RU2734484C1 - Method for non-invasive prenatal diagnostics of trisomy and a set for it - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention refers to biotechnology, particularly to clinical-laboratory diagnostics in the field of prenatal non-invasive diagnostics, and can be used for detection of trisomy on 21st chromosome in the early pregnancy (starting from 8th obstetric week of gestation).

EFFECT: technical result of the proposed method is non-invasive diagnosis of trisomy on 21st chromosome of the fetus, having high sensitivity (possibility of quantitative analysis at low concentrations of fetal DNA, starting from 6th week – not less than 0_7 copies/mcl); absence of risk of pregnancy termination due to absence of invasive contact with fetal tissues; simple application and interpretation of results in clinical diagnostic laboratories due to the absence of need for bioinformatic analysis; self-monitoring system both at the ssDNA restriction step, and at the stage of direct comparison of levels of 21st and the reference chromosomes.

5 cl, 9 dwg, 3 tbl, 2 ex

Description

The technical field to which the invention relates

The present invention relates to medicine, in particular to clinical and laboratory diagnostics in the field of prenatal non-invasive diagnostics, and can be used to detect trisomy on chromosome 21 in a fetus at an early stage of pregnancy (starting from the 8th obstetric week of gestation).

State of the art

Down syndrome (trisomy on the 21st chromosome) is a genomic pathology in which in most cases the patient's karyotype is represented by 47 chromosomes, while normally only 46 chromosomes are present in the cell nucleus, an increase in the number of chromosomes is due to the appearance of an extra (third) 21 th chromosome [Asim A. et al. Down syndrome: an insight of the disease // J. Biomed. Sci. 2015. T. 22. No. 1. P. 41]. There are also additional forms of this disease: translocation of a section of chromosome 21 to other chromosomes (more often to chromosomes 14, 15, 21, 22, Y), a mosaic variant.

Down syndrome is a very common pathology - on average, 700 pregnancies have 1 trisomy on the 21st chromosome [Presson A.R. et al. Current estimate of down syndrome population prevalence in the United States // J. Pediatr. 2013. T. 163. No. 4. C. 1163-1168]. However, due to the development of prenatal diagnostics, the birth rate of children with this pathology is currently at the level of 1: 1100, since with a prenatal diagnosis of trisomy on chromosome 21, pregnant women are encouraged to terminate the pregnancy. Factors affecting the likelihood of developing trisomy on chromosome 21 include the age of the father and mother, as well as trisomy on chromosome 21 in past pregnancies. So, with a mother's age of 20-24 years, the probability of developing trisomy on chromosome 21 is 1: 1562, with a mother's age of 25-29 years - 1: 1000, while with a mother's age over 45 years old - 1:19. Also, the age of the father over 42 years old significantly increases the risk of developing this pathology.

Fetal DNA (cfDNA) circulating in the peripheral blood of the mother was discovered in 1997 [Lo Y.M.D. et al. Presence of fetal DNA in maternal plasma and serum // Lancet. 1997. T. 350. No. 9076. C. 485-487]. The genetic material of the fetus enters the maternal blood vessels during the physiological cycle of apoptosis in the placenta, which is necessary for trophoblast renewal. cfDNA has unique properties that distinguish it from circulating maternal DNA and, in a way, complicate its laboratory analysis: a high degree of fragmentation and a relatively low content in the blood compared to the mother's DNA (fraction). It is known that cfDNA fragments are mostly shorter than fragments of maternal circulating DNA [Chan K.C.A. et al. Size Distributions of Maternal and Fetal DNA in Maternal Plasma // Clin. Chem. 2004. T. 50. No. 1. S. 88-92]. It was also demonstrated that the average fraction of cfDNA in the 1st trimester of pregnancy is only 9%, and cfDNA begins to appear in the mother's blood already starting from the 4th week of pregnancy [Zhou Y. et al. Effects of Maternal and Fetal Characteristics on Cell -Free Fetal DNA Fraction in Maternal Plasma // Reprod. Sci. 2015. T. 22. No. 11. C. 1429-1435]. The features of cfDNA can also be attributed to a different from the maternal pattern of epigenetic regulation, in particular the degree of methylation of some gene promoters [Kim S.Y. et al. Quantification of the placental epigenetic signature of the SERPINB5 gene in maternal plasma of pregnancies complicated by small for gestational age // Placenta. 2015. T. 36. No. 2. S. 131-137]. Thus, cfDNA is not only a promising diagnostic material that does not require invasive examination of the embryonic tissue, but also has a number of features that can be used to separate it from the maternal circulating DNA.

It is known from the prior art that the standard method in the Russian Federation for testing for the presence of trisomy on the 21st chromosome in a pregnant woman is screenings of the first and second trimesters (11-14 and 16-21 weeks, respectively). As part of the first trimester screening, the amount of plasma protein A associated with pregnancy, the free β-subunit of human chorionic gonadotropin, is determined, as well as ultrasound examination. While in the framework of the second trimester screening, the levels of α-fetoprotein, free β-subunit of human chorionic gonadotropin, free estriol, as well as ultrasound examination are determined. Using this approach, it is possible to diagnose trisomy on chromosome 21 with a probability reaching only 70% with a false positive rate of 5% [Mujezinovic F., Alfirevic Z. Procedure-Related Complications of Amniocentesis and Chorionic Villous Sampling // Obstet. Gynecol. 2007. T. 110. No. 3. C. 687-694]. Therefore, the diagnosis must be verified using one of the invasive types of research, accompanied by fetal tissue sampling: chorionic villus aspiration (8-14 weeks), amniocentesis (14-18 weeks), cordocentesis (from the 18th week) [Tongsong T. et al. Second-trimester cordocentesis and the risk of small for gestational age and preterm birth // Obstet. Gynecol. 2014. T. 124. No. 5. C. 919-925]. Despite the fact that invasive procedures have a relatively high accuracy (over 90%), their implementation is associated with a rather high risk of abortion (2%).

An example of an approach to the aforementioned invasive diagnosis is known from the prior art and is described in patent CN108070639. In accordance with this method, the amniotic fluid is the biological substrate for the diagnosis of trisomy on the 21st chromosome. Using digital polymerase chain reaction (PCR) and a set of oligonucleotide primers and probes specific to the 21st and reference chromosomes, the levels of the above chromosomes are determined in DNA isolated from the amniotic fluid in order to determine their ratio. for the invasive methods described above: amniotic fluid, as a rule, is obtained at 14-18 weeks of pregnancy, as a result of which the diagnosis of trisomy on chromosome 21 occurs relatively late, and in case of termination of pregnancy, the risks of unwanted consequences for the patient increase, also performing amniocentesis required to obtain this biomaterial carries a 2% risk of abortion.

Thus, the disadvantages of the above approach to prenatal diagnosis of trisomy on chromosome 21 can be attributed to the late term of the final diagnosis, which increases the possible risks in case of a decision to terminate pregnancy, low accuracy of the non-invasive stage of determination, high risk of termination of pregnancy during the invasive stage. ...

The prior art known approaches to non-invasive prenatal diagnosis of trisomy on the 21st chromosome, based on sequencing methods of the new generation. In particular, there is a known method of non-invasive prenatal diagnosis of fetal aneuploidies, which consists in the fact that a pregnant woman at an early stage (from the 8th week of gestation) is sampled peripheral blood, from which total circulating DNA (ssDNA) is extracted, which is then analyzed when using new generation sequencing technologies (RU2627673). These approaches are highly accurate, however, highly qualified specialists with bioinformatics education are required to operate new-generation sequencers and data analysis, and the maintenance of such devices is much more expensive than maintaining equipment for various types of PCR, for the analysis of the results of which there is also no need for a specialist. -bioinformatics. The above factors make this type of prenatal non-invasive diagnostics inaccessible for the general population due to the high cost.

The prior art knows methods of non-invasive prenatal diagnostics based on real-time PCR after restriction sensitive to methylation, for example, a method for obtaining DNA primers and probes for minimally invasive prenatal PCR diagnostics of trisomy of the 21st chromosome in a fetus from the blood of a pregnant woman and diagnostic kit for its implementation (RU2602366). This approach implies, after isolation of circulating DNA from the mother's blood, restriction sensitive to methylation, and then real-time PCR on differentially methylated sites of fetal DNA on the 21st and reference chromosomes. The main disadvantage of this type of study is the need for parallel quantitative real-time PCR, as a result of which the ratio of the 21st and the reference chromosomes is influenced not only by the pipetting error within individual tubes for parallel real-time PCR, but also by the limited reproducibility of real-time PCR. time. It should be noted that with quantitative real-time PCR, the level of DNA is determined relative to a standard, the low quality of which can significantly distort the result, and the accuracy of real-time PCR significantly decreases when working with low concentrations of DNA, which are the case with cfDNA. and this type of PCR is not very resistant to PCR inhibitors when compared with more modern PCR variations - digital PCR [Quan PL, Sauzade M., Brouzes E. DPCR: A technology review // Sensors (Switzerland). 2018. T. 18. No. 4]. Another disadvantage of the above-described approach to non-invasive prenatal diagnosis of trisomy is the absence of a restriction completeness check system that is sensitive to methylation. In the event of its incomplete flow, copies of the mother's genetic material, both the 21st chromosome and the reference, will remain in the DNA solution, which will significantly distort the ratio of these chromosomes in the presence of trisomy on the 21st chromosome of the fetus. All the above-described disadvantages of this approach did not allow it to be widely used in prenatal diagnosis.

Thus, there is currently a need to create a method for non-invasive prenatal diagnosis of trisomy on the 21st chromosome, devoid of all of the above disadvantages.

Disclosure of invention

The technical problem solved by the claimed invention is to eliminate disadvantages, such as the effect of limited reproducibility of quantitative DNA analysis methods and pipetting errors on the accuracy of determining the ratio of the 21st and reference chromosomes, as well as the cfDNA fraction, low accuracy of quantitative determination of the DNA level at low concentrations fetal genetic material observed in early pregnancy (6-12 weeks), the need for bioinformatic analysis of the results, the absence of a restriction completeness check system that is sensitive to methylation. The technical problem is realized by creating a set of reagents and a method for non-invasive prenatal diagnosis of trisomy on the 21st chromosome by determining the ratio of the 21st and reference chromosomes in the amount of DNA circulating in the mother's blood, followed by confirmation of the results by determining the cfDNA fraction, providing a high level of statistical reliability.

The technical result of the proposed method is to conduct a non-invasive diagnosis of trisomy on the 21st chromosome of the fetus, which has high sensitivity (the possibility of quantitative analysis at low concentrations of fetal DNA, starting from the 6th week - at least 0.7 copies / μl); no risk of termination of pregnancy due to the absence of invasive contact with fetal tissues; ease of use and interpretation of results in clinical diagnostic laboratories due to the absence of the need for bioinformatics analysis; a self-control system both at the stage of ssDNA restriction and at the stage of direct comparison of the levels of the 21st and reference chromosomes.

The technical problem is solved by the method of non-invasive prenatal determination of trisomy on the 21st chromosome, including taking blood from a pregnant woman, separating plasma, isolating circulating extracellular DNA from it, followed by determining the ratio of the 21st chromosome and the reference one and confirming the results by determining the cfDNA fraction and its compliance with the increase in the above ratio; with an increased ratio of the 21st chromosome and the reference, confirmed by the cfDNA fraction, a conclusion is made about the presence of trisomy on the 21st chromosome in the fetus.

The problem is also solved by the method of determining trisomy on the 21st chromosome by fetal DNA in the mother's blood, including:

- isolation of DNA from the blood plasma of a pregnant woman with obtaining two aliquots;

- digital PCR of aliquot No. 1 with quantitative determination of the levels of the 21st and reference chromosomes for the PRDM15 and EIF2C1 genes, respectively, with the calculation of their ratio;

- when the ratio of the levels of the 21st and reference chromosomes is less than or equal to 1, it is concluded that there is no trisomy on the 21st chromosome of the fetus;

- when the ratio of the levels of the 21st and reference chromosomes is more than 1, a conclusion is made about the possible presence of trisomy on the 21st chromosome of the fetus and the fraction of fetal DNA on the 21st chromosome is calculated.

In this case, aliquot No. 2 is used to verify the results obtained, for this:

- aliquot # 2 is treated with a restriction endonuclease sensitive to methylation;

- confirm the completeness of restriction by real-time PCR for the ASTV gene containing a restriction site and devoid of hypermethylation,

- in the presence of a signal from the ASTH gene, the restriction procedure sensitive to methylation is repeated,

- in the absence of a signal from the ASHF gene, a restriction sensitive to methylation is considered fully passed,

- carry out digital PCR of aliquot No. 2 with parallel determination of the number of copies of the RASSF1A gene hypermethylated in the fetus and the EIF2C1 gene, devoid of the restriction site and representing the sum of the mother and fetus DNA, in one reaction mixture,

- determine the fraction of fetal DNA by the ratio of the copy numbers of the RASSF1A gene and the EIF2C1 gene.

- if the discrepancy between the values of the fetal DNA fraction calculated from the results of measurements of aliquots No. 1 and No. 2 does not exceed 10% of the larger value, the measurement results are considered reliable.

The problem is also solved by creating a set of reagents intended for the implementation of the proposed method, including primers and probes specific to the genes PRDM15, EIF2C1, ASTV, RASSF1A.

Brief Description of Drawings

FIG. 1 shows the results of real-time PCR for the ASHB gene to confirm the completeness of restriction (example 1).

FIG. 2 shows the results of digital PCR chip # 1.1 for the PRDM15 (chromosome 21) and EIF2C1 (chromosome 1) genes (example 1).

FIG. 3 shows the results of digital PCR chip # 2.1 on the RASSF1A gene hypermethylated in the fetus (chromosome 3) and the EIF2C1 gene, devoid of a restriction site and reflecting the sum of maternal and fetal DNA (chromosome 1) (example 1).

FIG. 4 shows the results of real-time PCR for the ASHB gene to confirm the completeness of the restriction (example 2).

FIG. 5 shows the results of digital PCR chip # 1.1 for the PRDM15 (chromosome 21) and EIF2C1 (chromosome 1) genes (example 2).

FIG. 6 shows the results of digital PCR chip No. 2.1 on the RASSF1A gene hypermethylated in the fetus (chromosome 3) and the EIF2C1 gene, devoid of a restriction site and reflecting the sum of maternal and fetal DNA (chromosome 1) (example 2).

FIG. 7 shows the results of real-time PCR for the ASHB gene to confirm the completeness of the restriction (example 3).

FIG. 8 shows the results of digital PCR chip # 1.1 for the PRDM15 (chromosome 21) and EIF2C1 (chromosome 1) genes (example 3).

FIG. 9 shows the results of digital PCR chip No. 2.1 on the RASSF1A gene hypermethylated in the fetus (chromosome 3) and the EIF2C1 gene, devoid of a restriction site and reflecting the sum of maternal and fetal DNA (chromosome 1) (example 3).

Implementation of the invention

The analysis of biomaterials from 23 women in early pregnancy (12-16 weeks) with a high risk of developing trisomy on the 21st chromosome in the fetus according to the results of screening the first trimester using the proposed method showed that 11 patients have trisomy 21- th chromosome.

Patients participating in the study underwent invasive prenatal diagnosis of trisomy on chromosome 21 using chorionic villus aspiration and subsequent karyotyping. In 11 patients, the diagnosis was confirmed, which coincided 100% with the results of the determination according to the claimed method.

Thus, the suitability of the proposed method for prenatal non-invasive diagnosis of trisomy on the 21st chromosome was confirmed by fetal DNA circulating in the mother's blood.

The inventive method for non-invasive prenatal determination of trisomy on the 21st chromosome includes:

- obtaining a sample of the peripheral blood of a pregnant woman;

- Isolation of blood plasma from the sample by centrifuging the blood sample;

- isolation of DNA from blood plasma to obtain a solution with isolated DNA;

- selection of two aliquots from the resulting solution;

- treatment of aliquot No. 2 with a restriction endonuclease sensitive to methylation;

- verification of the completeness of restriction by carrying out real-time PCR for the ASTV gene;

- in the presence of a signal from the ASTH gene, the restriction procedure sensitive to methylation is repeated,

- in the absence of a signal from the ASHF gene, a restriction sensitive to methylation is considered fully passed,

- conducting digital PCR:

1) aliquots No. 1 from the original solution with the isolated DNA for the gene of the 21st chromosome PRDM15 and the reference one - EIF2C1;

2) aliquots No. 2, treated with restriction endonuclease, for the RASSF1A gene hypermethylated in the fetus and the EIF2C1 gene, devoid of the restriction site and representing the sum of the mother and fetus DNA;

- calculation of the fetal DNA fraction according to the results of digital PCR of aliquot No. 2 by dividing the DNA concentration for the RASSF1A gene hypermethylated in the fetus by the DNA concentration for the EIF2C1 gene, devoid of a restriction site and representing the sum of the mother's and fetus's DNA, according to the formula:

where F _R is the fetal DNA fraction determined by the RASSF1A gene hypermethylated in the fetus; C _R - DNA concentration for the RASSF1A gene in aliquot # 2; C _E - DNA concentration for the EIF2C1 gene in aliquot No. 2;

- data analysis of digital PCR aliquot No. 1:

1) if, in the analysis, the ratio of the levels of the 21st chromosome (PRDM15 gene) and the reference chromosomes (EIF2C1 gene) is less than or equal to 1, then it is concluded that there is no trisomy on the 21st chromosome of the fetus;

2) if the ratio of the levels of the 21st (PRDM15 gene) and the reference (EIF2C1 gene) chromosomes is more than 1, then a conclusion is made about the possible presence of trisomy on the 21st chromosome of the fetus and the fetal DNA fraction on the 21st chromosome is calculated, for this you need to use the formula:

where F _P is the fetal DNA fraction determined by the PRDM15 gene; С _Р - DNA concentration for the gene of the 21st chromosome PRDM15 in aliquot No. 1; C _E1 - DNA concentration for the EIF2C1 gene in aliquot # 1;

- when the F _P and F _R values converge (the difference between the results does not exceed 10% of the larger value; 10% is an instrumental error when conducting digital PCR on chips), it is believed that the fetus has trisomy on chromosome 21.

The centrifugation process is carried out under conditions sufficient to precipitate blood cells and obtain plasma. It is preferable to carry out centrifugation for 10 minutes at 3000 g with an average acceleration rate and a low deceleration rate; it is not recommended to take the lower plasma layer (10% of the total plasma volume at the bottom of the tube).

Isolation of DNA from blood plasma is carried out using a set of reagents that ensure complete isolation of genetic material from a sample and is designed to isolate extracellular DNA from plasma.

It is preferable to use the endonuclease BstFN I for restriction, the duration of the restriction must be calculated based on the expected concentration of DNA in solution and the enzyme activity indicated by the manufacturer.

Digital PCR is recommended to be performed in accordance with the recommendations of the manufacturer of digital PCR equipment and using reagents suitable for the equipment used for digital PCR, for example, from the QuantStudio ™ 3D Digital PCR 20K Chip Kit v2 (Thermo Fisher Scientific, USA ) using specific hydrolyzable probes.

Below are the sequences of primers and probes:

RASSF1A_F: 5'-AGCCTGAGCTCATTGAGCT-3 '(SEQ ID NO: 1)

RASSF1A_R: 5'-ACCAGCTGCCGTGTG-3 '(SEQ ID NO: 2)

RASSF1A_pr: 5'-6-FAM-CCAACGCGCTGCGCA-BHQ-1-3 '(SEQ ID NO: 3)

EIF2C1_F: 5'-GTTCGGCTTTCACCAGTCT-3 '(SEQ ID NO: 4)

EIF2C1_F: 5'-CTCCATAGCTCTCCCCACTC-3 '(SEQ ID NO: 5)

EIF2C1_pr: 5'-HEX-CGCCCTGCCATGTGGAAGAT-BHQ-1-3 '(SEQ ID NO: 6)

PRDM15_F: 5'-GCACACTCCAGAATGACC-3 '(SEQ ID NO: 7)

PRDM15_R: 5'-GGAGGCTGGATTGAGTTG-3 '(SEQ ID NO: 8)

PRDM15_pr: 5'-6-FAM-TGGGCAGTGGAGACGCATTGGCA-BHQ-1-3 '(SEQ ID NO: 9)

ACTB_F: 5'-GCGCCGTTCCGAAAGT-3 '(SEQ ID NO: 10)

ACTB_R: 5'-CGGCGGATCGGCAA-3 '(SEQ ID NO: 11)

ACTB_pr: 5'-HEX-ACCGCCGAGACCGCGT-BHQ-1-3 '(SEQ ID NO: 12)

The test system, designed for non-invasive prenatal determination of trisomy on chromosome 21, includes primers and probes specific to the PRDM15, EIF2C1, RASSF1A genes on chromosomes 21, 1 and 3, respectively. These primers and probes can be added to the reaction mixture for digital PCR.

Below is a more detailed description of the proposed method, which does not limit the scope of the claimed invention, but demonstrates the possibility of implementing the invention with the achievement of the claimed technical result.

1) Taking 10 ml of blood from a patient into a tube containing EDTA to prevent coagulation, blood: EDTA ratio 9: 1.

2) The tube with blood must be stored at 4 ° C for no more than 4 hours before further operations to prevent the loss of genetic material due to the action of plasma nucleases.

3) The blood tube must be centrifuged for 10 minutes at 3000g with an average acceleration rate and a low deceleration rate.

4) On completion of centrifugation, take 5 ml of plasma into a separate tube, while taking from the lower plasma layer should be avoided.

5) Isolation of DNA from extracellular plasma using a set ^{QIAamp Circulating Nucleic Acid Kit (Qiagen ®} , Germany) in accordance with the instruction.

In a 50 ml test tube were pipetted 500 l QIAGEN ^® Proteinase K, then in the same tube were added 5 ml of plasma test sample. Carrier RNA was prepared separately in an ACL buffer. For this, 4.4 ml of ACL buffer and 5.6 μl of carrier RNA, previously dissolved in AVE buffer in accordance with the instructions on the package, were added to a separate tube and vortexed for 30 s. The initial 50 ml tube containing the plasma and investigated QIAGEN ^® Proteinase K, was added 4 ml of carrier RNA ACL buffer. The tube with the resulting mixture was closed with a lid and mixed by vortexing for 30 s. Then the tube was incubated for 30 min at 60 ° C in a thermostat (Eppendorf ™ ThermoStat Plus, USA) to lyse all protein components of the plasma. After incubation, 9 ml of ACB buffer was added to the lysate, the tube was capped, and the contents were mixed by vortexing for 30 s. Then the tube was incubated on ice for 5 min. Next, a QIAmp Mini column was attached to a vacuum pump, to which a 20 ml expander was then attached. After incubation on ice, the contents of the tube were carefully poured into a column expander. Then the vacuum pump was turned on. When the liquid completely passed through the column, the vacuum pump was turned off and the pressure was brought to 0 mbar. The column expander was then removed. The column cover was left open. Next, 600 μL of ACW1 buffer was added to the column with a pipette, and the vacuum pump was turned on. When the liquid completely passed through the column, the vacuum pump was turned off and the pressure was brought to 0 mbar. Then, 750 μL of ACW2 buffer was pipetted into the column, the vacuum pump was turned on. When the liquid completely passed through the column, the vacuum pump was turned off and the pressure was brought to 0 mbar. After that, 750 μL of ethanol (96-100%) was pipetted into the test tube and the vacuum pump was turned on. When the liquid completely passed through the column, the vacuum pump was turned off and the pressure was brought to 0 mbar. Then the column was closed with a hook, disconnected from the vacuum pump, placed in an empty 2 ml tube, and centrifuged at 14,000 rpm for 3 minutes. The column was placed in a new empty 2 ml tube (the last tube was discarded), the lid was opened and incubated at 56 ° C for 10 min on a thermostat (Eppendorf ™ ThermoStat Plus, USA) to dry the column membrane. Then the column was placed in a clean 1.5 ml tube (the last tube was discarded) and 60 μl of buffer AVE was carefully pipetted into the center of the column membrane, then incubated at room temperature for 3 min. Then, the column in the tube was centrifuged at 14,000 rpm for 1 min to elute the nucleic acids. If the further analysis is not started immediately, the extracted DNA is stored at a temperature of -80 ° C.

6) 2 aliquots were taken from the solution with isolated DNA.

Aliquot No. 1 - 15.7 μl; aliquot No. 2 - 15.2 μl. When free from manipulations, all aliquots were stored at 4 ° C.

7) In aliquot # 2, restriction was performed in accordance with the following procedure.

Aliquot No. 1 was supplemented with 1 μl of BstFN I endonuclease (SibEnzyme, Russia) and 1.8 μl of buffer (Buffer Y 10X concentrate, SibEnzyme, Russia). The mixture was vortexed for 30 seconds and then centrifuged at 6000 rpm for 10 seconds. The tube was placed in an amplifier (Eppendorf ™ Mastercycler gradient), on which the program was set: 60 ° C 40 min (for restriction) - 80 ° C 20 min (for enzyme inactivation).

8) To check the completeness of restriction, real-time PCR was performed for the ASHB gene.

Prepared 3 tubes with optically clear caps of 0.1 ml. Each of them was loaded with 12.5 μl TaqMan Maxima Probe qPCR Master Mix (2X) (Thermo Fisher Scientific, USA), 0.75 μl probes for ASTH at a concentration of 10 μmol / L, 1 μl of primers for ASTH at their concentration 10 μmol / l, 8.75 μl of distilled sterile water. In 1 of 3 tubes, 1 μl of a solution from aliquot No. 2, subjected to restriction, was added. 1 μL of distilled sterile water (negative control) was added to the 2nd tube. In the third tube, 1 μL of a solution of any genomic DNA that was not subjected to restriction was added. The tubes with solutions were centrifuged at a speed of 6000 rpm for 1 min. Then they were introduced into an Applied Biosystems® 7500 FAST Real-Time PCR System for real-time PCR, on which the program was set: denaturation (95 ° C, 10 min) - 1 cycle, denaturation (95 ° C, 15 s), annealing (60 ° C, 1 min) and elongation (70 ° C, 1 min) - 60 cycles, final elongation (70 ° C, 5 min) - 1 cycle. After the amplification, it was made sure that no traces of the ASHB gene were found in the test tube with the test sample, that is, it was believed that the restriction was successful. When traces of the ASTF gene were found, the restriction procedure was repeated, after which the real-time PCR procedure was repeated.

9) Mixtures were prepared for digital PCR.

For this, 2 tubes of 1.5 ml were taken. 17.4 μl QuantStudio ™ 3D Digital PCR Master Mix v2. 1.74 µl of a previously prepared mixture containing primers and probes for the PRDM15 and EIF2C1 genes (primer concentrations 18 µmol / L, probes 5 µmol / L) were added to test tube No. 1. In a test tube No. 2, 1.74 μl of a previously prepared mixture containing primers and probes for the RASSF1A and EIF2C1 genes (primer concentration 18 µmol / L, probes 5 µmol / L) was added. The sequences of primers and probes are indicated above. Then, 15.7 µl of DNA from aliquot No. 1, containing the intact sum of circulating DNA of the mother and the fetus, was introduced into test tube No. 1; in test tube No. 2 - 15.7 μl of DNA from aliquot No. 2, subjected to restriction. The tubes with solutions were centrifuged at 6000 rpm for 10 s.

10) Prepared 4 chips for digital PCR (QuantStudio ™ 3D Digital PCR Chip v2).

Using the QuantStudio ™ 3D Digital PCR Chip Loader, the solution was added to chips # 1.1 and # 1.2 from tube # 1; for chips # 2.1 and # 2.2 - solution from test tube # 2. To do this, 14.5 μL of the mixture was added to each chip from a corresponding tube into a removable plastic QuantStudio ™ 3D Digital PCR Chip Loader with a mechanical pipette, avoiding the formation of air bubbles, and then dosing was started by pressing the central button of the QuantStudio ™ 3D Digital PCR Chip Loader. Immediately after dispensing, the chip matrix was coated with immersion liquid from a syringe to prevent evaporation. Then, the QuantStudio ™ 3D Digital PCR Chip Loader with the chip cap inserted in advance (QuantStudio ™ 3D Digital PCR Chip Lid v2) was lowered and held for 15 seconds. After that, the immersion liquid from the syringe was carefully injected into the hole on the chip cover until the entire contents of the syringe were filled with the immersion liquid and only an air bubble the size of the hole on the chip cover remained. Next, the protective film was removed from the non-sticky part of the lid and pressed for 15 s until the chip was tightly closed. Then the chip was set aside and its surface was covered with a metal plate supplied. Only after that did we proceed to dispensing and preparing the next chip.

11) Amplification of 4 prepared chips was carried out.

For this, the chips were transferred to an amplifier (ProFlex ™ 2x Flat PCR System) set at an angle of 11 ° and covered with the supplied soft pads for better contact with the heating elements. The following parameters were set in the amplifier program: denaturation (96 ° С, 10 min) - 1 cycle, denaturation (98 ° С, 30 s), annealing (63 ° С, 1 min) and elongation (70 ° С, 1 min) - 60 cycles, holding at 10 ° C for no longer than 24 hours. Then the amplification process was started.

12) Read the results of digital PCR on a QuantStudio ™ 3D Digital PCR Instrument. For this, after amplification, the chips were sequentially installed into the reading slot of the QuantStudio ™ 3D Digital PCR Instrument. The results of digital PCR were read and processed automatically by the system software.

13) Analyzed the results of digital PCR chips # 2.1, # 2.2.

On the cloud service (QuantStudio ™ 3D AnalysisSuite) in the operator's personal account, DNA concentrations, copies / μl, were recorded (it was previously noted in the system that the probes on the RASSF1A give a signal in the FAM channel, and on the EIF2C1 - in the VIC channel). Chips # 2.1 and # 2.2 in the system were given the same name for a more accurate determination of the DNA concentration in the sample. To determine the fraction of fetal DNA for the RASSF1A gene, the obtained concentrations were substituted into the expression:

where F _R is the fetal DNA fraction determined by the RASSF1A gene hypermethylated in the fetus; C _R - DNA concentration for the RASSF1A gene in aliquot # 2; C _E - DNA concentration for EIF2C1 gene in aliquot No. 2.

14) Analyzed the results of digital PCR chips # 1.1 and # 1.2.

On the cloud service (QuantStudio ™ 3D AnalysisSuite) in the operator's personal account, DNA concentrations, copies / μl, were recorded (it was previously noted in the system that probes for the PRDM15 gene give a signal in the FAM channel, and on EIF2C1 - in the VIC channel). Chips No. 1.1 and 13.2 in the system were given the same name for more accurate determination of the DNA concentration in the sample.

15) If, in the analysis, the ratio of the concentration of PRDM15 and EIF2C1 is less than or equal to 1, then it was considered that the fetus does not have trisomy on the 21st chromosome;

16) If, in the analysis, the ratio of the concentration of PRDM15 and EIF2C1 is greater than 1, then it was considered that trisomy on the 21st chromosome is possible in the fetus and the obtained concentrations were substituted into the expression:

where F _P is the fetal DNA fraction determined by the PRDM15 gene; С _Р - DNA concentration for the gene of the 21st chromosome PRDM15 in aliquot No. 1; C _E1 - DNA concentration for the EIF2C1 gene in aliquot # 1;

When the F _P and F _R values converge (the difference between the results does not exceed 10% of the larger value; 10% is an instrumental error when conducting digital PCR on chips), it was considered that the fetus has trisomy on the 21st chromosome.

Example 1.

Patient F., 41 years old. The gestation period is 13 weeks. The patient underwent a sample of 10 ml of peripheral blood in a tube with EDTA. Was carried out the isolation of extracellular DNA from blood, selection of aliquots and restriction with subsequent confirmation of its completeness in accordance with the method described in this document. FIG. 1 shows the results of real-time PCR to confirm the completeness of the restriction.

After confirming the completeness of the restriction, digital PCR analysis was performed according to the method described herein. FIG. Figures 2 and 3 graphically represent the results of digital PCR chips # 1.1 and # 2.1, respectively.

From the information presented in FIG. 2, it can be concluded that in the sample under study, the ratio of the 21st and reference chromosomes is greater than 1, which corresponds to the genotype in fetal trisomy on the 21st chromosome. Thus, to confirm the results, it is necessary to apply the formula F _P = (C _P -C _E2 ) * 2 / C _E2 .

From the information presented in FIG. 3, it can be concluded that fetal DNA is present in the sample. To determine the fraction of fetal DNA, it is necessary to apply the formula F _R = C _R / C _E and compare the resulting fractions.

DNA concentrations obtained in the course of digital PCR analysis of aliquots No. 1 and No. 2, as well as the results of determining the fetal DNA fraction for both the RASSF1A gene and the PRDM15 gene (chromosome 21) are presented in Table 1.

According to the data presented in table 1, a conclusion was made about the presence of trisomy on the 21st chromosome in the fetus, since there is a convergence of F _P and F _R values.

Based on the results of screening for the first trimester of pregnancy, patient F. was referred for the invasive diagnosis of trisomy on chromosome 21 by aspiration of chorionic villi with subsequent karyotyping. According to the results of invasive diagnostics, patient F. revealed trisomy on the 21st chromosome of the fetus, which corresponds to the results of non-invasive determination of trisomy on the 21st chromosome using the claimed set of reagents and technology.

Example 2.

Patient L., 39 years old. The gestation period is 13 weeks. The patient underwent a sample of 10 ml of peripheral blood in a tube with EDTA. Was carried out the isolation of extracellular DNA from blood, selection of aliquots and restriction with subsequent confirmation of its completeness in accordance with the method described in this document. FIG. 4 shows the results of real-time PCR to confirm the completeness of the restriction.

After confirming the completeness of the restriction, digital PCR analysis was performed according to the method described herein. FIG. 5 and 6 graphically show the results of digital PCR chips # 1.1 and # 2.1, respectively.

From the information presented in FIG. 5, it can be concluded that the ratio of the 21st and reference chromosomes in the test sample is less than 1, which does not correspond to the genotype in fetal trisomy on the 21st chromosome.

From the information presented in FIG. 6, it can be concluded that fetal DNA is present in the sample. To determine the fraction of fetal DNA, it is necessary to apply the formula F _R = C _R / C _E.

DNA concentrations obtained during the analysis by digital PCR of aliquots No. 1 and No. 2, as well as the results of determining the fraction of fetal DNA for the RASSF1A gene are presented in Table 2.

According to the data presented in Table 2, a conclusion was made about the absence of trisomy on the 21st chromosome in the fetus, since the value of the ratio of the levels of the 21st and reference chromosomes is less than 1.

Based on the results of screening for the first trimester of pregnancy, patient F. was referred for the invasive diagnosis of trisomy on chromosome 21 by aspiration of chorionic villi with subsequent karyotyping. According to the results of invasive diagnostics, patient F. did not reveal trisomy on the 21st chromosome of the fetus, which corresponds to the results of non-invasive determination of trisomy on the 21st chromosome using the claimed set of reagents and technology.

Example 3.

Patient V., 36 years old. The gestation period is 14 weeks. The patient underwent a sample of 10 ml of peripheral blood in a tube with EDTA. Was carried out the isolation of extracellular DNA from blood, selection of aliquots and restriction with subsequent confirmation of its completeness in accordance with the method described in this document. FIG. 7 shows the results of real-time PCR to confirm the completeness of the restriction.

After confirming the completeness of the restriction, digital PCR analysis was performed according to the method described herein. FIG. 8 and 9 graphically show the results of digital PCR chips # 1.1 and # 2.1, respectively.

From the information presented in FIG. 8, it can be concluded that the ratio of the 21st and reference chromosomes in the sample under study is more than 1, which corresponds to the genotype in fetal trisomy on the 21st chromosome.

From the information presented in FIG. 9, it can be concluded that fetal DNA is present in the sample. To determine the fraction of fetal DNA, it is necessary to apply the formula F _R = C _R / C _E.

DNA concentrations obtained during the analysis by digital PCR of aliquots No. 1 and No. 2, as well as the results of determining the fraction of fetal DNA for the RASSF1A gene are presented in Table 3.

According to the data presented in table 3, a conclusion was made about the presence of trisomy on the 21st chromosome in the fetus, since there is a convergence of the F _P and F _R values.

However, according to the results of screening for the first trimester of pregnancy, patient V. did not show signs of trisomy on chromosome 21, and she was not sent for invasive diagnostics. There was a discrepancy in the results between the determination of trisomy on the 21st chromosome by the method presented in this document and the screening of the first trimester of pregnancy.

With the consent of patient V., monitoring of the pregnancy outcome was established. The newborn had signs of the development of trisomy on the 21st chromosome, on the basis of which the attending physician decided to conduct postnatal karyotyping for the child. According to the results of karyotyping, the newborn was diagnosed with Down syndrome (trisomy on the 21st chromosome), which corresponds to the genotype of the fetus prenatally determined using the methodology claimed in this document.

Thus, the claimed method of non-invasive prenatal diagnostics allows to determine with high accuracy the presence of trisomy on the 21st chromosome using fetal DNA in early pregnancy. The advantage of the proposed method is that the determination of fetal DNA fractions occurs in the same reaction mixture, due to which the ratio is not affected by pipetting error and limited reproducibility of quantitative determination of the DNA level, and a system for confirming the completeness of restriction is presented. In clinical practice, this will make the non-invasive prenatal determination of trisomy on chromosome 21 more accurate and reliable.

--->

LIST OF SEQUENCES

<110> Federal State Budgetary Educational Institution of Higher Professional Education "Lomonosov Moscow State University" (MSU)

<120> METHOD FOR NON-INVASIVE PRENATAL TRISOMY DIAGNOSTICS AND SET FOR ITS CARRYING OUT

<160> SEQ ID NO: 1

<210> 1

<211> 19

<212> DNA

<213> Artificial sequence

<223> Human ras association domain-containing protein 1, RASSF1A_F

<400> 1

1 AGCCTGAGCTCATTGAGCT

<160> SEQ ID NO: 2

<210> 2

<211> 15

<212> DNA

<213> Artificial sequence

<223> Human ras association domain-containing protein 1, RASSF1A_R

<400> 2

1 ACCAGCTGCCGTGTG

<160> SEQ ID NO: 3

<210> 3

<211> 15

<212> DNA

<213> Artificial sequence

<223> Human ras association domain-containing protein 1, RASSF1A_pr

<400> 3

1 6-FAM-CCAACGCGCTGCGCA-BHQ-1

<160> SEQ ID NO: 4

<210> 4

<211> 19

<212> DNA

<213> Artificial sequence

<223> Human protein argonaute-1, EIF2C1_F

<400> 4

1 GTTCGGCTTTCACCAGTCT

<160> SEQ ID NO: 5

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence

<223> Human protein argonaute-1, EIF2C1_R

<400> 5

1 CTCCATAGCTCTCCCCACTC

<160> SEQ ID NO: 6

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence

<223> Human protein argonaute-1, EIF2C1_pr

<400> 6

1 HEX-CGCCCTGCCATGTGGAAGAT-BHQ-1

<160> SEQ ID NO: 7

<210> 7

<211> 18

<212> DNA

<213> Artificial sequence

<223> Human PR / SET domain 15 protein, PRDM15_F

<400> 7

1 GCACACTCCAGAATGACC

<160> SEQ ID NO: 8

<210> 8

<211> 18

<212> DNA

<213> Artificial sequence

<223> Human PR / SET domain 15 protein, PRDM15_R

<400> 8

1 GGAGGCTGGATTGAGTTG

<160> SEQ ID NO: 9

<210> 9

<211> 23

<212> DNA

<213> Artificial sequence

<223> Human PR / SET domain 15 protein, PRDM15_pr

<400> 9

1 6-FAM-TGGGCAGTGGAGACGCATTGGCA-BHQ-1

<160> SEQIDNO: 10

<210> 10

<211> 16

<212> DNA

<213> Artificial sequence

<223> Human beta-actin protein, ACTB_F

<400> 10

1 GCGCCGTTCCGAAAGT

<160> SEQ ID NO: 11

<210> 11

<211> 14

<212> DNA

<213> Artificial sequence

<223> Human beta-actin protein, ACTB_R

<400> 11

1 CGGCGGATCGGCAA

<160> SEQ ID NO: 12

<210> 12

<211> 16

<212> DNA

<213> Artificial sequence

<223> Human beta-actin protein, ACTB_pr

<400> 12

1 HEX-ACCGCCGAGACCGCGT-BHQ-1

<---

Claims (16)

1. A method of non-invasive prenatal diagnosis of trisomy by the 21st chromosome of the fetus by fetal DNA, characterized by the fact that the blood plasma of a pregnant woman is taken, circulating extracellular DNA is isolated from it, followed by the determination of the ratio of the levels of the 21st chromosome and the reference one with confirmation of the result by fraction of fetal DNA, determined using restriction sensitive to methylation, and by the fact that with a confirmed increased ratio of the 21st chromosome and the reference one, it is concluded that there is trisomy on the 21st chromosome in the fetus. 2. The method according to claim 1, characterized in that to determine trisomy on the 21st chromosome of the fetus by fetal DNA in the blood of a pregnant woman: - DNA is isolated from the blood plasma of a pregnant woman to obtain two aliquots; - digital PCR of aliquot No. 1 is carried out with quantitative determination of the levels of the 21st and reference chromosomes for the PRDM15 and EIF2C1 genes, respectively, and the calculation of their ratio; - when the ratio of the 21st and the reference chromosomes is equal to or less than 1, it is concluded that there is no trisomy on the 21st chromosome of the fetus; - when the ratio of the 21st and reference chromosomes is more than 1, a conclusion is made about the presence of trisomy on the 21st chromosome of the fetus; - the fraction of fetal DNA is calculated by the level of excess chromosome 21; - Aliquot # 2 is used to verify the results obtained. 3. The method according to claim 2, characterized in that for verification of the results: - aliquot No. 2 is processed with a restriction endonuclease sensitive to methylation; - the completeness of the restriction is checked using real-time PCR for the ASTV gene, devoid of methylation in the fetus and mother; - carry out digital PCR of aliquot No. 2 after restriction with determination of the number of copies of the RASSF1A gene hypermethylated in the fetus and devoid of the restriction site of the EIF2C1 gene, representing the sum of the mother and fetus DNA; - determine the fraction of fetal DNA by the ratio of the number of copies of the gene RASSF1A and EIF2C1, obtained as a result of measurements in aliquot No. 2; - if the discrepancy between the values of the fetal DNA fraction, calculated from the results of measurements of aliquots No. 1 and No. 2, does not exceed 10% of the larger value, the measurement results according to item 2 are considered reliable. 4. A set of reagents for implementing the method according to claim 1, including at least oligonucleotide primers - forward and reverse, and probes specific to the genes PRDM15, EIF2C1, RASSF1A and ASHB, presented in lyophilized form or in aqueous solution. 5. The kit according to claim 4, characterized in that oligonucleotide primers and probes with the sequences SEQ ID NO: 1 - SEQ ID NO: 12 are used.

Images