RU2590700C2 - Method of identifying regulator short-lived proteins in human proteome involved in specific modulation of cytotoxic effect - Google Patents

Abstract

FIELD: biochemistry.

SUBSTANCE: chimeric fusion proteins are obtained: GST USD HDAC6 and GST-PSMA3, via expression thereof in E. coli cells by adding corresponding vectors and subsequent treatment by affine chromatography on glutathione-sepharose. Method comprises reaction of binding proteins from extract of multiple myeloma cells before or after combined chemotherapy with bortezomib and doxorubicin with GST-UBD_HDAC6 and GST-PSMA3. Method includes washing off bound proteins from chromatographic carrier with glutathione-containing buffer solution. Desalination and concentration are performed on micro-concentrators. Obtained protein preparations are separated in a two-dimensional electrophoresis system: I direction - isoelectric focusing of proteins on device Ettan IPG Phor3 (GE Healthcare), II direction - separation of proteins by molecular mass in denaturating Laemmli electrophoresis. Spots corresponding to separate proteins are cut from polyacrylamide gel and composition thereof is analysed. Higher efficiency of cleaning regulatory of short-lived proteins (both polyubiquitinated (GST-UBD_HDAC6) and subject to ubiquitin-independent proteolysis GST-PSMA3)). Convenience of method consists in that it makes it possible to manipulate directly with cell extracts, without additional purification steps of proteins.

EFFECT: invention simplifies diagnosis of multiple myeloma by detecting among short-lived regulatory proteins specific markers specific for given disease.

1 cl, 2 dwg, 1 tbl

Description

The invention relates to the field of biotechnology, in particular to genetic and cellular engineering, and can be used in medicine.

Multiple myeloma (MM) is a malignant tumor of the B-lymphocyte system in the bone marrow, leading to the differentiation of pre-B cells into plasma cells. Transformed plasmocyte cells, in addition to replacing normal bone marrow cells, also produce a myeloma protein, which is a monoclonal antibody that replaces normal antibodies in the blood, which leads to an increase in the body's susceptibility to infection and kidney problems. The etiology of this disease is not fully understood. It is known that at the protein level, myeloma cells are characterized by increased expression of DNA-dependent kinase, casein kinase CK2, Akt and other kinases responsible for the transmission of the proliferation signal.

To date, one of the most promising drugs against this incurable disease is bortezomib (Velcade). Bortezomib is a boron acid derivative dipeptide and is a potent specific inhibitor of proteasome proteolytic activities (Adams J. and Kauffman M. 2004. Cancer Investigation 22: 304-311; Jagannath S. et al., 2004. British Journal of Haematology. 127: 165-172.). The proteasome implements the main non-lysosomal proteolytic pathway in the cell through the recognition and specific destruction of proteins covalently modified with the ubiquitin protein. It is important to note that myeloma cells are much more sensitive to the effects of bortezomib compared to normal blood plasma cells, or B cells. To date, the mechanism of this phenomenon is not known.

Recently it was shown that treatment of MM cells with bortezomib increased their sensitivity to drugs that cause genotoxic stress, in particular, to doxorubicin. Survival of patients with resistance to bortezomib monotherapy with combined chemotherapy with doxorubicin increased almost 2 times (Orlowski R.Z. 2004. J. Natl. Compr. Cane. Netw. 2 Suppl 4: S16-20). Doxorubicin is a genotoxic agent that, by blocking the activity of the topoisomerase II enzyme, causes double-stranded DNA breaks. Doxorubicin, at low doses, enhances the activity of proteasomes, and at high doses, inhibits it.

The molecular mechanisms of synergism between bortezomib and doxorubicin in myeloma cells are still completely unexplored and are an urgent problem for both fundamental and applied medicine. We can only assume that this effect may be due to the accumulation of signal short-lived ubiquitinated proteins (under normal conditions, destroyed by the proteasome), which induce cell cycle arrest and apoptosis in response to DNA damage. The proteomic approach should accelerate the identification of the corresponding ubiquitinated proteins, which would begin to study their role in cell cycle arrest and apoptosis of myeloma cells in response to chemotherapy. In this regard, the problem of studying the ubiquitoma proteins that interact with the proteasome and accumulate in the cells as a result of the action of bortezomib and doxorubicin becomes extremely urgent.

The problem of identifying ubiquitinated proteins is that they are rapidly degraded by the proteasome, and the percentage of their content in the cell is very small. Accordingly, the methodological question arises of purification and enrichment of the fraction of ubiquitinated proteins for their further identification by mass spectrometric analysis.

Another important point is the fact that in addition to ubiquitin-dependent degradation, proteasomes are also capable of destroying proteins along the ubiquitin-independent pathway, through protein-protein interactions with the alpha 7 (PSMA3) subunit of the 20S proteasome (Fedorova OA, Moiseeva TN, Nikiforov AA, Tsimokha AS, Livinskaya VA, Hodson M., Bottrill A., Evteeva IN, Ermolayeva JB, Kuznetzova IM, Turoverov KK, Eperon I., Barlev NA 2011. Biochem. Biophys. Res. Commun. 416 (3-4): 258 -265). For example, the most important human cancer suppressor p53, which causes apoptosis of myeloma cells in response to genotoxic stress, undergoes proteasome degradation both in the ubiquitin-dependent and in the ubiquitin-independent pathways (Tsvetkov P., Reuven N. .. Shaul Y. 2010. Cell Death Differentiation 17: 103-108; Mittenberg AG, Moiseeva TN, Barlev NA 2008. Front. Biosci. 13: 7184-7192). In this case, in order to have a complete picture of the proteins destroyed by proteasomes in MM cells, it is also necessary to identify human proteome proteins that interact with the proteasome core complex, regardless of ubiquitinylation.

The 26S proteasome is known to be a complex of ATP-dependent proteases and consists of a 20S catalytic core particle and associated regulatory complexes. The proteasome implements the main non-lysosomal proteolytic pathway in the cell through the recognition and specific destruction of proteins covalently modified with the ubiquitin protein. The 20S proteasome (700 kDa) is a hollow cylinder consisting of four rings, each of which is respectively formed by a family of alpha or beta subunits. Alpha subunits play a structural role, and beta subunits directly carry out proteolytic destruction of proteins. The 19S regulatory complex consists of six ATPase and at least eleven non-ATPase subunits that help to recognize, denature and deubiquitinate the substrate protein for its subsequent destruction in the 20S complex (Konstantinova IM, Tsimokha AS, Mittenberg AG 2008. Int. Rev. Cell Mol. Biol. 267: 59-124). It is also necessary to take into account the fact that the proteasomes themselves can undergo ubiquitinylation, which can modulate its bonds with other proteins and proteolytic activities. Recent studies indicate that enzyme deubiquitinylating proteasomes may be new targets in cancer therapy (D'Arcy P., Under S. 2012. Int. J. Biochem. Cell Biol. 44 (11): 1729-1738) .

One of the most promising and at the same time quite simple approaches to solving this problem seems to us to create fusion proteins that carry the sequence of glutathione S-transferase (Smith DB, Johnson KS 1988. Gene. 67: 31-40), as well as interesting us polypeptide (sequence of the ubiquitin binding domain (SDL) of HDAC6 or a fragment of the 20S subunit of the proteasome alpha7 (PSMA3)).

HDAC6 ubiquitin binding domain (DRC) (Bertos NR, Gilquin B., Chan GK, Yen TJ, Khochbin S., Yang XJ 2004. J. Biol. Chem. 279: 48246-48254) mainly binds polyubiquitins, and not monoubiquitins, and therefore, most likely, will play an important role in vivo in the regulation of protein lifetime (Hook SS, Orian A., Cowley SM, Eisenman RN 2002. PNAS USA 99 (21): 13425-13430).

Accordingly, our proposed proteomic approach for identifying the totality of ubiquitinylated and neubiquitinylated proteins associated with the proteasome and being its substrates in MM cells seems to be very relevant and scientifically significant.

As a prototype, we have chosen the method described in patent US20090220470, the most relevant in relation to the studied object. It proposed a method of enriching drugs from total cell lysates with ubiquitinylated proteins using ubiquitin-binding domains of various genes. The essence of the method is to create a genetic engineering construct - a molecule of desosciribonucleic acid, which carries the DNA sequence of glutathione S-transferase in the expression vector, followed by specific binding sites of ubiquitin; followed by expression of this chimeric protein in E. coli cells. The authors propose using chimeric proteins that carry two tandemly located different ubiquitin-binding domains, thereby increasing the binding efficiency of ubiquitinylated proteins. The population of proteins enriched in this way is subsequently used for various studies of the ubiquitoma of the cell.

To date, the biochemical mechanisms that determine the fate of ubiquitinylated proteins have not been adequately studied. It has recently been found that the recognition of specific ubiquitinated target proteins occurs using ubiquitin-binding proteins, which are also known as ubiquitin receptors. Ubiquitin-binding proteins usually include ubiquitin-binding domains (UDM). They are small (20-150 amino acids) domains of modular nature, which can non-covalently interact with both mono- and polyubiquitinylated chains. DRCs were found both in enzymes that directly catalyze the ubiquitinylation and deubiquitinylation reactions, and in ubiquitin receptors that recognize and interpret the signals of this post-translational modification conjugated with substrate proteins to control a variety of cellular events. SDDs are diverse in structure and are found in proteins that perform various biological functions. Detailed molecular structures are known for a number of DNAs, but in order to understand the mechanism of their action, it is necessary to know how the specificity of their binding to ubiquitin is determined, how this binding is regulated, and how the DNAs function in the context of full-sized proteins.

To date, five DRC modules have been identified. The short and simple Rpn10 sequence in yeast (S5a or PSMD4 in humans), which is necessary and sufficient for interactions with ubiquitin, was used as a starting point in several bioinformation searches to identify similar sequences in other proteins. It turned out that, like the original S5a, ubiquitin-interacting motifs (UVM) in a number of different proteins are direct authentic ubiquitin-binding motifs (USM). Another motif, the ubiquitin-associated domain (AD), was first identified using the bioinformation technique as a sequence pattern common to a number of proteins subjected to ubiquitinylation and / or deubiquitinylation. At about the same time that UVM was discovered, independent studies showed that UAD can directly interact with ubiquitin. The discovery of UVM and UAD gave impetus to active research in this area. One of the most impressive discoveries was that UVM and UAD are found in a variety of proteins with diverse functions and localization.

In this regard, the DDD found in the HDAC6 protein, histone deacetylase 6, seems to be very promising. The domain (USDD-6) is located at the C-terminus and has a “zinc finger” type structure. It is interesting to note that mutations in cysteines, which are involved in the coordination of zinc atoms, significantly reduced the ability of USD-6 to bind ubiquitin. Thus, we can say that the structure of the “zinc finger” type is important for the active binding of ubiquitin molecules. This domain is able to bind both mono- and polyubiquitin substrates with a high affinity constant (about 60 nM). It has also been shown that USD-6 specifically recognizes the C-terminal sequence of ubiquitin - RLRGG. A pair of glycines (GGs) is key in recognizing this sequence, since their removal or mutation completely destroys the interaction of the corresponding peptidomimetics with UDM-6 (Hard RL, Liu J., Shen J., Zhou P., Pei D. 2010. Biochemistry 49: 10737-10746). Accordingly, it was shown that, at the cellular level, HDAC6 protein is capable of accumulating ubiquitinylated proteins due to SDD, thereby causing the formation of protein aggregates (aggregates) and insoluble inclusion bodies (Boyault C., Gilquin B., Zhang Y., Rybin V., Garman E ., Meyer-Klaucke W., Matthias P., Milller CW, Khochbin S. 2006. EMBO J. 25: 3357-3366). Thus, the ubiquitin-binding domain of the HDAC6 protein is a universal DRC and can be used to enrich the fraction of short-lived ubiquitinylated proteins. It should be noted that the ubiquitin-binding domain of histone deacetylase 6 used by us (see Fig. 1) mainly binds polyubiquitins, rather than mono-quinquitins (as in US20090220470), which is more relevant for studying short-lived regulatory proteins.

Analogues of the second chimeric protein (GST-PSMA3, see Figure 2.), used in our work to enrich the cell extract with target proteins for ubiquitin-independent proteasome proteolysis, were not found during a patent search.

The aim of the present invention is the rapid and effective identification of regulatory short-lived proteins in the human proteome that can participate in the specific modulation of the cytotoxic effect of combined chemotherapy with bortezomib (a proteasome inhibitor) and doxorubicin (a genotoxic stress inducer) on tumor cells of multiple myeloma (MM). This is achieved in the present application by single-stage affinity chromatography with fusion proteins (GST-UBD_HDAC6 and GST-PSMA3), which allows to purify both polyubiquitinylated proteins and target proteins for ubiquitin-independent proteolysis of proteasomes from cell extracts. Fusion proteins include a fragment of the HDAC6 gene corresponding to the ubiquitin-binding domain (UDM6), or cDNA of the proteasome alpha 7 subunit gene fused to a fragment of the gene encoding the substrate-binding domain of the glutathione S-transferase enzyme (GST). Both constructs are expressed in the E. coli bacterial strain BL21. The obtained cell extracts are clarified by centrifugation and bind to glutathione-sepharose. Chimeric proteins fused to GST are incubated with protein extracts prepared from multiple myeloma cells to specifically precipitate the affinity carrier and the ubiquitinylated or PSMA3 associated proteins associated with them. The cell proteins thus obtained are further purified from excess salts, separated in a two-dimensional protein electrophoresis system and analyzed by direct and tandem time-of-flight mass spectrometry.

The positive effect of the application of the present invention is the quick and effective identification of potential tumor markers among short-lived regulatory proteins: 1) in reducing, due to single-stage affinity purification, the time for obtaining the desired protein molecules, 2) in increasing the efficiency of binding of polyubiquitinated proteins using a carrier with UBD HDAC6, 3) in the ability to cover the widest range of regulatory proteins, due to the use of the GST-PSMA3 fusion protein that binds to targets for ubiquitin nez dependence proteasome proteolysis.

The invention is illustrated by the following graphic materials:

Figure 1 shows a map of the vector pLEICS-14 into which HDAC6 DRC is ligated. The HDAC6 sequence was taken as a template for the polymerase chain reaction in order to amplify the fragment (3135-3648) that binds the polyubiquitin corresponding to A.a. 1045-1216. The following primers were used:

N-ter: GTATTTTCAGGGCGCCCCCAGTACACTGAT ...,

C-ter: GTCGACTGCAGAATTTTAGTGTGGGTtca

for cloning into a pLEICS-14 vector containing the sequence of the enzyme glutathione-3-transferase (GST). The sequence of the insert in the resulting construct is checked by DNA sequencing. After transformation into the bacterial strain BL21, the protein is induced with 0.2 mM IPTG overnight at 16 ° C to avoid the formation of insoluble protein aggregates. The protein is then purified from E. coli cells previously sonicated by glutathione-containing resin (Glutathione-sepharose 4B, GE Healthcare) according to the manufacturer's recommendations.

The nucleotide sequence of histone deacetylase 6 cDNA (HDAC6). The insert (ubiquitin-binding domain) is shown in italics:

Figure 2 shows a map of the vector pGEX-5X-l into which the PSMA3 cDNA sequence is ligated.

The creation of the α7-GST chimeric protein required the obtaining of the cDNA sequence of the α7 proteasome subunit (PSMA3) by PCR coupled to reverse transcription. The total RNA of human cells of the K562 line was used as an RNA matrix. Primer Sequences:

N-ter: 5'-ATGCGGATCCGCATGAGCTCAATCGGC-3 '

C-ter: 5 '-CGGAGGATCCGTTACATATTATCATC-3'.

The resulting PCR product is cloned into the pGEX-5X-1 expression vector, which carries a GST gene fragment, for subsequent affinity purification of the chimeric protein on glutathione-sepharose. After bacterial transformation, positive colonies containing a vector with an insert are first determined by PCR with specific primers, and then, after plasmid DNA is isolated, the insert sequence in the resulting construct is checked by DNA sequencing. After transformation into the bacterial strain BL21, the protein is induced with 0.2 mM IPTG overnight at 16 ° C to avoid the formation of insoluble protein aggregates. The protein is then purified from E. coli cells previously sonicated by glutathione-containing resin (Glutathione-sepharose 4B, GE Healthcare) according to the manufacturer's recommendations.

The method is as follows: the resulting genetic engineering constructs are introduced into E. coli cells in order to express the fusion proteins of interest to us (GST-PSMA3 and GST-UBD_HDAC6). The purification of proteins from E. coli cells is carried out using affinity chromatography on glutathione-sepharose (GE Healthcare).

The next step is the reaction of binding of proteins from the extract of multiple myeloma cells (before or after combined chemotherapy with bortezomib and doxorubicin): polyubiquitinylated (in the case of using the fusion protein GST-UBD_HDAC6), or target proteins for ubiquitin-independent proteasome proteolysis (GST-PSMA3) . The bound proteins are washed from the chromatographic medium with a glutathione-containing buffer solution, then desalted and concentrated on Amicon microconcentrators (Millipore Inc.). The obtained protein preparations are separated in a two-dimensional electrophoresis system (I direction is the isoelectric focusing of proteins on an Ettan IPG Phor 3 device (GE Healthcare), II direction is the separation of proteins by molecular weight in Laemmley denaturing electrophoresis).

Stains corresponding to individual proteins are excised from the polyacrylamide gel and their composition is analyzed by time-of-flight tandem mass spectrometry using an AB Sciex 5800 MALDI TOF / TOF (AB Sciex) instrument.

Table 1 Screening for ubiquitinylated proteins that interact with proteasomes Protein groups Nuclear proteins Cytoplasmic proteins Proteasome Associated Proteins 26S protease regulatory subunit 6A F-box-like / WD repeat-containing protein TBL1XR 26S protease regulatory subunit 6B RAD23 homolog B Deubiquitylating Enzymes Ubiquitin carboxyl-terminal hydrolase 5 WD repeat-containing protein 48 Ubiquitin carboxyl-terminal hydrolase 14 Transcription RNA polymerase II-associated factor 1 homolog RuvB-like 1 Poly (U) -binding-splicing factor PUF60 Histone deacetylase 2 DNA replication licensing factor MCM3 DNA replication licensing factor MCM6 F-box-like / WD repeat-containing protein TBL1XR Retinoblastoma-binding protein 5 Alpha-enolase WD repeat-containing protein 5 TAR DNA-binding protein 43, Non-POU domain-containing octamer-binding protein Far upstream element-binding protein 2 Transcription initiation factor IIB Alpha-enolase Splicing Splicing factor FOR subunit 3 Poly (U) -binding-splicing factor PUF60 116 kDa U5 small nuclear ribonucleoprotein component Cleavage and polyadenylation specificity factor subunit 2, TAR DNA-binding protein 43, Heterogeneous nuclear ribonucleoproteins: F; L-like; A2 / B1; C1 / C2 Far upstream element-binding protein 2 Non-POU domain-containing octamer-binding protein Polypyrimidine tract-binding protein 1 ATP-dependent RNA helicase DDX1 Probable ATP-dependent RNA helicase DDX5 Heterogeneous nuclear ribonucleoprotein Al Broadcast Tyrosyl-tRNA synthetase Elongation factors: 1-alpha 1; 2 Tryptophanyl-tRNA synthetase Glycyl-tRNA synthetase Lysyl-tRNA synthetase

Chaperones Calreticulin Protein disulfide-isomerase Stress-70 protein, mitochondria 60 kDa heat shock protein, mitochondrial Heat shock cognate 71 kDa protein Heat shock 70 kDa protein 1 Heat shock protein HSP 90-beta Heat shock protein HSP 90-alpha DnaJ homolog subfamily A member 1 T-complex protein 1 subunit beta Endoplasmin Heat shock protein HSP 90-alpha Heat shock protein HSP 90-beta Heat shock cognate 71 kDa protein Heat shock 70 kDa protein Heat shock 70 kDa protein 1L Heat shock-related 70 kDa protein 2 60 kDa heat shock protein, mitochondrial T-complex protein 1 subunits: theta; delta; gamma; zeta Protein disulfide-isomerase Cytoskeleton and myofibrillar proteins Actin, cytoplasmic 1 Alpha-actinin-2 Alpha-actinin-4 Tubulin alpha-1 B Tubulin beta-2A chain Tubulin alpha-1 In chain Actin, cytoplasmic 1 DNA damage Pre-mRNA-processing factor 19 ATP-dependent DNA helicase 2 subunits: 1 (Ku70); 2 (Ku86) Non-POU domain-containing octamer-binding protein RuvB-like 1 UV excision repair protein RAD23 homolog B Metabolism 78 kDa glucose-regulated protein ATP synthase subunit beta, mitochondrial Fructose-bisphosphate aldolase A Alpha-2-HS-glycoprotein Creatine kinase B-type Glyceraldehyde-3-phosphate dehydrogenase Malate dehydrogenase, mitochondrial 78 kDa glucose-regulated protein Protein disulfide-isomerase Triosephosphate isomerase Trifunctional enzyme subunit beta, mitochondrial Phosphoglycerate mutase 1 Alpha-1 -antichymotrypsin Pyruvate kinase isozymes M1 / M2 Phosphoglycerate-phosphate-phosphate-phosphate 3-phosphate phosphate A chain Dihydrolipoyllysine-residue acetyltransferase component ofpyruvate dehydrogenase complex, mitochondrial C-1-tetrahydrofolate synthase CTP synthase Lon protease homolog, mitochondrial Neutral alpha-glucosidase AB Replication DNA replication licensing factor MCM6 DNA replication licensing factor MCM6

The novelty of the present invention lies in the fact that it proposed a method of single-stage affinity purification from human cells of an aggregate of short-lived regulatory proteins, including both polyubiquitinylated (i.e. potential targets of the ubiquitin-dependent proteasome pathway) and associated with the subunit of the proteasome alpha7 (t. e. targets of ubiquitin-independent proteasome proteolysis) proteins. The sequence of the ubiquitin-binding domain of histone deacetylase 6 is used to purify polyubiquitinylated proteins: this polypeptide has a significantly higher affinity for polyubiquitinylated substrates than its analogues from other proteins. No analogues of the second chimeric protein (GST-PSMA3) used in our work to enrich the cell extract with target proteins for ubiquitin-independent proteasome proteolysis have been found in world practice. The convenience of the method consists in the ability to manipulate directly with cell extracts, bypassing the stages of additional protein purification.

The invention may find important application:

- to develop diagnostic approaches based on methods of high-performance analysis of protein interactions between proteasomes and their substrates;

- identifying the mechanisms of the cytotoxic effects of the above drugs in tumor cells of MM, as well as identifying new protein markers specific to this disease.

The acquired knowledge can have important applications in clinical practice when developing methods of anti-cancer therapy.

Bibliography

Adams J and Kauffman M. 2004. Development of the proteasome inhibitor Velcade (Bortezomib). Cancer Investigation 22: 304-311.

Bertos N.R., Gilquin B., Chan O.K., Yen T.J., Khochbin S., Yang X.J. 2004. Role of the tetradecapeptide repeat domain of human histone deacetylase 6 in cytoplasmic retention. J. Biol Chem 279 (46): 48246-48254.

Boyault C., Gilquin B., Zhang Y., Rybin V., Garman E., Meyer-Klaucke W., Matthias P, Muller C.W., Khochbin S. HDAC6-p97 / VCP controlled polyubiquitin chain turnover. 2006. EMBO J. 25: 3357-3366.

D'Arcy P., Linder S. 2012. Proteasome deubiquitinases as novel targets for cancer therapy. Int. J. Biochem. Cell Biol. 44 (11): 1729-1738.

Fedorova O.A., Moiseeva T.N., Nikiforov A.A., Tsimokha A.S., Livinskaya V.A., Hodson M., Bottrill A., Evteeva I.N., Ermolayeva J.B., Kuznetzova I.M., Turoverov K.K., Eperon I., Barlev N.A. 2011. Proteomic analysis of the 20S proteasome (PSMA3) -interacting proteins reveals a functional link between the proteasome and mRNA metabolism. Biochem. Biophys. Res. Commun. 416 (3-4): 258-265.

Hard R.L., Liu J., Shen J., Zhou P., Pei D. 2010. HDAC6 and Ubp-M BUZ domains recognize specific C-terminal sequences of proteins. Biochemistry. 49: 10737-10746.

Hook S.S., Orian A., Cowley S.M., Eisenman R.N. 2002. Histone deacetylase 6 binds polyubiquitin through its zinc finger (PAZ domain) and copurifies with deubiquitinating enzymes. PNAS USA 99 (21): 13425-13430.

Jagannath S., Barlogie B., Berenson J., Siegel D., Irwin D., Richardson PG, Niesvizky R., Alexanian R., Limentani SA, Alsina M., Adams J., Kauflman M., Esseltine DL, Schenkein DP, Anderson KC 2004. A phase 2 study of two doses of bortezomib in relapsed or refractory myeloma. British Journal of Haematology. 127 (2): 165-172.

Konstantinova I.M., Tsimokha A.S., Mittenberg A.G. 2008. Role ofProteasomes in Cellular Regulation. International Review of Cellular and Molecular Biology, 267: 59-124.

Mittenberg A.G., Moiseeva T.N., Barlev N.A. 2008. Role ofproteasomes in transcription and their regulation by covalent modifications. Front Biosci. 13: 7184-7192.

Orlowski R.Z. 2004. Bortezomib in combination with other therapies for the treatment of multiple myeloma. J. Natl. Compr. Cane. Netw. 2 Suppi 4: S16-20.

Smith D.B., Johnson K.S. 1988. Single-step purification ofpolypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene. 67 (1): 31-40.

Tsvetkov P., Reuven N., Shaul Y. 2010. Ubiquitin-independent p53 proteasomal degradation Cell Death Differ. 17 (1): 103-108.

Claims (1)

A method for identifying regulatory short-lived proteins in the human proteome involved in the specific modulation of the cytotoxic effect, including the production of chimeric fusion proteins: GST SDC HDAC6 and GST-PSMA3, by expression in E. coli cells through the introduction of appropriate vectors into them and subsequent purification using affinity chromatography on glutathione-sepharose, the reaction of binding of proteins from the extract of multiple myeloma cells before or after combined chemotherapy with bortezomib and doxorubicin with GST-UBD_HDAC6 and GST-PSMA3, washing available proteins from a chromatographic carrier with glutathione-containing buffer solution, desalination and concentration on microconcentrators, separation of the obtained protein preparations in a two-dimensional electrophoresis system: I direction - isoelectric focusing of proteins on an Ettan IPG Phor3 device (GE Healthcare), II direction - separation of proteins by molecular weight in Lammley denaturing electrophoresis, spots corresponding to individual proteins are excised from the polyacrylamide gel and their composition is analyzed using a time-of-flight tandem th mass spectrometry the instrument AB Sciex 5800 MALDI TOF / TOF (AB Sciex).

Images