RU2688729C1 - RECOMBINANT PLASMID DNA OF pFUSE-MARX-29-PRAD-F2A/BChE-14 CONTAINING A MODIFIED HUMAN BUTYRYLCHOLINESTERASE GENE FOR EXPRESSION OF BUTYRYLCHOLINESTERASE GENE IN MAMMALIAN CELLS FOR THERAPY OF ORGANOPHOSPHORUS TOXIN POISONING - Google Patents

Abstract

FIELD: biotechnology.SUBSTANCE: invention relates to production of recombinant human butyrylcholinesterase (BuChE). Task is solved by creating a genetic construct - recombinant plasmid DNA pFUSE-MARX-29-PRAD-F2A/BChE-14 containing a nucleotide sequence of a synthetic gene of modified human butyrylcholinesterase coding a version of butyrylcholinesterase with replacement of sequence 284-TPLSV-288 with sequence 284-HTIHG-288, providing production of modified enzyme rhBChE-14, capable of reactivation after covalent inhibition by paraoxone and not subject to aging, a nucleotide binding sequence with a nuclear matrix (MAR X-29), which enables to increase production of the target protein due to both increase in the level of transcription of the gene located in close proximity, and due to higher stability of the ribosome-transcript complex.EFFECT: invention can be used in medicine in therapy of organophosphorus toxins, for therapy of narcotic substance poisonings of cocaine type, for therapy of consequences of anesthesia in people with endogenous Buchester deficiency.1 cl, 3 dwg, 1 tbl, 4 ex

Description

The invention relates to biotechnology, namely: to sodan genetic constructs for the production of recombinant human butyrylcholinesterase (Buhe) and can be used in medicine in the treatment of organophosphorus toxins poisoning.

The object of the study is the enzyme butyrylcholinesterase, which is a natural analogue of the enzyme acetylcholinesterase by the mechanism of action. The enzyme acetylcholinesterase is a target for a large range of neuro-paralytic toxins, narcotic drugs. The administration of monkeys (M. mulatta) of large doses of the enzyme butyrylcholinesterase (30 mg / kg) showed no significant deviations from the norm in behavioral activity and physicochemical blood parameters during 4 weeks of observation [Lockridge O., Masson P. Neurotoxicology. 2000]. Similar results were obtained for guinea pigs [Saxena A. et al. Biochem Pharmacol. 2011].

The enzyme butyrylcholinesterase is a stoichiometric antidote, which means that one equivalent of the enzyme irreversibly interacts with one equivalent of a poisonous substance. Previously, a rational design was created mutant version of butyrylcholinesterase - G117H, for which the ability to hydrolyze the ecotyiophate substrate [Millard CB, Lockridge O, Broomfield CA. Biochemistry. 1995]; paraoxon [Lockridge O, Blong RM, Masson P, Froment MT, Millard CB, Broomfield CA, Biochemistry. 1997]; methyl paraoxon and diisopropyl phosphate [Schopfer LM et al., J Med Chem Def. 2004]; Sarin, Soman, Vx [Millard CB, Lockridge O, Broomfield CA. Biochemistry. 1998].

Known to the region in the form of a bourgeois and the region of the region and the region; et al., J Med Chem Def 2004].

The disadvantages of all the listed mutants is a sharp drop in the level of hydrolysis of analogues of natural essential substrates acetylthiocholine and butyrylthiocholine [Wang Y. et al. Toxicol Appl Pharmacol. 2004]. As well as all the listed mutants have the ability to irreversibly inactivate after interaction with phosphates, called "aging" [Millard CB, Lockridge O, Broomfield C A. Biochemistry. 1998]. Thus, the mutant G117H / E197D with the lowest aging effect is considered to be considered the most effective.

A method of obtaining human butyrylcholinesterase by purifying blood plasma. The modern protocol, published in 2005, is designed to process 100 liters of human blood plasma in one cleaning cycle. The protocol of industrial purification of BuHE from blood plasma is protected by patent US 20060194301 A1. Large-scale purification of BuHE from human blood plasma according to this protocol takes from 14 days, requires specially prepared reagents and utensils and has no more than 50% yield, however, it allows to obtain hBuHE 80% purity, as well as a product of high purity (> 95%) using additional cleansing cycles using HPLC [O. Jbilo et al. Eur J Biochem. 1994].

The disadvantages of this method are the high price of the source material. Increased demands on the quality of raw materials due to the high risk of sample contamination with dangerous viruses.

A known method for producing recombinant low glycosylated buhe in non-lymphoid cells of the CHO line [Nachon F. et al. Eur J Biochem. 2002]. When building cells in a roller for a long time, it was possible to obtain 3-5 mg of protein per liter of growth medium.

The disadvantage of this method is the extremely low level of production, since to ensure the profitability of production, it is required to increase the level of production to 50-100 mg per liter of growth medium.

A method of producing recombinant BCS in transgenic animals is known. The BuHE gene was placed under the control of the goat β-casein promoter. The resulting genetic construct was introduced by microinjection into pronucleos of in vitro goat zygotes. Studies have shown that from 1 to 5 grams of active buhe is found in a liter of milk of transgenic goats. The project turned out to be promising [Yang X., Carter M.G. Proc Natl Acad Sci USA. 2007]. PharmAthene, Inc. announced the release of the drug Protexia®; In 2009, the transgenic drug passed the first stage of preclinical testing (NCT00333528 and NCT00744146), but the project was later closed due to unprofitable production.

The disadvantage of this method is to obtain an enzyme with insufficient glycosylation, which reduces its pharmacological indicators.

A method of obtaining active buhe from transgenic plants of tobacco Bentham (N. benthamiana) [Geyer B.C. et al. Proc Natl Acad Sci USA. 2010]. Since the representativeness of the coding codons in the human and plant genomes is different, the researchers modified the human BuChE DNA sequence, replacing part of the non-preferred codons and changing the parts of the gene that affect the efficiency of transcription and mRNA stability. The number of modeling sites has also been reduced [Geyer B.C. et al. Plant Biotechnol. J. 2010]. As a result, researchers were able to obtain transgenic plants with the expression level of BuHE up to 1.3% of the total fraction of soluble proteins (about 100 mg per kilogram of raw biomass).

The disadvantages of this method is an altered glycosylation profile, which reduces its pharmacological properties.

Expression of recombinant Buhe in Escherichia coli cells resulted in an inactive enzyme due to the lack of necessary post-translational modifications of recombinant polypeptide chains and the formation of insoluble inclusion bodies [Myers TM et al. Neurotoxicol Teratol. 2012].

The closest analogue of the claimed invention are the patents US 20070111279 A1 (published on May 17, 2007) and EP 2661492 A2 (published on November 13, 2013), of which are known recombinant vectors encoding butyrylcholinesterase and intended for its expression in CHO cells. However, the claimed invention differs from the closest analogue in that the plasmid DNA pFUSE-MARX-29-PRAD-F2A / BChE-14 consists of the plasmid pFUSE containing the synthetic hEF / HTLV promoter, the nucleotide sequence of the BleoR gene, the nucleotide sequence of the proline rich tetramerization gene PRAD , nucleotide sequence of the self-processing peptide F2A, located in a single reading frame with the modified butyrylcholinesterase gene and the nucleotide sequence of the synthetic butyrylcholinesterase modified gene human, and the nucleotide sequence binding to the nuclear matrix (MARX-29).

The invention solves the problem of obtaining recombinant human butyrylcholinesterase in yeast cells.

The problem is solved by creating a genetic construct - recombinant plasmid DNA pFUSE-MARX-29-PRAD-F2A / BChE-14, encoding a gene of modified human butyrylcholinesterase, consisting of the plasmid pFUSE, containing:

high-performance synthetic promoter hEF / HTLV,

The nucleotide sequence of the proline-rich peptide gene is tetramerization of PRAD, which is involved in the natural tetramerization process 4rChOOHE and the BChE gene,

the sequence of the BleoR gene, the product of which ensures the stability of the transformants to the antibiotic zeocin,

The nucleotide sequence of the proline-rich PRAD peptide, which provides the tetrameric form of the modified butyrylcholinesterase enzyme,

The nucleotide sequence of the self-processing peptide F2A, which is in a single reading frame with the modified butyrylcholinesterase gene and the nucleotide sequence of the proline-rich PRAD peptide, provides simultaneous expression of the butyrylcholinesterase and proline-rich peptide PRAD genes,

the nucleotide sequence of a synthetic gene for human butyrylcholinesterase modified encoding the variant enzyme butyrylcholinesterase the replacement sequence 284-TPLSV-288 in the sequence 284-HTIHG-288, which provides the modified enzyme products rhBChE-14, capable of inhibiting reactivation after covalent paraoxon and not susceptible to aging

The nucleotide sequence of binding to the nuclear matrix (MAR X-29), allowing to increase the production of the target protein due to both an increase in the transcription level of the gene located in close proximity, and due to the greater stability of the ribosome-transcript complex.

The invention is illustrated by the following graphic materials:

FIG. 1. Scheme of the genetic construct - recombinant plasmid DNA pFUSE-MARX-29-PRAD-F2 A / BChE-14.

FIG. 2. Analytical expression of clones obtained after transfection of cells of the CHO K-1 cell line. The enzyme activity in the culture fluid of the best clones from the transformation series is presented.

FIG. 3. Analysis of the oligomeric composition of the products of the best clones of the modified butyrylcholinesterase rhBChE-14.

Table 1. Kinetic analysis of the enzyme modified butyrylcholinesterase rhBChE-14.

The invention is illustrated by the following examples.

EXAMPLE 1

Creation of the genetic construct pPicZαA / BChE.

The modified butyrylcholinesterase gene sequence is obtained from the pBudCE / EF / BCHE genetic construct Ilyushin D.G. et al. Proc. Natl. Acad. Sci. USA. 2013 using PCR with overlapping primers and kit atctcgaggatagcaaagtcacaatcatatgcat oligonucleotides, gtcccctatgggcacaccatccacggt, cacaccatccacggtaactttggtccgac, aagcggccgctcagagacccacacaactttctttct and subsequent cloning in vector pFUSE MAR PRAD-F2A-BChE [Terekhov et al., Biochimie 2015] using restriction endonucleases NotI and XhoI, to obtain a genetic construct pFUSE-MARX-29-PRAD-F2A / BChE-14 (Fig. 1).

EXAMPLE 2

Transfection and analytical expression of the genetic construct pPicZαA / BChE-14.

The resulting construct pFUSE-MARX-29-PRAD-F2A / BChE-14 is linearized and used for a series of transfections of CHO K-1 cells. Selection is carried out using the antibiotic zeocin at a concentration of 1.5 mg / ml. For the selection of producer strain clones, cells are grown in Advanced DMEM medium containing 10% fetal bovine serum. When confidentiality is reached more than 90%, the medium is replaced with a protein-free medium ProCHO-4, ProCHO-5 or similar. After 72 hours, the medium is centrifuged and analyzed by the method of Ellman (Fig. 2).

The expression level of the modified butyrylcholinesterase enzyme was found to be from 21 to 42 μg / ml.

EXAMPLE 3

Analysis of the oligomeric composition of the modified human rhBChE-14 butyrylcholinesterase.

Electrophoretic separation of proteins in PAAG under non-denaturing conditions was carried out according to standard methods. Samples, the control sample and the sample of the modified human butyrylcholinesterase rhBChE-14 were applied in a buffer: 10% glycerol, 0.2 M Tris-HCl, pH 7.5. Electrophoresis in a concentrating gel was carried out at a current of 8-10 mA per 1 gel plate, and in separating gel at 15-20 mA. At the end of electrophoretic separation of proteins in a non-denaturing PAG, the gel plate was transferred to a solution containing 125 mM NaOH, 125 mM maleic acid, 11.6 mM sodium citrate, 10 mM CuSO4, 550 μM potassium hexacyanoferrate (III) and 2 mmm butyrylthiocholine iodide. The gel was incubated in solution for 3-8 hours at room temperature on an orbital shaker. The evaluation of the oligomeric composition was performed by densitometry of a polyacrylamide gel using TotalLab software TY 20. Analysis of the results suggests that the synthesized target product of the modified human butyrylcholinesterase rhBChE-14 is active, and for clones A11, B3 and F3, the content is exclusively of tetrameric form (Fig. 3). )

EXAMPLE 4

Analysis of kinetic parameters.

To assess the reactivity of the preparations obtained with respect to paraoxon, kinetic measurements were performed according to the following scheme: a sample of modified human butyrylcholinesterase rhBChE-14 at a concentration of 2 nM was preincubated with paraoxon at a concentration of 6 μM for 5 min in 0.1 M phosphate buffer (pH = 7.4 ) at 25 ° C. After incubation, residual activity was measured by the standard Eman method with 1 mM butyrylthiocholine iodide (BTC) and 0.5 mM DTNB as a substrate in 0.1 M potassium phosphate buffer, pH 7.2. For the measurements, a Varioscan spot spectrophotometer was used (Thermo Scientific, USA, Technological Park IBC). The measurements were carried out at a wavelength of 405 nm for 60 min. The obtained data were analyzed using the SigmaPlot software (ver. 11.0, SYSTAT Software). The number of active BChE centers was determined by titration with diisopropylfluorophosphate (DFP) according to the standard Ellman method. The observed inhibition constants were calculated as the angle of inclination of the linear portion of the curve on the graph Ln (E / E0) versus time (Table 1)

Annex 1.

The nucleotide sequence of the recombinant plasmid DNA pFUSE-MARX-29-PRAD-F2 A / BChE-14

Claims (1)

Recombinant plasmid DNA pFUSE-MARX-29-PRAD-F2A / BChE-14, which encodes the enzyme modified human butyrylcholinesterase, where the modification is a replacement of the sequence 284-TPLSV-288 by the sequence 284-HTIHG-288, which provides the production of the modified rhBChE-ch8EE-148-chit-288 enzyme, providing the production of the modified rhBChE-ch8 -E288-h8hE-288 sequence. human, consisting of the plasmid pFUSE, containing the synthetic hEF / HTLV promoter, the nucleotide sequence of the BleoR gene, the nucleotide sequence of the proline-rich peptide gene of PRAD tetramerization, the nucleotide sequence of the self-processing p the F2A peptide, located in a single reading frame with the modified butyrylcholinesterase gene, and the nucleotide sequence of the synthetic gene of modified human butyrylcholinesterase, as well as the nucleotide sequence of the binding to the nuclear matrix (MAR X-29).

Images