KR101634244B1 - Method for preparing grk5 knockout mouse using talen - Google Patents

Abstract

The present invention relates to a method for easily and efficiently producing GRK5 knockout transgenic mice using a transcription activator-like effector nuclease (TALEN), wherein the transgenic mice produced by the method of the present invention are useful for the treatment of Alzheimer's disease Can be used as an animal model for studying causes and pathogenic mechanisms and for developing new drugs.

Description

METHOD FOR PREPARING GRK 5 KNOCKOUT MOUSE USING TALEN < RTI ID = 0.0 >

The present invention relates to a method for producing a GRK5 knockout transgenic mouse using TALEN (transcription activator-like effector nuclease).

Alzheimer's disease is the most common form of dementia, a degenerative brain disease in which mental function declines gradually as brain tissue loses function in the aging process. It is known that Alzheimer's disease is caused by the accumulation of neurotoxic substances such as β-amyloid protein and tau protein, which causes oxidative stress to cause death of nerve cells.

Currently, the precise cause and pathogenesis of Alzheimer's disease is not fully understood. Alzheimer's disease model is widely used as a target for researching the cause and mechanism of development of Alzheimer's disease and developing new drugs.

Examples of animal models of Alzheimer's disease include transgenic mice in which amyloid protein is modified or transgenic mice in which tau protein is modified, which are major causes of Alzheimer's disease. These transgenic mice are prepared by inserting desired DNA into a viral vector, A method in which a specific DNA is directly injected into an embryo of an animal or a method in which a specific DNA is once injected into a stem cell and then introduced into a developing embryo, There is a problem that it is not easy to produce an effective transgenic mouse and it takes much time and effort.

Recently, a genome editing system of genes using Zinc-Finger Nuclease (ZFN) and TALEN has been developed (Boch, Jens, Nature Biotechnology, 29 (2): 1356, 2011) Development of transgenic animals such as knockout mice has become easier (Davies B et al., PLoS One 8: e60216, 2013). However, in order to develop an effective transgenic animal, it is also necessary to select an appropriate disease-related gene and target site and optimize the process.

Accordingly, the inventors of the present invention have completed the present invention by confirming that knockout mice GRK5 gene can be produced by cleaving mouse GRK5 gene using TALEN targeting a specific exon region in mouse.

Accordingly, an object of the present invention is to provide a method for producing a transgenic mouse knocked out of the GRK5 gene.

Another object of the present invention is to provide a transgenic mouse knocked out of the GRK5 gene produced by the above method.

In order to accomplish the above object, the present invention provides a method for detecting a specific activity of a cell, using a transcription activator-like effector nuclease (TALEN) comprising a transcription activator-like effector DNA binding domain and a DNA cleavage domain Wherein the specific gene is a mouse GRK5 (G protein-coupled receptor kinase 5) gene, and the TAL effector DNA binding domain is represented by SEQ ID NO: 3 in the GRK5 gene. Wherein the compound is coupled to exon 5, which is an agonist of the present invention.

Further, according to another object, the present invention provides a GRK5 knockout mouse produced by the above method, wherein GRK5 knockout is maintained in F1, F2 and F3 mice at crossing.

The present invention provides a convenient method for producing transgenic mice knocked out of the mouse GRK5 gene using TALEN. Therefore, the mouse prepared above can be used as an animal model for studying the cause and pathogenesis of Alzheimer's disease and developing new drugs Can be usefully used.

FIG. 1 is a schematic view showing a process of preparing a GRK5 knockout mouse using TALEN according to the present invention.
FIG. 2 is a photograph showing the expression of the surrogate reporter on the day 0, day 1, day 2, and day 3 after transfection of 293 T cells with TALEN and a surrogate reporter as fluorescence images of cells.
FIG. 3 shows the ratio of knockout cells in plasma cells using a cell analyzer after transfecting 293 T cells with TALEN and surrogate reporter.
Figure 4 shows the T7E1 assay results of a GKR5 knockout transgenic mouse (F0) produced using TALEN against exon 5. In the figure, WT denotes a wild type mouse, and # 1 to # 53 indicate the number of each mouse object. # 28, # 39, and # 41 represent knocked out individuals as a result of T7E1 analysis.
Figure 5 compares the deletion target sequence and amino acid sequence of the knockout transgenic mice (F028, F039, F041) prepared according to the present invention with wild-type mice.
FIG. 6A shows the knockout gene transfer ratio of progeny obtained by crossing knockout transgenic mice (F028, F039, F041) prepared according to the present invention with wild type mice, and FIG. 6B shows T7E1 analysis And 6C compares the deletion target sequence and amino acid sequence of the mutant confirmed strain.
FIG. 7A shows the process for preparing an F3 homozygote from transgenic mice (F028, F039, F041) prepared according to the present invention, 7B shows PCR results for each F3, The results of T7E1 analysis for the wild relatives are shown.
FIG. 8A shows a process for preparing an F2 homozygote from a transgenic mouse F041 prepared according to the present invention, and FIG. 8B shows the result of T7E1 analysis for each F2 member and a comparison between a target nucleotide sequence and an amino acid sequence.

Hereinafter, terms used in the present invention will be described.

As used herein, the term "GRK5 (G protein-coupled receptor kinase 5)" is one of seven GRK family members known to date and functions to desensitize phosphorylated receptors (GPCR) bound to G proteins. GRK5 mRNA is widely expressed in the brain (hippocampus) and peripheral tissues, especially in the heart, lung and placenta. In a cellular model system, GRK5 can phosphorylate several neuronal GPCRs including the? 2-adrenergic receptor, M2-muscarinic receptor, secretin, angiotensin AT1, and aorticotropic hormone receptor. Recently, it has been shown that GRK5 deficiency is associated with early Alzheimer's disease (AD) and that GRK5 knockout mice can be used as models for early Alzheimer's disease studies (Suo Z et al., Neurobiol. Aquing, 2007 Suo Z et al., Advances in Alzheimers Disease 2 (2004), < RTI ID = 0.0 > 2013) 148-160).

The term "transcription activator-like effector nuclease " (TALEN) as used herein refers to an artificial neuron produced by fusing a transcription activator-like effector DNA binding domain into a DNA cleavage domain As a cleavage agent, it is very effective in inducing mutations in specific genomic loci.

The DNA cleavage domain in TALEN can be a DNA cleavage domain derived from FokI endonuclease, which results in double strand breakage (DSB) when the dimer is formed. DSB is a fairly deadly DNA damage, and life has a repair mechanism, one of which is the non-homologous end-joining (NHEJ) method in which the truncated end region of the DNA is directly connected to be. When NHEJ occurs, the truncated portion of the DNA is immediately reconnected by DNA ligase, and some DNA base pairs are lost during this process. TALEN is a technique for manipulating genes using DSB by FokI and NHEJ for them. When NHEJ occurs in DNA truncated by TALEN, DNA template by homologous recombination (HR) can be obtained instead of NHEJ by providing an appropriate DNA template, and the DNA template provided can be inserted into the gene. Unlike conventional restriction enzymes that recognize specific DNA base pairs and cut DNA, FokI cuts DNA randomly when it becomes a dimer, so if you make TALEN in a form that can bind to a desired site, . For specific information on TALEN, see Boch, Jens, Nature Biotechnology, 29 (2): 1356, 2011).

The present invention provides a method of knocking out a specific gene using a transcription activator-like effector nuclease (TALEN) comprising a transcription activator-like effector DNA binding domain and a DNA cleavage domain, Wherein the specific gene is a mouse GRK5 (G protein-coupled receptor kinase 5) gene, and the TAL effector DNA binding domain binds to exon 5 in the GRK5 gene. To provide a method for producing a GRK5 knockout mouse.

Mice transfected with a specific gene using a transcription activator-like effector nuclease (TALEN) containing a transcription activator-like effector DNA binding domain and a DNA cleavage domain The method of preparation is described in Tesson, L. et al., Nature Biotechnology, 29 (8): 695696, 2011; Davies B et al., PLoS One 8: e60216, 2013, the disclosure of which is incorporated herein by reference.

The present invention is characterized in that a GRK5 knockout mouse is produced using TALEN comprising a TAL effector DNA binding domain which binds to exon 5 in the mouse GRK5 gene. In addition, the GRK5 knockout mouse produced in the present invention is characterized by being used as an animal model of Alzheimer's disease.

The method for producing the GRK5 knockout mouse according to the present invention can be manufactured through the following steps, but is not limited thereto.

<Step 1> TALEN Production

The TALEN used in the method of the present invention comprises a TAL effector DNA binding domain and a DNA cleavage domain, wherein the TAL effector DNA binding domain binds to exon 5 in the GRK5 gene. In one embodiment, the TALEN used in the method of the present invention comprises a TAL effector DNA binding domain and a DNA cleavage domain, wherein the TAL effector DNA binding domain comprises the nucleotide sequence of SEQ ID NO: 10 in exon 5 within the GRK gene, And binds to a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 12. In another embodiment, the TALEN used in the method of the invention is a first TALEN (left TALEN) comprising a TAL effector DNA binding domain and a DNA cleavage domain; And a second TALEN (right TALEN) comprising a TAL effector DNA binding domain and a DNA cleavage domain, wherein the first TALEN binds to a nucleotide sequence of SEQ ID NO: 10 in exon 5 within the GRK5 gene, TALEN binds to a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 12 in exon 5 within the GRK5 gene. In another embodiment, the TAL effector DNA binding domain of the first TALEN has the nucleotide sequence shown in SEQ ID NO: 17, and the TAL effector DNA binding domain of the second TALEN has the nucleotide sequence shown in SEQ ID NO: 18.

In addition, the DNA cleavage domain of TALEN may be in the form of a DNA cleavage domain derived from FokI endonuclease or a variant thereof known in the art, and may recognize the spacer (SEQ ID NO: 11) in exon 5.

The TALEN used in the present invention can be prepared by methods known in the art and can be manufactured by TALEN suppliers such as, for example, Addgene, Tulzen and the like.

<Step 2> TALEN mRNA Manufacturing

The TALEN used in the present invention is made into mRNA for injection into a mouse. TALEN the mRNA is a method of preparing a vector including a nucleotide encoding a TALEN and linearizing it, and then, in vitro (in vitro ) transcription.

The vector containing the TALEN-encoding nucleotide is linked to a nucleotide encoding a first TALEN (left TALEN) and a second TALEN (right TALEN) downstream of the ampicillin antibiotic (Amp +) resistance site and the cytomegalovirus (CMV) promoter , FokI nuclease followed by bovine growth hormone poly A (BGH polyadenylation sequence). The vector can be linearized by digesting with PvuI restriction enzyme and then mRNA can be synthesized using a kit for mRNA synthesis, for example, a mMACHINE T7 Ultra Kit (manufactured by Ambion).

<Step 3> TALEN mRNA Into the mouse embryo

The TALEN mRNA may be injected into a mouse embryo by methods commonly known in the art. Specifically, the fertilized eggs for injection were prepared by injecting 7.5 IU of female sex mouse (PMSG, PMSG, manufactured by Sigma) with 7.5 IU (human chorionic gonadotropin hCG, Sigma product) at 24 hours After induction, mice were induced to be fertilized on the same day, and fertilized eggs were obtained from the fallopian tubes at 13-14 hours after fertilization. After the modification, the first TALEN (left TALEN) and the second TALEN (right TALEN) are injected into the cytoplasm of mouse 1 st cell embryos using a microinjector at a concentration of 4 ng / ul.

<Step 4> Embryo transfer

The embryos implanted with the TALAEN mRNA can be cultured in a 37 ° C incubator for 24 hours and transplanted into the surrogate mother in a two-celled state.

The method of the present invention may further comprise the step of confirming mutagenesis in the mouse produced in step (4). The confirmation can be made by T7E1 analysis and sequence analysis, but can also be confirmed by methods known in the art.

On the other hand, the present invention provides a GRK5 knockout mouse which is produced by the method described above, and GRK5 knockout is maintained in F1, F2 and F3 mice when crossed.

In an exemplary embodiment, the transgenic mice produced by the method of the present invention are characterized in that 45, 3 or 2 bases in exon 5 of GRK5 are deleted compared to wild type mice (see FIG. 5).

In addition, the transgenic mouse (F0) according to the present invention maintains GRK5 knockout even in F1, F2 and F3 mice when crossed. According to the experimental results of the present invention, the mutant produced by crossing the transgenic mouse according to the present invention with a wild type (WT) mouse (F1, F2 or F3) has the same mutation as the transgenic mouse according to the present invention, For example, 45, 3 or 2 base deletions in GRK5.

In addition, the transgenic mouse according to the present invention has a homozygote in F2 or F3. The knockout transgenic mouse having the homozygote is superior to the transgenic mouse having the heterozygote for transgenic knockout of GRK5 double strand.

The transgenic mice according to the present invention can be knocked out of the GRK5 gene and used as an Alzheimer's disease model.

EXAMPLES Hereinafter, the present invention will be described in detail with reference to Examples. However, the following Examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

Example  One: TALEN Using GRK5 Knockout  Manufacture of mice

<1-1> TALEN &Lt; / RTI &gt;

Exon 1, exon 3 and exon 5 of GRK5 were selected as knockout genes to produce a mouse knockout mouse GRK5 (G protein-coupled receptor kinase 5) gene. (SEQ ID NO: 1, GenBank Accession No. AF040755) of the GRK5 gene in mouse, the entire nucleotide sequence of exon 3 (SEQ ID NO: 2, GenBank Accession No. AF040757) and the entire nucleotide sequence of exon 5 3, GenBank Accession No. AF040759) were analyzed to determine the respective base sequence regions of the exons to which the TAL effector DNA binding domain could bind (SEQ ID NOS: 4 and 6, 7 and 9, and 10, 12). Based on this, the first TALEN (left TALEN) and the second TALEN (right TALEN) were produced by commissioning to Tulzen.

The base sequence region to which the DNA binding domain of the left TALEN binds Spacer The base sequence region to which the DNA binding domain of the right TALEN binds
(Bound to a sequence complementary to the following sequence) Exon 1 TCCCTCGCTGACTGCCGACT
(SEQ ID NO: 4) GTCAATGGAGCT
(SEQ ID NO: 5) GGAAAACATCGTGGCCAACA
(SEQ ID NO: 6) Exon 3 TGCTTTTTCGACAGTTCTGT
(SEQ ID NO: 7) GAAACCAGGCCT
(SEQ ID NO: 8) GGGCTGGAGTGCTACATTCA
(SEQ ID NO: 9) Exon 5 TTGCCCAAGTTGGACAGGA
(SEQ ID NO: 10) CTGGTCTCCCAG
(SEQ ID NO: 11) ACAGAGAAGAAGCTCCTGCA
(SEQ ID NO: 12)

Specifically, each TALEN comprises a TAL effector DNA binding domain and a DNA cleavage domain (derived from a FokI endonuclease), wherein (1) a TAL effector having a nucleotide sequence of SEQ ID NO: 13 for TALEN binding to exon 1, DNA binding domain, and a second TALEN comprising a TAL effector DNA binding domain having the nucleotide sequence of SEQ ID NO: 14; (2) in the case of TALEN binding to exon 3, A first TALEN comprising a TAL effector DNA binding domain having a base sequence and a second TALEN comprising a TAL effector DNA binding domain having a base sequence of SEQ ID NO: 16, and (3) a second TALEN comprising a TALEN A first TALEN comprising the TAL effector DNA binding domain having the nucleotide sequence of SEQ ID NO: 17, and a second TALEN comprising the TAL effector DNA binding domain having the nucleotide sequence of SEQ ID NO: 18.

Each TALEN for exons 1, 3 and 5 was cloned into a pcDNA-TAL-NC plasmid with reference to the method described in Sakuma, T. et al., Genes Cells, 18, 315326 (2013) A vector containing each TALEN was prepared.

<1-2> TALEN mRNA Through microinjection of GRK -5 Knockout  Embryo Production and Transplantation

The vector containing each TALEN prepared in Example 1 was digested with Pvu II restriction endonucleases and then linearized by phenol / chloroform extraction and ethanol precipitation. Then, 1 g of the linearized plasmid was used as a template and in vitro (according to the manufacturer's instructions) with mMessage mMachine T7 Ultra kit (Life Technologies) vitro ) transcription reaction was performed.

The synthesized mRNA was purified using a MegaClear kit (Life Technologies). The RNA concentration was determined using a NanoDrop 1000 spectrometer (NanoDrop Technologies, Inc.), and the concentration of the RNA was measured using an injection buffer (10 mM TrisHCl / 0.1 mM EDTA pH 7.4)) was used to dilute the total amount of both TALEN mRNAs to 600 ng / ml (1: 1 ratio, i.e. 300 ng / ml each). A mixture of the two TALEN mRNAs (4 ng / l) was injected into the cytoplasm of 180 single cell embryos of C57BL6 mice according to the standard method (Sung et al, Nature Biotechnology, 2013, 31: 23-24 page). The injected embryos were cultured in M16 medium for 24 hours at 37 DEG C and then the embryos differentiated into 2-cell stage were transfected into seven embryonic C57BLs according to the standard method (Hogan, Nature, 1983, 306: 313-314) / 6 &lt; / RTI &gt; All animal protection protocols and experiments were approved by Seoul National University Animal Experimental Ethics Committee.

Example  2: Analysis of transformed cells

A surrogate reporter vector (a kanamycin resistant region) encoding a fusion protein of monomeric red fluorescent protein (mRFP) - enhanced green fluorescent protein (eGFP) ), The target sequence in exon 5 described in Table 1 was inserted between the mRFP and the DNA sequence encoding eGFP (inserted in the XmaI and XbaI restriction enzyme sites downstream of the CMV promoter) so that the eGFP sequence was located outside the frame of the mRFP sequence Fused. The stop codon was inserted upstream of the eGFP sequence.

After transfecting 293 T cells with 0.4 uL of the lipofectamine and the reporter vector at a ratio of 2: 1: 1 to the first TALEN and the second TALEN, the cells were cultured at 0, 1, 2, Fluorescence images were taken using a FACS analyzer (FACSAria II or FACSVantage SEM (BD Biosciences)). The results are shown in Fig.

As shown in FIG. 2, the proportion of cells expressing both RFP and GFP simultaneously after transfection, that is, transformed cells, was increased.

In the same manner as above, 293 T cells were transfected with a surrogate reporter inserted with the target sequence of exons 1, 3 or 5 described in Table 1 and TALEN, and the cells were classified by flow cytometry. The results are shown in Fig. As a result, the proportion of transformed cells was found to increase.

The results show that TALEN can be used to knock out exons 1, 3 or 5 of the GRK5 gene.

On the other hand, in FIG. 3, the exon 5 was more efficiently cleaved than the exons 1 and 3 (exon 1: 8.7%, exon 3: 9.7% and exon 5: 12.7% Were used only in mice.

Example  3: TALEN  Mutation confirmation in mice by treatment

Sixty offspring from the mice prepared in Example 1 were obtained and the mutation in the surviving 53 mice was confirmed by T7E1 and sequencing.

Double strand breaks (DSBs) induced by TALEN, a genetic scissors (artificial DNA restriction enzyme), are generated by an error-prone non-homologous end joining (NHEJ) Can be restored. The resulting DNA contains a small DNA sequence insertion / deletion (indel) mutation near the site where the DSB occurred. Insertion / deletion mutations of DNA sequences of these specific sites can be searched in vitro by treating amplified DNA fragments with mismatch-sensitive T7 endonuclease I (T7E1) .

For this, genomic DNA was isolated from the transgenic mouse using G-spin Genomic DNA Extraction Kit (Intron Bio). Sequences around the TALEN target site were amplified by PCR using primers specific for the mouse GRK5 gene exon 5 (SEQ ID NOS: 19 and 20). A PCR amplicon containing the TALEN target site was analyzed by a mismatch-sensitive T7 endonuclease cleavage assay. Briefly, if the TALEN target site is cleaved by TALEN, the DNA DSB can be restored by the error-prone NHEJ mechanism and thus induce indel to the target site in the subpopulation of the transformed cells. The polymerized DNA was treated with 5 units of T7E1 at 37 占 폚 for 15 minutes and precipitated by the addition of 2.5 times of ethanol. Amplified GRK5 exon 1, 3 or 5 fragments treated with wild type alleles and T7E1 enzyme were analyzed on 2% agarose gel electrophoresis to identify the mutated alleles.

The results are shown in Fig. As shown in FIG. 4, it was confirmed that mutation occurred in exon 5 of mouse of F028 (# 28), F039 (# 39), and F041 (# 41).

Meanwhile, the specific nucleotide sequences of the exon 5 regions of the mice of F028, F039 and F041 were compared with wild-type (WT) mice not mutated.

The nucleotide sequence was analyzed by dideoxynucleotide DNA sequencing method, and the results are shown in Fig.

As shown in FIG. 5, the F028 mouse had a 45 bp base deletion in the exon 5 as compared with the wild-type mouse. In the F039 mouse, the 3 bp base was deleted compared to the wild-type mouse. 2 bp of the base was deleted.

The results show that transgenic mice in which a specific gene region of GRK5 has been mutated can be produced by the method of the present invention.

Example  4: Transfection of mouse In progeny  Genotype identification

After the transgenic mouse (F0) identified in Example 3 was mated with a wild-type (WT) mouse, the genotype of the produced plant (F1) was confirmed by T7E1 analysis and sequencing.

Specifically, F028, F039 and F041 mice were crossed with wild-type (WT) mice by the multiplex method. From the F028 mice, 6 live animals were produced, 16 from the F039 mice were produced, and 7 from the F041 mice were produced (see Fig. 6A).

As a result of performing T7E1 analysis in the same manner as in Example 3 for the above-described Sanjay (F1), 3 outbreaks (37.5%) in F1 28, 6 strains (37.5%) in F139 and 4 strains Mutants were detected in the wild (57.1%) (see FIG. 6B). The results show that the mutants of the present invention are maintained in the strain at a high rate despite crossing with wild type mice.

On the other hand, the nucleotide sequence of the mutant was confirmed and compared with the nucleotide sequence of the wild-type mouse, and the result is shown in FIG. 6C. As shown in FIG. 6C, it is confirmed that the living organisms F1 maintain the same mutation as the parent (F0). The results show that the mutation of the present invention is maintained without further mutation despite mating with a wild-type mouse.

Example  5: GRK5  Generation of homozygotes

F028 mice were mated with 2 wild-type mice to produce F1 plants, and F1 # 6 mice were mated with wild-type mice to produce F2 plants. F1 # 9 mouse and F2 # 7 mouse were also crossed to produce F3 acid. Furthermore, F1 # 10 mice were crossed with F2 # 9 mice to produce F3 acid. Finally, F1 # 12 mouse and F2 # 10 mouse were crossed to produce F3 acid (Fig. 7A).

The generated F3 acid was confirmed by PCR analysis to generate a homozygous exon 5 in the GRK5 gene. The results are shown in Fig. 7B. As a result of the PCR analysis, three mice of # 3, # 5 and # 6 among eight F3 plants (F3 28-6-1 ~ 8) obtained by crossing F1 # 9 mouse and F2 # Respectively. It was also confirmed that one mouse of # 5 among the 6 F3 mice (F3 28-6-9-1 ~ 6) obtained by crossing the F1 # 10 mouse with the F2 # 9 mouse was homozygous. In addition, three mice of # 3, # 4 and # 10 among 10 F3 mice (F3 28-6-10-1 ~ 10) obtained by crossing F1 # 12 mice and F2 # 10 mice were homozygous Respectively. The results of F3 28-6-10-1 ~ 10 were supported by T7E1 analysis (Figure 7C).

On the other hand, F041 mouse was crossed with two wild type mice to produce F1 mutant, and F1 # 13 mouse and F1 # 2 mouse were crossed to obtain F2 (FIG. 8A).

As a result of performing T7E1 analysis on the F2 member, it was confirmed that mice of # 4, # 7, and # 8 among 8 animals were homozygous (FIG. 8B).

The results show that transgenic mice prepared according to the method of the present invention can be obtained by transfecting a transgenic mouse having a homozygous deletion of exon 5 in the GRK5 gene, It is possible to obtain a transgenic mouse having excellent characteristics.

<110> Hankyong Industry Academic Cooperation Center <120> METHOD FOR PREPARING GRK5 KNOCKOUT MOUSE USING TALEN <130> FPD / 201309-0029 <160> 20 <170> Kopatentin 2.0 <210> 1 <211> 292 <212> DNA <213> Mus musculus <220> <221> exon &Lt; 222 > (1) .. (292) <223> GRK 5 exon 1 <400> 1 gaaagtgttg agggaggggg gaggggggac acagagggag gaagaagcgg cggcggcgtc 60 tcttcggtgc agagggggaa actccgcggg ctccgagaaa gaataatgcg gtagcaggca 120 ggctgcttgc tctggggttt ggcagcagcg gcggcagctc gagcagcggc agcggcagcg 180 gcatcatccc agacgctgac agcacagccg gccggctccc tcgctgactg ccgactgtca 240 atggagctgg aaaacatcgt ggccaacacg gtcttgctga aagcccggga ag 292 <210> 2 <211> 113 <212> DNA <213> Mus musculus <220> <221> exon &Lt; 222 > (1) .. (113) <223> GRK5 exon 3 <400> 2 acagagatta ctacagtcta tgtgacaagc aaccaattgg gagactgctt tttcgacagt 60 tctgtgaaac caggcctggg ctggagtgct acattcagtt cctggactta gtg 113 <210> 3 <211> 101 <212> DNA <213> Mus musculus <220> <221> exon &Lt; 222 > (1) <223> GRK5 exon 5 <400> 3 tccccagtct tcattgccca agttggacag gacctggtct cccagacaga gaagaagctc 60 ctgcagagcc cctgcaaaga actcttctct gcttgtgctc a 101 <210> 4 <211> 20 <212> DNA <213> Mus musculus <400> 4 tccctcgctg actgccgact 20 <210> 5 <211> 12 <212> DNA <213> Mus musculus <400> 5 gtcaatggag ct 12 <210> 6 <211> 20 <212> DNA <213> Mus musculus <400> 6 ggaaaacatc gtggccaaca 20 <210> 7 <211> 20 <212> DNA <213> Mus musculus <400> 7 tgctttttcg acagttctgt 20 <210> 8 <211> 12 <212> DNA <213> Mus musculus <400> 8 gaaaccaggc ct 12 <210> 9 <211> 20 <212> DNA <213> Mus musculus <400> 9 gggctggagt gctacattca 20 <210> 10 <211> 19 <212> DNA <213> Mus musculus <400> 10 ttgcccaagt tggacagga 19 <210> 11 <211> 12 <212> DNA <213> Mus musculus <400> 11 ctggtctccc ag 12 <210> 12 <211> 20 <212> DNA <213> Mus musculus <400> 12 acagagaaga agctcctgca 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DNA binding domain of left TALEN for exon 1 <400> 13 agggagcgac tgacggctga 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DNA binding domain of right TALEN for exon 1 <400> 14 acaaccggtg ctacaaaagg 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DNA binding domain of left TALEN for exon 3 <400> 15 acgaaaaagc tgtcaagaca 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DNA binding domain of right TALEN for exon 3 <400> 16 acttacatcg tgaggtcggg 20 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> DNA binding domain of left TALEN for exon 5 <400> 17 aacgggttca acctgtcct 19 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DNA binding domain of right TALEN for exon 5 <400> 18 acgtcctcga agaagagaca 20 <210> 19 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer for exon 5 of GRK5 <400> 19 tgtgaccata tgcagggaca ggta 24 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer for exon 5 of GRK5 <400> 20 caaagaagac agggatcttc ccaa 24

Claims (4)

Mice transfected with a specific gene using a transcription activator-like effector nuclease (TALEN) containing a transcription activator-like effector DNA binding domain and a DNA cleavage domain In the method of manufacturing,
Wherein the specific gene is a mouse GRK5 (G protein-coupled receptor kinase 5) gene, and the TAL effector DNA binding domain binds to exon 5 represented by SEQ ID NO: 3 in the GRK5 gene. A method of manufacturing a knockout mouse.
The method according to claim 1, wherein the TAL effector DNA binding domain binds to a base sequence complementary to a base sequence represented by SEQ ID NO: 10 and / or a nucleotide sequence complementary to a base sequence represented by SEQ ID NO: 12 in exon 5 within a GRK gene. To produce a GRK5 knockout mouse.
A GRK5 knockout mouse produced by the method of claim 1 or 2, wherein GRK5 knockout is maintained in F1, F2, and F3 mice at breeding.
4. The GRK5 knockout mouse according to claim 3, wherein said GRK5 knockout mouse is used as an Alzheimer's disease model.

Images