thr Gly Leu Gln Gly Pro Gln Gly Ile Gln Gly

595 600 605

Val Gln Gly Asp Ile Gly Pro Thr Gly Pro Gln Gly Val Gln Gly Pro

610 615 620

Gln Gly Ile Gln Gly Ile Thr Gly Ala Thr Gly Asp Gln Gly Pro Gln

625 630 635 640

Gly Ile Gln Gly Pro Gln Gly Ile Gln Gly Pro Thr Gly Pro Gln Gly

645 650 655

Ile Gln Gly Gly Gln Gly Pro Gln Gly Ile Gln Gly Ala Thr Gly Ala

660 665 670

Thr Gly Ala Gln Gly Pro Gln Gly Ile Gln Gly Ile Gln Gly Val Gln

675 680 685

Gly Pro Thr Gly Pro Gln Gly Pro Thr Gly Ile Gln Gly Val Gln Gly

690 695 700

Glu Ile Gly Pro Thr Gly Pro Gln Gly Val Gln Gly Leu Gln Gly Pro

705 710 715 720

Gln Gly Pro Thr Gly Asp Thr Gly Pro Thr Gly Pro Gln Gly Pro Gln

725 730 735

Gly Ile Gln Gly Pro Thr Gly Ala Thr Gly Ala Thr Gly Ser Gln Gly

740 745 750

Ile Gln Gly Pro Thr Gly Ala Thr Gly Ala Thr Gly Ser Gln Gly Ile

755 760 765

Gln Gly Pro Thr Gly Ala Thr Gly Ala Thr Gly Ala Thr Gly Ala Thr

770 775 780

Gly Ala Thr Gly Ala Thr Gly Ala Thr Gly Val Thr Gly Val Ser Thr

785 790 795 800

Thr Ala Thr Tyr Ser Phe Ala Asn Asn Thr Ser Gly Ser Ala Ile Ser

805 810 815

Val Leu Leu Gly Gly Thr Asn Ile Pro Leu Pro Asn Asn Gln Asn Ile

820 825 830

Gly Pro Gly Ile Thr Val Ser Gly Gly Asn Thr Val Phe Thr Val Thr

835 840 845

Asn Ala Gly Asn Tyr Tyr Ile Ala Tyr Thr Ile Asn Ile Thr Ala Ala

850 855 860

Leu Leu Val Ser Ser Arg Ile Thr Val Asn Gly Ser Pro Leu Ala Gly

865 870 875 880

Thr Ile Asn Ser Pro Ala Val Ala Thr Gly Ser Phe Asn Ala Thr Ile

885 890 895

Ile Ser Asn Leu Ala Ala Gly Ser Ala Ile Ser Leu Gln Leu Phe Gly

900 905 910

Leu Leu Ala Val Ala Thr Leu Ser Thr Thr Thr Pro Gly Ala Thr Leu

915 920 925

Thr Ile Ile Arg Leu Ser

930

<210> 29

<211> 39

<212> Protein

<213> Bacillus mycoides

<400> 29

Val Phe Asp Lys Asn Glu Ile Gln Lys Ile Asn Gly Ile Leu Gln Ala

1 5 10 15

Asn Ala Leu Asn Pro Asn Leu Ile Gly Pro Thr Leu Pro Pro Ile Pro

20 25 30

Pro Phe Thr Leu Pro Thr Gly

35

<210> 30

<211> 287

<212> Protein

<213> Bacillus mycoides

<400> 30

Val Phe Asp Lys Asn Glu Ile Gln Lys Ile Asn Gly Ile Leu Gln Ala

1 5 10 15

Asn Ala Leu Asn Pro Asn Leu Ile Gly Pro Thr Leu Pro Pro Ile Pro

20 25 30

Pro Phe Thr Leu Pro Thr Gly Pro Thr Gly Gly Thr Gly Pro Thr Gly

35 40 45

Val Thr Gly Pro Thr Gly Val Thr Gly Pro Thr Gly Val Thr Gly Pro

50 55 60

Thr Gly Val Thr Gly Pro Thr Gly Val Thr Gly Pro Thr Gly Val Thr

65 70 75 80

Gly Pro Thr Gly Val Thr Gly Pro Thr Gly Val Thr Gly Pro Thr Gly

85 90 95

Val Thr Gly Pro Thr Gly Val Thr Gly Pro Thr Gly Val Thr Gly Pro

100 105 110

Thr Gly Val Thr Gly Pro Thr Gly Gly Thr Glu Gly Cys Leu Cys Asp

115 120 125

Cys Cys Val Leu Pro Met Gln Ser Val Leu Gln Gln Leu Ile Gly Glu

130 135 140

Thr Val Ile Leu Gly Thr Ile Ala Asp Thr Pro Asn Thr Pro Pro Leu

145 150 155 160

Phe Phe Leu Phe Thr Ile Thr Ser Val Asn Asp Phe Leu Val Thr Val

165 170 175

Thr Asp Gly Thr Thr Thr Phe Val Val Asn Ile Ser Asp Val Thr Gly

180 185 190

Val Gly Phe Leu Pro Pro Gly Pro Pro Ile Thr Leu Leu Pro Pro Thr

195 200 205

Asp Val Gly Cys Glu Cys Glu Cys Arg Glu Arg Pro Ile Arg Gln Leu

210 215 220

Leu Asp Ala Phe Ile Gly Ser Thr Val Ser Leu Leu Ala Ser Asn Gly

225 230 235 240

Ser Ile Ala Ala Asp Phe Ser Val Glu Gln Thr Gly Leu Gly Ile Val

245 250 255

Leu Gly Thr Leu Pro Ile Asn Pro Thr Thr Thr Val Arg Phe Ala Ile

260 265 270

Ser Thr Cys Lys Ile Thr Ala Val Asn Ile Thr Pro Ile Thr Met

275 280 285

<210> 31

<211> 30

<212> Protein

<213> Bacillus mycoides

<400> 31

Met Asp Glu Phe Leu Tyr Phe Ala Ala Leu Asn Pro Gly Ser Ile Gly

1 5 10 15

Pro Thr Leu Pro Pro Val Gln Pro Phe Gln Phe Pro Thr Gly

20 25 30

<210> 32

<211> 190

<212> Protein

<213> Bacillus mycoides

<400> 32

Met Asp Glu Phe Leu Tyr Phe Ala Ala Leu Asn Pro Gly Ser Ile Gly

1 5 10 15

Pro Thr Leu Pro Pro Val Gln Pro Phe Gln Phe Pro Thr Gly Pro Thr

20 25 30

Gly Ser Thr Gly Ala Thr Gly Ser Thr Gly Ser Thr Gly Ser Thr Gly

35 40 45

Pro Thr Gly Ser Thr Gly Ser Thr Gly Ser Thr Gly Ser Thr Gly Pro

50 55 60

Thr Gly Pro Thr Gly Pro Thr Gly Ser Thr Gly Pro Thr Gly Pro Thr

65 70 75 80

Gly Phe Asn Leu Pro Ala Gly Pro Ala Ser Ile Thr Leu Thr Ser Asn

85 90 95

Glu Thr Thr Ala Cys Val Ser Thr Gln Gly Asn Asn Thr Leu Phe Phe

100 105 110

Ser Gly Gln Val Leu Val Asn Gly Ser Pro Thr Pro Gly Val Val Val

115 120 125

Ser Phe Ser Phe Ser Asn Pro Ser Leu Ala Phe Met Val Pro Leu Ala

130 135 140

Val Ile Thr Asn Ala Ser Gly Asn Phe Thr Ala Val Phe Leu Ala Ala

145 150 155 160

Asn Gly Pro Gly Thr Val Thr Val Thr Ala Ser Leu Leu Asp Ser Pro

165 170 175

Gly Thr Met Ala Ser Val Thr Ile Thr Ile Val Asn Cys Pro

180 185 190

<210> 33

<211> 21

<212> Protein

<213> Bacillus mycoides

<400> 33

Met Asp Ser Lys Asn Ile Gly Pro Thr Phe Pro Pro Leu Pro Ser Ile

1 5 10 15

Asn Phe Pro Thr Gly

20

<210> 34

<211> 335

<212> Protein

<213> Bacillus mycoides

<400> 34

Met Asp Ser Lys Asn Ile Gly Pro Thr Phe Pro Pro Leu Pro Ser Ile

1 5 10 15

Asn Phe Pro Thr Gly Val Thr Gly Glu Thr Gly Ala Thr Gly Glu Thr

20 25 30

Gly Ala Thr Gly Ala Thr Gly Glu Thr Gly Ala Thr Gly Glu Thr Gly

35 40 45

Glu Thr Gly Ala Thr Gly Ala Thr Gly Ala Thr Gly Ala Thr Gly Glu

50 55 60

Thr Gly Ala Thr Gly Ala Thr Gly Ala Thr Gly Ala Ala Gly Ala Thr

65 70 75 80

Gly Glu Thr Gly Ala Thr Gly Glu Thr Gly Ala Thr Gly Glu Thr Gly

85 90 95

Ala Thr Gly Glu Thr Gly Ala Thr Gly Val Thr Gly Glu Thr Gly Ala

100 105 110

Thr Gly Glu Thr Gly Ala Ala Gly Glu Thr Gly Ile Thr Gly Val Thr

115 120 125

Gly Pro Thr Gly Glu Thr Gly Ala Thr Gly Glu Thr Gly Ala Thr Gly

130 135 140

Ala Thr Gly Ile Thr Gly Ala Thr Gly Ile Thr Gly Val Ala Gly Ala

145 150 155 160

Thr Gly Glu Thr Gly Ala Ala Gly Glu Thr Gly Pro Thr Gly Ala Thr

165 170 175

Gly Ala Ile Gly Ala Ile Gly Ala Thr Gly Ala Thr Gly Ile Thr Gly

180 185 190

Val Thr Gly Ala Thr Gly Glu Thr Gly Ala Ala Gly Ala Thr Gly Ile

195 200 205

Thr Gly Val Thr Gly Ala Thr Gly Glu Thr Gly Ala Ala Gly Ala Thr

210 215 220

Gly Ile Thr Gly Ala Thr Gly Ile Thr Gly Val Ala Gly Ala Thr Gly

225 230 235 240

Ile Thr Gly Pro Thr Gly Ile Pro Gly Thr Ile Pro Thr Thr Asn Leu

245 250 255

Leu Tyr Phe Thr Phe Ser Asp Gly Glu Lys Leu Ile Tyr Thr Asn Ala

260 265 270

Asp Gly Ile Ala Gln Tyr Gly Thr Thr Gln Ile Leu Ser Pro Ser Glu

275 280 285

Val Ser Tyr Ile Asn Leu Phe Ile Asn Gly Ile Leu Gln Pro Gln Pro

290 295 300

Phe Tyr Glu Val Thr Ala Gly Gln Leu Thr Leu Leu Asp Asp Glu Pro

305 310 315 320

Pro Ser Gln Gly Ser Ser Ile Ile Leu Gln Phe Ile Ile Ile Asn

325 330 335

<210> 35

<211> 22

<212> Protein

<213> Bacillus thuringiensis

<400> 35

Met Ile Gly Pro Glu Asn Ile Gly Pro Thr Phe Pro Ile Leu Pro Pro

1 5 10 15

Ile Tyr Ile Pro Thr Gly

20

<210> 36

<211> 234

<212> Protein

<213> Bacillus thuringiensis

<400> 36

Met Ile Gly Pro Glu Asn Ile Gly Pro Thr Phe Pro Ile Leu Pro Pro

1 5 10 15

Ile Tyr Ile Pro Thr Gly Glu Thr Gly Pro Thr Gly Ile Thr Gly Ala

20 25 30

Thr Gly Glu Thr Gly Pro Thr Gly Ile Thr Gly Pro Thr Gly Ile Thr

35 40 45

Gly Ala Thr Gly Glu Thr Gly Ser Thr Gly Ile Thr Gly Ala Thr Gly

50 55 60

Glu Thr Gly Ser Thr Gly Ile Thr Gly Pro Ile Gly Ile Thr Gly Ala

65 70 75 80

Thr Gly Glu Thr Gly Pro Ile Gly Ile Thr Gly Ala Thr Gly Glu Thr

85 90 95

Gly Pro Thr Gly Ile Thr Gly Ser Thr Gly Ile Thr Gly Leu Thr Gly

100 105 110

Val Thr Gly Leu Thr Gly Glu Thr Gly Pro Ile Gly Ile Thr Gly Pro

115 120 125

Thr Gly Ile Thr Gly Pro Thr Gly Val Thr Gly Ala Thr Gly Pro Thr

130 135 140

Gly Gly Ile Gly Pro Ile Thr Thr Thr Asn Leu Leu Tyr Tyr Thr Phe

145 150 155 160

Ala Asp Gly Glu Lys Leu Ile Tyr Thr Asp Thr Asp Gly Ile Pro Gln

165 170 175

Tyr Gly Thr Thr Asn Ile Leu Ser Pro Ser Glu Val Ser Tyr Ile Asn

180 185 190

Leu Phe Val Asn Gly Ile Leu Gln Pro Gln Pro Leu Tyr Glu Val Ser

195 200 205

Thr Gly Lys Leu Thr Leu Leu Asp Thr Gln Pro Pro Ser Gln Gly Ser

210 215 220

Ser Ile Ile Leu Gln Phe Ile Ile Ile Asn

225 230

<210> 37

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 37

ggatccatgg ctgaacacaa tcc 23

<210> 38

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 38

ggatccttaa ttcgtattct ggcc 24

<210> 39

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 39

ggatccatga aacggtcaat c 21

<210> 40

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 40

ggatccttac taatttggtt ctgt 24

<210> 41

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 41

ggatccatgc taccaaaagc c 21

<210> 42

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Primer

<400> 42

ggatccttag tccgcaggcg tagc 24

<210> 43

<211> 35

<212> Protein

<213> Bacillus cereus

<400> 43

Met Ser Asn Asn Asn Ile Pro Ser Pro Phe Phe Phe Asn Asn Phe Asn

1 5 10 15

Pro Glu Leu Ile Gly Pro Thr Phe Pro Pro Ile Pro Pro Leu Thr Leu

20 25 30

Pro Thr Gly

35

<210> 44

<211> 222

<212> Protein

<213> Bacillus cereus

<400> 44

Met Ser Asn Asn Asn Ile Pro Ser Pro Phe Phe Phe Asn Asn Phe Asn

1 5 10 15

Pro Glu Leu Ile Gly Pro Thr Phe Pro Pro Ile Pro Pro Leu Thr Leu

20 25 30

Pro Thr Gly Pro Thr Gly Ser Thr Gly Ala Thr Gly Ala Thr Gly Pro

35 40 45

Thr Gly Ala Thr Gly Pro Thr Gly Ala Thr Gly Pro Thr Gly Ala Thr

50 55 60

Gly Ala Thr Gly Ser Thr Gly Ala Thr Gly Pro Thr Gly Ala Thr Gly

65 70 75 80

Thr Phe Ser Ser Ala Asn Ala Ser Ile Val Thr Pro Ala Pro Gln Thr

85 90 95

Val Asn Asn Leu Ala Pro Ile Gln Phe Thr Ala Pro Val Leu Ile Ser

100 105 110

Lys Asn Val Thr Phe Asn Gly Ile Asp Thr Phe Thr Ile Gln Ile Pro

115 120 125

Gly Asn Tyr Phe Phe Ile Gly Ala Val Met Thr Ser Asn Asn Gln Ala

130 135 140

Gly Pro Val Ala Val Gly Val Gly Phe Asn Gly Ile Pro Val Pro Ser

145 150 155 160

Leu Asp Gly Ala Asn Tyr Gly Thr Pro Thr Gly Gln Glu Val Val Cys

165 170 175

Phe Gly Phe Ser Gly Gln Ile Pro Ala Gly Thr Thr Ile Asn Leu Tyr

180 185 190

Asn Ile Ser Asp Lys Thr Ile Ser Ile Gly Gly Ala Thr Ala Ala Gly

195 200 205

Ser Ser Ile Val Ala Ala Arg Leu Ser Phe Phe Arg Ile Ser

210 215 220

<210> 45

<211> 41

<212> Protein

<213> Bacillus cereus

<400> 45

Met Phe Ser Glu Lys Lys Arg Lys Asp Leu Ile Pro Asp Asn Phe Leu

1 5 10 15

Ser Ala Pro Ala Leu Asp Pro Asn Leu Ile Gly Pro Thr Phe Pro Pro

20 25 30

Ile Pro Ser Phe Thr Leu Pro Thr Gly

35 40

<210> 46

<211> 293

<212> Protein

<213> Bacillus cereus

<400> 46

Met Phe Ser Glu Lys Lys Arg Lys Asp Leu Ile Pro Asp Asn Phe Leu

1 5 10 15

Ser Ala Pro Ala Leu Asp Pro Asn Leu Ile Gly Pro Thr Phe Pro Pro

20 25 30

Ile Pro Ser Phe Thr Leu Pro Thr Gly Ser Thr Gly Pro Thr Gly Pro

35 40 45

Thr Gly Asp Thr Gly Pro Thr Gly Pro Thr Ala Thr Ile Cys Ile Arg

50 55 60

Thr Asp Pro Asp Asn Gly Cys Ser Val Ala Glu Gly Ser Gly Thr Val

65 70 75 80

Ala Ser Gly Phe Ala Ser His Ala Glu Ala Cys Asn Thr Gln Ala Ile

85 90 95

Gly Asp Cys Ser His Ala Glu Gly Gln Phe Ala Thr Ala Ser Gly Thr

100 105 110

Ala Ser His Ala Glu Gly Phe Gln Thr Thr Ala Ser Gly Phe Ala Ser

115 120 125

His Thr Glu Gly Ser Gly Thr Thr Ala Asp Ala Asn Phe Ser His Thr

130 135 140

Glu Gly Ile Asn Thr Ile Val Asp Val Leu His Pro Gly Ser His Ile

145 150 155 160

Met Gly Lys Asn Gly Thr Thr Arg Ser Ser Phe Ser Trp His Leu Ala

165 170 175

Asn Gly Leu Ala Val Gly Pro Ser Leu Asn Ser Ala Val Ile Glu Gly

180 185 190

Val Thr Gly Asn Leu Tyr Leu Asp Gly Val Val Ile Ser Pro Asn Ala

195 200 205

Ala Asp Tyr Ala Glu Met Phe Glu Thr Ile Asp Gly Asn Leu Ile Asp

210 215 220

Val Gly Tyr Phe Val Thr Leu Tyr Gly Glu Lys Ile Arg Lys Ala Asn

225 230 235 240

Ala Asn Asp Asp Tyr Ile Leu Gly Val Val Ser Ala Thr Pro Ala Met

245 250 255

Ile Ala Asp Ala Ser Asp Leu Arg Trp His Asn Leu Phe Val Arg Asp

260 265 270

Glu Trp Gly Arg Thr Gln Tyr His Glu Val Val Val Pro Glu Lys Lys

275 280 285

Met Ala Met Glu Glu

290

<210> 47

<211> 49

<212> Protein

<213> Bacillus cereus

<400> 47

Met Thr Arg Lys Asp Lys Phe Asn Arg Ser Arg Ile Ser Arg Arg Asp

1 5 10 15

Arg Phe Asn Ser Pro Lys Ile Lys Ser Glu Ile Leu Ile Ser Pro Asp

20 25 30

Leu Val Gly Pro Thr Phe Pro Pro Ile Pro Ser Phe Thr Leu Pro Thr

35 40 45

Gly

<210> 48

<211> 83

<212> Protein

<213> Bacillus cereus

<400> 48

Met Thr Arg Lys Asp Lys Phe Asn Arg Ser Arg Ile Ser Arg Arg Asp

1 5 10 15

Arg Phe Asn Ser Pro Lys Ile Lys Ser Glu Ile Leu Ile Ser Pro Asp

20 25 30

Leu Val Gly Pro Thr Phe Pro Pro Ile Pro Ser Phe Thr Leu Pro Thr

35 40 45

Gly Val Thr Gly Pro Thr Gly Asn Thr Gly Pro Thr Gly Ile Thr Gly

50 55 60

Pro Thr Gly Asp Thr Gly Pro Thr Gly Asp Thr Gly Pro Thr Gly Ile

65 70 75 80

Thr Gly Pro

<210> 49

<211> 38

<212> Protein

<213> Bacillus cereus

<400> 49

Met Ser Arg Lys Asp Arg Phe Asn Ser Pro Lys Ile Lys Ser Glu Ile

1 5 10 15

Ser Ile Ser Pro Asp Leu Val Gly Pro Thr Phe Pro Pro Ile Pro Ser

20 25 30

Phe Thr Leu Pro Thr Gly

35

<210> 50

<211> 163

<212> Protein

<213> Bacillus cereus

<400> 50

Met Ser Arg Lys Asp Arg Phe Asn Ser Pro Lys Ile Lys Ser Glu Ile

1 5 10 15

Ser Ile Ser Pro Asp Leu Val Gly Pro Thr Phe Pro Pro Ile Pro Ser

20 25 30

Phe Thr Leu Pro Thr Gly Ile Thr Gly Pro Thr Gly Asn Thr Gly Pro

35 40 45

Thr Gly Asp Thr Gly Pro Thr Gly Pro Thr Phe Asn Ile Asn Phe Arg

50 55 60

Ala Glu Lys Asn Gly Ala Gln Ser Phe Thr Pro Pro Ala Asp Ile Gln

65 70 75 80

Val Ser Tyr Gly Asn Ile Ile Phe Asn Asn Gly Gly Gly Tyr Ser Ser

85 90 95

Val Thr Asn Thr Phe Thr Ala Pro Ile Asn Gly Ile Tyr Leu Phe Ser

100 105 110

Ala Asn Ile Gly Phe Asn Pro Thr Leu Gly Thr Thr Ser Thr Leu Arg

115 120 125

Ile Thr Ile Arg Lys Asn Leu Val Ser Val Ala Ser Gln Thr Ile Asp

130 135 140

Ile Gln Phe Ser Ala Ala Glu Ser Gly Thr Leu Thr Val Gly Ser Ser

145 150 155 160

Asn phe phe

<210> 51

<211> 39

<212> Protein

<213> Bacillus cereus

<400> 51

Met Lys Glu Arg Asp Asn Lys Gly Lys Gln His Ser Leu Asn Ser Asn

1 5 10 15

Phe Arg Ile Pro Pro Glu Leu Ile Gly Pro Thr Phe Pro Pro Val Pro

20 25 30

Thr Gly Phe Thr Gly Ile Gly

35

<210> 52

<211> 323

<212> Protein

<213> Bacillus cereus

<400> 52

Met Lys Glu Arg Asp Asn Lys Gly Lys Gln His Ser Leu Asn Ser Asn

1 5 10 15

Phe Arg Ile Pro Pro Glu Leu Ile Gly Pro Thr Phe Pro Pro Val Pro

20 25 30

Thr Gly Phe Thr Gly Ile Gly Ile Thr Gly Pro Thr Gly Pro Gln Gly

35 40 45

Pro Thr Gly Pro Gln Gly Pro Arg Gly Phe Gln Gly Pro Met Gly Glu

50 55 60

Met Gly Pro Thr Gly Pro Gln Gly Val Gln Gly Ile Gln Gly Pro Ala

65 70 75 80

Gly Gln Met Gly Ala Thr Gly Pro Glu Gly Gln Gln Gly Pro Glu Gly

85 90 95

Leu Arg Gly Pro Val Gly Ala Thr Gly Ala Thr Gly Leu Gln Gly Val

100 105 110

Gln Gly Ile Gln Gly Pro Ile Gly Ser Thr Gly Ala Thr Gly Ala Gln

115 120 125

Gly Ile Gln Gly Ile Gln Gly Leu Gln Gly Pro Ile Gly Ala Thr Gly

130 135 140

Pro Glu Gly Pro Gln Gly Ile Gln Gly Val Gln Gly Leu Pro Gly Ala

145 150 155 160

Thr Gly Pro Gln Gly Val Gln Gly Val Gln Gly Val Ile Gly Pro Gln

165 170 175

Gly Pro Ser Gly Ser Thr Gly Gly Thr Gly Ala Thr Gly Gln Gly Val

180 185 190

Thr Gly Pro Thr Gly Ile Thr Gly Ser Thr Gly Val Thr Gly Pro Ser

195 200 205

Gly Gly Pro Pro Gly Pro Thr Gly Pro Thr Gly Ala Thr Gly Pro Gly

210 215 220

Gly Gly Pro Ser Gly Ser Thr Gly Val Thr Gly Ser Thr Gly Asn Thr

225 230 235 240

Gly Ala Thr Gly Ser Pro Gly Val Thr Gly Ala Thr Gly Pro Thr Gly

245 250 255

Ser Thr Gly Ala Thr Gly Ile Gln Gly Ser Gln Gly Ile Gln Gly Ile

260 265 270

Gln Gly Ile Gln Gly Pro Leu Gly Pro Thr Gly Pro Glu Gly Pro Gln

275 280 285

Gly Ile Gln Gly Ile Pro Gly Pro Thr Gly Ile Thr Gly Glu Gln Gly

290 295 300

Ile Gln Gly Val Gln Gly Ile Gln Gly Ile Thr Gly Ala Thr Gly Asp

305 310 315 320

Gln Gly Thr

<210> 53

<211> 39

<212> Protein

<213> Bacillus cereus

<400> 53

Met Arg Glu Arg Asp Asn Lys Arg Gln Gln His Ser Leu Asn Pro Asn

1 5 10 15

Phe Arg Ile Ser Pro Glu Leu Ile Gly Pro Thr Phe Pro Pro Val Pro

20 25 30

Thr Gly Phe Thr Gly Ile Gly

35

<210> 54

<211> 436

<212> Protein

<213> Bacillus cereus

<400> 54

Met Arg Glu Arg Asp Asn Lys Arg Gln Gln His Ser Leu Asn Pro Asn

1 5 10 15

Phe Arg Ile Ser Pro Glu Leu Ile Gly Pro Thr Phe Pro Pro Val Pro

20 25 30

Thr Gly Phe Thr Gly Ile Gly Ile Thr Gly Pro Thr Gly Pro Gln Gly

35 40 45

Pro Thr Gly Pro Gln Gly Pro Arg Gly Phe Gln Gly Pro Met Gly Glu

50 55 60

Met Gly Pro Thr Gly Pro Gln Gly Val Gln Gly Ile Gln Gly Pro Val

65 70 75 80

Gly Pro Ile Gly Ala Thr Gly Pro Glu Gly Gln Gln Gly Pro Gln Gly

85 90 95

Leu Arg Gly Pro Gln Gly Glu Thr Gly Ala Thr Gly Pro Gly Gly Val

100 105 110

Gln Gly Leu Gln Gly Pro Ile Gly Pro Thr Gly Ala Thr Gly Ala Gln

115 120 125

Gly Val Gln Gly Ile Gln Gly Leu Gln Gly Pro Ile Gly Ala Thr Gly

130 135 140

Pro Glu Gly Pro Gln Gly Ile Gln Gly Val Gln Gly Leu Pro Gly Ala

145 150 155 160

Thr Gly Ser Gln Gly Ile Gln Gly Val Gln Gly Ile Gln Gly Pro Gln

165 170 175

Gly Pro Ser Gly Asn Thr Gly Ala Thr Gly Ala Thr Gly Gln Gly Ile

180 185 190

Thr Gly Pro Thr Gly Ile Thr Gly Pro Thr Gly Ile Thr Gly Pro Ser

195 200 205

Gly Gly Pro Pro Gly Pro Thr Gly Pro Thr Gly Ala Thr Gly Pro Gly

210 215 220

Gly Gly Pro Ser Gly Ser Thr Gly Ala Thr Gly Ala Thr Gly Asn Thr

225 230 235 240

Gly Ala Thr Gly Asn Thr Gly Ile Thr Gly Ala Thr Gly Ser Thr Gly

245 250 255

Pro Thr Gly Ser Thr Gly Ala Gln Gly Leu Gln Gly Ile Gln Gly Ile

260 265 270

Gln Gly Pro Ile Gly Pro Thr Gly Pro Glu Gly Pro Gln Gly Ile Gln

275 280 285

Gly Ile Pro Gly Pro Thr Gly Val Thr Gly Glu Gln Gly Ile Gln Gly

290 295 300

Val Gln Gly Ile Gln Gly Ile Thr Gly Ala Thr Gly Asp Gln Gly Pro

305 310 315 320

Gln Gly Ile Gln Gly Val Ile Gly Ala Gln Gly Val Thr Gly Ala Thr

325 330 335

Gly Asp Gln Gly Pro Gln Gly Ile Gln Gly Val Pro Gly Pro Ser Gly

340 345 350

Ala Thr Gly Pro Gln Gly Val Gln Gly Ile Gln Gly Pro Met Gly Asp

355 360 365

Ile Gly Pro Thr Gly Pro Glu Gly Pro Glu Gly Leu Gln Gly Pro Gln

370 375 380

Gly Ile Gln Gly Val Pro Gly Pro Val Gly Ala Thr Gly Pro Glu Gly

385 390 395 400

Pro Gln Gly Ile Gln Gly Ile Gln Gly Val Gln Gly Ala Thr Gly Pro

405 410 415

Gln Gly Pro Gln Gly Ile Gln Gly Ile Gln Gly Val Gln Gly Ile Thr

420 425 430

Gly Ala Thr Gly

435

<210> 55

<211> 36

<212> Protein

<213> Bacillus thuringiensis

<400> 55

Met Lys Asn Arg Asp Asn Lys Gly Lys Gln Gln Ser Asn Phe Arg Ile

1 5 10 15

Pro Pro Glu Leu Ile Gly Pro Thr Phe Pro Pro Val Pro Thr Gly Phe

20 25 30

Thr Gly Ile Gly

35

<210> 56

<211> 470

<212> Protein

<213> Bacillus thuringiensis

<400> 56

Met Lys Asn Arg Asp Asn Lys Gly Lys Gln Gln Ser Asn Phe Arg Ile

1 5 10 15

Pro Pro Glu Leu Ile Gly Pro Thr Phe Pro Pro Val Pro Thr Gly Phe

20 25 30

Thr Gly Ile Gly Ile Thr Gly Pro Thr Gly Pro Gln Gly Pro Thr Gly

35 40 45

Pro Gln Gly Pro Arg Gly Phe Gln Gly Pro Met Gly Glu Met Gly Pro

50 55 60

Thr Gly Pro Gln Gly Val Gln Gly Ile Gln Gly Pro Val Gly Pro Ile

65 70 75 80

Gly Ala Thr Gly Pro Glu Gly Gln Gln Gly Ala Gln Gly Leu Arg Gly

85 90 95

Pro Gln Gly Glu Thr Gly Ala Thr Gly Pro Gln Gly Val Gln Gly Leu

100 105 110

Gln Gly Pro Ile Gly Pro Thr Gly Ala Thr Gly Ala Gln Gly Ile Gln

115 120 125

Gly Ile Gln Gly Leu Gln Gly Pro Ile Gly Ala Thr Gly Pro Glu Gly

130 135 140

Pro Gln Gly Ile Gln Gly Val Gln Gly Leu Pro Gly Ala Thr Gly Pro

145 150 155 160

Gln Gly Ile Gln Gly Ala Gln Gly Ile Gln Gly Thr Gln Gly Pro Ser

165 170 175

Gly Asn Thr Gly Ala Thr Gly Ala Thr Gly Gln Gly Leu Thr Gly Pro

180 185 190

Thr Gly Ile Thr Gly Pro Thr Gly Ile Thr Gly Pro Ser Gly Gly Pro

195 200 205

Pro Gly Pro Thr Gly Pro Thr Gly Ala Thr Gly Pro Gly Gly Gly Pro

210 215 220

Ser Gly Ser Thr Gly Ala Thr Gly Ala Thr Gly Asp Thr Gly Ala Thr

225 230 235 240

Gly Ser Thr Gly Val Thr Gly Ala Thr Gly Ala Gln Gly Pro Gln Gly

245 250 255

Val Gln Gly Ile Gln Gly Pro Thr Gly Ala Thr Gly Ala Thr Gly Ala

260 265 270

Thr Gly Pro Gln Gly Ile Gln Gly Pro Gln Gly Ile Gln Gly Pro Thr

275 280 285

Gly Ala Thr Gly Ala Thr Gly Ser Gln Gly Pro Thr Gly Asn Thr Gly

290 295 300

Pro Thr Gly Ser Gln Gly Ile Gln Gly Pro Thr Gly Pro Thr Gly Ala

305 310 315 320

Gly Ala Thr Gly Ala Thr Gly Ala Thr Gly Ala Thr Gly Val Ser Thr

325 330 335

Thr Ala Thr Tyr Ala Phe Ala Asn Asn Thr Ser Gly Ser Ile Ile Ser

340 345 350

Val Leu Leu Gly Gly Thr Asn Ile Pro Leu Pro Asn Asn Gln Asn Ile

355 360 365

Gly Pro Gly Ile Thr Val Ser Gly Gly Asn Thr Val Phe Thr Val Ala

370 375 380

Asn Ala Gly Asn Tyr Tyr Ile Ala Tyr Thr Ile Asn Leu Thr Ala Gly

385 390 395 400

Leu Leu Val Ser Ser Arg Ile Thr Val Asn Gly Ser Pro Leu Ala Gly

405 410 415

Thr Ile Asn Ser Pro Ala Val Ala Ala Gly Ser Phe Ser Ala Thr Ile

420 425 430

Ile Ala Asn Leu Pro Ala Gly Ala Ala Val Ser Leu Gln Leu Phe Gly

435 440 445

Val Ile Ala Leu Ala Thr Leu Ser Thr Ala Thr Pro Gly Ala Thr Leu

450 455 460

Thr Ile Ile Arg Leu Ser

465 470

<210> 57

<211> 136

<212> Protein

<213> Bacillus mycoides

<400> 57

Met Lys Phe Ser Lys Lys Ser Thr Val Asp Ser Ser Ile Val Gly Lys

1 5 10 15

Arg Val Val Ser Lys Val Asn Ile Leu Arg Phe Tyr Asp Ala Arg Ser

20 25 30

Cys Gln Asp Lys Asp Val Asp Gly Phe Val Asp Val Gly Glu Leu Phe

35 40 45

Thr Ile Phe Arg Lys Leu Asn Met Glu Gly Ser Val Gln Phe Lys Ala

50 55 60

His Asn Ser Ile Gly Lys Thr Tyr Tyr Ile Thr Ile Asn Glu Val Tyr

65 70 75 80

Val Phe Val Thr Val Leu Leu Gln Tyr Ser Thr Leu Ile Gly Gly Ser

85 90 95

Tyr Val Phe Asp Lys Asn Glu Ile Gln Lys Ile Asn Gly Ile Leu Gln

100 105 110

Ala Asn Ala Leu Asn Pro Asn Leu Ile Gly Pro Thr Leu Pro Pro Ile

115 120 125

Pro Pro Phe Thr Leu Pro Thr Gly

130 135

<210> 58

<211> 384

<212> Protein

<213> Bacillus mycoides

<400> 58

Met Lys Phe Ser Lys Lys Ser Thr Val Asp Ser Ser Ile Val Gly Lys

1 5 10 15

Arg Val Val Ser Lys Val Asn Ile Leu Arg Phe Tyr Asp Ala Arg Ser

20 25 30

Cys Gln Asp Lys Asp Val Asp Gly Phe Val Asp Val Gly Glu Leu Phe

35 40 45

Thr Ile Phe Arg Lys Leu Asn Met Glu Gly Ser Val Gln Phe Lys Ala

50 55 60

His Asn Ser Ile Gly Lys Thr Tyr Tyr Ile Thr Ile Asn Glu Val Tyr

65 70 75 80

Val Phe Val Thr Val Leu Leu Gln Tyr Ser Thr Leu Ile Gly Gly Ser

85 90 95

Tyr Val Phe Asp Lys Asn Glu Ile Gln Lys Ile Asn Gly Ile Leu Gln

100 105 110

Ala Asn Ala Leu Asn Pro Asn Leu Ile Gly Pro Thr Leu Pro Pro Ile

115 120 125

Pro Pro Phe Thr Leu Pro Thr Gly Pro Thr Gly Gly Thr Gly Pro Thr

130 135 140

Gly Val Thr Gly Pro Thr Gly Val Thr Gly Pro Thr Gly Val Thr Gly

145 150 155 160

Pro Thr Gly Val Thr Gly Pro Thr Gly Val Thr Gly Pro Thr Gly Val

165 170 175

Thr Gly Pro Thr Gly Val Thr Gly Pro Thr Gly Val Thr Gly Pro Thr

180 185 190

Gly Val Thr Gly Pro Thr Gly Val Thr Gly Pro Thr Gly Val Thr Gly

195 200 205

Pro Thr Gly Val Thr Gly Pro Thr Gly Gly Thr Glu Gly Cys Leu Cys

210 215 220

Asp Cys Cys Val Leu Pro Met Gln Ser Val Leu Gln Gln Leu Ile Gly

225 230 235 240

Glu Thr Val Ile Leu Gly Thr Ile Ala Asp Thr Pro Asn Thr Pro Pro

245 250 255

Leu Phe Phe Leu Phe Thr Ile Thr Ser Val Asn Asp Phe Leu Val Thr

260 265 270

Val Thr Asp Gly Thr Thr Thr Phe Val Val Asn Ile Ser Asp Val Thr

275 280 285

Gly Val Gly Phe Leu Pro Pro Gly Pro Pro Ile Thr Leu Leu Pro Pro

290 295 300

Thr Asp Val Gly Cys Glu Cys Glu Cys Arg Glu Arg Pro Ile Arg Gln

305 310 315 320

Leu Leu Asp Ala Phe Ile Gly Ser Thr Val Ser Leu Leu Ala Ser Asn

325 330 335

Gly Ser Ile Ala Ala Asp Phe Ser Val Glu Gln Thr Gly Leu Gly Ile

340 345 350

Val Leu Gly Thr Leu Pro Ile Asn Pro Thr Thr Thr Val Arg Phe Ala

355 360 365

Ile Ser Thr Cys Lys Ile Thr Ala Val Asn Ile Thr Pro Ile Thr Met

370 375 380

<210> 59

<211> 196

<212> Protein

<213> Bacillus anthracis

<400> 59

Met Ser Asn Asn Asn Tyr Ser Asn Gly Leu Asn Pro Asp Glu Ser Leu

1 5 10 15

Ser Ala Ser Ala Phe Asp Pro Asn Leu Val Gly Pro Thr Leu Pro Pro

20 25 30

Ile Pro Pro Phe Thr Leu Pro Thr Gly Pro Thr Gly Pro Phe Thr Thr

35 40 45

Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly

50 55 60

Pro Thr Gly Pro Thr Gly Pro Thr Gly Asp Thr Gly Thr Thr Gly Pro

65 70 75 80

Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr

85 90 95

Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Phe Thr Pro Thr Gly Pro

100 105 110

Thr Gly Pro Thr Gly Pro Thr Gly Asp Thr Gly Thr Thr Gly Pro Thr

115 120 125

Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Asp Thr Gly

130 135 140

Thr Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro

145 150 155 160

Thr Gly Pro Thr Gly Pro Thr Phe Thr Gly Pro Thr Gly Pro Thr Gly

165 170 175

Pro Thr Gly Ala Thr Gly Leu Thr Gly Pro Thr Gly Pro Thr Gly Pro

180 185 190

Ser Gly Leu Gly

195

<210> 60

<211> 17

<212> Protein

<213> Bacillus anthracis

<400> 60

Met Ala Phe Asp Pro Asn Leu Val Gly Pro Thr Leu Pro Pro Ile Pro

1 5 10 15

Pro

<210> 61

<211> 17

<212> Protein

<213> Bacillus anthracis

<400> 61

Met Ala Leu Glu Pro Asn Leu Ile Gly Pro Thr Leu Pro Pro Ile Pro

1 5 10 15

Pro

<210> 62

<211> 17

<212> Protein

<213> Bacillus weihenstephensis

<400> 62

Met Ala Leu Asn Pro Asn Leu Ile Gly Pro Thr Leu Pro Pro Ile Pro

1 5 10 15

Pro

<210> 63

<211> 17

<212> Protein

<213> Bacillus weihenstephensis

<400> 63

Met Ala Leu Asp Pro Asn Ile Ile Gly Pro Thr Leu Pro Pro Ile Pro

1 5 10 15

Pro

<210> 64

<211> 17

<212> Protein

<213> Bacillus cereus

<400> 64

Met Ala Leu Glu Pro Asn Leu Ile Gly Pro Thr Leu Pro Ser Ile Pro

1 5 10 15

Pro

<210> 65

<211> 17

<212> Protein

<213> Bacillus weihenstephensis

<400> 65

Met Ala Leu Asp Pro Asn Leu Ile Gly Pro Pro Leu Pro Pro Ile Thr

1 5 10 15

Pro

<210> 66

<211> 17

<212> Protein

<213> Bacillus weihenstephensis

<400> 66

Met Ala Leu Asn Pro Gly Ser Ile Gly Pro Thr Leu Pro Pro Val Pro

1 5 10 15

Pro

<210> 67

<211> 17

<212> Protein

<213> Bacillus weihenstephensis

<400> 67

Met Ala Leu Asn Pro Cys Ser Ile Gly Pro Thr Leu Pro Pro Met Gln

1 5 10 15

Pro

<210> 68

<211> 17

<212> Protein

<213> Bacillus mycoides

<400> 68

Met Ala Leu Asn Pro Gly Ser Ile Gly Pro Thr Leu Pro Pro Val Gln

1 5 10 15

Pro

<210> 69

<211> 17

<212> Protein

<213> Bacillus anthracis

<400> 69

Met Ala Leu Asn Pro Gly Ser Val Gly Pro Thr Leu Pro Pro Met Gln

1 5 10 15

Pro

<210> 70

<211> 17

<212> Protein

<213> Bacillus cereus

<400> 70

Met Ala Leu Asp Pro Asn Leu Ile Gly Pro Thr Phe Pro Pro Ile Pro

1 5 10 15

Ser

<210> 71

<211> 799

<212> Protein

<213> Bacillus mycoides

<400> 71

Met Lys Arg Lys Thr Pro Phe Lys Val Phe Ser Ser Leu Ala Ile Thr

1 5 10 15

Thr Met Leu Gly Cys Thr Phe Ala Leu Gly Thr Ser Val Ala Tyr Ala

20 25 30

Glu Thr Thr Ser Gln Ser Lys Gly Ser Ile Ser Thr Thr Pro Ile Asp

35 40 45

Asn Asn Leu Ile Gln Glu Glu Arg Leu Ala Glu Ala Leu Lys Glu Arg

50 55 60

Gly Thr Ile Asp Gln Ser Ala Ser Lys Glu Glu Thr Gln Lys Ala Val

65 70 75 80

Glu Gln Tyr Ile Glu Lys Lys Lys Gly Asp Gln Pro Asn Lys Glu Ile

85 90 95

Leu Pro Asp Asp Pro Ala Lys Glu Ala Ser Asp Phe Val Lys Lys Val

100 105 110

Lys Glu Lys Lys Met Glu Glu Lys Glu Lys Val Lys Lys Ser Val Glu

115 120 125

Asn Ala Ser Ser Glu Gln Thr Pro Ser Gln Asn Lys Lys Gln Leu Asn

130 135 140

Gly Lys Val Pro Thr Ser Pro Ala Lys Gln Ala Pro Tyr Asn Gly Ala

145 150 155 160

Val Arg Thr Asp Lys Val Leu Val Leu Leu Val Glu Phe Ser Asp Tyr

165 170 175

Lys His Asn Asn Ile Glu Gln Ser Pro Gly Tyr Met Tyr Ala Asn Asp

180 185 190

Phe Ser Arg Glu His Tyr Gln Lys Met Leu Phe Gly Asn Glu Pro Phe

195 200 205

Thr Leu Phe Asp Gly Ser Lys Val Lys Thr Phe Lys Gln Tyr Tyr Glu

210 215 220

Glu Gln Ser Gly Gly Ser Tyr Thr Thr Asp Gly Tyr Val Thr Glu Trp

225 230 235 240

Leu Thr Val Pro Gly Lys Ala Ala Asp Tyr Gly Ala Asp Gly Lys Thr

245 250 255

Gly His Asp Asn Lys Gly Pro Lys Gly Ala Arg Asp Leu Val Lys Glu

260 265 270

Ala Leu Lys Ala Ala Ala Glu Lys Gly Leu Asp Leu Ser Gln Phe Asp

275 280 285

Gln Phe Asp Arg Tyr Asp Thr Asn Gly Asp Gly Asn Gln Asn Glu Pro

290 295 300

Asp Gly Val Ile Asp His Leu Met Val Ile His Ala Gly Val Gly Gln

305 310 315 320

Glu Ala Gly Gly Gly Lys Leu Gly Asp Asp Ala Ile Trp Ser His Arg

325 330 335

Ser Lys Leu Ala Gln Asp Pro Val Ala Ile Glu Gly Thr Lys Ser Lys

340 345 350

Val Ser Tyr Trp Asp Gly Lys Val Ala Ala His Asp Tyr Thr Ile Glu

355 360 365

Pro Glu Asp Gly Ala Val Gly Val Phe Ala His Glu Phe Gly His Asp

370 375 380

Leu Gly Leu Pro Asp Glu Tyr Asp Thr Asn Tyr Thr Gly Ala Gly Ser

385 390 395 400

Pro Val Glu Ala Trp Ser Leu Met Ser Gly Gly Ser Trp Thr Gly Arg

405 410 415

Ile Ala Gly Thr Glu Pro Thr Ser Phe Ser Pro Gln Asn Lys Asp Phe

420 425 430

Leu Gln Lys Asn Met Asp Gly Asn Trp Ala Lys Ile Val Glu Val Asp

435 440 445

Tyr Asp Lys Ile Lys Arg Gly Val Gly Phe Pro Thr Tyr Ile Asp Gln

450 455 460

Ser Val Thr Lys Ser Asn Arg Pro Gly Leu Val Arg Val Asn Leu Pro

465 470 475 480

Glu Lys Ser Val Glu Thr Ile Lys Thr Gly Phe Gly Lys His Ala Tyr

485 490 495

Tyr Ser Thr Arg Gly Asp Asp Met His Thr Thr Leu Glu Thr Pro Leu

500 505 510

Phe Asp Leu Thr Lys Ala Ala Asn Ala Lys Phe Asp Tyr Lys Ala Asn

515 520 525

Tyr Glu Leu Glu Ala Glu Cys Asp Phe Ile Glu Val His Ala Val Thr

530 535 540

Glu Asp Gly Thr Lys Thr Leu Ile Asp Lys Leu Gly Asp Lys Val Val

545 550 555 560

Lys Gly Asp Gln Asp Thr Thr Glu Gly Lys Trp Ile Asp Lys Ser Tyr

565 570 575

Asp Leu Ser Gln Phe Lys Gly Lys Lys Val Lys Leu Gln Phe Asp Tyr

580 585 590

Ile Thr Asp Pro Ala Leu Thr Tyr Lys Gly Phe Ala Met Asp Asn Val

595 600 605

Asn Val Thr Val Asp Gly Lys Val Val Phe Ser Asp Asp Ala Glu Gly

610 615 620

Gln Ala Lys Met Lys Leu Asn Gly Phe Val Val Ser Asp Gly Thr Glu

625 630 635 640

Lys Lys Pro His Tyr Tyr Tyr Leu Glu Trp Arg Asn Tyr Ala Gly Ser

645 650 655

Asp Glu Gly Leu Lys Val Gly Arg Gly Pro Val Tyr Asn Thr Gly Leu

660 665 670

Val Val Trp Tyr Ala Asp Asp Ser Phe Lys Asp Asn Trp Val Gly Arg

675 680 685

His Pro Gly Glu Gly Phe Leu Gly Val Val Asp Ser His Pro Glu Ala

690 695 700

Val Val Gly Asn Leu Asn Gly Lys Pro Val Tyr Gly Asn Thr Gly Leu

705 710 715 720

Gln Ile Ala Asp Ala Ala Phe Ser Leu Asp Gln Thr Pro Ala Trp Asn

725 730 735

Val Asn Ser Phe Thr Arg Gly Gln Phe Asn Tyr Pro Gly Leu Pro Gly

740 745 750

Val Ala Thr Phe Asp Asp Ser Lys Val Tyr Ser Asn Thr Gln Ile Pro

755 760 765

Asp Ala Gly Arg Lys Val Pro Gln Leu Gly Leu Lys Phe Gln Val Val

770 775 780

Gly Gln Ala Asp Asp Lys Ser Ala Gly Ala Ile Trp Ile Arg Arg

785 790 795

<210> 72

<211> 152

<212> Protein

<213> Bacillus anthracis

<400> 72

Met Ser Cys Asn Glu Asn Lys His His Gly Ser Ser His Cys Val Val

1 5 10 15

Asp Val Val Lys Phe Ile Asn Glu Leu Gln Asp Cys Ser Thr Thr Thr

20 25 30

Cys Gly Ser Gly Cys Glu Ile Pro Phe Leu Gly Ala His Asn Thr Ala

35 40 45

Ser Val Ala Asn Thr Arg Pro Phe Ile Leu Tyr Thr Lys Ala Gly Ala

50 55 60

Pro Phe Glu Ala Phe Ala Pro Ser Ala Asn Leu Thr Ser Cys Arg Ser

65 70 75 80

Pro Ile Phe Arg Val Glu Ser Val Asp Asp Asp Ser Cys Ala Val Leu

85 90 95

Arg Val Leu Ser Val Val Leu Gly Asp Ser Ser Pro Val Pro Pro Thr

100 105 110

Asp Asp Pro Ile Cys Thr Phe Leu Ala Val Pro Asn Ala Arg Leu Val

115 120 125

Ser Thr Ser Thr Cys Ile Thr Val Asp Leu Ser Cys Phe Cys Ala Ile

130 135 140

Gln Cys Leu Arg Asp Val Thr Ile

145 150

<210> 73

<211> 167

<212> Protein

<213> Bacillus anthracis

<400> 73

Met Phe Ser Ser Asp Cys Glu Phe Thr Lys Ile Asp Cys Glu Ala Lys

1 5 10 15

Pro Ala Ser Thr Leu Pro Ala Phe Gly Phe Ala Phe Asn Ala Ser Ala

20 25 30

Pro Gln Phe Ala Ser Leu Phe Thr Pro Leu Leu Leu Pro Ser Val Ser

35 40 45

Pro Asn Pro Asn Ile Thr Val Pro Val Ile Asn Asp Thr Val Ser Val

50 55 60

Gly Asp Gly Ile Arg Ile Leu Arg Ala Gly Ile Tyr Gln Ile Ser Tyr

65 70 75 80

Thr Leu Thr Ile Ser Leu Asp Asn Ser Pro Val Ala Pro Glu Ala Gly

85 90 95

Arg Phe Phe Leu Ser Leu Gly Thr Pro Ala Asn Ile Ile Pro Gly Ser

100 105 110

Gly Thr Ala Val Arg Ser Asn Val Ile Gly Thr Gly Glu Val Asp Val

115 120 125

Ser Ser Gly Val Ile Leu Ile Asn Leu Asn Pro Gly Asp Leu Ile Arg

130 135 140

Ile Val Pro Val Glu Leu Ile Gly Thr Val Asp Ile Arg Ala Ala Ala

145 150 155 160

Leu Thr Val Ala Gln Ile Ser

165

<210> 74

<211> 156

<212> Protein

<213> Bacillus anthracis

<400> 74

Met Ser Cys Asn Cys Asn Glu Asp His His His His Asp Cys Asp Phe

1 5 10 15

Asn Cys Val Ser Asn Val Val Arg Phe Ile His Glu Leu Gln Glu Cys

20 25 30

Ala Thr Thr Thr Cys Gly Ser Gly Cys Glu Val Pro Phe Leu Gly Ala

35 40 45

His Asn Ser Ala Ser Val Ala Asn Thr Arg Pro Phe Ile Leu Tyr Thr

50 55 60

Lys Ala Gly Ala Pro Phe Glu Ala Phe Ala Pro Ser Ala Asn Leu Thr

65 70 75 80

Ser Cys Arg Ser Pro Ile Phe Arg Val Glu Ser Ile Asp Asp Asp Asp

85 90 95

Cys Ala Val Leu Arg Val Leu Ser Val Val Leu Gly Asp Thr Ser Pro

100 105 110

Val Pro Pro Thr Asp Asp Pro Ile Cys Thr Phe Leu Ala Val Pro Asn

115 120 125

Ala Arg Leu Ile Ser Thr Asn Thr Cys Leu Thr Val Asp Leu Ser Cys

130 135 140

Phe Cys Ala Ile Gln Cys Leu Arg Asp Val Thr Ile

145 150 155

<210> 75

<211> 182

<212> Protein

<213> Bacillus anthracis

<400> 75

Met Glu Val Gly Gly Thr Ser Val Lys Asn Lys Asn Lys Ser Ser Thr

1 5 10 15

Val Gly Lys Pro Leu Leu Tyr Ile Ala Gln Val Ser Leu Glu Leu Ala

20 25 30

Ala Pro Lys Thr Lys Arg Ile Ile Leu Thr Asn Phe Glu Asn Glu Asp

35 40 45

Arg Lys Glu Glu Ser Asn Arg Asn Glu Asn Val Val Ser Ser Ala Val

50 55 60

Glu Glu Val Ile Glu Gln Glu Glu Gln Gln Gln Glu Gln Glu Gln Glu

65 70 75 80

Gln Glu Glu Gln Val Glu Glu Lys Thr Glu Glu Glu Glu Gln Val Gln

85 90 95

Glu Gln Gln Glu Pro Val Arg Thr Val Pro Tyr Asn Lys Ser Phe Lys

100 105 110

Asp Met Asn Asn Glu Glu Lys Ile His Phe Leu Leu Asn Arg Pro His

115 120 125

Tyr Ile Pro Lys Val Arg Cys Arg Ile Lys Thr Ala Thr Ile Ser Tyr

130 135 140

Val Gly Ser Ile Ile Ser Tyr Arg Asn Gly Ile Val Ala Ile Met Pro

145 150 155 160

Pro Asn Ser Met Arg Asp Ile Arg Leu Ser Ile Glu Glu Ile Lys Ser

165 170 175

Ile Asp Met Ala Gly Phe

180

<210> 76

<211> 174

<212> Protein

<213> Bacillus anthracis

<400> 76

Met Lys Glu Arg Ser Glu Asn Met Arg Ser Ser Ser Arg Lys Leu Thr

1 5 10 15

Asn Phe Asn Cys Arg Ala Gln Ala Pro Ser Thr Leu Pro Ala Leu Gly

20 25 30

Phe Ala Phe Asn Ala Thr Ser Pro Gln Phe Ala Thr Leu Phe Thr Pro

35 40 45

Leu Leu Leu Pro Ser Thr Gly Pro Asn Pro Asn Ile Thr Val Pro Val

50 55 60

Ile Asn Asp Thr Ile Ser Thr Gly Thr Gly Ile Arg Ile Gln Val Ala

65 70 75 80

Gly Ile Tyr Gln Ile Ser Tyr Thr Leu Thr Ile Ser Leu Asp Asn Val

85 90 95

Pro Val Thr Pro Glu Ala Ala Arg Phe Phe Leu Thr Leu Asn Ser Ser

100 105 110

Thr Asn Ile Ile Ala Gly Ser Gly Thr Ala Val Arg Ser Asn Ile Ile

115 120 125

Gly Thr Gly Glu Val Asp Val Ser Ser Gly Val Ile Leu Ile Asn Leu

130 135 140

Asn Pro Gly Asp Leu Ile Gln Ile Val Pro Val Glu Val Ile Gly Thr

145 150 155 160

Val Asp Ile Arg Ser Ala Ala Leu Thr Val Ala Gln Ile Arg

165 170

<210> 77

<211> 796

<212> Protein

<213> Bacillus thuringiensis

<400> 77

Met Ser Lys Lys Pro Phe Lys Val Leu Ser Ser Ile Ala Leu Thr Ala

1 5 10 15

Val Leu Gly Leu Ser Phe Gly Ala Gly Thr Gln Ser Ala Tyr Ala Glu

20 25 30

Thr Pro Val Asn Lys Thr Ala Thr Ser Pro Val Asp Asp His Leu Ile

35 40 45

Pro Glu Glu Arg Leu Ala Asp Ala Leu Lys Lys Arg Gly Val Ile Asp

50 55 60

Ser Lys Ala Ser Glu Thr Glu Thr Lys Lys Ala Val Glu Lys Tyr Val

65 70 75 80

Glu Asn Lys Lys Gly Glu Asn Pro Gly Lys Glu Ala Ala Asn Gly Asp

85 90 95

Gln Leu Thr Lys Asp Ala Ser Asp Phe Leu Lys Lys Val Lys Asp Ala

100 105 110

Lys Ala Asp Thr Lys Glu Lys Leu Asn Gln Pro Ala Thr Gly Thr Pro

115 120 125

Ala Ala Thr Gly Pro Val Lys Gly Gly Leu Asn Gly Lys Val Pro Thr

130 135 140

Ser Pro Ala Lys Gln Lys Asp Tyr Asn Gly Glu Val Arg Lys Asp Lys

145 150 155 160

Val Leu Val Leu Leu Val Glu Tyr Ala Asp Phe Lys His Asn Asn Ile

165 170 175

Asp Lys Glu Pro Gly Tyr Met Tyr Ser Asn Asp Phe Asn Lys Glu His

180 185 190

Tyr Glu Lys Met Leu Phe Gly Asn Glu Pro Phe Thr Leu Asp Asp Gly

195 200 205

Ser Lys Ile Glu Thr Phe Lys Gln Tyr Tyr Glu Glu Gln Ser Gly Gly

210 215 220

Ser Tyr Thr Val Asp Gly Thr Val Thr Lys Trp Leu Thr Val Pro Gly

225 230 235 240

Lys Ala Ala Asp Tyr Gly Ala Asp Ala Pro Gly Gly Gly His Asp Asn

245 250 255

Lys Gly Pro Lys Gly Pro Arg Asp Leu Val Lys Asp Ala Leu Lys Ala

260 265 270

Ala Val Asp Ser Gly Ile Asp Leu Ser Glu Phe Asp Gln Phe Asp Gln

275 280 285

Tyr Asp Val Asn Gly Asp Gly Asn Lys Asn Gln Pro Asp Gly Leu Ile

290 295 300

Asp His Leu Met Ile Ile His Ala Gly Val Gly Gln Glu Ala Gly Gly

305 310 315 320

Gly Lys Leu Gly Asp Asp Ala Ile Trp Ser His Arg Trp Thr Val Gly

325 330 335

Pro Lys Pro Phe Pro Ile Glu Gly Thr Gln Ala Lys Val Pro Tyr Trp

340 345 350

Gly Gly Lys Met Ala Ala Phe Asp Tyr Thr Ile Glu Pro Glu Asp Gly

355 360 365

Ala Val Gly Val Phe Ala His Glu Tyr Gly His Asp Leu Gly Leu Pro

370 375 380

Asp Glu Tyr Asp Thr Gln Tyr Ser Gly Gln Gly Glu Pro Ile Glu Ala

385 390 395 400

Trp Ser Ile Met Ser Gly Gly Ser Trp Ala Gly Lys Ile Ala Gly Thr

405 410 415

Thr Pro Thr Ser Phe Ser Pro Gln Asn Lys Glu Phe Phe Gln Lys Thr

420 425 430

Ile Gly Gly Asn Trp Ala Asn Ile Val Glu Val Asp Tyr Glu Lys Leu

435 440 445

Asn Lys Gly Ile Gly Leu Ala Thr Tyr Leu Asp Gln Ser Val Thr Lys

450 455 460

Ser Ala Arg Pro Gly Met Ile Arg Val Asn Leu Pro Asp Lys Asp Val

465 470 475 480

Lys Thr Ile Glu Pro Ala Phe Gly Lys Gln Tyr Tyr Tyr Ser Thr Lys

485 490 495

Gly Asp Asp Leu His Thr Lys Met Glu Thr Pro Leu Phe Asp Leu Thr

500 505 510

Asn Ala Thr Ser Ala Lys Phe Asp Phe Lys Ser Leu Tyr Glu Ile Glu

515 520 525

Ala Gly Tyr Asp Phe Leu Glu Val His Ala Val Thr Glu Asp Gly Lys

530 535 540

Gln Thr Leu Ile Glu Arg Leu Gly Glu Lys Ala Asn Ser Gly Asn Ala

545 550 555 560

Asp Ser Thr Asn Gly Lys Trp Ile Asp Lys Ser Tyr Asp Leu Ser Gln

565 570 575

Phe Lys Gly Lys Lys Val Lys Leu Thr Phe Asp Tyr Ile Thr Asp Gly

580 585 590

Gly Leu Ala Leu Asn Gly Phe Ala Leu Asp Asn Ala Ser Leu Thr Val

595 600 605

Asp Gly Lys Val Val Phe Ser Asp Asp Ala Glu Gly Thr Pro Gln Leu

610 615 620

Lys Leu Asp Gly Phe Val Val Ser Asn Gly Thr Glu Lys Lys Lys His

625 630 635 640

Asn Tyr Tyr Val Glu Trp Arg Asn Tyr Ala Gly Ala Asp Asn Ala Leu

645 650 655

Lys Phe Ala Arg Gly Pro Val Phe Asn Thr Gly Met Val Val Trp Tyr

660 665 670

Ala Asp Ser Ala Tyr Thr Asp Asn Trp Val Gly Val His Pro Gly His

675 680 685

Gly Phe Leu Gly Val Val Asp Ser His Pro Glu Ala Ile Val Gly Thr

690 695 700

Leu Asn Gly Lys Pro Thr Val Lys Ser Ser Thr Arg Phe Gln Ile Ala

705 710 715 720

Asp Ala Ala Phe Ser Phe Asp Lys Thr Pro Ala Trp Lys Val Val Ser

725 730 735

Pro Thr Arg Gly Thr Phe Thr Tyr Asp Gly Leu Ala Gly Val Pro Lys

740 745 750

Phe Asp Asp Ser Lys Thr Tyr Ile Asn Gln Gln Ile Pro Asp Ala Gly

755 760 765

Arg Ile Leu Pro Lys Leu Gly Leu Lys Phe Glu Val Val Gly Gln Ala

770 775 780

Asp Asp Asn Ser Ala Gly Ala Val Arg Leu Tyr Arg

785 790 795

<210> 78

<211> 430

<212> Protein

<213> Bacillus cereus

<400> 78

Met Lys His Asn Asp Cys Phe Asp His Asn Asn Cys Asn Pro Ile Val

1 5 10 15

Phe Ser Ala Asp Cys Cys Lys Asn Pro Gln Ser Val Pro Ile Thr Arg

20 25 30

Glu Gln Leu Ser Gln Leu Ile Thr Leu Leu Asn Ser Leu Val Ser Ala

35 40 45

Ile Ser Ala Phe Phe Ala Asn Pro Ser Asn Ala Asn Arg Leu Val Leu

50 55 60

Leu Asp Leu Phe Asn Gln Phe Leu Ile Phe Leu Asn Ser Leu Leu Pro

65 70 75 80

Ser Pro Glu Val Asn Phe Leu Lys Gln Leu Thr Gln Ser Ile Ile Val

85 90 95

Leu Leu Gln Ser Pro Ala Pro Asn Leu Gly Gln Leu Ser Thr Leu Leu

100 105 110

Gln Gln Phe Tyr Ser Ala Leu Ala Gln Phe Phe Phe Ala Leu Asp Leu

115 120 125

Ile Pro Ile Ser Cys Asn Ser Asn Val Asp Ser Ala Thr Leu Gln Leu

130 135 140

Leu Phe Asn Leu Leu Ile Gln Leu Ile Asn Ala Thr Pro Gly Ala Thr

145 150 155 160

Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro Ala Gly

165 170 175

Thr Gly Ala Gly Pro Thr Gly Ala Thr Gly Ala Thr Gly Ala Thr Gly

180 185 190

Pro Thr Gly Ala Thr Gly Pro Ala Gly Thr Gly Gly Ala Thr Gly Ala

195 200 205

Thr Gly Ala Thr Gly Val Thr Gly Ala Thr Gly Ala Thr Gly Ala Thr

210 215 220

Gly Pro Thr Gly Pro Thr Gly Ala Thr Gly Pro Thr Gly Ala Thr Gly

225 230 235 240

Ala Thr Gly Ala Thr Gly Pro Thr Gly Ala Thr Gly Pro Thr Gly Ala

245 250 255

Thr Gly Leu Thr Gly Ala Thr Gly Ala Ala Gly Gly Gly Ala Ile Ile

260 265 270

Pro Phe Ala Ser Gly Thr Thr Pro Ser Ala Leu Val Asn Ala Leu Val

275 280 285

Ala Asn Thr Gly Thr Leu Leu Gly Phe Gly Phe Ser Gln Pro Gly Val

290 295 300

Ala Leu Thr Gly Gly Thr Ser Ile Thr Leu Ala Leu Gly Val Gly Asp

305 310 315 320

Tyr Ala Phe Val Ala Pro Arg Ala Gly Thr Ile Thr Ser Leu Ala Gly

325 330 335

Phe Phe Ser Ala Thr Ala Ala Leu Ala Pro Ile Ser Pro Val Gln Val

340 345 350

Gln Ile Gln Ile Leu Thr Ala Pro Ala Ala Ser Asn Thr Phe Thr Val

355 360 365

Gln Gly Ala Pro Leu Leu Leu Thr Pro Ala Phe Ala Ala Ile Ala Ile

370 375 380

Gly Ser Thr Ala Ser Gly Ile Ile Ala Glu Ala Ile Pro Val Ala Ala

385 390 395 400

Gly Asp Lys Ile Leu Leu Tyr Val Ser Leu Thr Ala Ala Ser Pro Ile

405 410 415

Ala Ala Val Ala Gly Phe Val Ser Ala Gly Ile Asn Ile Val

420 425 430

<210> 79

<211> 437

<212> Protein

<213> Bacillus cereus

<400> 79

Met Lys His Asn Asp Cys Phe Gly His Asn Asn Cys Asn Asn Pro Ile

1 5 10 15

Val Phe Thr Pro Asp Cys Cys Asn Asn Pro Gln Thr Val Pro Ile Thr

20 25 30

Ser Glu Gln Leu Gly Arg Leu Ile Thr Leu Leu Asn Ser Leu Ile Ala

35 40 45

Ala Ile Ala Ala Phe Phe Ala Asn Pro Ser Asp Ala Asn Arg Leu Ala

50 55 60

Leu Leu Asn Leu Phe Thr Gln Leu Leu Asn Leu Leu Asn Glu Leu Ala

65 70 75 80

Pro Ser Pro Glu Gly Asn Phe Leu Lys Gln Leu Ile Gln Ser Ile Ile

85 90 95

Asn Leu Leu Gln Ser Pro Asn Pro Asn Leu Gly Gln Leu Leu Ser Leu

100 105 110

Leu Gln Gln Phe Tyr Ser Ala Leu Ala Pro Phe Phe Phe Ser Leu Ile

115 120 125

Leu Asp Pro Ala Ser Leu Gln Leu Leu Leu Asn Leu Leu Ala Gln Leu

130 135 140

Ile Gly Val Thr Pro Gly Gly Gly Ala Thr Gly Pro Thr Gly Pro Thr

145 150 155 160

Gly Pro Gly Gly Gly Ala Thr Gly Pro Thr Gly Pro Thr Gly Pro Gly

165 170 175

Gly Gly Ala Thr Gly Pro Thr Gly Ala Thr Gly Pro Thr Gly Asp Thr

180 185 190

Gly Leu Ala Gly Ala Thr Gly Ala Thr Gly Pro Thr Gly Asp Thr Gly

195 200 205

Val Ala Gly Pro Ala Gly Pro Thr Gly Pro Thr Gly Asp Thr Gly Leu

210 215 220

Ala Gly Ala Thr Gly Pro Thr Gly Pro Thr Gly Asp Thr Gly Leu Ala

225 230 235 240

Gly Ala Thr Gly Pro Thr Gly Ala Thr Gly Leu Ala Gly Ala Thr Gly

245 250 255

Pro Thr Gly Ala Thr Gly Leu Thr Gly Ala Thr Gly Ala Thr Gly Ala

260 265 270

Ala Gly Gly Gly Ala Ile Ile Pro Phe Ala Ser Gly Thr Thr Pro Ala

275 280 285

Ala Leu Val Asn Ala Leu Ile Ala Asn Thr Gly Thr Leu Leu Gly Phe

290 295 300

Gly Phe Ser Gln Pro Gly Ile Gly Leu Ala Gly Gly Thr Ser Ile Thr

305 310 315 320

Leu Ala Leu Gly Val Gly Asp Tyr Ala Phe Val Ala Pro Arg Asp Gly

325 330 335

Val Ile Thr Ser Leu Ala Gly Phe Phe Ser Ala Thr Ala Ala Leu Ser

340 345 350

Pro Leu Ser Pro Val Gln Val Gln Ile Gln Ile Leu Thr Ala Pro Ala

355 360 365

Ala Ser Asn Thr Phe Thr Val Gln Gly Ala Pro Leu Leu Leu Thr Pro

370 375 380

Ala Phe Ala Ala Ile Ala Ile Gly Ser Thr Ala Ser Gly Ile Ile Pro

385 390 395 400

Glu Ala Ile Pro Val Val Ala Gly Asp Lys Ile Leu Leu Tyr Val Ser

405 410 415

Leu Thr Ala Ala Ser Pro Ile Ala Ala Val Ala Gly Phe Val Ser Ala

420 425 430

Gly Ile Asn Ile Val

435

<210> 80

<211> 119

<212> Protein

<213> Bacillus anthracis

<400> 80

Met Leu Phe Thr Ser Trp Leu Leu Phe Phe Ile Phe Ala Leu Ala Ala

1 5 10 15

Phe Arg Leu Thr Arg Leu Ile Val Tyr Asp Lys Ile Thr Gly Phe Leu

20 25 30

Arg Arg Pro Phe Ile Asp Glu Leu Glu Ile Thr Glu Pro Asp Gly Ser

35 40 45

Val Ser Thr Phe Thr Lys Val Lys Gly Lys Gly Leu Arg Lys Trp Ile

50 55 60

Gly Glu Leu Leu Ser Cys Tyr Trp Cys Thr Gly Val Trp Val Ser Ala

65 70 75 80

Phe Leu Leu Val Leu Tyr Asn Trp Ile Pro Ile Val Ala Glu Pro Leu

85 90 95

Leu Ala Leu Leu Ala Ile Ala Gly Ala Ala Ala Ile Ile Glu Thr Ile

100 105 110

Thr Gly Tyr Phe Met Gly Glu

115

<210> 81

<211> 61

<212> Protein

<213> Bacillus anthracis

<400> 81

Met Phe Ala Val Ser Asn Asn Pro Arg Gln Asn Ser Tyr Asp Leu Gln

1 5 10 15

Gln Trp Tyr His Met Gln Gln Gln His Gln Ala Gln Gln Gln Ala Tyr

20 25 30

Gln Glu Gln Leu Gln Gln Gln Gly Phe Val Lys Lys Lys Gly Cys Asn

35 40 45

Cys Gly Lys Lys Lys Ser Thr Ile Lys His Tyr Glu Glu

50 55 60

<210> 82

<211> 481

<212> Protein

<213> Bacillus anthracis

<400> 82

Met Ser Arg Tyr Asp Asp Ser Gln Asn Lys Phe Ser Lys Pro Cys Phe

1 5 10 15

Pro Ser Ser Ala Gly Arg Ile Pro Asn Thr Pro Ser Ile Pro Val Thr

20 25 30

Lys Ala Gln Leu Arg Thr Phe Arg Ala Ile Ile Ile Asp Leu Thr Lys

35 40 45

Ile Ile Pro Lys Leu Phe Ala Asn Pro Ser Pro Gln Asn Ile Glu Asp

50 55 60

Leu Ile Asp Thr Leu Asn Leu Leu Ser Lys Phe Ile Cys Ser Leu Asp

65 70 75 80

Ala Ala Ser Ser Leu Lys Ala Gln Gly Leu Ala Ile Ile Lys Asn Leu

85 90 95

Ile Thr Ile Leu Lys Asn Pro Thr Phe Val Ala Ser Ala Val Phe Ile

100 105 110

Glu Leu Gln Asn Leu Ile Asn Tyr Leu Leu Ser Ile Thr Lys Leu Phe

115 120 125

Arg Ile Asp Pro Cys Thr Leu Gln Glu Leu Leu Lys Leu Ile Ala Ala

130 135 140

Leu Gln Thr Ala Leu Val Asn Ser Ala Ser Phe Ile Gln Gly Pro Thr

145 150 155 160

Gly Pro Thr Gly Pro Thr Gly Pro Thr Gly Pro Ala Gly Ala Thr Gly

165 170 175

Ala Thr Gly Pro Gln Gly Val Gln Gly Pro Ala Gly Ala Thr Gly Ala

180 185 190

Thr Gly Pro Gln Gly Val Gln Gly Pro Ala Gly Ala Thr Gly Ala Thr

195 200 205

Gly Pro Gln Gly Ala Gln Gly Pro Ala Gly Ala Thr Gly Ala Thr Gly

210 215 220

Pro Gln Gly Ala Gln Gly Pro Ala Gly Ala Thr Gly Ala Thr Gly Pro

225 230 235 240

Gln Gly Ile Gln Gly Pro Ala Gly Ala Thr Gly Ala Thr Gly Pro Gln

245 250 255

Gly Val Gln Gly Pro Thr Gly Ala Thr Gly Ile Gly Val Thr Gly Pro

260 265 270

Thr Gly Pro Ser Gly Gly Pro Ala Gly Ala Thr Gly Pro Gln Gly Pro

275 280 285

Gln Gly Asn Thr Gly Ala Thr Gly Pro Gln Gly Ile Gln Gly Pro Ala

290 295 300

Gly Ala Thr Gly Ala Thr Gly Pro Gln Gly Ala Gln Gly Pro Ala Gly

305 310 315 320

Ala Thr Gly Ala Thr Gly Pro Gln Gly Val Gln Gly Pro Thr Gly Ala

325 330 335

Thr Gly Ile Gly Val Thr Gly Pro Thr Gly Pro Ser Gly Pro Ser Phe

340 345 350

Pro Val Ala Thr Ile Val Val Thr Asn Asn Ile Gln Gln Thr Val Leu

355 360 365

Gln Phe Asn Asn Phe Ile Phe Asn Thr Ala Ile Asn Val Asn Asn Ile

370 375 380

Ile Phe Asn Gly Thr Asp Thr Val Thr Val Ile Asn Ala Gly Ile Tyr

385 390 395 400

Val Ile Ser Val Ser Ile Ser Thr Thr Ala Pro Gly Cys Ala Pro Leu

405 410 415

Gly Val Gly Ile Ser Ile Asn Gly Ala Val Ala Thr Asp Asn Phe Ser

420 425 430

Ser Asn Leu Ile Gly Asp Ser Leu Ser Phe Thr Thr Ile Glu Thr Leu

435 440 445

Thr Ala Gly Ala Asn Ile Ser Val Gln Ser Thr Leu Asn Glu Ile Thr

450 455 460

Ile Pro Ala Thr Gly Asn Thr Asn Ile Arg Leu Thr Val Phe Arg Ile

465 470 475 480

Ala

<210> 83

<211> 275

<212> Protein

<213> Bacillus thuringiensis

<400> 83

Met Lys Met Lys Arg Gly Ile Thr Thr Leu Leu Ser Val Ala Val Leu

1 5 10 15

Ser Thr Ser Leu Val Ala Cys Ser Gly Ile Thr Glu Lys Thr Val Ala

20 25 30

Lys Glu Glu Lys Val Lys Leu Thr Asp Gln Gln Leu Met Ala Asp Leu

35 40 45

Trp Tyr Gln Thr Ala Gly Glu Met Lys Ala Leu Tyr Tyr Gln Gly Tyr

50 55 60

Asn Ile Gly Gln Leu Lys Leu Asp Ala Val Leu Ala Lys Gly Thr Glu

65 70 75 80

Lys Lys Pro Ala Ile Val Leu Asp Leu Asp Glu Thr Val Leu Asp Asn

85 90 95

Ser Pro His Gln Ala Met Ser Val Lys Thr Gly Lys Gly Tyr Pro Tyr

100 105 110

Lys Trp Asp Asp Trp Ile Asn Lys Ala Glu Ala Glu Ala Leu Pro Gly

115 120 125

Ala Ile Asp Phe Leu Lys Tyr Thr Glu Ser Lys Gly Val Asp Ile Tyr

130 135 140

Tyr Ile Ser Asn Arg Lys Thr Asn Gln Leu Asp Ala Thr Ile Lys Asn

145 150 155 160

Leu Glu Arg Val Gly Ala Pro Gln Ala Thr Lys Glu His Ile Leu Leu

165 170 175

Gln Asp Pro Lys Glu Lys Gly Lys Glu Lys Arg Arg Glu Leu Val Ser

180 185 190

Gln Thr His Asp Ile Val Leu Phe Phe Gly Asp Asn Leu Ser Asp Phe

195 200 205

Thr Gly Phe Asp Gly Lys Ser Val Lys Asp Arg Asn Gln Ala Val Ala

210 215 220

Asp Ser Lys Ala Gln Phe Gly Glu Lys Phe Ile Ile Phe Pro Asn Pro

225 230 235 240

Met Tyr Gly Asp Trp Glu Gly Ala Leu Tyr Asp Tyr Asp Phe Lys Lys

245 250 255

Ser Asp Ala Glu Lys Asp Lys Ile Arg Arg Asp Asn Leu Lys Ser Phe

260 265 270

Asp Thr Lys

275

<210> 84

<211> 795

<212> Protein

<213> Bacillus thuringiensis

<400> 84

Met Lys Lys Lys Lys Lys Leu Lys Pro Leu Ala Val Leu Thr Thr Ala

1 5 10 15

Ala Val Leu Ser Ser Thr Phe Ala Phe Gly Gly His Ala Ala Tyr Ala

20 25 30

Glu Thr Pro Thr Ser Ser Leu Pro Ile Asp Glu His Leu Ile Pro Glu

35 40 45

Glu Arg Leu Ala Glu Ala Leu Lys Gln Arg Gly Val Ile Asp Gln Ser

50 55 60

Ala Ser Gln Ala Glu Thr Ser Lys Ala Val Glu Lys Tyr Val Glu Lys

65 70 75 80

Lys Lys Gly Glu Asn Pro Gly Lys Glu Ile Leu Thr Gly Asp Ser Leu

85 90 95

Thr Gln Glu Ala Ser Asp Phe Met Lys Lys Val Lys Asp Ala Lys Met

100 105 110

Arg Glu Asn Glu Gln Ala Gln Gln Pro Glu Val Gly Pro Val Ala Gly

115 120 125

Gln Gly Ala Ala Leu Asn Pro Gly Lys Leu Asn Gly Lys Val Pro Thr

130 135 140

Thr Ser Ala Lys Gln Glu Glu Tyr Asn Gly Ala Val Arg Lys Asp Lys

145 150 155 160

Val Leu Val Leu Leu Val Glu Phe Ser Asp Phe Lys His Asn Asn Ile

165 170 175

Asp Gln Glu Pro Gly Tyr Met Tyr Ser Lys Asp Phe Asn Arg Glu His

180 185 190

Tyr Gln Lys Met Leu Phe Gly Asp Glu Pro Phe Thr Leu Phe Asp Gly

195 200 205

Ser Lys Ile Asn Thr Phe Lys Gln Tyr Tyr Glu Glu Gln Ser Gly Gly

210 215 220

Ser Tyr Thr Val Asp Gly Thr Val Thr Glu Trp Leu Thr Val Pro Gly

225 230 235 240

Lys Ala Ser Asp Tyr Gly Ala Asp Ala Gly Thr Gly His Asp Asn Lys

245 250 255

Gly Pro Leu Gly Pro Lys Asp Leu Val Lys Glu Ala Leu Lys Ala Ala

260 265 270

Val Ala Lys Gly Ile Asn Leu Ala Asp Phe Asp Gln Tyr Asp Gln Tyr

275 280 285

Asp Gln Asn Gly Asn Gly Asn Lys Asn Glu Pro Asp Gly Ile Ile Asp

290 295 300

His Leu Met Val Val His Ala Gly Val Gly Gln Glu Ala Gly Gly Gly

305 310 315 320

Lys Leu Lys Asp Asp Ala Ile Trp Ser His Arg Ser Lys Leu Gly Ser

325 330 335

Lys Pro Tyr Ala Ile Asp Gly Thr Lys Ser Ser Val Ser Asn Trp Gly

340 345 350

Gly Lys Met Ala Ala Tyr Asp Tyr Thr Ile Glu Pro Glu Asp Gly Ala

355 360 365

Val Gly Val Phe Ala His Glu Tyr Gly His Asp Leu Gly Leu Pro Asp

370 375 380

Glu Tyr Asp Thr Lys Tyr Ser Gly Gln Gly Glu Pro Val Glu Ser Trp

385 390 395 400

Ser Ile Met Ser Gly Gly Ser Trp Ala Gly Lys Ile Ala Gly Thr Glu

405 410 415

Pro Thr Ser Phe Ser Pro Gln Asn Lys Glu Phe Phe Gln Lys Asn Met

420 425 430

Lys Gly Asn Trp Ala Asn Ile Leu Glu Val Asp Tyr Asp Lys Leu Ser

435 440 445

Lys Gly Ile Gly Val Ala Thr Tyr Val Asp Gln Ser Thr Thr Lys Ser

450 455 460

Lys Arg Pro Gly Ile Val Arg Val Asn Leu Pro Asp Lys Asp Ile Lys

465 470 475 480

Asn Ile Glu Ser Ala Phe Gly Lys Lys Phe Tyr Tyr Ser Thr Lys Gly

485 490 495

Asn Asp Ile His Thr Thr Leu Glu Thr Pro Val Phe Asp Leu Thr Asn

500 505 510

Ala Lys Asp Ala Lys Phe Asp Tyr Lys Ala Phe Tyr Glu Leu Glu Ala

515 520 525

Lys Tyr Asp Phe Leu Asp Val Tyr Ala Ile Ala Glu Asp Gly Thr Lys

530 535 540

Thr Arg Ile Asp Arg Met Gly Glu Lys Asp Ile Lys Gly Gly Ala Asp

545 550 555 560

Thr Thr Asp Gly Lys Trp Val Asp Lys Ser Tyr Asp Leu Ser Gln Phe

565 570 575

Lys Gly Lys Lys Val Lys Leu Gln Phe Glu Tyr Leu Thr Asp Ile Ala

580 585 590

Val Ala Tyr Lys Gly Phe Ala Leu Asp Asn Ala Ala Leu Thr Val Asp

595 600 605

Gly Lys Val Val Phe Ser Asp Asp Ala Glu Gly Gln Pro Ala Met Thr

610 615 620

Leu Lys Gly Phe Thr Val Ser Asn Gly Phe Glu Gln Lys Lys His Asn

625 630 635 640

Tyr Tyr Val Glu Trp Arg Asn Tyr Ala Gly Ser Asp Thr Ala Leu Gln

645 650 655

Tyr Ala Arg Gly Pro Val Phe Asn Thr Gly Met Val Val Trp Tyr Ala

660 665 670

Asp Gln Ser Phe Thr Asp Asn Trp Val Gly Val His Pro Gly Glu Gly

675 680 685

Phe Leu Gly Val Val Asp Ser His Pro Glu Ala Ile Val Gly Thr Leu

690 695 700

Asn Gly Gln Pro Thr Val Lys Ser Ser Thr Arg Tyr Gln Ile Ala Asp

705 710 715 720

Ala Ala Phe Ser Phe Asp Gln Thr Pro Ala Trp Lys Val Asn Ser Pro

725 730 735

Thr Arg Gly Ile Phe Asp Tyr Lys Gly Leu Pro Gly Val Ala Lys Phe

740 745 750

Asp Asp Ser Lys Gln Tyr Ile Asn Ser Val Ile Pro Asp Ala Gly Arg

755 760 765

Lys Leu Pro Lys Leu Gly Leu Lys Phe Glu Val Val Gly Gln Ala Glu

770 775 780

Asp Lys Ser Ala Gly Ala Val Trp Leu His Arg

785 790 795

<210> 85

<211> 169

<212> DNA

<213> Bacillus anthracis

<400> 85

taatcaccct cttccaaatc aatcatatgt tatacatata ctaaactttc cattttttta 60

aattgttcaa gtagtttaag atttcttttc aataattcaa atgtccgtgt cattttcttt 120

cggttttgca tctactatat aatgaacgct ttatggaggt gaatttatg 169

<210> 86

<211> 303

<212> DNA

<213> Bacillus anthracis

<400> 86

atttatttca ttcaattttt cctatttagt acctaccgca ctcacaaaaa gcacctctca 60

ttaatttata ttatagtcat tgaaatctaa tttaatgaaa tcatcatact atatgtttta 120

taagaagtaa aggtaccata cttaattaat acatatctat acacttcaat atcacagcat 180

gcagttgaat tatatccaac tttcatttca aattaaataa gtgcctccgc tattgtgaat 240

gtcatttact ctccctacta catttaataa ttatgacaag caatcatagg aggttactac 300

atg 303

<210> 87

<211> 173

<212> DNA

<213> Bacillus anthracis

<400> 87

aattacataa caagaactac attagggagc aagcagtcta gcgaaagcta actgcttttt 60

tattaaataa ctattttatt aaatttcata tatacaatcg cttgtccatt tcatttggct 120

ctacccacgc atttactatt agtaatatga atttttcaga ggtggatttt att 173

<210> 88

<211> 124

<212> DNA

<213> Bacillus weihenstephensis

<400> 88

ctatgattta agatacacaa tagcaaaaga gaaacatatt atataacgat aaatgaaact 60

tatgtatatg tatggtaact gtatatatta ctacaataca gtatactcat aggaggtagg 120

tatg 124

<210> 89

<211> 376

<212> DNA

<213> Bacillus weihenstephensis

<400> 89

ggtaggtaga tttgaaatat gatgaagaaa aggaataact aaaaggagtc gatatccgac 60

tccttttagt tataaataat gtggaattag agtataattt tatataggta tattgtatta 120

gatgaacgct ttatccttta attgtgatta atgatggatt gtaagagaag gggcttacag 180

tccttttttt atggtgttct ataagccttt ttaaaagggg taccacccca cacccaaaaa 240

cagggggggt tataactaca tattggatgt tttgtaacgt acaagaatcg gtattaatta 300

ccctgtaaat aagttatgtg tatataaggt aactttatat attctcctac aataaaataa 360

aggaggtaat aaagtg 376

<210> 90

<211> 225

<212> DNA

<213> Bacillus thuringiensis

<400> 90

aacccttaat gcattggtta aacattgtaa agtctaaagc atggataatg ggcgagaagt 60

aagtagattg ttaacaccct gggtcaaaaa ttgatattta gtaaaattag ttgcactttg 120

tgcatttttt cataagatga gtcatatgtt ttaaattgta gtaatgaaaa acagtattat 180

atcataatga attggtatct taataaaaga gatggaggta actta 225

<210> 91

<211> 125

<212> DNA

<213> Bacillus thuringiensis

<400> 91

taattccacc ttcccttatc ctctttcgcc tatttaaaaa aaggtcttga gattgtgacc 60

aaatctcctc aactccaata tcttattaat gtaaatacaa acaagaagat aaggagtgac 120

attaa 125

<210> 92

<211> 144

<212> DNA

<213> Bacillus thuringiensis

<400> 92

aggatgtctt tttttatatt gtattatgta catccctact atataaattc cctgctttta 60

tcgtaagaat taacgtaata tcaaccatat cccgttcata ttgtagtagt gtatgtcaga 120

actcacgaga aggagtgaac ataa 144

<210> 93

<211> 126

<212> DNA

<213> Bacillus thuringiensis

<400> 93

ttaatgtcac tccttatctt cttgtttgta tttacattaa taagatattg gagttgagga 60

gatttggtca caatctcaag accttttttt taaataggcg aaagaggata agggaaggtg 120

gaatta 126

<210> 94

<211> 103

<212> DNA

<213> Bacillus thuringiensis

<400> 94

atatattttc ataatacgag aaaaagcgga gtttaaaaga atgagggaac ggaaataaag 60

agttgttcat atagtaaata gacagaattg acagtagagg aga 103

<210> 95

<211> 169

<212> DNA

<213> Bacillus thuringiensis

<400> 95

aaactaaata atgagctaag catggattgg gtggcagaat tatctgccac ccaatccatg 60

cttaacgagt attattatgt aaatttctta aaattgggaa cttgtctaga acatagaacc 120

tgtccttttc attaactgaa agtagaaaca gataaaggag tgaaaaaca 169

<210> 96

<211> 111

<212> DNA

<213> Bacillus thuringiensis

<400> 96

attcactaca acggggatga gtttgatgcg gatacatatg agaagtaccg gaaagtgttt 60

gtagaacatt acaaagatat attatctcca tcataaagga gagatgcaaa g 111

<210> 97

<211> 273

<212> DNA

<213> Bacillus anthracis

<400> 97

cgcgcaccac ttcgtcgtac aacaacgcaa gaagaagttg gggatacagc agtattctta 60

ttcagtgatt tagcacgcgg cgtaacagga gaaaacattc acgttgattc agggtatcat 120

atcttaggat aaatataata ttaattttaa aggacaatct ctacatgttg agattgtcct 180

ttttatttgt tcttagaaag aacgattttt aacgaaagtt cttaccacgt tatgaatata 240

agtataatag tacacgattt attcagctac gta 273

<210> 98

<211> 303

<212> DNA

<213> Bacillus anthracis

<400> 98

tgaagtatct agagctaatt tacgcaaagg aatctcagga caacactttc gcaacaccta 60

tattttaaat ttaataaaaa aagagactcc ggagtcagaa attataaagc tagctgggtt 120

caaatcaaaa atttcactaa aacgatatta tcaatacgca gaaaatggaa aaaacgcctt 180

atcataaggc gttttttcca ttttttcttc aaacaaacga ttttactatg accatttaac 240

taatttttgc atctactatg atgagtttca ttcacattct cattagaaag gagagattta 300

atg 303

<210> 99

<211> 240

<212> DNA

<213> Bacillus anthracis

<400> 99

tatatcatat gtaaaattag ttcttattcc cacatatcat atagaatcgc catattatac 60

atgcagaaaa ctaagtatgg tattattctt aaattgttta gcaccttcta atattacaga 120

tagaatccgt cattttcaac agtgaacatg gatttcttct gaacacaact ctttttcttt 180

ccttatttcc aaaaagaaaa gcagcccatt ttaaaatacg gctgcttgta atgtacatta 240

<210> 100

<211> 267

<212> DNA

<213> Bacillus thuringiensis

<400> 100

tatcacataa ctctttattt ttaatatttc gacataaagt gaaactttaa tcagtggggg 60

ctttgttcat ccccccactg attattaatt gaaccaaggg ataaaaagat agagggtctg 120

accagaaaac tggagggcat gattctataa caaaaagctt aatgtttata gaattatgtc 180

tttttatata gggagggtag taaacagaga tttggacaaa aatgcaccga tttatctgaa 240

ttttaagttt tataaagggg agaaatg 267

<210> 101

<211> 124

<212> DNA

<213> Bacillus thuringiensis

<400> 101

attttttact tagcagtaaa actgatatca gttttactgc tttttcattt ttaaattcaa 60

tcattaaatc ttccttttct acatagtcat aatgttgtat gacattccgt aggaggcact 120

tata 124

<210> 102

<211> 170

<212> DNA

<213> Bacillus thuringiensis

<400> 102

acataaattc acctccataa agcgttcatt atatagtaga tgcaaaaccg aaagaaaatg 60

acacggacat ttgaattatt gaaaagaaat cttaaactac ttgaacaatt taaaaaaatg 120

gaaagtttag tatatgtata acatatgatt gatttggaag agggtgatta 170

<210> 103

<211> 212

<212> DNA

<213> Bacillus thuringiensis

<400> 103

ttctattttc caacataaca tgctacgatt aaatggtttt ttgcaaatgc cttcttggga 60

agaaggatta gagcgttttt ttatagaaac caaaagtcat taacaatttt aagttaatga 120

cttttttgtt tgcctttaag aggttttatg ttactataat tatagtatca ggtactaata 180

acaagtataa gtatttctgg gaggatatat ca 212

<210> 104

<211> 1500

<212> DNA

<213> Bacillus subtilis

<400> 104

atgaaacggt caatctcgat ttttattacg tgtttattga ttacgttatt gacaatgggc 60

ggcatgatag cttcgccggc atcagcagca gggacaaaaa cgccagtagc caagaatggc 120

cagcttagca taaaaggtac acagctcgtt aaccgagacg gtaaagcggt acagctgaag 180

gggatcagtt cacacggatt gcaatggtat ggagaatatg tcaataaaga cagcttaaaa 240

tggctgagag atgattgggg tatcaccgtt ttccgtgcag cgatgtatac ggcagatggc 300

ggttatattg acaacccgtc cgtgaaaaat aaagtaaaag aagcggttga agcggcaaaa 360

gagcttggga tatatgtcat cattgactgg catatcttaa atgacggtaa tccaaaccaa 420

aataaagaga aggcaaaaga attcttcaag gaaatgtcaa gcctttacgg aaacacgcca 480

aacgtcattt atgaaattgc aaacgaacca aacggtgatg tgaactggaa gcgtgatatt 540

aaaccatatg cggaagaagt gatttcagtt atccgcaaaa atgatccaga caacatcatc 600

attgtcggaa ccggtacatg gagccaggat gtgaatgatg ctgccgatga ccagctaaaa 660

gatgcaaacg ttatgtacgc acttcatttt tatgccggca cacacggcca atttttacgg 720

gataaagcaa actatgcact cagcaaagga gcacctattt ttgtgacaga gtggggaaca 780

agcgacgcgt ctggcaatgg cggtgtattc cttgatcaat cgagggaatg gctgaaatat 840

ctcgacagca agaccattag ctgggtgaac tggaatcttt ctgataagca ggaatcatcc 900

tcagctttaa agccgggggc atctaaaaca ggcggctggc ggttgtcaga tttatctgct 960

tcaggaacat tcgttagaga aaacattctc ggcaccaaag attcgacgaa ggacattcct 1020

gaaacgccat caaaagataa acccacacag gaaaatggta tttctgtaca gtacagagca 1080

ggggatggga gtatgaacag caaccaaatc cgtccgcagc ttcaaataaa aaataacggc 1140

aataccacgg ttgatttaaa agatgtcact gcccgttact ggtataaagc gaaaaacaaa 1200

ggccaaaact ttgactgtga ctacgcgcag attggatgcg gcaatgtgac acacaagttt 1260

gtgacgttgc ataaaccaaa gcaaggtgca gatacctatc tggaacttgg atttaaaaac 1320

ggaacgttgg caccgggagc aagcacaggg aatattcagc tccgtcttca caatgatgac 1380

tggagcaatt atgcacaaag cggcgattat tcctttttca aatcaaatac gtttaaaaca 1440

acgaaaaaaa tcacattata tgatcaagga aaactgattt ggggaacaga accaaattag 1500

<210> 105

<211> 852

<212> DNA

<213> Bacillus thuringiensis

<400> 105

atgaaaaaga aagtacttgc tttagcggca gctattacat tggttgctcc attacaaagt 60

gttgcatttg ctcatgaaaa tgatggggga cagagatttg gagttattcc gcgctggtct 120

gctgaagata aacataaaga aggcgtgaat tctcatttat ggattgtaaa tcgtgcaatt 180

gatattatgt ctcgtaatac aacacttgta aaacaagatc gagttgcact attaaatgaa 240

tggcgtactg agttagagaa cggtatttat gctgctgact atgaaaatcc ttattatgat 300

aatagcacat ttgcttcaca tttctatgac cctgacaatg ggaaaactta tattccgtat 360

gcaaagcagg caaaggaaac tggagctaaa tattttaaat tagctggtga gtcttacaaa 420

aataaagata tgcaacaagc attcttctat ttaggattat ctcttcatta tctaggggat 480

gtaaaccaac cgatgcatgc agcaaacttt acaaaccttt cgtatccaca agggttccat 540

tctaaatatg aaaactttgt agatacgata aaagataact ataaagtaac ggatggaaat 600

ggatattgga actggaaagg tacgaatcca gaagattgga ttcatggagc ggcagtagtt 660

gcgaaacaag attacgctgg cattgtaaat gataatacga aagattggtt cgtgagagct 720

gctgtatcac aagaatatgc agataaatgg cgcgctgaag ttacaccaat gacaggtaag 780

cgtttaatgg atgcacaacg tgttactgct ggatatattc agctttggtt tgatacgtac 840

ggagatcgtt aa 852

<210> 106

<211> 729

<212> DNA

<213> Bacillus subtilis

<400> 106

gcgggactga ataaagatca aaagcgccgg gcggaacagc tgacaagtat ctttgaaaac 60

ggcacaacgg agatccaata tggatatgta gagcgattgg atgacgggcg aggctataca 120

tgcggacggg caggctttac aacggctacc ggggatgcat tggaagtagt ggaagtatac 180

acaaaggcag ttccgaataa caaactgaaa aagtatctgc ctgaattgcg ccgtctggcc 240

aaggaagaaa gcgatgatac aagcaatctc aagggattcg cttctgcctg gaagtcgctt 300

gcaaatgata aggaatttcg cgccgctcaa gacaaagtaa atgaccattt gtattatcag 360

cctgccatga aacgatcgga taatgccgga ctaaaaacag cattggcaag agctgtgatg 420

tacgatacgg ttattcagca tggcgatggt gatgaccctg actcttttta tgccttgatt 480

aaacgtacga acaaaaaagc gggcggatca cctaaagacg gaatagacga gaagaagtgg 540

ttgaataaat tcttggacgt acgctatgac gatctgatga atccggccaa tcatgacacc 600

cgtgacgaat ggagagaatc agttgcccgt gtggacgtgc ttcgctctat cgccaaggag 660

aacaactata atctaaacgg accgattcat gttcgttcaa acgagtacgg taattttgta 720

atcaaataa 729

<210> 107

<211> 499

<212> Protein

<213> Bacillus subtilis

<400> 107

Met Lys Arg Ser Ile Ser Ile Phe Ile Thr Cys Leu Leu Ile Thr Leu

1 5 10 15

Leu Thr Met Gly Gly Met Ile Ala Ser Pro Ala Ser Ala Ala Gly Thr

20 25 30

Lys Thr Pro Val Ala Lys Asn Gly Gln Leu Ser Ile Lys Gly Thr Gln

35 40 45

Leu Val Asn Arg Asp Gly Lys Ala Val Gln Leu Lys Gly Ile Ser Ser

50 55 60

His Gly Leu Gln Trp Tyr Gly Glu Tyr Val Asn Lys Asp Ser Leu Lys

65 70 75 80

Trp Leu Arg Asp Asp Trp Gly Ile Thr Val Phe Arg Ala Ala Met Tyr

85 90 95

Thr Ala Asp Gly Gly Tyr Ile Asp Asn Pro Ser Val Lys Asn Lys Val

100 105 110

Lys Glu Ala Val Glu Ala Ala Lys Glu Leu Gly Ile Tyr Val Ile Ile

115 120 125

Asp Trp His Ile Leu Asn Asp Gly Asn Pro Asn Gln Asn Lys Glu Lys

130 135 140

Ala Lys Glu Phe Phe Lys Glu Met Ser Ser Leu Tyr Gly Asn Thr Pro

145 150 155 160

Asn Val Ile Tyr Glu Ile Ala Asn Glu Pro Asn Gly Asp Val Asn Trp

165 170 175

Lys Arg Asp Ile Lys Pro Tyr Ala Glu Glu Val Ile Ser Val Ile Arg

180 185 190

Lys Asn Asp Pro Asp Asn Ile Ile Ile Val Gly Thr Gly Thr Trp Ser

195 200 205

Gln Asp Val Asn Asp Ala Ala Asp Asp Gln Leu Lys Asp Ala Asn Val

210 215 220

Met Tyr Ala Leu His Phe Tyr Ala Gly Thr His Gly Gln Phe Leu Arg

225 230 235 240

Asp Lys Ala Asn Tyr Ala Leu Ser Lys Gly Ala Pro Ile Phe Val Thr

245 250 255

Glu Trp Gly Thr Ser Asp Ala Ser Gly Asn Gly Gly Val Phe Leu Asp

260 265 270

Gln Ser Arg Glu Trp Leu Lys Tyr Leu Asp Ser Lys Thr Ile Ser Trp

275 280 285

Val Asn Trp Asn Leu Ser Asp Lys Gln Glu Ser Ser Ser Ala Leu Lys

290 295 300

Pro Gly Ala Ser Lys Thr Gly Gly Trp Arg Leu Ser Asp Leu Ser Ala

305 310 315 320

Ser Gly Thr Phe Val Arg Glu Asn Ile Leu Gly Thr Lys Asp Ser Thr

325 330 335

Lys Asp Ile Pro Glu Thr Pro Ser Lys Asp Lys Pro Thr Gln Glu Asn

340 345 350

Gly Ile Ser Val Gln Tyr Arg Ala Gly Asp Gly Ser Met Asn Ser Asn

355 360 365

Gln Ile Arg Pro Gln Leu Gln Ile Lys Asn Asn Gly Asn Thr Thr Val

370 375 380

Asp Leu Lys Asp Val Thr Ala Arg Tyr Trp Tyr Lys Ala Lys Asn Lys

385 390 395 400

Gly Gln Asn Phe Asp Cys Asp Tyr Ala Gln Ile Gly Cys Gly Asn Val

405 410 415

Thr His Lys Phe Val Thr Leu His Lys Pro Lys Gln Gly Ala Asp Thr

420 425 430

Tyr Leu Glu Leu Gly Phe Lys Asn Gly Thr Leu Ala Pro Gly Ala Ser

435 440 445

Thr Gly Asn Ile Gln Leu Arg Leu His Asn Asp Asp Trp Ser Asn Tyr

450 455 460

Ala Gln Ser Gly Asp Tyr Ser Phe Phe Lys Ser Asn Thr Phe Lys Thr

465 470 475 480

Thr Lys Lys Ile Thr Leu Tyr Asp Gln Gly Lys Leu Ile Trp Gly Thr

485 490 495

Glu Pro Asn

<210> 108

<211> 283

<212> Protein

<213> Bacillus thuringiensis

<400> 108

Met Lys Lys Lys Val Leu Ala Leu Ala Ala Ala Ile Thr Leu Val Ala

1 5 10 15

Pro Leu Gln Ser Val Ala Phe Ala His Glu Asn Asp Gly Gly Gln Arg

20 25 30

Phe Gly Val Ile Pro Arg Trp Ser Ala Glu Asp Lys His Lys Glu Gly

35 40 45

Val Asn Ser His Leu Trp Ile Val Asn Arg Ala Ile Asp Ile Met Ser

50 55 60

Arg Asn Thr Thr Leu Val Lys Gln Asp Arg Val Ala Leu Leu Asn Glu

65 70 75 80

Trp Arg Thr Glu Leu Glu Asn Gly Ile Tyr Ala Ala Asp Tyr Glu Asn

85 90 95

Pro Tyr Tyr Asp Asn Ser Thr Phe Ala Ser His Phe Tyr Asp Pro Asp

100 105 110

Asn Gly Lys Thr Tyr Ile Pro Tyr Ala Lys Gln Ala Lys Glu Thr Gly

115 120 125

Ala Lys Tyr Phe Lys Leu Ala Gly Glu Ser Tyr Lys Asn Lys Asp Met

130 135 140

Gln Gln Ala Phe Phe Tyr Leu Gly Leu Ser Leu His Tyr Leu Gly Asp

145 150 155 160

Val Asn Gln Pro Met His Ala Ala Asn Phe Thr Asn Leu Ser Tyr Pro

165 170 175

Gln Gly Phe His Ser Lys Tyr Glu Asn Phe Val Asp Thr Ile Lys Asp

180 185 190

Asn Tyr Lys Val Thr Asp Gly Asn Gly Tyr Trp Asn Trp Lys Gly Thr

195 200 205

Asn Pro Glu Asp Trp Ile His Gly Ala Ala Val Val Ala Lys Gln Asp

210 215 220

Tyr Ala Gly Ile Val Asn Asp Asn Thr Lys Asp Trp Phe Val Arg Ala

225 230 235 240

Ala Val Ser Gln Glu Tyr Ala Asp Lys Trp Arg Ala Glu Val Thr Pro

245 250 255

Met Thr Gly Lys Arg Leu Met Asp Ala Gln Arg Val Thr Ala Gly Tyr

260 265 270

Ile Gln Leu Trp Phe Asp Thr Tyr Gly Asp Arg

275,280

<210> 109

<211> 244

<212> Protein

<213> Bacillus subtilis

<400> 109

Leu Glu Ala Gly Leu Asn Lys Asp Gln Lys Arg Arg Ala Glu Gln Leu

1 5 10 15

Thr Ser Ile Phe Glu Asn Gly Thr Thr Glu Ile Gln Tyr Gly Tyr Val

20 25 30

Glu Arg Leu Asp Asp Gly Arg Gly Tyr Thr Cys Gly Arg Ala Gly Phe

35 40 45

Thr Thr Ala Thr Gly Asp Ala Leu Glu Val Val Glu Val Tyr Thr Lys

50 55 60

Ala Val Pro Asn Asn Lys Leu Lys Lys Tyr Leu Pro Glu Leu Arg Arg

65 70 75 80

Leu Ala Lys Glu Glu Ser Asp Asp Thr Ser Asn Leu Lys Gly Phe Ala

85 90 95

Ser Ala Trp Lys Ser Leu Ala Asn Asp Lys Glu Phe Arg Ala Ala Gln

100 105 110

Asp Lys Val Asn Asp His Leu Tyr Tyr Gln Pro Ala Met Lys Arg Ser

115 120 125

Asp Asn Ala Gly Leu Lys Thr Ala Leu Ala Arg Ala Val Met Tyr Asp

130 135 140

Thr Val Ile Gln His Gly Asp Gly Asp Asp Pro Asp Ser Phe Tyr Ala

145 150 155 160

Leu Ile Lys Arg Thr Asn Lys Lys Ala Gly Gly Ser Pro Lys Asp Gly

165 170 175

Ile Asp Glu Lys Lys Trp Leu Asn Lys Phe Leu Asp Val Arg Tyr Asp

180 185 190

Asp Leu Met Asn Pro Ala Asn His Asp Thr Arg Asp Glu Trp Arg Glu

195 200 205

Ser Val Ala Arg Val Asp Val Leu Arg Ser Ile Ala Lys Glu Asn Asn

210 215 220

Tyr Asn Leu Asn Gly Pro Ile His Val Arg Ser Asn Glu Tyr Gly Asn

225 230 235 240

Phe val ile lys

<---

Claims (29)

1. Composition for enhancing plant growth and promoting plant vitality, containing: a) recombinant exospore-producing Bacillus cells from the Bacillus cereus family that express a fusion protein comprising: (I) at least one protein or peptide selected from the group consisting of an endoglucanase having a sequence at least 85% identical to SEQ ID NO: 107, and a phospholipase having a sequence at least 85% identical to SEQ ID NO: 108; and (Ii) a targeting sequence, exospore protein, or exospore protein fragment, wherein the targeting sequence, exospore protein, or exospore protein fragment comprises: - an amino acid sequence having at least 43% identity with amino acids 20–35 of SEQ ID NO: 1, where the identity with amino acids 25–35 is at least 54%; - amino acids 1-35 of SEQ ID NO: 1; - amino acids 20-35 of SEQ ID NO: 1; - amino acids 22-31 of SEQ ID NO: 1; - amino acids 22-33 of SEQ ID NO: 1; - amino acids 20-31 of SEQ ID NO: 1; - the amino acid sequence from SEQ ID NO: 1; or - an amino acid sequence having at least 85% identity with SEQ ID NO: 2; and b) at least one biological control agent selected from the group consisting of Bacillus subtilis QST713 and Bacillus firmus I-1582 in a synergistically effective amount, wherein synergism occurs between a) and b) and wherein a synergistic weight ratio of recombinant exospory producing Bacillus cells and at least one biological control agent is in the range from 1: 1000 to 1000: 1. 2. A composition according to claim 1, wherein the member of the Bacillus cereus family is selected from the group consisting of Bacillus anthracis , Bacillus cereus , Bacillus thuringiensis , Bacillus mycoides , Bacillus pseudomycoides , Bacillus samanii, Bacillus gaemokensis, Bacillhensus weihenstep combinations thereof. 3. The composition of claim 1, wherein the fusion protein comprises an endoglucanase having a sequence of at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 107. 4. The composition of claim 1, wherein the recombinant Bacillus cells are derived from Bacillus thuringiensis BT013A. 5. The composition of claim 1, wherein the fusion protein comprises a phospholipase having a sequence of at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ 15 ID NO: 108. 6. Composition according to any one of paragraphs. 1-5, where the fusion protein is expressed under the control of a sporulation promoter native to the targeting sequence, an exospore protein, or an exospore protein fragment of the fusion protein. 7. Composition according to any one of paragraphs. 1-6, where the fusion protein is expressed under the control of a highly expressed sporulation promoter. 8. The composition of claim 7, wherein the highly expressed sporulation promoter comprises a sporulation-specific sigma-K polymerase promoter sequence. 9. Composition according to any one of paragraphs. 6-8, wherein the sporulation promoter comprises a nucleotide sequence having at least 80% identity with any nucleotide sequence from SEQ ID NOs: 85-03. 10. Seed for germination of plants, coated with a composition according to any one of claims. 1-9. 11. Use of a composition according to any one of claims 1 to 9 for enhancing plant growth. 12. Use according to claim 11, wherein the composition is applied to conventional or transgenic plants or their seeds. 13. A method of treating a plant, part of a plant, or a locus surrounding a plant to enhance plant growth, comprising the step of simultaneously or sequentially applying a composition according to claim 1 on a plant, part of a plant, or a locus of plant growth. 14. A composition according to claim 1, wherein the fusion protein comprises SEQ ID NO: 107; the targeting sequence includes amino acids 20-35 of SEQ ID NO: 1; and Bacillus cells are of Bacillus thuringiensis BT013A origin. 15. The composition according to claim 1, where the fusion protein comprises SEQ ID NO: 108; the targeting sequence includes amino acids 20-35 of SEQ ID NO: 1; and Bacillus cells are of Bacillus thuringiensis BT013A origin. 16. A method of treating a plant, a part of a plant, or a locus surrounding a plant to promote plant vitality, comprising the step of simultaneously or sequentially applying a composition according to claim 1 on a plant, a part of a plant, or a locus of plant growth. 17. The use of a composition according to any one of paragraphs. 1-9 to promote plant vitality.

Images