RU2639535C2

RU2639535C2 - Method for screening of antitumor preparations - parp1 inhibitors based on biochemical methods of analysis

Info

Publication number: RU2639535C2
Application number: RU2015152272A
Authority: RU
Inventors: Василий Михайлович Студитский; Ольга Игоревна Студитская; Елена Юрьевна Котова; Наталия Валериевна Малюченко
Priority date: 2015-12-07
Filing date: 2015-12-07
Publication date: 2017-12-21
Also published as: RU2015152272A

Abstract

FIELD: biotechnology.SUBSTANCE: to implement this method, nucleosomes are collected from purified histones on DNA matrices, then ligated with RNA polymerase, and the molecular target PARP1 is introduced into the resulting complex, followed by the transcription buffer, as well as the test chemical compounds. The said transcription buffer contains deoxynucleotide triphosphates (dNTPs) and labeled α-32F-GTF. Next, transcription and evaluation of transcription products are carried out by their separation with electrophoresis. The conclusion about the presence of PARP1 inhibitory activity in the test compound is made by presence bands at 15, 45 and in the run-off region on the electrophoregram, showing transcription pausing, as shown in Fig. 1, the said activity rating being carried out with a reference value of PARP1 with NAD.EFFECT: invention allows to increase the specificity and selectivity of a nucleosome-based molecule selection system.19 cl, 2 dwg, 7 ex

Description

Область техники, к которой относится изобретениеFIELD OF THE INVENTION

Изобретение относится к области медицинской и молекулярной биологии, преимущественно к области регуляции экспрессии генов на уровне транскрипции, и может быть использовано, например, для поиска противоопухолевых препаратов, направленных на PARP1 с использованием способа, основанного на применении системы из специальных нуклеосомных матриц, белка PARP1 и буфера внесения. При внесении различных соединений в данную систему может происходить взаимодействие данных веществ с PARP1 и, соответственно, ухудшение связывания PARP1 с нуклеосомными матрицами, что в дальнейшем позволит обнаружить ингибиторы PARP1.The invention relates to the field of medical and molecular biology, mainly to the field of regulation of gene expression at the transcription level, and can be used, for example, to search for anticancer drugs aimed at PARP1 using a method based on the use of a system of special nucleosome matrices, protein PARP1 and application buffer. When various compounds are introduced into this system, the interaction of these substances with PARP1 and, accordingly, the deterioration of the binding of PARP1 to nucleosome matrices can occur, which will subsequently reveal PARP1 inhibitors.

Уровень техникиState of the art

В основе поиска и получения современных лекарственных средств лежит нацеленность на молекулярную мишень. Одна из мишеней, используемых при разработке противоопухолевых препаратов, - фермент поли(ADP-рибозо)полимераза 1 (PARP1), участвующий во многих клеточных процессах, начиная от репарации ДНК до гибели клеток [Kraus W.L., Hottiger М.O. // Mol. Aspects Med. 2013. V. 34. P. 1109-1123]. Недавно показали, что одним из самых ранних событий, происходящих при повреждениях ДНК, является узнавание ферментом PARP1 разрывов ДНК. При возникновении разрывов ДНК, вызванных, в частности, алкилирующими агентами и радиацией, PARP1 связывается с местами разрывов за счет так называемых «цинковых пальцев», расположенных в ДНК-связывающем домене и одновременно синтезирует олиго- или поли(ADP-рибозные) цепочки, ковалентно связываемые с разными акцепторными белками или с собственной молекулой путем перемещения единицы ADP-рибозы от НАД+. В результате в месте разрыва происходит деконденсация хроматина, что облегчает доступ ферментов репарации. Модифицированные поли(ADP-рибозил)ированные белки хроматина привлекают факторы, ремоделирующие хроматин. Следует отметить, что репарация ДНК при активном участии PARP1 происходит лишь при минимальном генотоксическом повреждении. При более сильном повреждении запускается процесс апоптоза, а при обширном повреждении ДНК наблюдается сверхактивация PARP, приводящая к некрозу.The search and obtaining of modern medicines is based on the focus on the molecular target. One of the targets used in the development of anticancer drugs is the enzyme poly (ADP-ribose) polymerase 1 (PARP1), which is involved in many cellular processes ranging from DNA repair to cell death [Kraus W.L., Hottiger M.O. // Mol. Aspects Med. 2013. V. 34. P. 1109-1123]. Recently it has been shown that one of the earliest events occurring during DNA damage is the recognition of DNA breaks by the PARP1 enzyme. In the event of DNA breaks caused, in particular, by alkylating agents and radiation, PARP1 binds to the break points due to the so-called “zinc fingers” located in the DNA binding domain and simultaneously synthesizes oligo or poly (ADP-ribose) chains, covalently bound to different acceptor proteins or to its own molecule by moving units of ADP-ribose from NAD +. As a result, chromatin decondensation occurs at the rupture site, which facilitates the access of repair enzymes. Modified poly (ADP-ribosylated) chromatin proteins attract chromatin remodeling factors. It should be noted that DNA repair with the active participation of PARP1 occurs only with minimal genotoxic damage. With more severe damage, the apoptosis process starts, and with extensive DNA damage, over-activation of PARP is observed, leading to necrosis.

Получено множество данных об участии PARP1 в канцерогенезе. Потеря PARP1 приводит к нарушениям процесса репарации ДНК, ингибированию транскрипции некоторых генов, вовлеченных в репликацию ДНК, регуляцию клеточного цикла. Повышенная экспрессия PARP1 наблюдается в меланомах, опухолях легкого и молочной железы [

, Peralta-Leal A, O'Valle F, Rodriguez-Vargas JM, Gonzalez-Flores A, Majuelos-Melguizo J,

, Serrano S, de Herreros AG, Rodriguez-Manzaneque JC, et al. // PLoS Genet. 2013. V. 9. №6. P. el003531; Nowsheen S, Cooper T, Stanley JA, Yang ES. // PLoS One. 2012. V. 7. №10. P. e46614; Galia A, Calogero AE, Condorelli R, Fraggetta F, La Corte A, Ridolfo F, Bosco Ρ, Castiglione R, Salemi M. // Eur. J. Histochem. 2012. V. 56. №1. P. e9; Csete Bl, Lengyel Z,

, Battyáni Ζ. // Pathol. Oncol. Res. 2009. V. 15. №1. P. 47-53; Telli ML, Ford JM. // Clin. Breast Cancer. 2010. V. 10 Suppl 1. №P. E16-22; Shimizu S, Nomura F, Tomonaga T, Sunaga M, Noda M, Ebara M, Saisho H. // Oncol. Rep.2004. V. 12. P. 821-825]. При этом повышенный уровень экспрессии рассматривается как прогностический признак, связанный с худшим прогнозом выживаемости [Rojo F, Garcia-Parra J, Zazo S, Tusquets I, Ferrer-Lozano J, Menendez S, Eroles Ρ, Chamizo С, Servitja S, Ramirez-Merino Ν, et al. // Ann. Oncol. 2012. V. 23. №P. 1156-1164]. Было показано, что высокий уровень экспрессии PARP1 коррелирует с более агрессивным фенотипом злокачественных опухолей молочной железы (РМЖ) (эстроген-негативный тип РМЖ) [Domagala Ρ, Huzarski Τ, Lubinski J, Gugala K, Domagala W. // Breast Cancer Res. Treat. 2011. V. 127. P. 861-869]. Экспрессия PARP1 может коррелировать с устойчивостью опухолей к терапии [Michels J, Vitale I, Galluzzi L, Adam J, Olaussen KA, Kepp O, Senovilla L, Talhaoui I, Guegan J, Enot DP, et al. // Cancer Res. 2013. V. 73. P. 2271-2280]. Подобная более высокая «злокачественность» связана, видимо, с тем, что повышенная экспрессия PARP1 способствует репарации повреждений ДНК и тем самым преодолению генетической нестабильности, свойственной трансформированным клеткам.A lot of data has been obtained on the involvement of PARP1 in carcinogenesis. Loss of PARP1 leads to impaired DNA repair process, inhibition of transcription of some genes involved in DNA replication, regulation of the cell cycle. Increased expression of PARP1 is observed in melanomas, tumors of the lung and breast [

, Serrano S, de Herreros AG, Rodriguez-Manzaneque JC, et al. // PLoS Genet. 2013. V. 9. No. 6. P. el003531; Nowsheen S, Cooper T, Stanley JA, Yang ES. // PLoS One. 2012. V. 7. No. 10. P. e46614; Galia A, Calogero AE, Condorelli R, Fraggetta F, La Corte A, Ridolfo F, Bosco Ρ, Castiglione R, Salemi M. // Eur. J. Histochem. 2012. V. 56. No. 1. P. e9; Csete Bl, Lengyel Z,

, Battyáni Ζ. // Pathol. Oncol. Res. 2009. V. 15. No. 1. P. 47-53; Telli ML, Ford JM. // Clin. Breast Cancer 2010. V. 10 Suppl 1. No.P. E16-22; Shimizu S, Nomura F, Tomonaga T, Sunaga M, Noda M, Ebara M, Saisho H. // Oncol. Rep. 2004. V. 12. P. 821-825]. Moreover, an increased level of expression is considered as a prognostic sign associated with a worse prognosis of survival [Rojo F, Garcia-Parra J, Zazo S, Tusquets I, Ferrer-Lozano J, Menendez S, Eroles Ρ, Chamizo C, Servitja S, Ramirez-Merino Ν, et al. // Ann. Oncol. 2012. V. 23. No. P. 1156-1164]. It was shown that a high level of PARP1 expression correlates with a more aggressive phenotype of breast cancer (breast cancer) (an estrogen-negative type of breast cancer) [Domagala Ρ, Huzarski Τ, Lubinski J, Gugala K, Domagala W. // Breast Cancer Res. Treat. 2011. V. 127. P. 861-869]. Expression of PARP1 may correlate with tumor resistance to therapy [Michels J, Vitale I, Galluzzi L, Adam J, Olaussen KA, Kepp O, Senovilla L, Talhaoui I, Guegan J, Enot DP, et al. // Cancer Res. 2013. V. 73. P. 2271-2280]. Such a higher “malignancy" is apparently due to the fact that the increased expression of PARP1 promotes the repair of DNA damage and thereby overcomes the genetic instability inherent in transformed cells.

Практически все существующие ингибиторы PARP1 являются миметиками никотинамида, т.е. ориентированы на связывание с каталитическим доменом PARP1 и конкуренцию с НАД+. При проведении расширенных клинических испытаний ингибиторов PARP1 вскрылся целый ряд проблем. Во-первых, соединения, ингибирующие связывание НАД+, имеют довольно низкую специфичность к PARP1, а также блокируют другие ферментативные пути с участием НАД+. Следует отметить, что НАД+ - это кофактор, который взаимодействует со многими ферментами, вовлеченными в ряд клеточных процессов, поэтому конкуренция с НАД+ приводит к высокой токсичности. Во-вторых, остается открытым вопрос о безопасности длительного применения существующих ингибиторов PARP1. Известно, что опухолевые клетки обладают способностью быстро приобретать устойчивость к препаратам, применяемым в качестве длительной монотерапии [Mandery K., Fromm M.F. // Br. J. Pharmacol. 2012. V. 165. Р. 345-362]. Эти проблемы стали причиной того, что многие ингибиторы PARP1 не прошли длительные систематические клинические испытания. Испытания некоторых ингибиторов PARP1 прекращены уже на I и II стадиях из-за высокой токсичности и ряда побочных эффектов. Обнаруженный в КИ ряд побочных эффектов заставляет менять стратегию разработки новых ингибиторов PARP1. Поскольку PARP1 состоит из нескольких функциональных доменов и обладает дополнительными активностями, помимо ферментативной, то активность PARP1 можно регулировать ингибированием данных функциональных доменов. В частности, разрабатываются препараты, направленные на ингибирование связывания PARP1 с ДНК [Kirsanov ΚΙ, Koto va Ε, Makhov Ρ, Golovine K, Lesovaya EA, Kolenko VM, Yakubovskaya MG, Tulin AV. // Oncotarget. 2014 V.5. P. 428-437]. PARP1 играет также ключевую роль в регуляции транскрипции [Maluchenko N.V., Kotova Ε., Chupyrkina A.A., Nikitin D.V., Kirpichnikov M.P., Studitsky V.M. // Mol. biol. Mosc. 2015. V. 49. №1. P. 1-15; Kotova E., Tulin A.V. // Proc. Natl. Acad. Sci. USA. 2010. V. 107. №14. P. 6406-6411]. По мнению авторов, поиск соединений, способных предотвращать участие PARP1 в процессе транскрипции, может привести к разработке нового класса лекарственных средств, имеющих более высокую специфичность и менее выраженные побочные эффекты. Используя полученную ранее авторами систему транскрипции в нуклеосомных системах, становится возможным обнаружение новых ингибиторов PARP1.Almost all existing PARP1 inhibitors are nicotinamide mimetics, i.e. focused on binding to the catalytic domain of PARP1 and competition with NAD +. An extended clinical trial of PARP1 inhibitors revealed a number of problems. First, compounds that inhibit NAD + binding have a rather low specificity for PARP1 and also block other enzymatic pathways involving NAD +. It should be noted that NAD + is a cofactor that interacts with many enzymes involved in a number of cellular processes, therefore, competition with NAD + leads to high toxicity. Secondly, the question of the safety of long-term use of existing PARP1 inhibitors remains open. It is known that tumor cells have the ability to quickly acquire resistance to drugs used as long-term monotherapy [Mandery K., Fromm M.F. // Br. J. Pharmacol. 2012. V. 165. R. 345-362]. These problems have caused many PARP1 inhibitors to fail lengthy systematic clinical trials. Tests of some PARP1 inhibitors were discontinued already at stages I and II due to high toxicity and a number of side effects. A number of side effects found in CI make us change the strategy of developing new PARP1 inhibitors. Since PARP1 consists of several functional domains and has additional activities besides enzymatic, PARP1 activity can be regulated by inhibition of these functional domains. In particular, preparations are being developed aimed at inhibiting the binding of PARP1 to DNA [Kirsanov ΚΙ, Koto va Ε, Makhov Ρ, Golovine K, Lesovaya EA, Kolenko VM, Yakubovskaya MG, Tulin AV. // Oncotarget. 2014 V.5. P. 428-437]. PARP1 also plays a key role in the regulation of transcription [Maluchenko N.V., Kotova Ε., Chupyrkina A.A., Nikitin D.V., Kirpichnikov M.P., Studitsky V.M. // Mol. biol. Mosc. 2015. V. 49. No. 1. P. 1-15; Kotova E., Tulin A.V. // Proc. Natl. Acad. Sci. USA 2010. V. 107. No. 14. P. 6406-6411]. According to the authors, the search for compounds that can prevent the participation of PARP1 in the transcription process may lead to the development of a new class of drugs with higher specificity and less pronounced side effects. Using the transcription system obtained earlier by the authors in nucleosome systems, it becomes possible to detect new PARP1 inhibitors.

Нуклеосомные поверхности можно использовать в качестве основы для разработки способа скрининга соединений, вызывающих изменение транскрипционной активности различных белков, в частности PARP1.Nucleosome surfaces can be used as the basis for the development of a method for screening compounds that cause a change in the transcriptional activity of various proteins, in particular PARP1.

Известен способ использования нуклеосом в качестве биосенсоров [United States Patent Application 20090062130 Nucleosome-based biosensors // Application Number 11/687859]. Подобный биосенсор состоит, по крайней мере, из одной нуклеосомы, состоящей из ДНК-регулирующего транскрипционного элемента, в котором ДНК помечена двумя метками (а гистоновый октамер остается немеченым). В ДНК введена последовательность, взаимодействующая с лигандом ядерных рецепторов. Система предложена для высокопроизводительного скрининга определенных веществ агонистов и антагонистов ядерных рецепторов, что ограничивает использование данного способа.A known method of using nucleosomes as biosensors [United States Patent Application 20090062130 Nucleosome-based biosensors // Application Number 11/687859]. Such a biosensor consists of at least one nucleosome consisting of a DNA regulatory transcriptional element in which DNA is labeled with two labels (and the histone octamer remains unlabeled). A sequence is introduced into the DNA that interacts with the ligand of nuclear receptors. The system is proposed for high-throughput screening of certain substances of agonists and antagonists of nuclear receptors, which limits the use of this method.

Авторами [Na Ζ, Peng В, Ng S, Pan S, Lee JS, Shen HM, Yao SQ // Angew Chem Int Ed Engl. 2015, V. 54. P.2515-2519] предложен способ поиска ингибиторов, направленных на BRCT. Использовали пептидную библиотеку (около 100 пептидов), в которую вносили фрагмент BRCT белка PARP1. По результатам скринирования отобрали наиболее активно BRCT-связывающий пептид. На микропланшетах, в каждую лунку вносили данный пептид и затем тестировали низкомолекулярные соединения, отбирали наиболее активно дестабилизирующие взаимодействие пептида с BRCT. Таким образом, был обнаружен ряд новых ингибиторов PARP1. Среди них самая высокая активность наблюдалась у (±) госсипола (IC50=0,54±0,06 мкМ). Этот способ перспективен для поиска новых ингибиторов PARP1, но направленность на BRCT домен в существенной степени ограничивает круг поиска новых ингибиторов PARP1.Authors [Na Ζ, Peng B, Ng S, Pan S, Lee JS, Shen HM, Yao SQ // Angew Chem Int Ed Engl. 2015, V. 54. P.2515-2519] a method of searching for inhibitors directed to BRCT is proposed. A peptide library was used (about 100 peptides), into which a BRCT fragment of the PARP1 protein was introduced. According to the results of the screening, the most active BRCT-binding peptide was selected. On microplates, this peptide was introduced into each well and then low molecular weight compounds were tested, the most actively destabilizing interaction of the peptide with BRCT was selected. Thus, a number of new PARP1 inhibitors have been discovered. Among them, the highest activity was observed in (±) gossypol (IC50 = 0.54 ± 0.06 μM). This method is promising for the search for new PARP1 inhibitors, but the focus on the BRCT domain significantly limits the search for new PARP1 inhibitors.

Известен также способ, в котором новые ингибиторы PARP1 определяют с помощью иммуноферментного анализа [Kotova Ε., Tulin A.V. // Meth. Mol. Biol. 2011. V. 780. P. 491-516]. Способ заключается в нанесении на 96-луночный планшет для ИФА раствора, содержащего гистон Н4, затем следует отмывка фосфатно-солевым буфером, далее внесение различных концентраций PARP1 с дальнейшим определением комплекса Н4 и PARP1 с помощью меченых антител, направленных к PARP1. Этот способ позволяет определять ингибиторы PARP1, которые разрушают интерфейс между данным белком и гистоном Н4. Ограничение данного метода заключается в том, что он не позволяет выявлять ингибиторы PARP1, которые направлены к другим участкам нуклеосомы (поверхность Н2А/Н2 В димера гистонов, Н3 гистона, HI и др. функционально активные области нуклеосомы).There is also known a method in which new PARP1 inhibitors are determined using enzyme-linked immunosorbent assay [Kotova Ε., Tulin A.V. // Meth. Mol. Biol. 2011. V. 780. P. 491-516]. The method consists in applying a solution containing histone H4 to a 96-well ELISA plate, followed by washing with phosphate-buffered saline, then adding various concentrations of PARP1 with further determination of the complex of H4 and PARP1 using labeled antibodies directed to PARP1. This method allows the determination of PARP1 inhibitors that disrupt the interface between this protein and histone H4. The limitation of this method is that it does not allow detecting PARP1 inhibitors that are directed to other parts of the nucleosome (the H2A / H2B surface of histone dimer, histone H3, HI, and other functionally active regions of the nucleosome).

Наиболее близким техническим решением (прототипом) является метод, который позволяет определять способность веществ различного происхождения стабилизировать или дестабилизировать элонгационный комплекс РНК-полимеразы с помощью определения ∅-петли [United States Patent Application US 20120045429 Al //. Methods and Agent for Modulating the RNA Polymerase II-Histone Surface // V. Studitsky, O. Studitskaia, D. Gaykalova]. На основе предложенного подхода нуклеосомы могут быть использованы для определения агентов, влияющих на процесс прохождения транскрипции в искусственно созданной системе (ИНСТИВ - искусственная нуклеосомная система транскрипции in vitro). Для осуществления данного метода были разработаны специальные нуклеосомные матрицы [Kulaeva OI, Gaykalova DA, Pestov NA, Golovastov VV, Vassylyev DG, Artsimovitch I, Studitsky VM Mechanism of chromatin remodeling and recovery during passage of RNA polymerase II // Nat Struct Mol Biol.- 2009.- V.16.- P. 1272-1278; Bondarenko VA, Steele LM, Ujvari A, Kulaeva OI, Studitsky VM Nucleosomes can form a polar barrier to transcript elongation by RNA polymerase II // Mol Cell. - 2006. - V. 24. - P. 469-479; Kireeva ML, Walter W, Tchernajenko V, Bondarenko V, Kashlev M Studitsky VM. Nucleosome remodeling induced by RNA polymerase II. Loss of the H2A/H2B dimer during transcription // Mol Cell. 2002. - V. 9. - P. 541-552; Kulaeva OI, Hsieh FK, Studitsky VM. RNA polymerase complexes cooperate to relieve the nucleosomal barrier and evict historie //Proc Natl Acad Sci USA. - 2010. - V. 107.- P. 11325-11330; Studitsky, V. M. Preparation and analysis of positioned nucleosomes// Methods Mol. Biol. - 1999. - V. 119. - P. 17-26; Gaykalova D., Kulaeva O.I., Bondarenko VA. Studitsky V.M. Preparation and analysis of uniquely positioned nucleosomes// Methods Mol. Biol. - 2009. - V. 523. - P. 109-123; Walter, W., Studitsky, V. M. Construction, analysis, and transcription of model nucleosomal templates // Methods. - 2004. - V. 33. - P. 18-24]. Вышеупомянутый способ включает внесение тестируемого агента в соответствующем буфере в ИНСТИВ, инкубации и тестирования образования ∅-петли. Данный способ основан на данных, что в ИНСТИВ запускается механизм, включающий формирование промежуточного интермедиата - ∅-петли, который облегчает прохождение РНК полимеразы по ДНК, навернутую на нуклеосому (что имитирует процесс прохождения РНК полимеразы в хроматине в естественных условиях в клетке). Предполагается, что нарушения в системах, контролирующих сохранение хроматина в процессах репликации и транскрипции, в том числе нарушение образования ∅-петли, приводят к развитию различных патологий, включая опухолеобразование и преждевременное старение клетки. Таким образом, вещества, которые будут способствовать корректному формированию ∅-петли, могут быть потенциальными противоопухолевыми агентами. Есть ряд недостатков способа, предложенного в US 20120045429 Al, которые могут ограничивать внедрение и практическое применение данного способа. Ограничения связаны с трудностью детекции образования ∅-петли. Есть небольшое число методов, достоверно и напрямую детектирующих наличие ∅-петли. Как правило, это высокотехнологичные методы, такие как электронная микроскопия, рентгено-структурный анализ и, возможно, зондовая сканирующая микроскопия (очень высокого разрешения). Эти методы трудоемки и трудозатраты, требуют привлечения высококвалифицированных специалистов для проведения и интерпретации результатов. Кроме того, занимают продолжительное время и дорогостоящие при реализации. Есть более экономичные методы детекции ∅-петли (например, с помощью ДНКаза1 футпринтинга), но при их реализации происходит потеря в достоверности и повышение погрешности измерений. Кроме того, идея использовать непосредственно сами нуклеосомные поверхности в качестве основы для скрининга веществ, обуславливает низкую специфичность и селективность такой системы отбора молекул. Недостатки данного способа можно преодолеть, если данную систему модифицировать путем введения конкретной молекулярной мишени, против которой осуществлять скрининг соединений. И вторым необходимым преобразованием способа, предложенного в US 20120045429 A1, должно быть значительное упрощение в системе детекции без потери в чувствительности, специфичности и достоверности. Способ использования нуклеосомных матриц US 20120045429 A1 был выбран в качестве прототипа предложенного решения. Но предлагаемый способ устраняет вышеперечисленные недостатки за счет введения в систему ИНСТИВ конкретной молекулярной мишени, против которой будут тестироваться соединения и за счет упрощения детекции продуктов в системе.The closest technical solution (prototype) is a method that allows you to determine the ability of substances of various origin to stabilize or destabilize the elongation complex of RNA polymerase by determining the ∅-loop [United States Patent Application US 20120045429 Al //. Methods and Agent for Modulating the RNA Polymerase II-Histone Surface // V. Studitsky, O. Studitskaia, D. Gaykalova]. Based on the proposed approach, nucleosomes can be used to determine agents that influence the process of transcription in an artificially created system (INSTIV - artificial nucleosome transcription system in vitro). To implement this method, special nucleosome matrices were developed [Kulaeva OI, Gaykalova DA, Pestov NA, Golovastov VV, Vassylyev DG, Artsimovitch I, Studitsky VM Mechanism of chromatin remodeling and recovery during passage of RNA polymerase II // Nat Struct Mol Biol.- 2009.- V.16.- P. 1272-1278; Bondarenko VA, Steele LM, Ujvari A, Kulaeva OI, Studitsky VM Nucleosomes can form a polar barrier to transcript elongation by RNA polymerase II // Mol Cell. - 2006. - V. 24. - P. 469-479; Kireeva ML, Walter W, Tchernajenko V, Bondarenko V, Kashlev M Studitsky VM. Nucleosome remodeling induced by RNA polymerase II. Loss of the H2A / H2B dimer during transcription // Mol Cell. 2002. - V. 9. - P. 541-552; Kulaeva OI, Hsieh FK, Studitsky VM. RNA polymerase complexes cooperate to relieve the nucleosomal barrier and evict historie // Proc Natl Acad Sci USA. - 2010. - V. 107.- P. 11325-11330; Studitsky, V. M. Preparation and analysis of positioned nucleosomes // Methods Mol. Biol. - 1999. - V. 119. - P. 17-26; Gaykalova D., Kulaeva O.I., Bondarenko VA. Studitsky V.M. Preparation and analysis of uniquely positioned nucleosomes // Methods Mol. Biol. - 2009. - V. 523. - P. 109-123; Walter, W., Studitsky, V. M. Construction, analysis, and transcription of model nucleosomal templates // Methods. - 2004. - V. 33. - P. 18-24]. The aforementioned method involves introducing the test agent in an appropriate buffer into INSTIV, incubating and testing the formation of the ∅-loop. This method is based on the data that in INSTIV a mechanism is launched that includes the formation of an intermediate intermediate, the ∅-loop, which facilitates the passage of RNA polymerase through DNA, screwed onto the nucleosome (which simulates the process of passage of RNA polymerase in chromatin under natural conditions in the cell). It is assumed that disorders in the systems that control chromatin preservation in the processes of replication and transcription, including impaired ∅-loop formation, lead to the development of various pathologies, including tumor formation and premature cell aging. Thus, substances that will contribute to the correct formation of the ∅-loop may be potential antitumor agents. There are several disadvantages of the method proposed in US 20120045429 Al, which may limit the implementation and practical application of this method. Limitations are associated with the difficulty of detecting the formation of the ∅-loop. There are a small number of methods that reliably and directly detect the presence of the ∅-loop. As a rule, these are high-tech methods, such as electron microscopy, X-ray structural analysis and, possibly, probe scanning microscopy (very high resolution). These methods are time-consuming and labor-intensive, require the involvement of highly qualified specialists to conduct and interpret the results. In addition, they take a long time and are expensive to implement. There are more economical methods for detecting the ∅-loop (for example, using DNase1 footprinting), but when they are implemented, there is a loss in reliability and an increase in the measurement error. In addition, the idea of using directly the nucleosome surfaces themselves as the basis for the screening of substances leads to low specificity and selectivity of such a molecular selection system. The disadvantages of this method can be overcome if this system is modified by introducing a specific molecular target against which to screen compounds. And the second necessary transformation of the method proposed in US 20120045429 A1, should be a significant simplification in the detection system without loss in sensitivity, specificity and reliability. The method of using nucleosome matrices US 20120045429 A1 was chosen as a prototype of the proposed solution. But the proposed method eliminates the above disadvantages by introducing into the INSTIV system a specific molecular target against which the compounds will be tested and by simplifying the detection of products in the system.

Раскрытие изобретенияDisclosure of invention

Задачей предлагаемого технического решения является создание способа простого в реализации, не требующего дорогостоящих реактивов, при сохранении достоверности результатов.The objective of the proposed technical solution is to create a method easy to implement, not requiring expensive reagents, while maintaining the reliability of the results.

Поставленная задача решается способом скрининга противоопухолевых препаратов - ингибиторов PARP1, включающим сборку нуклеосом из очищенных гистонов на ДНК-матрицах, лигирование с РНК-полимеразой, внесение в полученный комплекс молекулярной мишени - белка PARP1, с последующим внесением буфера транскрипции, содержащего дезоксинуклеотидтрифосфаты (дНТФ) и меченый α-32Ф-ГТФ, a также тестируемых или контрольных химических соединений, проведение транскрипции, оценку продуктов транскрипции.The problem is solved by a method for screening antitumor drugs - PARP1 inhibitors, including assembling nucleosomes from purified histones on DNA matrices, ligation with RNA polymerase, introducing PARP1 protein into the resulting molecular target complex, followed by adding a transcription buffer containing deoxynucleotide triphosphates and labeled α-32F-GTP, as well as test or control chemical compounds, transcription, evaluation of transcription products.

Предпочтительно РНК полимераза, используемая в способе, является РНК полимеразой 2 натурального или рекомбинантного происхождения из различных организмов, включая дрожжей, млекопитающих, пресмыкающихся и др.Preferably, the RNA polymerase used in the method is RNA polymerase 2 of natural or recombinant origin from various organisms, including yeast, mammals, reptiles, etc.

Возможен вариант использования в качестве РНК полимеразы РНК полимеразы натурального или рекомбинантного прокариотического происхождения, например РНК полимеразы Е. coli.It is possible to use RNA polymerase of natural or recombinant prokaryotic origin as an RNA polymerase, for example, E. coli RNA polymerase.

Предпочтительно для сборки нуклеосомных матриц использовать очищенные препараты гистонов Н2А, Н2В, Н3, Н4 натурального происхождения из различных организмов, включая дрожжей, млекопитающих, пресмыкающихся.It is preferable to use purified preparations of histones H2A, H2B, H3, H4 of natural origin from various organisms, including yeast, mammals, reptiles, for assembly of nucleosome matrices.

Предпочтительно, что при использовании очищенных гистонов Н3 и Н4 их добавляют в двухкратном, а очищенные гистоны Н2А и Н2В в трехкратном избытке по отношению к матричной ДНК.It is preferable that when using purified histones H3 and H4 they are added in two-fold, and purified histones H2A and H2B in three-fold excess with respect to template DNA.

Возможен вариант, когда для сборки нуклеосомных матриц дополнительно используют гистон HI как натурального, так и рекомбинантного происхождения.A variant is possible when histone HI of both natural and recombinant origin is additionally used to assemble nucleosome matrices.

Предпочтительно для сборки нуклеосомных матриц использовать мутантные гистоновые белки, например Sin-мутанты.It is preferable to use mutant histone proteins, for example, Sin mutants, to assemble nucleosome templates.

Возможен вариант, когда осуществляют сборку неполных нуклеосом, например гексасом или тетрасом.A variant is possible when assembling incomplete nucleosomes, for example, hexasomes or tetrasomes.

Предпочтительно для сборки гибридных нуклеосомных матриц использовать рекомбинантные или синтетические гистоны эукариотического и прокариотического происхождения.It is preferable to use recombinant or synthetic histones of eukaryotic and prokaryotic origin for the assembly of hybrid nucleosome matrices.

Возможен вариант, когда для сборки нуклеосом используют ДНК- матрицу, несущую мутации, ассоциированные с различными заболеваниями или со старением.A variant is possible when a DNA matrix is used to assemble nucleosomes that carries mutations associated with various diseases or with aging.

Еще одним вариантом воплощения изобретения является введение в систему вместе с тестируемым агентом факторов, ремоделирующих хроматин, например SWI/SNF, ISW2, ACF и др.Another embodiment of the invention is the introduction of chromatin remodeling factors, for example, SWI / SNF, ISW2, ACF, etc. into the system together with the test agent.

Предпочтительно сборку нуклеосом проводить на поверхности лунок планшета или зерен сорбента.Preferably, the assembly of nucleosomes is carried out on the surface of the wells of the tablet or grains of the sorbent.

Предпочтительно оценку продуктов транскрипции проводить биохимическими методами анализа, например электрофоретически.It is preferable to evaluate the transcription products by biochemical methods of analysis, for example electrophoretically.

Возможен вариант, когда перед оценкой продуктов транскрипции, дополнительно проводят обработку смеси реагентами для футпринтинга, например гидроксилами или ДНКАазой1.It is possible that before evaluating the products of transcription, the mixture is additionally treated with reagents for footprinting, for example, hydroxyls or DNKAase1.

Предпочтительно перед внесением агентов в систему проводят предварительное математическое моделирование.Preferably, prior to introducing the agents into the system, preliminary mathematical modeling is carried out.

Технический результат предлагаемого изобретения заключается в снижении погрешности измерений, а также в повышении их достоверности, а также в повышении специфичности (селективности) системы. Кроме того, функциональные возможности использования ИНСТИВ для тестирования противоопухолевых соединений расширены за счет введения дополнительного компонента - белка PARP1. Снижение погрешности измерений и повышение достоверности происходит за счет того, что в системе детектируется не образование ∅-петли, а образование транскриптов, образующихся при работе РНК полимеразы в системе.The technical result of the invention is to reduce the measurement error, as well as to increase their reliability, as well as to increase the specificity (selectivity) of the system. In addition, the functionality of using INSTIV for testing antitumor compounds has been expanded by introducing an additional component, the PARP1 protein. A decrease in the measurement error and an increase in reliability occurs due to the fact that the system does not detect the formation of the ∅-loop, but the formation of transcripts formed during the operation of RNA polymerase in the system.

Указанный технический результат достигается тем, что применяется способ использования системы ИНСТИВ, включающий:The specified technical result is achieved by the fact that the method of using the INSTIV system is used, including:

1) сборку нуклеосом из очищенных гистонов на ДНК-матрицах,1) the assembly of nucleosomes from purified histones on DNA matrices,

2) сшивку с РНК-полимеразным комплексом,2) crosslinking with an RNA polymerase complex,

3) внесение молекулярной мишени - белка PARP1,3) the introduction of a molecular target - protein PARP1,

4) внесение различных химических соединений, агентов, способных регулировать транскрипционную активность PARP1,4) the introduction of various chemical compounds, agents capable of regulating the transcriptional activity of PARP1,

5) внесение буфера, содержащего все четыре буквы в виде дезоксинуклеотидтрифосфатов (дНТФ), необходимых для построения РНК-транскриптов, а именно «АТФ», «ТТФ», «УТФ», «ГТФ», плюс одной меченой буквы, в данном случае - «α-32Ф-ГТФ». Подробный состав буфера для транскрипции приведен в разделе «Методика реализации способа»,5) the introduction of a buffer containing all four letters in the form of deoxynucleotide triphosphates (dNTPs) necessary for the construction of RNA transcripts, namely “ATP”, “TTF”, “UTP”, “GTP”, plus one labeled letter, in this case - "Α-32F-GTF." The detailed composition of the buffer for transcription is given in the section "Methodology for implementing the method",

6) оценку продуктов транскрипции, и отличающийся тем, что способ используют для тестирования ингибиторов PARP1 - потенциальных противоопухолевых препаратов.6) evaluation of transcription products, and characterized in that the method is used to test PARP1 inhibitors - potential antitumor drugs.

В такой модификации (после добавления PARP1) система будет обозначаться как ИНСТИВ_PARPl. Тестируемые и контрольные вещества вносят согласно описанному ниже протоколу (см. «Методика реализации способа»). Любые вещества различного происхождения (высокомолекулярные, низкомолекулярные, экзогенные, эндогенные и пр.), приводящие в тестируемой системе к изменениям транскрипционной активности PARP1 будут рассматриваться как потенциальные противоопухолевые агенты. Таким образом, в предлагаемой тестируемой системе возможно осуществление скрининга большого количества веществ с целью последующего отбора лекарственных препаратов.In this modification (after adding PARP1) the system will be designated as INSTIV_PARPl. Test and control substances are added according to the protocol described below (see "Methodology for the implementation of the method"). Any substances of various origin (high molecular weight, low molecular weight, exogenous, endogenous, etc.) that lead to changes in the transcriptional activity of PARP1 in the test system will be considered potential antitumor agents. Thus, in the proposed test system, it is possible to screen a large number of substances for the subsequent selection of drugs.

Возможен вариант, когда транскрипцию проводят различными РНК полимеразами натурального или рекомбинантного происхождения, из различных видов животных, например РНК полимеразу 2 (РНКП2) дрожжей, пресмыкающихся, млекопитающих и др.A variant is possible when transcription is carried out by various RNA polymerases of natural or recombinant origin, from various animal species, for example, RNA polymerase 2 (RNAP2) of yeast, reptiles, mammals, etc.

Транскрипцию также можно проводить различными РНК полимеразами натурального или рекомбинантного прокариотического происхождения, например РНК полимеразу Е. Coli.Transcription can also be carried out with various RNA polymerases of natural or recombinant prokaryotic origin, for example, E. Coli RNA polymerase.

Возможно применение варианта, в котором для сборки нуклеосомных матриц используют рекомбинантные гистоны эукариотического и прокариотического происхождения, включая использование коммерческих препаратов фирм INVITROGENE, CLONTECH, STRATAGENE, PROMEGA и др. Рекомбинантные гистоны могут содержать различные модификации и быть очищены различными способами. Также могут быть использованы синтетические гистоны, полученные с помощью автоматических белковых синтезаторов.It is possible to use a variant in which recombinant histones of eukaryotic and prokaryotic origin are used to assemble nucleosome matrices, including the use of commercial preparations from INVITROGENE, CLONTECH, STRATAGENE, PROMEGA, etc. Recombinant histones can contain various modifications and can be purified in various ways. Synthetic histones obtained using automatic protein synthesizers can also be used.

Возможен вариант, в котором сборка нуклеосомных матриц происходит на поверхности лунок планшета или зерен сорбента, при этом нуклеосомы оказываются ковалентно или нековалетно прикреплены к твердой поверхности носителя. Применение носителей позволяет оптимизировать разделение компонентов смеси и облегчить процедуру отмывок от нежелательных компонентов и примесей. Твердые поверхности могут быть изготовлены из различных материалов, таких как полистирол, поливинилхлорид, полипропилен, целлюлоза, нитроцеллюлоза, нейлон, гели декстрана, полиакриламида, агарозы и др. Твердая фаза может быть в виде пробирок, планшетов для микротитрования, шариков, пленок и др.A variant is possible in which the assembly of nucleosome matrices occurs on the surface of the wells of a plate or grains of sorbent, while the nucleosomes are covalently or non-covalently attached to the solid surface of the carrier. The use of carriers allows to optimize the separation of the components of the mixture and to facilitate the washing procedure from unwanted components and impurities. Solid surfaces can be made of various materials, such as polystyrene, polyvinyl chloride, polypropylene, cellulose, nitrocellulose, nylon, dextran gels, polyacrylamide, agarose, etc. The solid phase can be in the form of test tubes, microtiter plates, balls, films, etc.

Можно использовать вариант, в котором к твердой поверхности прикрепляют ДНК, а не нуклеосомы.A variant may be used in which DNA, rather than nucleosomes, are attached to a solid surface.

Оценку продуктов транскрипции или интермедиатов проводят электрофоретически.Evaluation of transcription products or intermediates is carried out electrophoretically.

Способ использования специальных функциональных нуклеосомных матриц для проведения скрининга для тестирования ингибиторов PARP1 реализуется следующим образом (см. раздел «Методика реализации способа»).The method of using special functional nucleosome matrices for screening for testing PARP1 inhibitors is implemented as follows (see the section "Methodology of the method").

Реализация данного способа может служить основой для получения коммерческой системы поиска и функциональной проверки новых противоопухолевых лекарственных препаратов, направленных на PARP1. Известно, что получение лекарств - долгий и дорогостоящий процесс, при этом из 5-10 тысяч тестируемых соединений лишь 0,1% доходит до стадии клинических испытаний, в результате которых только 10-20% разрешают к применению. Большинство молекул отсеивается на стадии преклинических исследований по показателям эффективности и безопасности. Доклинические эксперименты (на культурах клеток, тем более животных моделях) являются высокозатратными, трудоемкими и длительными. Предлагаемая в данном способе система ИНСТИВ_PARPl является миниатюрной функциональной системой, воспроизводящей клеточный процесс транскрипции. Поскольку в данную систему внесена молекулярная мишень, то в такой модификации система позволяет проверять PARP1-ингибирующую активность соединений. Таким образом, использование данной системы позволит оптимизировать стадию «отсева» молекул по показателям эффективности, что в значительной степени может удешевить и ускорить процесс поиска новых лекарственны соединений.The implementation of this method can serve as the basis for obtaining a commercial search system and functional verification of new antitumor drugs aimed at PARP1. It is known that obtaining drugs is a long and expensive process, while from 5-10 thousand tested compounds, only 0.1% reaches the stage of clinical trials, as a result of which only 10-20% are allowed for use. Most molecules are screened out at the preclinical stage in terms of efficacy and safety. Preclinical experiments (on cell cultures, especially animal models) are costly, time consuming and lengthy. The INSTIV_PARPl system proposed in this method is a miniature functional system that reproduces the cellular transcription process. Since a molecular target is introduced into this system, in this modification the system allows one to check the PARP1-inhibiting activity of the compounds. Thus, the use of this system will optimize the stage of “screening” of molecules in terms of efficiency, which can significantly reduce the cost and speed up the search for new medicinal compounds.

Для оценки конкурентоспособности и патентоспособности результатов авторами заявки был проведен информационный поиск по патентным базам данных и по работам, опубликованным в открытой печати. Анализ результатов поиска показал, что предлагаемый подход не используется в исследовательской и медицинской практике, не описан в открытых источниках и не защищен патентами. Следовательно, предложение отвечает критериям новизны и изобретательского уровня.To assess the competitiveness and patentability of the results, the authors of the application carried out an information search on patent databases and on works published in the open press. Analysis of the search results showed that the proposed approach is not used in research and medical practice, is not described in open sources and is not protected by patents. Therefore, the proposal meets the criteria of novelty and inventive step.

Следует отметить, что ингибиторы PARP1 представляют большой интерес и имеют практическую ценность не только в онкологии, но и в терапии различных воспалительных процессов, сердечно-сосудистых и неврологических заболеваний, а также заболеваний, связанных со старением [Mouchiroud L., Auwerx J. // Crit. Rev. Biochem. Mol. Biol. 2013. V. 48. №4. P. 397-408; Biirkle A. // Mol. Aspects Med. 2013. V. 34. P. 1046-1065; Ma Y., He X., Nie H., Hong Y., Sheng C, Wang Q., Xia W., Ying W. // Curr. Drug Targets. 2012. V. 13. №2. P. 222-229; Ying W. // Scientifica (Cairo). 2013. V. 2013. Article ID 691251; Baxter P., Xu Y., Swanson R.A. // Transi. Stroke Res. 2014. V. 5. №1. P. 136-144; Rosado M.M., Novelli F., Pioli C. // Immunology. 2013. V. 139. №4. P. 428-137]. Поэтому использование данного способа в дальнейшем может позволить осуществлять поиск новых лекарственных субстанций, направленных не только против опухолей, но и обладающих другим спектром активностей.It should be noted that PARP1 inhibitors are of great interest and have practical value not only in oncology, but also in the treatment of various inflammatory processes, cardiovascular and neurological diseases, as well as diseases associated with aging [Mouchiroud L., Auwerx J. // Crit. Rev. Biochem. Mol. Biol. 2013. V. 48. No. 4. P. 397-408; Biirkle A. // Mol. Aspects Med. 2013. V. 34. P. 1046-1065; Ma Y., He X., Nie H., Hong Y., Sheng C, Wang Q., Xia W., Ying W. // Curr. Drug Targets. 2012. V. 13. No. 2. P. 222-229; Ying W. // Scientifica (Cairo). 2013. V. 2013. Article ID 691251; Baxter P., Xu Y., Swanson R.A. // Transi. Stroke Res. 2014. V. 5. No. 1. P. 136-144; Rosado M.M., Novelli F., Pioli C. // Immunology. 2013. V. 139. No. 4. P. 428-137]. Therefore, the use of this method in the future may allow the search for new medicinal substances directed not only against tumors, but also having a different spectrum of activities.

Краткое описание чертежейBrief Description of the Drawings

На фиг. 1 представлены результаты электрофореза в присутствии PARP1 и ингибиторов PARP1. Дорожки подписаны сверху. Первая дорожка - маркер молекулярного веса.In FIG. 1 shows the results of electrophoresis in the presence of PARP1 and PARP1 inhibitors. The tracks are signed on top. The first track is a molecular weight marker.

На фиг. 2 показан выход транскриптов в %. На фигуре: PARP-PARP1, NAD - НАД, Olap - олапариб, Goss - госсиполIn FIG. 2 shows the transcript yield in%. On the figure: PARP-PARP1, NAD - OVER, Olap - olaparib, Goss - gossypol

Осуществление изобретенияThe implementation of the invention

Методика реализации способаMethodology for implementing the method

1. Очистка РНК- полимераз (РНКП)1. Purification of RNA polymerases (RNAP)

Можно использовать дрожжевую РНК полимеразу 2 с концевым тагом из шести гистидинов. РНК полимеразу 2 выделяют согласно разработанному и опубликованному протоколу [Kireeva ML, L.L., Komissarova Ν, Kashlev Μ., Assays and affinity purification of biotinylated and nonbiotinylated forms of double-tagged core RNA polymerase II from Saccharomyces cerevisiae. Methods Enzymol., 2003. 370: p.138-55]. Либо можно использовать РНК полимеразу E.coli, которую выделяют из штамма бактерии RL721 согласно протоколу, опубликованному ранее [Kashlev, M., et al., Histidine-tagged RNA polymerase of Escherichia coli and transcription in solid phase. Methods Enzymol., 1996. 274: p.326-34]. Очищенные РНКП хранят небольшими аликвотами при -70°С.You can use yeast RNA polymerase 2 with an end tag of six histidines. RNA polymerase 2 is isolated according to a developed and published protocol [Kireeva ML, L.L., Komissarova Ν, Kashlev Μ., Assays and affinity purification of biotinylated and nonbiotinylated forms of double-tagged core RNA polymerase II from Saccharomyces cerevisiae. Methods Enzymol., 2003. 370: p.138-55]. Alternatively, E. coli RNA polymerase can be used, which is isolated from the bacterial strain RL721 according to a protocol published previously [Kashlev, M., et al., Histidine-tagged RNA polymerase of Escherichia coli and transcription in solid phase. Methods Enzymol., 1996. 274: p. 326-34]. Purified RNAP stored in small aliquots at -70 ° C.

2. Приготовление транскрипционных комплексов.2. Preparation of transcription complexes.

2.1. Приготовление раствора ДНК-РНК гибридной смеси, ДНК-РНК гибридную смесь готовят следующим образом. Синтетический РНК-нуклеотид RNA9 (5' AUCGAGAGG 3') и синтетический ДНК-нуклеотидом TDS 50 (5' GGTGTCGCTTGGGTTGGCTTTTCGGGCTGTCCCTCTCGATGGCTGTAAGT 3') соединяют в эквимолярных количествах (по 1.5 мкМ). Кратко: полученную смесь гибридизуют с помощью ПЦР по программе: 45°С - 5 мин, 42°С, 39°С, 36°С, 33°С, 30°С, 27°С, - 2 мин каждый шаг, 25°С - 10 мин. В результате получают ДНК-РНК гибридную смесь.2.1. Preparation of a solution of DNA-RNA hybrid mixture, DNA-RNA hybrid mixture is prepared as follows. Synthetic RNA9 RNA9 nucleotide (5 'AUCGAGAGG 3') and synthetic TDS 50 DNA nucleotide (5 'GGTGTCGCTTGGGTTGGCTTTTCGGGCTGTCCCTCTCGATGGCTGTAAGT 3') are combined in equimolar amounts (1.5 μM). Briefly: the resulting mixture is hybridized by PCR according to the program: 45 ° C - 5 min, 42 ° C, 39 ° C, 36 ° C, 33 ° C, 30 ° C, 27 ° C, - 2 min each step, 25 ° C - 10 min. The result is a DNA-RNA hybrid mixture.

2.2. Обработка РНКП ДНК-РНК гибридной смесью2.2. Treatment of RNAP DNA-RNA Hybrid Blend

15 мкл 1,33 нМ ДНК-РНК гибридной смеси соединяют с 4 мкл раствора РНК полимеразы (либо РНК полимеразы 2, либо РНКП полимеразы E. coli. Инкубируют при комнатной температуре 15 мин.15 μl of 1.33 nM DNA-RNA hybrid mixture is combined with 4 μl of an RNA polymerase solution (either RNA polymerase 2 or RNAP polymerase E. coli. Incubated at room temperature for 15 minutes.

2.3. Подготовка нематричной ДНК2.3. Preparation of non-DNA

В качестве нематричной (59ДНК) используют ДНК с последовательностью 5' ACTTACAGCCATCGAGAGGGACACGGCGAAAAGCCAACCCAAGCGA CACCGGCACTGGG 3'. Вносят 1 мМ 59 ДНК и инкубируют при комнатной температуре 15 мин.As non-matrix (59DNA), DNA with the sequence 5 'ACTTACAGCCATCGAGAGGGACACGGCGAAAAGCCAACCCAAGCGA CACCGGCACTGGG 3' is used. Contribute 1 mM 59 DNA and incubate at room temperature for 15 minutes.

2.4. Инкубация транскрипционного комплекса на Ni-NTA агарозе2.4. Incubation of the transcription complex on Ni-NTA agarose

Добавляют смесь, состоящую из ДНК-РНК гибридов и инкубированный вместе с ними раствор РНК полимеразы к подготовленной заранее Ni-NTA агарозе (Qiagen, Chatsworth, С А). Инкубируют при комнатной температуре 10 мин. Проводят однократную отмывку буфером ТВ40 с помощью центрифугирования 1 мин (1600 g Eppendorf). Супернатант удаляют. Проводят однократную отмывку буфером ТВ300 с помощью центрифугирования 1 мин (1600 g Eppendorf). Супернатант удаляют. Отмывают дважды буфером ТВ40 с помощью центрифугирования 1 мин (1600 g Eppendorf). Супернатант удаляют. Доводят до объема 30 мкл водой деионизованной. Добавляют к смеси раствор имидазола, инкубируют при комнатной температуре 5 мин. Центрифугируют в течение 1 мин (1600 оборотов/мин, Eppendorf, (Германия) и собирают супернатант. Доводят объем супернатанта до 21 мкл раствором ТВ40.A mixture consisting of DNA-RNA hybrids and an RNA polymerase solution incubated with them are added to pre-prepared Ni-NTA agarose (Qiagen, Chatsworth, C A). Incubate at room temperature for 10 minutes. A single wash was performed with TB40 buffer by centrifugation for 1 min (1600 g Eppendorf). The supernatant is removed. A single wash was performed with TB300 buffer by centrifugation for 1 min (1600 g Eppendorf). The supernatant is removed. Wash twice with TB40 buffer by centrifugation for 1 min (1600 g Eppendorf). The supernatant is removed. Bring to a volume of 30 μl with deionized water. An imidazole solution is added to the mixture, incubated at room temperature for 5 minutes. Centrifuged for 1 min (1600 rpm, Eppendorf, (Germany) and collect the supernatant. Bring the volume of the supernatant to 21 μl with a solution of TB40.

3. Приготовление ДНК-матриц для транскрипции3. Preparation of DNA templates for transcription

3.1. Подготовка ДНК-матриц3.1. DNA template preparation

ДНК, содержащую нуклеосом-позиционирующую последовательность, получали из плазмид pGEM-3Z/601, pGEM-3Z/603 и GEM-3Z/605 [Walter, W., et al., Assay of the fate of the nucleosome during transcription by RNA polymerase II. Methods Enzymol., 2003. 371: p.564-77]. Фрагменты ДНК из плазмид амплифицируют с помощью праймеров [Lowary, Р.Т. and J. Widom, New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning. J. Mol. Biol., 1998. 276(1): p.19-42] и очищают с помощью набора QIAfilter Plasmid Maxi Kit (Qiagen, Нидерланды) согласно протоколу фирмы-разработчика. Для сборки можно использовать различные типы матриц, например 601, 603, 605. Ранее было показано, что ДНК-последовательности данных матриц негомологичны, но все они обладали характерным свойством связывать коровые гистоны с высокой аффинностью и в точно определенных позициях на ДНК.DNA containing the nucleosome positioning sequence was obtained from plasmids pGEM-3Z / 601, pGEM-3Z / 603 and GEM-3Z / 605 [Walter, W., et al., Assay of the fate of the nucleosome during transcription by RNA polymerase II. Methods Enzymol., 2003. 371: p. 564-77]. DNA fragments from plasmids are amplified using primers [Lowary, R.T. and J. Widom, New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning. J. Mol. Biol., 1998. 276 (1): p.19-42] and purified using the QIAfilter Plasmid Maxi Kit (Qiagen, Netherlands) according to the protocol of the developer. Various types of matrices can be used for assembly, for example 601, 603, 605. It was previously shown that the DNA sequences of these matrices are not homologous, but they all had the characteristic property of binding core histones with high affinity and at precisely defined positions on DNA.

3.2. Присоединение промотерной части к ДНК-матрицам3.2. Attachment of the promoter portion to DNA templates

Вначале готовят линкерный Т7 промотер-содержащий ДНК-фрагмент согласно протоколу [38] путем амплификации с соответствующими праймерами. Фрагменты ДНК из плазмид амплифицируют с помощью праймеров [Lowary, Р.Т. and J. Widom, New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning. J. Mol. Biol., 1998. 276(1): p.19-42] и очищают с помощью набора QIAfilter Plasmid Maxi Kit (Qiagen) согласно протоколу фирмы-разработчика. Полученные PCR-продукты (Т7 промотер-содержащий ДНК-фрагмент и фрагмент, содержащий нуклеосом-позиционирующую последовательность) расщепляют с помощью рестриктазы TspRI, лигируют и проводят ПЦР с последующей очисткой ампликонов. Полученная ДНК-матрица содержит сильный Т7 промотер.First, the T7 linker promoter-containing DNA fragment is prepared according to the protocol [38] by amplification with the corresponding primers. DNA fragments from plasmids are amplified using primers [Lowary, R.T. and J. Widom, New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning. J. Mol. Biol., 1998. 276 (1): p.19-42] and purified using the QIAfilter Plasmid Maxi Kit (Qiagen) according to the protocol of the developer. The resulting PCR products (T7 promoter-containing DNA fragment and a fragment containing a nucleosome positioning sequence) are digested with TspRI restriction enzyme, ligated and PCR followed by purification of the amplicons. The resulting DNA matrix contains a strong T7 promoter.

4. Сборка нуклеосом4. Assembly of nucleosomes

Готовят буфера CRB, содержащих 10 мМ Tris-HCl (рН 8.0), 0.2 мМ ЭДТА, 5 мМ в-меркаптоэтанола, 0.1% NP-40, и различающиеся концентрации NaCl, а именно: в буфере CRB1 - 2М NaCl, в буфере CRB2 - 1,5М NaCl в буфере CRB3 - 1 M NaCl, в буфере CRB4 -0,75М NaCl, 0.75 M (CRB4); 0.5 M (CRB5); и 0.01 M (CRB6). Все буфера для проведения анализа охлаждают до 4°С. Растворяют 0.5-3 мкг ДНК-матрицы в буфере CRB1. Добавляют ДНК спермы лосося (Sigma-Aldrich, St.Louis, МО) в двухкратном избытке по отношению к матричной ДНК. Затем добавляют очищенные гистоны в молярном избытке, а именно очищенные гистоны Н3 и Н4 в двухкратном, а очищенные гистоны Н2А/H2B в трехкратном избытке по отношению к матричной ДНК. Реакционный объем доводят до 40-100 мкл и переносят в малые диализные мешки. Проводят диализ против CRB1 в течение ночи при +4°C. Затем проводят диализ против CRB2 в течение 1 часа при +4°C. Затем проводят диализ против CRB3 в течение 1 часа при +4°С. Затем проводят диализ против CRB4 в течение 1 часа при +4°C. Затем проводят диализ против CRB5 (в течение 1 часа при +4°C. Затем проводят диализ против CRB6 в течение ночи при +4°C. Таким образом, сборку нуклеосом проводят при субоптимальном соотношении ДНК-матриц и гистоновых белков (в качестве источников гистоновых белков может выступать донорный хроматин, рекомбинантные прокариотические и эукариотические гистоны, синтетические гистоны, а также гистоны, полученные от разных видов животных) с помощью модифицированного метода переноса с использованием продолжительного диализа. В ходе диализа получаются коровые (безлинкерные) нуклеосомы, которые хранят в силиконизированных пробирках (Eppendorf) при +4°C (заморозка не допускается). Сборку нуклеосом можно выполнять как в растворе, так и на различных сорбентах. Оценку качества сборки хроматина осуществляют различными способами, например электрофорезом в нативных условиях, с помощью определения чувствительности к рестриктазам, с помощью определения чувствительности к рестриктазам и последующего удлинения праймера и др. При необходимости (если нужны не коровые нуклеосомы, а нуклеосомы с линкерными хвостами ДНК, проводят сшивку с линкерной частью коровых нуклеосом с помощью Т4 ДНК-лигазы в течение 3 часов при 15°C. Проверка образцов нуклеосом как коровых, так с линкерами проводят с помощью нативного электрофореза.Prepare CRB buffers containing 10 mM Tris-HCl (pH 8.0), 0.2 mM EDTA, 5 mM b-mercaptoethanol, 0.1% NP-40, and varying NaCl concentrations, namely: in CRB1 buffer - 2M NaCl, in CRB2 buffer - 1.5 M NaCl in a CRB3 buffer - 1 M NaCl, in a CRB4 buffer -0.75 M NaCl, 0.75 M (CRB4); 0.5 M (CRB5); and 0.01 M (CRB6). All assay buffers are cooled to 4 ° C. Dissolve 0.5-3 μg of the DNA template in CRB1 buffer. Salmon sperm DNA (Sigma-Aldrich, St. Louis, MO) was added in a twofold excess with respect to template DNA. Then add purified histones in a molar excess, namely purified histones H3 and H4 in double, and purified histones H2A / H2B in triple excess with respect to template DNA. The reaction volume was adjusted to 40-100 μl and transferred into small dialysis bags. Dialysis against CRB1 overnight at + 4 ° C. Then dialysis against CRB2 for 1 hour at + 4 ° C. Then dialysis against CRB3 is carried out for 1 hour at + 4 ° C. Then dialysis against CRB4 for 1 hour at + 4 ° C. Then dialysis against CRB5 is performed (for 1 hour at + 4 ° C. Then dialysis against CRB6 is performed overnight at + 4 ° C. Thus, nucleosome assembly is carried out at a suboptimal ratio of DNA templates and histone proteins (as histone sources proteins can be donated chromatin, recombinant prokaryotic and eukaryotic histones, synthetic histones, as well as histones obtained from different animal species) using a modified transfer method using continuous dialysis. core (linkerless) nucleosomes that are stored in siliconized tubes (Eppendorf) at + 4 ° C (freezing is not allowed). Nucleosome assembly can be performed both in solution and on various sorbents. Chromatin assembly quality is assessed by various methods, for example, electrophoresis in under native conditions, by determining the sensitivity to restriction enzymes, by determining the sensitivity to restriction enzymes and subsequent primer extension, etc. If necessary (if not core nucleosomes, but linker nucleosomes are needed E-tailed DNA crosslinking is carried out with the linker portion of core nucleosomes with T4 DNA ligase for 3 h at 15 ° C. Verification of nucleosome samples of both core and linkers is carried out using native electrophoresis.

5. Приготовление элонгационного комплекса ЭК-39. Проводят лигирование транскрипционного комплекса с нуклеосомами. Для этого готовят следующую смесь:5. Preparation of elongation complex EK-39. Ligation of the transcriptional complex with nucleosomes is carried out. To do this, prepare the following mixture:

- 20,2 мкл транскрипционного комплекса, приготовленного, как описано в подразделе 2.4 настоящей методики.- 20.2 μl of the transcription complex, prepared as described in subsection 2.4 of this procedure.

- 0,8 мкл раствора бычьего сывороточного альбумина (БСА). Для приготовления раствора БСА используют бычий сывороточный альбумин (St. Louis, МО), который готовят в концентрации 10 мг/мл разбавлением в буфере ТВ40 (20 мМ Tris-HCl (рН 7.9), 5 мМ MgC12, 1 мМ β-меркаптоэтанола и 40 мМ КС1).- 0.8 μl of bovine serum albumin (BSA) solution. To prepare the BSA solution, bovine serum albumin (St. Louis, MO) is used, which is prepared at a concentration of 10 mg / ml by dilution in TB40 buffer (20 mM Tris-HCl (pH 7.9), 5 mM MgC12, 1 mM β-mercaptoethanol and 40 mM KC1).

- 2 мкл раствора АТФ. Используют коммерческий препарат АТФ (GE Helthcare Life Science) с исходной концентрацией 100 мМ.- 2 μl of ATP solution. A commercial ATP preparation (GE Helthcare Life Science) was used with an initial concentration of 100 mM.

- 1 мкл раствора ПЭГ. Для приготовления раствора ПЭГ используют реактив ПЭГ8000 (Sigma). Взвешивают 40 грамм ПЭГ8000, доводят деионизованной водой до 100 мл, растворяют путем перемешивания на магнитной мешалке.- 1 μl of a PEG solution. To prepare the PEG solution, PEG8000 reagent (Sigma) is used. 40 grams of PEG8000 are weighed, adjusted to 100 ml with deionized water, and dissolved by stirring on a magnetic stirrer.

- 13 мкл раствора нуклеосом, приготовленных, как описано в подразделе 4 настоящей методики.- 13 μl of a solution of nucleosomes prepared as described in subsection 4 of this procedure.

- 2 мкл 10-кратного раствора ТВ40.- 2 μl of a 10-fold solution of TB40.

- 1 мкл раствора Т4 лигазы. Используют коммерческий препарат Т4 лигазы (фирма -производитель - New England Biolabs, США). Исходная концентрация (400,000 units/ml). Добавляют 1 мкл стокового раствора на 20-50 мкл реакционной смеси. Общий объем смеси - 40 мкл. Смесь инкубируют при 13°С в течение 1 часа.- 1 μl of a solution of T4 ligase. Use a commercial preparation of T4 ligase (manufacturer - New England Biolabs, USA). Initial concentration (400,000 units / ml). Add 1 μl of stock solution to 20-50 μl of the reaction mixture. The total volume of the mixture is 40 μl. The mixture was incubated at 13 ° C for 1 hour.

Затем в полученную смесь 40 мкл добавляют 4,5 мкл раствора АТФ и 2 мкл α-32Ф-ГТФ. Для приготовления раствора АТФ используют коммерческий препарат АТФ (GE Helthcare Life Science). Исходная концентрация (100 мМ). Подготовку проводят в соответствии с инструкцией производителя. Стоковый раствор концентрацией 100 мМ разводят деионизованной водой до концентрации 100 мкМ, т.е. в 100 раз. Для приготовления раствора α-32p-ΓΤΦ используют коммерческий препарат α-32р-ГТФ (Perkin Elmer). Исходная концентрация ГТФ, [α-32Ф]- 3000Ci/mmol 10mCi/ml). Подготовку проводят в соответствии с инструкцией производителя.Then, 4.5 μl of ATP solution and 2 μl of α-32F-GTP are added to the resulting 40 μl mixture. To prepare the ATP solution, a commercial ATP preparation (GE Helthcare Life Science) is used. Initial concentration (100 mM). Preparation is carried out in accordance with the manufacturer's instructions. The stock solution with a concentration of 100 mM is diluted with deionized water to a concentration of 100 μM, i.e. 100 times. To prepare the solution of α-32p-ΓΤΦ, the commercial preparation α-32p-GTP (Perkin Elmer) is used. The initial concentration of GTP, [α-32F] - 3000Ci / mmol 10mCi / ml). Preparation is carried out in accordance with the manufacturer's instructions.

Общий объем смеси составляет 46,5 мкл. Инкубируют 15 мин при комнатной температуре. В полученную смесь 46.5 мкл добавляют 5 мкл раствора ГТФ, для приготовления которого использовали коммерческий препарат ГТФ (GE Helthcare Life Science). Исходная концентрация (100 мМ), подготовку проводили в соответствии с инструкцией производителя. Стоковый раствор концентрацией 100 мМ разводят деионизованной водой до концентрации 100 мкМ, т.е. в 100 раз Общий объем смеси составляет 51.5 мкл. Инкубируют 5 мин при комнатной температуре. Смесь доводят до объема 130 мкл добавлением 1-кратного раствора ТВ40. Проведение данных процедур позволяет получить комплексы, в которых РНК полимераза успевает транскрибировать 11-мерный олигонуклеотид. При этом РНК полимераза останавливается за 39 нуклеотидов от входа в нуклеосому. Такие комплексы получили название «ЭК-39». После подготовки смеси (объемом 51.5 мкл) аликвотят и для дальнейших экспериментов по транскрипции используют 10 мкл.The total volume of the mixture is 46.5 μl. Incubated for 15 minutes at room temperature. To the resulting mixture of 46.5 μl was added 5 μl of a GTP solution, for the preparation of which a commercial GTP preparation (GE Helthcare Life Science) was used. The initial concentration (100 mm), the preparation was carried out in accordance with the manufacturer's instructions. The stock solution with a concentration of 100 mM is diluted with deionized water to a concentration of 100 μM, i.e. 100 times the total volume of the mixture is 51.5 μl. Incubated for 5 min at room temperature. The mixture was adjusted to a volume of 130 μl by adding 1x TB40 solution. Carrying out these procedures allows to obtain complexes in which RNA polymerase manages to transcribe an 11-dimensional oligonucleotide. In this case, RNA polymerase stops for 39 nucleotides from the entrance to the nucleosome. Such complexes are called "EK-39." After preparation of the mixture (51.5 μl volume), aliquots were used and 10 μl was used for further transcription experiments.

Оценку получившихся ЭК-39 проводят следующим образом. ЭК-39 сорбируют на Ni2+-NTA агарозных зернах в течение 5 мин, аккуратно перемешивая каждые 40 сек. Затем трижды промывают 0,5 мл ТВ40, инкубируют в присутствии 0,5 мг/мл ацетилированного БСА (Sigma-Aldrich) в течение 10 мин и промывают два раза 0,5 мл ТВ40. Центрифугируют образцы при 1600 оборотах в минуту в течение 1 мин при комнатной температуре. Отмывают зерна с иммобилизованными ЕС-39 комплексов один раз с ТВ40, дважды ТВ300 (20 мМ Tris-HCl (рН 7.9), 5 мМ MgC12, 1 мМ β-меркаптоэтанола и 300 мМ KCl) и дважды ТВ40. Центрифугируют после каждой отмывки на микроцентрифуге Eppendorf при 1600 оборотах в минуту в течение 1 мин при комнатной температуре. Инкубируют отмытые зерна в 30 мкл буфера ТВ 150 ((20 мМ Tris-HCl (рН 7.9), 5 мМ MgC12, 1 мМ β-меркаптоэтанола и 150 мМ КС1) с 100 мМ имидазола при комнатной температуре в течение 5 мин при осторожном пипетировании каждые 30-40 сек. Для измерения ЭК-39 используют небольшую аликвоту (3-4 мкл).Evaluation of the resulting EC-39 is carried out as follows. EK-39 is sorbed on Ni2 + -NTA agarose grains for 5 minutes, gently mixing every 40 seconds. Then washed three times with 0.5 ml of TB40, incubated in the presence of 0.5 mg / ml of acetylated BSA (Sigma-Aldrich) for 10 minutes and washed twice with 0.5 ml of TB40. Centrifuge the samples at 1600 rpm for 1 min at room temperature. The grains with immobilized EC-39 complexes are washed once with TB40, twice with TB300 (20 mM Tris-HCl (pH 7.9), 5 mM MgC12, 1 mM β-mercaptoethanol and 300 mM KCl) and twice with TB40. Centrifuged after each washing in an Eppendorf microcentrifuge at 1600 rpm for 1 min at room temperature. The washed grains are incubated in 30 μl of TB 150 buffer ((20 mM Tris-HCl (pH 7.9), 5 mM MgC12, 1 mM β-mercaptoethanol and 150 mM KCl) with 100 mM imidazole at room temperature for 5 minutes with careful pipetting every 30-40 seconds A small aliquot (3-4 μl) is used to measure the EC-39.

6. Транскрипция in vitro в присутствии PARP1. Используя Ni2+-NTA агарозные зерна (50% суспензии в этаноле), можно сорбировать полученные комплексы затем, после отмывки, добавлять другие «буквы» нуклеотидов - ТТФ либо УТФ, чтобы продвинуть РНК полимеразу далее во время транскрипции. Если добавить все «буквы», то транскрипция идет на всей матрице и получается полноразмерный транскрипт. Реализуется следующим образом.6. In vitro transcription in the presence of PARP1. Using Ni2 + -NTA agarose grains (50% suspension in ethanol), it is possible to sorb the resulting complexes, then, after washing, add other “letters” of nucleotides - TTF or UTP to advance RNA polymerase further during transcription. If you add all the "letters", then the transcription goes on the entire matrix and you get a full-sized transcript. It is implemented as follows.

6.1. Транскрипция до получения полноразмерного транскрипта6.1. Transcription to receive a full-size transcript

После подготовки ЭК-39 (объемом 51.5 мкл) аликвотят и для 1 эксперимента транскрипции используют 10 мкл, добавляют 2 мкл стокового раствора 4 дезоксинуклеотидтрифосфатов (дНТФ) и 2 рМ очищенного фактора PARP-1, которые разводят буфером для транскрипции до 20 мкл. Буфер для транскрипции готовят следующим образом: 1,3 мкл 2М KCL (до конечной концентрации 150 мМ KCL), 6,7 мкл буфера ТВ 150 (20 мМ Tris-HCl, рН 7.9, 5 mM MgC12, 10 тМ ZnC12, 2 тМ 2-меркаптоэтанола).After preparation of EC-39 (51.5 μl volume), aliquots were used and 10 μl was used for 1 transcription experiment, 2 μl of stock solution of 4 deoxynucleotide triphosphates (dNTPs) and 2 rM purified factor PARP-1 were added, which were diluted with transcription buffer up to 20 μl. The transcription buffer is prepared as follows: 1.3 μl of 2M KCL (to a final concentration of 150 mM KCL), 6.7 μl of TB 150 buffer (20 mM Tris-HCl, pH 7.9, 5 mM MgC12, 10 tM ZnC12, 2 tM 2 mercaptoethanol).

Полученную смесь инкубируют 15 мин для качественных экспериментов. В таком виде получают полноразмерные транскрипты. Остановку транскрипции и выделение транскриптов описано в разделе 6.3. Оценку полученных результатов проводят способом, описанным в разделе 7.The resulting mixture was incubated for 15 minutes for quality experiments. In this form, full-size transcripts are obtained. Transcriptional arrest and transcript isolation is described in section 6.3. Evaluation of the results is carried out by the method described in section 7.

6.2. Остановка транскрипции и выделение транскриптов6.2. Transcription stop and transcript isolation

Транскрипцию останавливают эквивалентным объемом раствора фенол/хлороформа (1:1). Для приготовления раствора фенол/хлороформа использовали фенол производства Sigma, уравновешенный буфером состава 10 mM Tris НС1, рН 8.0, 1 тМ EDTA, с хлороформом производства J.T. Baker в соотношении 1:1). Тщательно перемешивали фенол-хлороформную смесь с транскрипционной смесью. Затем центрифугируют 14800 оборотов/мин на центрифуге (Eppendorf) при комнатной температуре 15 мин. Отбирают супернатант, содержащий нуклеиновые кислоты. К супернатанту добавляют раствор преципитации, приготовленный соединением раствора гликогена концентрации 100 мкг/мкл производства Sigma из расчета 1 мкл/100 мкл и 3М ацетат натрия рН 5 из расчета 1/10 объема супернатанта. Из полученной смеси экстрагированные транскрипты высаживают с помощью спирта. Добавляют 95% этанол (стоковый раствор - J.T. Baker, до конечной концентрации ~70%, т.е. 3 объема спирта к 1 объему супернатанта. Инкубируют в течение 20 мин при -70°C. Центрифугируют 14800 оборотов/мин (Eppendorf) 15 мин. Отмывают холодным 70-75% этанолом. Центрифугируют 14800 оборотов/мин (Eppendorf) 15 мин. Отбирают максимально всю надосадочную жидкость с помощью вакуумного насоса. Затем сушат несколько минут пассивно либо на бане 42°С. Осадок используют для оценки транскрипции. Для проведения анализа полученных транскриптов и ДНК-гистоновых комплексов используют электрофорез в денатурирующем геле. Для дополнительной информации можно использовать электрофорез в нативном геле, анализ чувствительности к рестриктазам с последующим проведением электрофореза в нативном геле, ДНКаза1-футпринтинг и пр.Transcription is stopped with an equivalent volume of phenol / chloroform solution (1: 1). To prepare the phenol / chloroform solution, we used Sigma phenol balanced with 10 mM Tris HC1 buffer, pH 8.0, 1 tM EDTA, with chloroform produced by J.T. Baker in a 1: 1 ratio). The phenol-chloroform mixture was thoroughly mixed with the transcription mixture. 14800 rpm was centrifuged in a centrifuge (Eppendorf) at room temperature for 15 minutes. A supernatant containing nucleic acids was selected. To the supernatant is added a precipitation solution prepared by combining a glycogen solution with a concentration of 100 μg / μl manufactured by Sigma at the rate of 1 μl / 100 μl and 3M sodium acetate pH 5 based on 1/10 of the volume of the supernatant. From the resulting mixture, the extracted transcripts are planted with alcohol. Add 95% ethanol (stock solution - JT Baker, to a final concentration of ~ 70%, i.e. 3 volumes of alcohol to 1 volume of supernatant. Incubate for 20 minutes at -70 ° C. 14800 rpm centrifuged (Eppendorf) 15 min. Wash with cold 70-75% ethanol. Centrifuged at 14800 rpm (Eppendorf) for 15 minutes. Take off the entire supernatant using a vacuum pump. Then passively dry it for several minutes or use a 42 ° C bath. The precipitate is used to evaluate transcription. analysis of the obtained transcripts and DNA-histone complexes using electro denaturing gel phoresis For additional information, native gel electrophoresis, restriction enzyme sensitivity analysis followed by native gel electrophoresis, DNAse1 footprinting, etc.

7. Оценка транскрипции с помощью электрофореза7. Assessment of transcription using electrophoresis

Метод оценки транскрипции представлен на конкретном примере. На фиг. 1 приведен скан ПААГ электрофореза после прохождения транскрипции в присутствии или отсутствии PARP1.A method for assessing transcription is presented using a specific example. In FIG. Figure 1 shows a scan of the SDS page electrophoresis after transcription in the presence or absence of PARP1.

На электрофореграмме (фиг. 1) наблюдается ряд полос различного размера и интенсивности, отражающих силу паузирования РНК полимеразы во время процесса транскрипции: чем сильнее паузирование, тем ярче полоска на геле. Каждая из полос характеризует транскрипционные барьеры для полимеразы - зоны паузирования. Паузирование РНК полимеразы происходит в результате прохождения фермента по ДНК, накрученной на нуклеосому. Зона нуклеосомы выделена слева овалом. Под влиянием различных факторов паузирование может ослабевать, в таком случае полоски на геле внутри нуклеосомной области становятся более бледными в нижней части и сдвигаются все выше, вплоть до положения “R-off” (от англ. - "run-off»). В положении “r-off” РНК-полимераза успешно проходит всю матрицу и заканчивает синтез полного транскрипта. Каждая пауза внутри нуклеосомы обозначается по положению нуклеотида, на котором происходит остановка, по отношению к “входу” в нуклеосому.On the electrophoregram (Fig. 1), a number of bands of various sizes and intensities are observed, reflecting the strength of the RNA polymerase pausing during the transcription process: the stronger the pausing, the brighter the strip on the gel. Each of the bands characterizes transcriptional barriers for polymerase - the pausing zone. Pausing of RNA polymerase occurs as a result of the passage of the enzyme through DNA, wound on the nucleosome. The nucleosome zone is marked with an oval on the left. Under the influence of various factors, pausing can weaken, in this case the strips on the gel inside the nucleosome region become paler in the lower part and shift higher up to the “R-off” position (from the English - “run-off”). “R-off” RNA polymerase successfully passes the entire matrix and completes the synthesis of the complete transcript. Each pause inside the nucleosome is indicated by the position of the nucleotide at which it stops, relative to the “entry” into the nucleosome.

Приведен электрофорез после транскрипции нуклеиновых кислот в присутствии PARP-1 как в присутствии НАД+, так и без НАД+. Было обнаружено, что, если только PARP1 присутствует в реакции, транскрипционные барьеры слегка повышаются и общая эффективность транскрипции уменьшается. В присутствии НАД+ картина меняется: происходит увеличение эффективности транскрипции и ослабление нуклеосомного паузирования РНКП2, особенно в областях от +15 до +45. В присутствии ингибитора PARP1 олапариба (вторая справа колонка на форезе) видно заметное увеличение паузирования, что говорит о том, что олапариб ингибирует действие PARP1 и препятствует прохождению транскрипции. Таким образом, олапариб можно использовать в разработанной системе ИНСТИВ в качестве референс-ингибитора. Другой ингибитор (некаталитический) - госсипол в меньшей степени ингибирует действие PARP1.Electrophoresis is given after transcription of nucleic acids in the presence of PARP-1 both in the presence of NAD + and without NAD +. It was found that, if only PARP1 is present in the reaction, the transcriptional barriers increase slightly and the overall transcription efficiency decreases. In the presence of NAD +, the picture changes: there is an increase in transcription efficiency and a weakening of the nucleosome pausing of RNAP2, especially in the regions from +15 to +45. In the presence of the PARP1 inhibitor olaparib (second column on the right side of the phoresis), a noticeable increase in pausing is seen, which suggests that olaparib inhibits the action of PARP1 and prevents the passage of transcription. Thus, olaparib can be used in the developed INSTIV system as a reference inhibitor. Another inhibitor (non-catalytic), gossypol, to a lesser extent inhibits the action of PARP1.

Полученные в ходе проведения электрофореза результаты возможно оценить полуколичественно, используя установку для сканирования гелей (например, Typhoon Trio (GE Healthcare, USA), и представить в виде процентного содержания выхода транскриптов и интермедиатов (фиг. 2).The results obtained during electrophoresis can be evaluated semi-quantitatively using a gel scanning unit (for example, Typhoon Trio (GE Healthcare, USA), and presented as a percentage of the output of transcripts and intermediates (Fig. 2).

Таким образом, используя систему ИНСТИВ, полученную в результате сборки нуклеосом из очищенных гистонов на ДНК-матрицах и последующей сшивки с РНК-полимеразным комплексом, и внесения молекулярной мишени - белка PARP1, а затем внесения различных химических соединений, можно проводить оценку продуктов транскрипции и отбирать соединения, влияющие на транскрипционную активность PARP1. Оценку активности соединений проводят с референсным значением - PARP1 с НАД (3-й столбец на фиг. 2), при этом положительным контролем служит PARP1 с НАД (2-й столбец на фиг. 2). Полуколичественную оценку можно проводить, сравнивая процентное (%) соотношение полноразмерных транскриптов (R-off). Референсное значение (то есть в присутствии PARP1+НАД) соответствует 50% выходу транскриптов (считая от общего количества всех транскриптов: полноразмерных и незаконченных). Если снижение R-off более 25% по сравнению PARP1+НАД, то эффект значимый, и можно расценивать как вещество с сильной ингибирующей активностью. Если снижение R-off от 10 до 25%, то вещество обладает средней ингибирующей активностью. И если снижение менее 10%, то вещество слабо ингибирует активность PARP1. Дополнить информацию об ингибирующей активности можно, анализируя остановки РНК полимеразы во время транскрипции (степень паузирования). Референсное значение (то есть в присутствии PARP1+НАД) остановок РНК полимеразы в положении +15 составляет 25% и в положении +45 тоже 25%. Увеличение паузирования (по сравнению с референсным) более чем на 15% указывает на сильные ингибирующие свойства вещества. Изменение в пределах 15% (по каждому из показателей (остановки в +15 или +45) указывает на слабую ингибирующую активность вещества. Кроме того, анализ остановок РНК полимеразы дает некоторое представление о продвижении РНК полимеразы внутри нуклеосомы. Предложенная система позволяет не только находить новые ингибиторы PARP1, но и проверять их функциональную активность. Авторы заявки полагают, что сведений, изложенных в материалах заявки, достаточно для практического осуществления изобретения.Thus, using the INSTIV system, obtained by assembling nucleosomes from purified histones on DNA matrices and subsequent crosslinking with the RNA polymerase complex, and introducing the molecular target - protein PARP1, and then introducing various chemical compounds, it is possible to evaluate transcription products and select compounds affecting the transcriptional activity of PARP1. Evaluation of the activity of the compounds is carried out with a reference value of PARP1 with NAD (3rd column in Fig. 2), while PARP1 with NAD (2nd column in Fig. 2) serves as a positive control. A semi-quantitative assessment can be carried out by comparing the percentage (%) ratio of full-size transcripts (R-off). The reference value (that is, in the presence of PARP1 + NAD) corresponds to 50% of the transcript output (counting from the total number of all transcripts: full-sized and unfinished). If the R-off decrease is more than 25% compared to PARP1 + NAD, then the effect is significant, and can be regarded as a substance with strong inhibitory activity. If the R-off reduction is from 10 to 25%, then the substance has an average inhibitory activity. And if the decrease is less than 10%, then the substance weakly inhibits the activity of PARP1. Information on inhibitory activity can be supplemented by analyzing the stoppage of RNA polymerase during transcription (degree of pausing). The reference value (that is, in the presence of PARP1 + NAD) of RNA polymerase stops at position +15 is 25% and at position +45 also 25%. An increase in pausing (compared to the reference) by more than 15% indicates strong inhibitory properties of the substance. A change within 15% (for each of the indicators (stops at +15 or +45) indicates a weak inhibitory activity of the substance. In addition, the analysis of RNA polymerase stops gives some idea about the progress of RNA polymerase inside the nucleosome. The proposed system allows not only to find new PARP1 inhibitors, but also to check their functional activity. The authors of the application believe that the information set forth in the application materials is sufficient for the practical implementation of the invention.

Claims

1. A method for screening anticancer drugs - PARP1 inhibitors, including assembling nucleosomes from purified histones on DNA matrices, ligation with RNA polymerase, introducing PARP1 protein into the resulting molecular target complex, followed by adding a transcription buffer containing deoxynucleotide triphosphates (dNTP) and α-32F-GTP, as well as test or control chemical compounds, transcription, evaluation of transcription products by separation using electrophoresis, the conclusion about the presence of the test compound PARP1-inhibitory activity is done when there are bands on the electrophoregram at points +15, +45 and in the run-off region, showing transcription pausing, as shown in FIG. 1, wherein said activity assessment is carried out with a reference value of PARP1 with NAD.

2. The method according to p. 1, characterized in that the reference value corresponds to a 50% yield of transcripts in the run-off region, if the decrease in the transcript yield of the test compound is more than 25% compared to the reference, the compound is evaluated as a substance with strong inhibitory activity if the decrease is from 10 to 25%, then as a substance with an average inhibitory activity, and if the decrease is less than 10%, then as a substance with a weak inhibitory activity;

- in the case of an increase in pausing compared to the reference point at points +15 or +45 by more than 15%, the compound is evaluated as a substance with strong inhibitory activity, if this increase is within 15%, then as a substance with weak inhibitory activity.

3. The method according to p. 1, characterized in that the RNA polymerase is an RNA polymerase 2 of natural or recombinant origin from various organisms selected from the group of yeast, mammals, reptiles.

4. The method according to p. 1, characterized in that the RNA polymerase using RNA polymerase of natural or recombinant prokaryotic origin.

5. The method according to p. 4, characterized in that the RNA polymerase is used E. coli RNA polymerase.

6. The method according to p. 1, characterized in that for the assembly of nucleosome matrices using purified preparations of histones H2A, H2B, H3, H4 of natural origin from various organisms selected from the group of yeast, mammals, reptiles.

7. The method according to p. 6, characterized in that when using purified histones H3 and H4 they are added in two-fold, and purified histones H2A and H2B in three-fold excess with respect to template DNA.

8. The method according to p. 1, characterized in that for the assembly of nucleosome matrices using mutant histone proteins.

9. The method according to p. 8, characterized in that Sin mutants are used as mutant histone proteins.

10. The method according to p. 1, characterized in that they carry out the assembly of incomplete nucleosomes.

11. The method according to p. 1, characterized in that for the assembly of nucleosome matrices using recombinant or synthetic histones of eukaryotic and prokaryotic origin.

12. The method according to p. 6, characterized in that for the assembly of nucleosome matrices additionally use histone H1 of both natural and recombinant origin.

13. The method according to p. 1, characterized in that for the assembly of nucleosomes use a DNA matrix that carries mutations associated with various diseases or with aging.

14. The method according to claim 1, characterized in that factors remodeling chromatin are introduced into the system together with the test agent.

15. The method according to p. 14, characterized in that as factors remodeling chromatin, use SWI / SNF, ISW2, ACF.

16. The method according to p. 1, characterized in that the assembly of nucleosomes occurs on the surface of the wells of the tablet or grains of the sorbent.

17. The method according to p. 1, characterized in that before evaluating the products of transcription, the mixture is additionally treated with reagents for footprinting.

18. The method according to p. 17, characterized in that the treatment is carried out with hydroxyls or DNAA1.

19. The method according to p. 1, characterized in that before introducing the agents into the system carry out preliminary mathematical modeling.