RU2619172C1 - Method for assessment of human periodontal resistance to development of chronic generalized periodontitis based on quantitative detection of periodontium protecting veillonella parvula bacteria by real time pcr - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: invention relates to determination of the extent of periodontal resistance to infection by Porphyromonas gingivalis, Prevotella intermedia, and Tannerella forsythensis pathogenic bacteria due to Veillonella parvula periodontium protecting bacteria presence. Determination of periodontal V. parvula contamination is achieved by real-time PCR. The invention is a comprehensive test system for V. parvula determination, as well as a principle of threshold value application, which allows to establish the relative share of V. parvula in the periodontal bacterial consortium by normalization of a signal with specific primers to the common bacterial DNA signal, and distinguish the normal level of periodontal contamination (capable of restraining pathological periodontal pathogenic hypercolonizing by P. gingivalis, P. intermedia and T. forsythensis bacteria) from a dysbiotic shift, leading to periodontal damage or propensity to chronic generalized periodontitis (CGP) development. The invention can be used to assess the propensity of an individual patient to periodontal infection by P. gingivalis, P. intermedia and T. forsythensis pathogenic bacteria to identify causes of CGP in the individual patient, evaluation of risk of occurrence of this disease in future and treatment effectiveness for both aggressive, and chronic periodontitis. A new way of real time polymerase chain reaction results interpretation to determine a specific type of bacteria in periodontal washouts, including V. parvula, includes determination of a relative Ct value for the sample according to the following algorithm: the average Ct value of the total bacterial mass for the same sample series is subtracted from the absolute Ct value (software defined thermal cycler with optical detection) averaged by two or more independent determinations for the specific set of primers and probe, then the normal degree of periodontal V. parvula contamination is identified, provided that the relative Ct value does not exceed 15.

EFFECT: improved assessment accuracy.

13 cl

Description

FIELD OF THE INVENTION

The invention relates to the field of medicine, dentistry and clinical and laboratory diagnostics, in particular to determining the degree of contamination of the human periodontium Veillonella parvula - a component of normal microflora and a potential antagonist of periodontopathogens. The subject of the invention is a test system based on real-time PCR, which allows to assess the degree of contamination of the periodontium V. parvula.

The high colonization of the periodontium of the examined patient V. parvula allows us to conclude that it is highly resistant to hypercolonization by the pathogenic species Porphyromonas gingivalis, Prevotella intermedia and Tannerella forsythensis, while the low presence of V. parvula in the periodontal microbiocenosis or its complete absence is a prognostic sign of increased risk supercritical colonization of periodontal disease by pathogens, followed by the development of chronic generalized periodontitis (CGP). The greatest efficiency in assessing the periodontal status can be achieved by parallel measurement of the presence in the periodontal microbiocenosis of pathogens: Aggregatibacter actinomycetemcomitans, P. gingivalis, P. intermedia, T. forsythensis, Treponema denticola [1-5] and V. parvula. This approach allows us to predict the dynamics of the development of the disease, to evaluate the effectiveness of the course of treatment, passed by the patient.

State of the art

Currently, the main reason for the development of periodontitis is considered to be periodontal colonization by the periodontopathogens of the red complex according to Sokransky: A. actinomycetemcomitans, P. gingivalis, P. intermedia, T. forsythensis and T. denticola [6]. All existing methods of treatment for CGP (antibiotic therapy, photodynamic therapy, ozone therapy, the use of an infrared laser, apparatus such as "Vector") are aimed at reducing the periodontal contamination of these species. Specialists and patients themselves observe a positive effect from the use of these drugs, however, as a rule, it turns out to be unstable: from a few months to several years, patients prone to CGP are forced to undergo repeated courses of treatment. The reasons for the patients' individual tendency to recurrence of the infection of periodontal pathogens remain unclear, however, it can be assumed that they are associated with insufficient representation of pathogen bacteria, pathogen antagonists in the periodontal microbiocenosis. Currently, the analysis of periodontal microbiocenosis components that can prevent its hypercolonization by pathogens is not used in the diagnosis of periodontitis. In general, in the literature practically no attention is paid to this issue.

One of the works that addresses the issue of the presence of both pathogenic and tread microflora on a periodontium is the article “Identification of key elements of normal and pathogenic microflora determining the periodontal state by NSG sequencing of 168-rDNA banks of periodontal bacterial consortia” [7]. In this work, using the NGS sequencing method, 6 genera of potential periodontoprotectors and 8 genera of potential periodontopathogens were identified that are related to the risk of aggressive (but not chronic) periodontitis. In individuals with a healthy periodontium, a statistically significant dominance of the genus Veillonella was revealed, which, therefore, was proposed to be considered as a criterion for the health of periodontium. The genera Streptococcus, Bergeyella, Granulicatella, Kingella and Corynebacterium have also been proposed as candidate periodontoprotectors.

The following analogues of the present invention are known.

Patent No. 2306341, publication date September 20, 2007 (the patent expired on April 8, 2010, but can be restored): “A set of reagents for the determination of DNA of periodontopathogenic microbes Prevotella intermedia sensu stricto, Bacteroides forsythus, Treponema denticola, Actinobacillus actinomycetemcomitans, Porphyromis gonas multiplex polymerase chain reaction "

This invention allows to determine five periodontopathogens in one sample using multiplex PNR, which is achieved using a combination of 16s rDNA primers in certain concentrations.

The kit also contains a sample preparation kit and positive and negative control samples. Analysis of products of the NDP is carried out by electrophoresis.

Patent No. 2420591, publication date 06/10/2011. The invention is a set of synthetic oligonucleotides for detecting the DNA of the periodontopathogenic microorganism Porphyromonas gingivalis. The technical result, the achievement of which the present invention is directed, is the reliable detection of the specified bacteria in biological material collected using dental probes. The specified result is achieved by using a set of synthetic oligonucleotides for the detection of the DNA of the periodontotogenic microorganism Porphyromonas gingivalis when stating the NDP.

Patent No. 2420589, publication date 06/10/2011. The invention is a set of synthetic oligonucleotides for detecting the DNA of a periodontopathogenic microorganism Prevotella intermedia. The technical result, the achievement of which the present invention is directed, is the reliable detection of the specified bacteria in biological material collected using dental probes. The specified result is achieved by using a set of synthetic oligonucleotides to identify the DNA of the periodontotopic microorganism Prevotella intermedia when stating the NDP.

Patent No. 2420592, publication date 06/10/2010. The invention is a set of synthetic oligonucleotides for detecting the DNA of the periodontopathogenic microorganism Actinobacillus actinomycetemcomitans. The technical result, the achievement of which the present invention is directed, is the reliable detection of the specified bacteria in biological material collected using dental probes.

The specified result is achieved by using a set of synthetic oligonucleotides to identify the DNA of the periodontopathogenic microorganism Actinobacillus actinomycetemcomitans when setting the NDP.

In all of these patents, it is proposed to evaluate the periodontal colonization by pathogenic microorganisms, for which test systems are proposed that include sets of appropriate synthetic oligonucleotides (primers and probes) for conducting a PNR.

The present invention is characterized in that it is proposed to evaluate the level of periodontal colonization by a bacterium - an antagonist of pathogenic microorganisms (periodontoprotector) Veillonella parvula by PCR-RV, for which a test system is proposed containing a set of primers and probes, as well as a method for assessing a person’s periodontal status for resistance to the development of chronic generalized periodontitis.

Disclosure of invention

The authors propose a method for assessing a person’s periodontal condition for resistance to the development of chronic generalized periodontitis caused by P. gingivalis, P. intermedia, and T. forsythensis, in which the DNA of the periodontal bacterium Veillonella parvula is used as a specific marker.

The technical result of the present invention is a method for reliable detection of V. parvula in biological material, with the possibility of quantitative evaluation of bacterial DNA in periodontal washout.

This result is achieved by using a set of synthetic oligonucleotides for the detection of DNA of the periodontoprotective microorganism V. parvula during the NDP, using the principle of real-time NDP including primers and probe:

where BHQ1 is a dark fluorescence quencher attached to the 5'-terminal nucleotide, and FdT is a fluorescent dye FAM attached to nucleotide T.

Biological material is taken from the periodontal pocket in patients using sterile paper endodontic pins (size No. 30-35), which are then placed in a test tube with Proba-Rapid reagent (NPO DNA-Technology LLC, Russia) of 0.5 ml and transported to the laboratory in a refrigerated state for 6 hours. The fence is carried out in duplicate from each patient.

Isolation of the total DNA of periodontal flushing is carried out using the Proba-GS reagent kit (NPO DNA-Technology LLC, Russia) in accordance with the instructions for the reagent kit. A DNA preparation corresponding to 1/10 of the volume of one washout (50 μl) was dissolved in 50 μl of an eluting solution (Proba-GS complete set). As a matrix for conducting one PNR reaction, 5 μl of the obtained preparation is used.

Methodology for conducting a panorama in real time

1. In the labeled polypropylene tubes for real-time PCR (Axygen), a volume of 200 μl contribute components of the reaction mixture to perform PCR.

The composition of the buffer per reaction (20 μl of the mixture), μl:

- 18 - PCR buffer (Set of reagents for PCR amplification, NPO DNA-Technology LLC, Russia);

- 1,695 - water;

0.27 dNTP 25 μM;

- 0.014 - a primer of 1,100 μm;

- 0.014 - primer 2, 100 μM;

- 0.007 - probe labeled with Fam fluorophore and BHQ quencher, 50 μM.

A drop of molten paraffin is added to each tube to demarcate the components of the reaction mixture before starting the reaction.

Primers for the detection of V. parvula, which are synthetic oligonucleotides for the 322 bp length marker region of the V. parvula genome - locus pin0048 of the InpA gene, are introduced into the reaction in order to ensure amplification of the product. A probe specific to the same DNA site contains a fluorescence tag and a fluorescence quencher, and its 3'-end is not capable of lengthening by DNA polymerase due to blockage of the hydroxyl group. In the case of the formation of a specific DNA product, the probe specifically interacts with it and is partially destroyed by DNA polymerase. In this case, the action of the quencher on the fluorescent label within the probe molecule ceases due to their separation, which leads to an increase in the level of probe fluorescence. The fluorescence signal of the reaction mixture is read by a thermal cycler with an optical detection system in real time or with some periodicity (for example, once per amplification cycle). The fluorescence intensity of the probe allows you to evaluate the concentration of the formed product, which, in turn, depends on the efficiency of the primers with the DNA matrix, the amount of material to be studied, and other parameters. In other words, the primers provide the reaction, and the probe - the assessment of its results.

2. Ex tempora prepare a diluted Taq polymerase solution (Set of reagents for PCR amplification, NPO DNA-Technology LLC, Russia), mixing the stock solution of the enzyme and water in the ratio: 0.5 μl of polymerase per 10 μl of water per one reaction. 10 μl of a freshly diluted Taq polymerase solution was added to each labeled tube without damaging the paraffin layer, and 5 μl of the analyzed DNA solution. A drop of mineral oil is added to each tube without damaging the paraffin layer.

3. Negative control sample (OKO) - a sample that is entered into the definition without the use of DNA. Instead, 5 μl of deionized water is added to the tube. An OKO is necessary to control possible contamination of reagents with products from previously conducted reactions. A positive result in this sample requires canceling the test results of the entire series. The determination should be repeated using newly prepared reagents.

4. Test tubes are installed in the DT-322 thermal cycler (NPO DNA-Technology LLC, Russia) or similar in technical capabilities. The total volume of the reaction mixture is 35 μl.

In parallel with the determination of specific DNA sequences of V. parvula, the total bacterial mass in the sample is determined (normalization parameter), for which a real-time PCR reaction is carried out in parallel using the following oligonucleotide primers and probe:

where BHQ1 is a dark fluorescence quencher attached to the 5'-terminal nucleotide, and FdT is a fluorescent dye FAM attached to nucleotide T.

The reaction mixture for determining the total bacterial mass is carried out according to the procedure identical to that described for the determination of specific DNA sequences of V. parvula, except that instead of primers SEQ ID NO 1 and SEQ ID NO 2, primers SEQ ID NO 4 and SEQ ID NO 5 are used, and instead of the probe SEQ ID NO 3 use a probe SEQ ID NO 6 in equivalent molar concentrations.

The reaction is carried out with the following cycling parameters:

Amplification program:

Analysis settings installed on the device:

Method - Geometric (Cf) (BF), cr = 9, vt = 10, tp = 30, tv = 5

For each reaction, the thermal cycler software automatically calculates the threshold cycle Ct.

The signal normalization when determining specific DNA sequences of V. parvula for each sample is carried out by calculating the value of the relative Ct. For this, from the absolute Ct values obtained by determining the specific DNA sequences of V. parvula (averaged over two samples of the same series), subtract the average Ct value of the total bacterial mass for the same sample from the series. Normal periodontal colonization is recorded provided that the relative Ct value for V. parvula is 15.0 cycles or more.

The implementation of the invention

Clinical material was collected on the basis of MGMSU them. A.I. Evdokimova. 153 patients from a resident of Moscow and the Moscow region aged 16 to 70 years were examined. The main criterion for the diagnosis of CGP was the destruction of the periodontal attachment. The severity was determined based on the depth of periodontal pockets and the degree of destruction of bone tissue.

Clinical data on the periodontal status of patients were expressed in points, as described in [8]: the severity of the disease (from 1 to 5), the depth of the periodontal pocket (from 0 to 4). The age of the patients was taken into account by including them in one of the groups: <30, 30-50,> 50 years.

Biological material was examined from periodontal pockets by selecting the contents using sterile paper endodontic pins, which were then placed in a test tube with Proba-Rapid reagent (NPO DNA-Technology LLC, Russia) with a volume of 0.5 ml (periodontal washings) and transported to laboratory in a chilled state. Material processing was carried out in a period not exceeding 6 hours. The material was taken in duplicate from each patient; at the stage of DNA extraction and PPR analysis, each repetition was processed separately.

The total DNA of periodontal flushing of patients was isolated using the Proba-GS reagent kit (NPO DNA-Technology LLC, Russia) in accordance with the instructions for the reagent kit. A DNA preparation corresponding to 1/10 of the volume of one washout (50 μl) was dissolved in 50 μl of an eluting solution (Proba-GS complete set). As a matrix for one PCR reaction, 5 μl of the obtained preparation was used.

For each sample, seven parallel determinations of the following parameters were performed:

1. Determination of specific DNA sequences of V. parvula using primers SEQ ID NO 1 and SEQ ID NO 2 and probe SEQ ID NO 3.

2. Determination of the total bacterial mass in the sample using primers SEQ ID NO 4 and SEQ ID NO 5 and probe SEQ ID NO 6.

3. Determination of specific sequences of periodontopathogens according to Sokransky: A. actinomycetemcomitans, P. gingivalis, P. intermedia, T. forsythensis and T. denticola using the methods and oligonucleotides described previously [5].

In order to normalize the signal (taking into account the spread in the amount of biomaterial taken and the efficiency of DNA extraction) for each sample, the “relative Ct” value was determined for both V. parvula and periodontopathogens. For this, from the absolute Ct value for a specific set of primers and probe averaged over two samples of the same series, the average Ct value of the total bacterial mass for the same two samples of the series was subtracted. The data expressed in the form of relative Ct were subjected to statistical processing.

Statistical processing of data was carried out using the Statistica 8.0 package for Windows, according to standard methods of variational analysis. To test the hypothesis about the significance of differences between pairs of samples in the studied parameter (relative Ct for V. parvula and periodontopathogens), the non-parametric Mann-Whitney test was used. When analyzing the correlations between the studied parameters within the sample, we used the Spearman correlation analysis. In all cases, the level of statistical significance was taken as 95% (p≤0.05).

The studied sample (153 people) included a control group of 75 people (patients without signs of periodontitis), an average age of 28 years and a case group (patients diagnosed with gingivitis, mild, moderate and severe CGP), the average age was 42 years. We can say that the control group included more patients from a younger age category, while the group of patients with CGP was more age-related. This result is associated with objective reasons: chronic periodontitis is an age-related disease, which complicates the task of selecting both young patients with a diagnosis of CGP (often at a young age we are talking about aggressive periodontitis) and age-related patients with a high degree of preservation of periodontal disease.

The ratio of the size of the samples of men and women was 61 and 92, respectively (the ratio of ages with a difference of ± 1 year corresponds to the values of the entire sample). Within the sample of women, the ratios were distributed as follows: women from the control group - 51 patients, women with a diagnosis of CGP - 41 patients; in the group of men, the control group was 27 people, CGP - 34 patients.

Statistical processing of the results using the non-parametric Mann-Whitney test showed significant differences in the level of contamination of the periodontium V. parvula in patients diagnosed with periodontitis and in the control group. So, the parameter R in the compared samples is 4, while the p value (significance of differences) was 5.5 × 10 ^-5 . This indicates that periodontal contamination with the V. parvula bacterium in healthy patients is significantly higher than in patients with CGP, which, in turn, confirms the assumption of the presence of protective properties in V. parvula.

When comparing the “relative Ct” parameter for V. parvula, no statistically significant differences were found in the samples of men and women. When comparing healthy women - women diagnosed with CGP with the same parameter of the samples, differences were observed on the verge of reliability. However, when comparing the “relative Ct” parameter for V. parvula in the samples, healthy men — men with a diagnosis of CGP — differences in the parameter R were 3.8 with the significance of the differences (p) = 1.3 × 10 ^-4 .

As a result of the analysis of the correlation in the representation on the periodontium of V. parvula and the main periodontopathogens according to Sokransky using the Spearman criterion, the following results were obtained: a pronounced inverse correlation is observed when comparing the degree of contamination of the periodontium V. parvula and P. gingivalis (R = 3.4, at p = 7 × 10 ^-4 ). The correlations of the representation of V. parvula in pairs with P. intermedia and T. forsythensis were also negative, but less stringent: R = 2.9 at p = 4 × 10 ^-3 and R = 3, l at p = 2 × 10 ^-3 respectively. No significant correlation was found between periodontal colonization by periodontoprotector V. parvula and periodontopathogens T. denticola and A. actinomycetemcomitans.

Such results may indicate that the contamination of the V. parvula bacterium is not directly related to the patient’s sex, but confirm the antagonistic effect of V. parvula in relation to periodontopathogens or periodontopathogen groups, the periodontal contamination of which is to some extent related to sex: P. gingivalis, to a lesser extent, P. intermedia and T. forsythensis.

The source of information

1. Zorina O.A., Kulakov A.A., Grudyanov A.I., Petrukhina N.B., Boriskina O.A., Avraamova T.V., Turchaninova M.A., Rebrikov D.V. RF patent No. 2420589. A set of synthetic oligonucleotides for the detection of DNA of the periodontopathogenic microorganism Prevotella intermedia by polymerase chain reaction. Application dated 04/21/2010. Publ. 06/10/2011.

2. Zorina OA, Kulakov AA, Grudyanov AI, Petrukhina NB, Boriskina OA, Avraamova TV, Turchaninova MA, Rebrikov DV RF patent No. 2420591. A set of synthetic oligonucleotides for the detection of DNA of the periodontopathogenic microorganism Porphyromonas gingivalis by polymerase chain reaction. Application dated 04/21/2010. Publ. 06/10/2011.

3. Zorina O. A., Kulakov A. A., Grudyanov A. I., Petrukhina N. B., Boriskina O. A., Avraamova T. V., Turchaninova M. A., Rebrikov D. V. RF patent No. 2420592. A set of synthetic oligonucleotides for the detection of DNA of the periodontopathogenic microorganism Actinobacillus actinomycetemcomitans by polymerase chain reaction. Application dated 04/21/2010. Publ. 06/10/2011.

4. Rebrikov D.V., Zorina O.A., Petrukhina N.B., Boriskina O.A., Berkutova I.S., Aimadinova N.K. RF patent No. 2510857. A set of synthetic oligonucleotides for the detection of DNA of the periodontopathogenic microorganism Treponema denticola by polymerase chain reaction. Application from 02.24.2012. Publ. 04/10/2014.

5. Shibaeva A.V., Rebrikov D.V., Trubnikova E.V., Ayvazova R.A. et al. A method for assessing periodontal colonization by pathogenic bacteria using real-time polymerase chain reaction. Application for patent for invention No. 201520411 dated 05/29/2015.

6. Ximénez-Fyvie L.A., Haffajee A.D., Socransky S.S. Comparison of the microbiota of supra- and subgingival plaque in health and periodontitis. J. Clin. Periodontol. 2000. V. 27. No. 9. P. 648-657.

7. Zorina O.A., Shibaeva A.B., Trubnikova E.B., Rebrikov DV, Shevelev A.B. Identification of key elements of normal and pathogenic microflora that determine the state of periodontal disease using NSG sequencing of 168-rDNA banks of periodontal bacterial consortia. Dentistry 2014. Volume 93. No. 6. S. 25-31.

8. Armitage G.C. Development of a classification system for periodontal diseases and conditions. Annals of periodontology. 1999. No4. P. 1-6.

Claims (11)

1. A method for assessing the state of human periodontal disease for resistance to the development of chronic generalized periodontitis caused by P. gingivalis, P. intermedia and T. forsythensis, characterized in that the periodontal contamination rate with the bacterium-periodontium Veillonella parvula determined by the polymerase method is used as a specific marker real-time chain reaction using specific primers and a probe, and when fixing a low level of contamination of Veillonella parvula, the risk of developing chronic generalized parody ontita is rated as high. 2. The method according to p. 1, characterized in that for the detection of Veillonella parvula DNA specific primers and probe are used: SEQ ID NO 1 ATCGGTTCTTTCATCATCGCTATT SEQ ID NO 2 TTAGTGGGTCAAAACCTACGGCAA SEQ ID NO 3 (BHQ1) -GCGGCACCT (FdT) CAAGGGCACCAGTG-P, where BHQ1 is a dark fluorescence quencher attached to the 5'-terminal nucleotide, and FdT is a fluorescent dye FAM attached to nucleotide T; 3. The method according to p. 1, characterized in that the absolute value of the threshold cycle and the Ct value of the total bacterial mass for the same sample are determined using universal primers specific for bacterial 16S rDNA and probe: SEQ ID NO 4 GGGCTACACACGTGCTACA SEQ ID NO 5 GGGTACCTTGTTACGACTT SEQ ID NO 6 (BHQ1) CGGGCCTTG (FdT) ACACACCGCCCGTC, where BHQ1 is the dark fluorescence quencher attached to the 5'-terminal nucleotide, and FdT is the FAM fluorescent dye attached to nucleotide T, after which the Ct parameter is calculated for the specific Veillonella parvula sequence and the total bacterial mass in the sample and normalized: from averaged over two or more independent determinations of the absolute value of Ct for a specific set of primers and probe subtract the average value Ct of the total bacterial mass for the same sample series; normal periodontal colonization is recorded provided that the relative Ct value for Veillonella parvula is 15.0 cycles or less, a larger number of cycles indicates a low colonization.