TR201903865A2 - USE OF INTERFERONES FOR THE TREATMENT OF AMYOTROPHIC LATERAL SCLEROSIS - Google Patents

Abstract

The invention relates to the use of interferon, preferably interferon-alpha, in the treatment of amyotrophic lateral sclerosis (ALS), particularly ALS caused by a mutation in the NEK1 gene. The invention further relates to a method developed for the treatment of a patient affected by ALS, comprising the steps of: (a) selecting a patient carrying a NEK1 variant, i.e., the NEK1 mutation, (b) providing the patient with a therapeutically effective amount of interferon, preferably interferon. -alfa giving.

Description

DESCRIPTION INTERFERON FOR THE TREATMENT OF AMYOTROPIC LATERAL SCLEROSIS USE OF TECHNICAL FIELD The present invention is associated with amyotrophic lateral sclerosis (ALS), specifically NEC1. It relates to the treatment of ALS.

BACKGROUND ALS, also known as Lou Gehrig's disease, is more common in the 40-65 age range. of motor neurons in the brain stem and spinal cord, affecting adults a neurodegenerative motor neuron resulting from its degradation and death is the disease. Early symptoms of ALS include weakening of the muscles, involuntary spasms and cramps. Individuals in the advanced stages of the disease They lose their ability to control voluntary muscles. In the final stages, it is usually die from respiratory failure.

ALS is a relatively rare disease, its prevalence is approximately every However, the socioeconomic and personal burden of the disease is serious.

Drugs used in ALS disease with very limited treatment options. its progression rather than eliminating or treating they slow down. Most patients are diagnosed 3-4 times after the onset of symptoms. They die within a year.

About 5-10% of ALS is familial, meaning it is passed from one generation to the next and Mendelian shows my quality. The remaining 90-95% of patients do not have a family history. are sporadic cases (Hardiinan, O. et al., Nature Reviews Neurology (2011), has been discovered. More than 30 genes have been associated with ALS as of this date (Robberecht, W. et al., Advances in Genoinics and Genetics (2015), 5, 327). What Unfortunately, these sections are insufficient to cure and eradicate ALS. they remained because the genes identified were very different functionally and structurally. Different How do all the different mutations in the ALS genes get the same disease? It is still not fully known today that it causes the phenotype.

such as Alzheimer's disease, Parkinson's disease, Huntington's disease and ALS A common point of neurodegenerative diseases is the protein seen in neurons. Proteins are vital metabolic, metabolic, in all cells of the body, not just neurons. It is responsible for performing structural or enzymatic functions. The three- dimensional conformations (structures) enable them to perform these functions. makes possible; therefore correct folding of proteins, that is, three-dimensional they need to be structured. Under certain circumstances, genetic or environmental Depending on the factors, proteins can be misfolded. misfolded proteins they lose their solubility in the cell cytoplasm, coalesce and and ultimately causes cell death (Taylor, J.P. et al., Nature (2016), Not only can it no longer fulfill its vital functions, but also toxic May cause cellular toxicity due to its tendency to form aggregates.

Prevents misfolding and misfolding of proteins in each cell This is what folds wrong when it is formed. mechanisms that destroy proteins What causes the type, amount, or misfolding of the protein? These cells are always free of toxicity or death, depending on the they may not be protected.

Cells overcome protein misfolding and its unfavorable consequences. It uses two main mechanisms to arrive. The first mechanism is molecular saperons. contains. Molecular saperones are the correct expression of proteins synthesized in ribozoin. It guides its folding. Molecular saperones are sometimes also already misunderstood. recognizing the folded intermediate protein forms and using them in ATP, can help them refold in such a way that (Hartl, F.U. et al., Nature wrong protection against this, as proteins can lead to toxic aggregates It provides folding proteins by directly removing them. This mechanism is ubiquitination of folded proteins followed by proteazoin complex Ubiquitin-Proteasome System (UPS) a type of post-translational protein that tags proteins for degradation modification (PTM). Both of the mentioned mechanisms are wrong with the protein. Aggregate formation occurs when it is insufficient to prevent folding. income. In the past years, researchers have associated ALS with a ubiquitin-like that there is a strong correlation between another modification, SUMO (Foran, E. et al., Neuromolecular Medicine (2013), 15(4), SUMO is converted to ubiquitin, called SUMO (Small Ubiquitin-like Modifier). a very similar, small peptide selected through a series of enzymatic reactions involves covalent binding to target proteins. SUMOization eukaryotic stability, solubility, enzymatic many important factors, including their activity and intracellular localization. It is used to change its properties (Hay, R.T., Molecular Cell (2005), SUMO on specific lysine amino acids found in they undergo modification; where ip is to a hydrophobic amino acid, K target lysine, X to any amino acid, D/S negatively charged aspartic or glutamic acid corresponds to. (Gareau, J.R. et al., Nature Reviews Molecular Cell Biology The vertebrate genome contains 3 functional SUMO paralogs: SUMO1, SUM02, and SUMO3. The SUM02 and SUMO3 sequences are 95% identical, therefore together they are named SUM02/3 (Martin, S. et al., Nature Reviews contains one of the consensus motif, so that it is itself subject to SUMO remains. As a result, poly-ubiquitin commonly seen in ubiquitination Similar to chains of poly-SUMO, chains are formed. SUM01 with SUM02/3 end of a growing poly-SUMO chain because it cannot SUMO itself. When added, it acts as a chain terminator (Hay, R.T., Molecular Cell (2005), 861; Seeler, J-S. et al., Nature Reviews Molecular Cell Biology (2003), 4(9), Ubiquitin and SUMO peptides have 18% identity and are N-terminal vary greatly in their regions. a target protein SUMOification, very similar to ubiquitination, consists of 3 steps. produced by an enzymatic reaction. In the first step, the SUMO peptide It is activated by the E] enzyme (SAEl/SAEZ). Activated SUMO peptide It is then transferred to an E2 conjugation enzyme called UBC9. Dozens Unlike the ubiquitination system in which different E2 enzymes function, protein SUMOization requires only one E2 enzyme: UBC9. UBC9, It can attach SUMO directly to target proteins, for this it needs an E3 ligase. E3 ligase can use this process in some cases, although it is not needed. The number of lysines targeted in the conjugation and the SUMO Three types of SUMOization can occur depending on the type: mono-, multi- or poly-SUMOization (Hickey, CM. et al., Nature Reviews Molecular Cell Biology proteases, (J.R. et al., Nature Reviews Molecular Cell Protein SUMOization is a highly dynamic modification and transcription, To regulate basic cellular processes such as DNA repair and replication used. Consistent with its role in these important processes, SUMO It is also necessary for Embryonic or conditional knockout of the SUMOlamanin UBC9 gene Causes death in mice (Nacerddine, K. et al., Developmental Cell (2005), 9(6), 769 ). Irregularities in the SUMO system leading to inutations in many diseases such as cancer (Seeler, J-S. et al., Nature is associated. Researchers believe that critical ALS-linked proteins are SUMO revealed that it is a target for inodification. For example, SOD-1 and SUMOization of TDP43 proteins increases the stability of both proteins, A SUMOl E3 ligase activity on the tumor suppressor Ebpl protein of FUS (Fei, E., et al., Biochemical and Biophysical Research In view of the fact that this may be increasing the Ebpl SUMOization of Fus is coming. FUS itself is also modified by SUMO and this modification can control the E3 ligase activity of FUS (Oh, S.-M. et al., stress, whose dysregulation is also associated with the pathogenesis of ALS It also plays an important role in the reaction mechanisms to conditions. (Dangoumau, A. et al. SUMO enzymatic functions of proteins, enzymatic activities, intracellular their localization, interactions with other proteins, and solubility. can affect; In addition, it can control protein stability. RNF4, It is an ubiquitin E3 ligase that only recognizes SUMOylated proteins. RNF4 SUMO recognizes proteins and then tagging them with ubiquitin to the proteasome It allows them to be destroyed by. In short, protein SUMOization, In particular, the SUM02/3 modification reduces protein degradation with the help of RNF4. may be a trigger (Xu, Y. et al., Nature Commun. (2014), 5, 4217; Researchers in the recent past 'including the inventor of the present application PML core bodies or particles (PML NBs: BroMyelocytic Leukemia Nuclear Eodies), found in the nucleus of cells, called that protein-based organelles facilitate the SUMOization of proteins. It contains the protein and is responsible for the hyper-SUMOlanina process of the proteins it contains. act as catalytic chambers that impose in PML particles Some of these hyper-SUMOlated proteins are later still PML. Thanks to the RNF4 enzyme entering its particles, it is subjected to poly-ubiquitination and they eventually collapse (Sahin, U. et al., The Journal of Cell Biology (2014), 204(6), 931).

PML is actually a tumor suppressor protein and is rare. with acute promyelocytic leukemia (APL), a type of bone marrow cancer (de The, H. et al., The Journal of Cell Biology (2012), 198(l), 11th). Chromosomal translocation in APL disease (t15-17) is called PML/RARA produces a given fusion oncoprotein (fusion oncoprotein PML and RARA: consists of the “retinoic acid alpha receptor”). PML/RARA, hematopoietic cell While disrupting the retinoic acid signaling pathway, which is essential for differentiation, the same It also prevents the formation of PML particles. APL today Arsenic trioxide and retinoic acid drug combination used in the treatment of It triggers the degradation of the PML/RARA oncoprotein, thereby reducing the risk of APL patients. most highly curable (de Th'e, H. et al., Nature Reviews Cancer Its function is apoptosis, p53 signal transduction pathway, aging, redox balance and anti- to regulate activities such as viral (Sahin, U. et al., The Journal of Pathology (2014), 234(3)). The PML protein itself is necessary for the formation of these particles. has a structural role. The PML protein is oxidized under oxidation conditions. it comes together when it is, cross-linking PML It forms the outer shell of the particles and gives these particles a hollow, spherical gives form. PML proteins in the outer shell are highly SUMO they undergo modification. Partner proteins are SUMOylated in the outer shell. SUMO-interacting motifs (SUMO-interacting) motif: interacts via SIM). As a result of this interaction, the global structure Sahin, U. et al., Nucleus (2014), 5(6), 499).

The flower bucket has become very popular and attracted attention in the past years. Funds collected as a result of “challenge / ice bucket challenge” and the name of the MinE project A new understanding of ALS has emerged, thanks to a worldwide scientific collaboration. gene discovered: NEK] (NIMA-associated kinase 1). NEK soon] Many mutations on ALS have been associated with ALS (Kenna, K.P. et al., Nature It belongs to a family of protein kinases (NEK family) consisting of three members (Monroe, G.R. et al., a member of it, from the control of the cell cycle to the provision of mitosis It plays a role in as many different functions as (Quarmby, L.M. et al., Journal of cell science). and its activity is particularly important as a result of DNA damage. has been shown to increase significantly. NECl is mostly located in the cytoplasm. However, following DNA breakage and damage, it enters the cell nucleus and DNA colocalizes with damage repair proteins.

NEKl is the cell cycle checkpoint involved in DNA damage repair. checkpoint) activates the kinases CHK] and CHKZ (Chen, Y. et al., Cell Cycle deficiency of DNA damage repair failures, therefore genomic It has been shown to cause genomic instability (Chen, Y. et al., Molecular cancer (2011), 10(l), 5). In addition to all these functions, NEKl it has also been genetically associated with polycystic kidney disease (Upadhya, P. et al., Proceedings of the National Academy of Sciences of the United States of America About 3% of all ALS cases are caused by mutations in the `1 NEKI gene. originates. A recent study of the NEKl function in motor neuron cells obtained from a patient with the loss mutation. well above the level expected following induction of DNA damage demonstrated accumulation of damage (Higelin, J. et al., Stem Cell Research (2018), 30, 150). Despite all these developments, NEKl mutations to ALS It is not known how it causes and the underlying treatment of a disease. It is not possible to provide the mechanism without understanding.

As a result, it is aimed to reveal the biological mechanism of mutant NEK1 and There is a great need to develop a treatment option for ALS.

SUMMARY OF THE INVENTION The present invention is for the treatment of a neurodegenerative disease, particularly ALS. interferon, preferably interferon alfa.

ALS mentioned in one embodiment of the present invention is a defect in the NEK1 gene. is an ALS caused by a mutation (associated with or due to NEKI) Also called ALS).

In another embodiment of the present invention, the above-mentioned mutation is 812. a premature termination (stop) codon at the amino acid position (i.e. p.Arg812Ter mutation).

In another embodiment of the present invention, the aforementioned ailments Interferon, interferon alpha, interferon beta and interferon used in the treatment of selected from a group of gamma; preferably interferon alfa.

The present invention also provides a treatment for patients affected by ALS. It is also related to the method and consists of the following steps: (a) Selecting a patient found to be affected by ALS; (b) give the patient a therapeutically effective amount of interferon, preferably interferon alpha. giving.

In another embodiment, a treatment for the patient affected by ALS method is provided, the method in question consists of the following steps: (a) Selecting an ALS patient with a NEK1 variant (i.e. a mutation in the NEK1 gene) ALS patient) (b) give the patient a therapeutically effective amount of interferon, preferably interferon alpha. giving.

Brief Description of Figures Figure 1. Generating a truncated version of NEK] (tNEKl). (a) Representative pictures of WT NEK1 and tNEK1 (b) Agarose gel PCR NEKl bands obtained after amplification and Dpnl digestion. shows. Amplified DNA is marked with an arrow. (c) Mutant plasmid sequence chromatogram. Signed bases point mutation has been successfully inserted shows. (d) Protein by anti-GST Western blot of said mutation level (encoding to facilitate detection of NEK1 A GST tag/tag is fused to the string).

Figure 2. Subcellular locations of WT and tNEK1 differ.

HEK293 cells were transfected with WT or tNEK1 plasmids. cells stained using anti-GST antibody (green). Both WT and TNEKl are It carries a GST tag/tag. Cell nuclei were stained with DAPI (blue).

Red arrows indicate aggregates of granules. samples confocal microscope displayed below.

Figure 3. TANK1 forms aggregate-like structures. Expressing GST-TNEKl stained with HEK transfected with plasmid.

Images were acquired using a confocal microscope.

Figure 4. tNEK1 exhibits loss of solubility and insoluble protein accumulates in the fraction. (a) Schematic representation of two separate lysate fractions. (b) HEK293 cells were transfected with the indicated plasmids. Cells are first fractionated (soluble fraction) using an NP-4O lysis buffer.

Using ultracentrifugation, the supernatant was separated from the pellet, which was then Extracted (insoluble fraction) in buffer containing SDS. Examples are labeled GST Using anti-GST antibodies to detect WT NEK1 or tNEK1 It was analyzed by western blot.

Figure 5. NEKl can be SUMOlized with SUMO1 and the SUMOization consensus SUMOization of NEK] mutants with disrupted motifs is reduced. WT NEK] or NEKI mutants with disrupted consensus motifs for SUMO1 plasmid SUMO1 transfected into HEK293 cells. Anti-GST antibody After immunoprecipitation using NEK1 SUMO level by Western blot, using anti-SUMOI antibody viewed.

Figure 6. Excessive (hyper) in the truncated NEK1 mutant (tNEK1) associated with ALS SUMOIma detected. WT NEK'] or tNEKl with SUMOI Anti-SUMO1 antibody following precipitation of pus from transfected cells was immunoblot with Excess (hyper) of tNEK1 run in the last well It appears to be SUMO.

Figure 7. SUMO deficiency, WT or tNEK9 aggregation tendency does not change. HEK293 cells were transfected with the indicated plasmids. Shape The protocol described in 4 was applied, unlike a pellet containing urea instead of SDS. extracted in tainpon (insoluble fraction). Western with the indicated antibody blot performed. NEK1 forms anti-GST antibody thanks to GST tags detected using Actin was used as a loading control. NEKl- 3KR: all 3 SUMO-tying consensus motifs are disrupted (lysines are converted to arginine by translation) NEK1 variant. ZKR-tNEK: consensus motif of each 2 SUMOlanina The tNEKl variant, which is also disrupted. NEKl- 3KR or 2KR-TNEKl SUMO cannot be modified (Figure 5).

Figure 8. WT NEKPI when PML NBs call tNEK1 selectively they do not call. HEK293 cells encoding GST-tagged WT or tNEK1 transfected with plasmids. For observation under a confocal microscope, anti- It was stained with GST (green) and anti-PML (red) antibodies. cell nuclei Stained with DAPI (blue). Formation of PML particles and partner protein cells to accelerate and stimulate uptake of 2 µM for 2 hours. treated with arsenic trioxide. White arrows indicate complete co-localization Figure 9. PML triggers the SUMO] modification of tNEK1. (a) HEK293 cells were transfected with the indicated plasmids. Arrows are most likely It points to tNEKl forms with increased mass since they are SUMO. PML excessive expression triggers SUMOization of the tNEK. (b) In HEK293 cells plasmids GST-tNEK1 and GFP-SUMO1 were transiently expressed. cells subjected to immunofluorescence analysis. Anti-GST (green) and anti-PML (red) antibodies were used, cell nuclei were stained with DAPI (blue). (+) two or means that three different wavelength channels are combined and displayed. is coming.

Figure 10. PML particles contain tNEK1 in response to IFN treatment. gets. HEK293 cells were transfected with GST-labeled tNEK1.

Anti-GST (green) tNEK1 and PML NBs, respectively, for immunofluorescence analysis and stained with anti-PML (red) antibodies. DAPI for core staining (blue) is used. Arrows point to full co-localization, arrowheads to PML Indicates contact between NBs and TNEK1. Full (full) co-localization only protein degradation was evident when inhibited with MG132, which is normal under normal conditions. It indicates that the TNEK1 that entered the PML NBs under it was destroyed.

Figure 11. tNEK1 protein level decreases as a result of IFN treatment. THIN HEK293 cells expressing AS, IFN and AS/IFN for 48 hours (AS: ZiiM, IFN . Left arrow IFN It indicates that tNEKl protein level decreased as a result of treatment.

Cells were also treated with ZuM MG132 to stop protein degradation.

MG132 blunted IFN activity and prevented the decrease in tNEKl level. It was determined that the tNEK1 protein of IFN was destroyed in the proteasome. shows that it is. PML Western blot PML in response to IFN treatment shows increased production (Stadler, M. et al., Oncogene(1995), ll(l2), 2565).

Figure 12. Interferon treatment does not affect NEK1 mRNA level. NEKl Expressing HEK293 cells were treated with IFN for 48 h, RNA isolated and qPCR analysis was performed.

Figure 13. PML is required for IFN-driven percolation destruction. HEK293 cells were transfected with the indicated siRNAs and 'Pretreated' with IFN.

Cells were transfected the next day with GST-labeled tNEK1. Figures IFN tNEK1 protein remaining in treated versus untreated cells shows the percentage. Arrows (red) cause of lFN° at tNEKl protein level This indicates a decrease in the absence of PML (green).

Figure 14. TNEK1 selectively summoned to PML particles, IFN-driven WT is more sensitive to destruction than NEK1. HEK293 cells GST-labeled WT or transfected with plasmids encoding tNEK1. From transfection (and IFN After 48 hours of treatment, cells were lysed and the indicated antibodies were Western blot was performed using IFN: used at 2000 IU/ml. for each group double wells were run.

Figure 15. IFN treatment attenuates tNEK1 aggregation. HEK293 cells were transfected as indicated and treated with IFN. lysate fractionation using the same protocol as described in Figure 4. carried out. IFN treatment increased the amount of insoluble tNEK1 (arrow) substantially reduces.

Figure 16. Aggregates of tNEK1 are proteasome-dependent by IFN treatment disappears in one go. HEK293 cells expressing GST-tNEK1 only For analysis, tNEK1 was stained using anti-GST antibody (green). White arrows indicate cells containing aggregates.

Figure 17. SUMO uptake for IFN g'i'id'i'iml'û tNEK1 degradation is necessary. HEK293 cells express either tNEK1 or ZKR-tNEK1 (both GST (labeled) coding plasmids and treated with IFN.

ZKR-tNEKl is a non-SUMO variant of tNEKl. IFN treatment sample While causing his destruction (arrow), ZKR-tNEKl cannot trigger his destruction.

DETAILED DESCRIPTION OF THE INVENTION The main purpose of this invention is to reveal the underlying mechanism of ALS and To provide the treatment of neurodegenerative diseases, especially ALS.

For this purpose, a series of experiments have been carried out by the present inventors. carried out, a new hypothesis was formed with the result of each experiment, and this Other experiments were conducted to test the hypothesis.

As stated in the background of the invention, 'An important question in this field, mutations on functionally and structurally different proteins how it causes the disease (in this case, ALS) phenotype. An answer to this question To find out, the owners of the present invention have a recently found NEK] aimed to focus on mutation.

Following are the steps to success in finding a new treatment for ALS summarizes the planned path, Details of the experiments are described in the description of the experiments and contained in the results section.

The first objective is that NEK1 mutants are capable of initiating and reversing the pathogenesis of ALS. The aim of the study was to determine whether it forms sustainable protein aggregates. This Necessary experiments were determined and carried out. As a result, wild Aggregate-like formations in cells expressing type (WT) NECH While not observed, these structures do not exist in cells expressing mutant NEK1. it has been seen.

Aggregate-like cells in cells expressing ciliated NEK1 (mutant NEKI) After observing the structures, the second step is that tNEK1 will form aggregation. was to investigate his tendency. After carefully designing the necessary experiments, the invention The owners stated that TNEK1 suffered a great loss of solubility, and that it was evident in the process. They found that it formed cellular aggregates.

After the results of these experiments, it is also clear that the defects in the SUMO Considering that it has been observed to trigger neurodegenerative diseases, When available, the inventors of NEKl (or tNEKl) SUMO The disorder contributes to tNEKl aggregation and loss of solubility they assumed it could be found. Therefore, the next goal is NEKl The aim was to test the effect of SUMOlysin on the solubility of the protein.

The results of the experiments showed that; like many other ALS-associated proteins tNEK1 has high levels of toxicity that can cause toxicity in motor neurons of ALS patients. had a tendency to aggregate.

The inventors of the present invention are then trapped in the cell nucleus of tNEK1. They thought that it could also enter the PML particles (NBs) because it remained intact. Spouse It has been previously shown that proteins promote entry into PML particles. Ainino acid motifs, called the SUMO-interaction motif (SIM), are also known as NEKI. is on it. In the recent past, PML particles were also proteins that are misfolded and tend to lose solubility shown to be selectively invoked. All this makes tNEK1 a powerful PML partner protein candidate. In addition, inventors tNEKF like other PML excessive (hyper) SUMO, such as the phenomenon observed in partner proteins has shown before. Selective analysis of PML particles after a detailed analysis It was found to call mutant (spliced) tNEK1 protein. tNEK1 was taken up into PML particles, especially under oxidation conditions. With the addition of the finding of the inventors, tNEK1 hyper-SUMO I decided to investigate whether it really is a PML-dependent process. they gave. At the end of many experiments, the obtained data showed that the PML particles hypothesized that it calls TNEK1 and initiates in situ hyper-SUMO it supports.

Finally, the inventors of the present invention explained the underlying pathogenesis of the disease. A molecule that could cure ALS, after uncovering its mechanism focused on finding As a result, interferon in the treatment of ALS, especially In ALS caused by NEKl mutation, more specifically p.Arg812Ter It has been found that the mutation is effective in ALS.

Interferons are cytokines with antiviral effects. All interferons are specific act as ligands of cell surface receptors and are antiviral, proteins with antitumor, antimicrobial and immunomodulatory effects transcription of hundreds of interferon-stimulated genes encoding regulates. There are three main types of interferons; interferon alpha, interferon beta and interferon gamma.

In conclusion, the present invention shows that neurodegenerative disorders are 'especially ALS is caused by a mutation, more specifically in the NEKI gene. It provides a molecule for the treatment of ALS.

The present invention also includes a) NEK1 mutation and b) tNEK1 protein expression provides a method of treatment for an ALS patient exhibiting; . This method is patient Administering a therapeutically effective amount of interferon, preferably interferon alfa includes the.

EXPERIMENTS AND RESULTS 1. MATERIALS 1.1. Equipment Equipment used in experiments for the purposes of this invention: Agarose Gel Electrophoresis System (EASY-CAST, Thermo Fisher, USA), Autoclaves, Carbon Dioxide Tank, Cell Culture vessels, Cell Culture Incubator, Cell Scraper, Centrifuges (Ultracentrifuge JZMC, Beckman, USA VWR CTlSRE, Japan Allegra X-22, Beckman USA), Centrifuge Tubes, Cold Room, Confocal Microscope (Leica SP8, USA), Coverslips, Cryovial Tubes (2ml), Freezers, Dishwasher, Documentation System, Electrophoresis Equipment (Mini-Protean III Cell, Bio-Rad, USA), ISI Blocks (Block heater catalog, VWR, USA), Ice Maker, Inverted Microscope ( Zl Axio Observer, Zeiss, USA), Laboratory Flasks, Laminar Flow Cabinet, Magnetic Mixer, Microfuge Tubes, Micropipettes, Micropipette Tips, Microscopes (Inverted Microscope, Nikon, Eclipse TS100, Netherlands, Fluorescent Microscope, Observer.Zl, Zeiss, Germany), Microwave Oven, Multiwell Pots, Nitrocellulose Membrane (Amersham, GE Life Sciences, UK), Oven, PCR Tubes (, Pipettor, Pipette Tips (Bulk), Pipette Tips (filtered), Power Supply, Real Time Quantitative PCR System (Bioneer Exicycler, Republic of Korea), Refrigerators, Rotor, Serological Pipettes, Shakers (Orbital shaker ANALOG, VWR, USA), Software (Quantity One, Bio-Rad, ITALY Image] , Image Analysis Software, NIH, USA XStella 1.0, Stella, GERMANY Flowlo, USA, Syngene-Genetools, UK Leica LASX, USA), Syringes, Syringa Filter Units, Test Tubes, Thermal Cycler, Vortex, Water Treatment, Water Purification System, Watmann Filter Paper-Extra Thick.

HEK293 cells. 1.3. Plasmids and Primers Table 1.1: Plasmids.

Structure Origin Spine Flag-PML Addgene #59742 pRKS 1V/pRK5 pEBG NEKl tvl University of Dundee, DU41359 pEBG Hughes de The, College de France. _ GFP-SUMO] Unknown provided by.

His-SUMO] Unknown provided by.

Table 1.2: Sequences of primers and siRNAs.

Oligo ID Sequence (5'-3') Application p.Arg8 12Ter- CTACAACTGAATGACATACAGTG SYM p.Arg812Ter- R CACTGTATGTCATTCAGTTGTAG SYM NEK] -qPCR- F AATGCTCAGAAAGGCGTTTTGT qPCR N APPENDIX] -qPC R R GGGGTCCCTATGCAAGTTCG qPCR GGAGGCGAGATCCCTCCAAAAT qPCR GGCTGTTGTCATACTTCTCATGG qPCR si CTRL UUCUCCGAACGUGUGUCACGUTT mute si PML AAGAGTCGGCCGACTTCTGGT mute NECl . 1 -F SYM NECl . 1 -R SYM NEKl .2-F DEM NEKl .2-R CCATATATTTCTCTTCTCCATTTAGC TTC SYM NEKl .3-F CAGATGTCATTGAGACTGGAAGGAAAT SYM NEK] .3-R ATTTCCTTCCAGTCTCAATGACATCTG SYM 1.4. General Kits and Enzymes Table 1. 3: Kits and Enzymes.

Name Seller Complete Mini Protease Inhibitor Cocktail Roche, Switzerland Direct- zolTM RNA MiniPrep Plus Zymo Research, USA DNA Ladder (l kb) NEB, USA Dpnl endonuclease NEB, USA ECL-Fenlto Thermo, USA ECL-Pico Thermo, USA PageRuler Dyed Protein Ladder Thermo, USA Q5 High Quality DNA Polynerase NEB, USA SensiFAsrTM cDNA Synthesis Kit Bioline, England SensiFASTTM SYBR® No-ROX Kit Bioline, England ZymoPURETM MaxiPrep Kits Zymo Research, USA ZymoPURETM MidiPrep Kits Zymo Research, USA ZymoPURETM MiniPrep Kits Zymo Research, USA 1.5 Chemicals Acetic Acid, Acrylamide, Agar, Agarose, Ammonium Persulfate (APS), Ampicillin, Arsenic, ß-Mercaptoethanol, Bovine Serum Albumin (SSA), Bromophenol Blue, Calcium chloride dehydrate, Cycloheximide, DAPI, Disodium hydrogen phosphate, DMSO, Dulbecco”s Modified Eagles Culture Liquid, EDTA, Ethanol, Ethidium Bromide, Fetal Bovine Serum (FSS), FluoroshieldTM, Glycerol, Glycine, HEPES Buffered saline solution (HBS), Hydrochloric acid, HiPerFect Transfection agent, Interferon alfa, Kanamycin, LB liquid, Methanol, MG132, Paraformaldehyde, Penicillin/Streptomycin (100X), Potassium chloride, Potassium dihydrogen phosphate, Sodium Chloride (NaCl), Sodium Dodecyl Sulfate (SDS), Sodium Hydroxide, TEMED, Tris-BaZ, Triton X-100, Tween 20, Ure. 1.6. Western Blot Buffers and Antibodies NP-4O buffer should be mixed with protease inhibitor cocktail before each use. supported. Urea tainpone was divided into small volumes and stored at -80 °C.

As an exception, mouse PML antibody was found at 5% SSA instead of skim milk in TBS-T. was prepared. If not specified, all antibodies in the table below are western used for blotting and at the indicated concentrations.

Table 1.4: Western Blotting Solutions and Buffers. Solution/Buffer Content 137mM NaCl 2mM EDTA 50 mM Tris-HCl, pH 7.4 9 M Urea 2.5mM EDTA Urea Buffer 2.5 inM EGTA 2001nM TrisHCl, pH 6.8 50 mM EDTA 375 mM TrisHCl pH 8.8 0/0 8 Separation Gel 0.1% (w/v) SDS Acrylamide: Bisacrylarnide (8 % 21/11) NP-40 Buffer 4X Laemmli Bumper 0.125 mM TrisHCl pH 6.8 Acrylamide.' Bisacrylamide (4% 21/11) 10X SDS Playback Buffer 10X Transfer Buffer 1)( Transfer Buffer Tween-20.1i IX Tris Buffered Saline (TBS-T) 50 mM Tris HCl, pH 7.4 150 mM NaCl Western B10t Blocking solution First] Antibody Solution Secondary Antibody Solution Table 1.5: Antibodies.

Antibody Vendor Source Dilution Cell Signaling Technologies, Aktin Tavsan 1: 1000 Cell Signaling Technologies, Flag Mouse 1 : 1000 Cell Signaling Technologies, 1000:1 GST Mouse .

Mouse 1 G, Cell Sinallin Technolo ies, Mouse IgG, .

Thermo Fisher Scientific, USA Goat 1: Alexa Fluor 546 PML Santa Cruz Biotechnology, USA Mouse Tavsan IgG, Cell Signaling Technologies, Rabbit IgG, . . . . . .

Thermo Fisher Scientific, USA Goat 1: Alexa Fluor 488 Tubulin Santa Cruz Biotechnology, USA Mouse 121000 2. METHODS To generate mutated plasmids, targeted mutagenesis was performed.

Primers were purchased from Macrogen. Polymerase chain reaction (PCR) components and PCR conditions are shown in the tables below. Amplification 250-500 ng of template DNA was used for DNA template after PCR at 37 oC Using Dpnl (6 al Cut Smart Tainpon + 1 al DpnI enzyme) for 3 hours torn apart. Then, 1 ali from each sample was transformed into the E. coli D1-I5alpha strain. was done. For transformation, competent cells are incubated on ice for 30 minutes. was done. This process was followed by a heat shock at 42 °C for 45 seconds. After that, Samples were incubated on ice for 2 minutes. Then 950 µl of LB was added to coinpetent cells and these cells were shaken for 1 hour at 37 °C. incubated. After incubation, competent cells were centrifuged and 900 u] LB was thrown over them. The remaining 100 µl were resuspended and appropriate spread on plates containing antibiotics. These plates were incubated at 37 °C overnight. was done. Single colonies were selected the next day and in LBs containing the appropriate antibiotics. It was incubated at 37°C overnight with shaking. Then ZymoPURE Plasmid Miniprep Kit (Zymo Research, USA) per manufacturer's recommendation Plasmid DNA was isolated using Finally, successfully Sequencing samples to Macrogen to confirm generated mutations sent to your name.

Table 2.1: PCR Components.

Component Volume (ul) Q5 reaction buffer (NEB) 5 dNTP (10 mM) 1 Forward primer (10 µM) 1.25 Reverse primer (10 HM) 1.25 template DNA l Q5 high quality DNA polymerase (NEB) l dH20 31.5 Grand Total 50 Table 2.2: PCR Conditions.

Temperature oC Time Cycle 98 30 sec 1 98 10 sec 55-65 30 sec 25 72 5 min 72 2 min 1 2 .2. Cell culture HEK and Penicillin (100 U/mL)-Streptomycin (100 ug/mL) in DMEM supplemented with (Lonza, Switzerland) (Gibco, Thermo Fisher Scientific, USA). Cells 100 mm° cell in a humidified atmosphere at 37°C, containing 5% COZ. is enlarged. These cells were passaged every 2 or 3 days. 2. 3. Plasmid DNA and siRNA Transfections On the day before plasmid DNA transfection, HEK293 cells It was planted in an amount to cover 50-70% of the culture cabinet during 500 ng ya 1 µg of plasmid DNA in 12 or 6 well culture dishes, respectively. transfected into grown cells. Transfection into 12-well dishes To make it, first, water an appropriate amount of plasmid DNA. in resolved. Then, 30.5 m1 of 2M CaClz mixture cooled in ice was added.

Following this, it will be drop by drop. added to the mix. Transfection mix after 10 min incubation slowly distributed to the cells. HEK293 cells for siRNA transfection, seeded at 105 cells per well. Also, 20 nM (1.2 pl) The siRNA was prepared in a total volume of 100 µl, free of FSS and antibiotics. dissolved in culture fluid. Then 1.5 µl of HiPerFect transfection agent (Qiagen, Germany) was added to the solution, this mixture was vortexed and incubated for 10 minutes at room temperature. Transfection after incubation The mixture was added dropwise to the cells. DNA transfections siRNA performed the day after transfection. 2 .4. Separation of Proteins into Soluble and Insoluble Fractions Precipitation tendencies of wild and mutant NEK1 proteins. These plasmids were expressed in HEK293 cells to determine

48 hours after transfection, cells were first washed with PBS and then then separated from the container by trypsin digestion. After collecting the cells, These cells were centrifuged at 2000 rpm for 2 minutes to get rid of trypsin, then washed once with PBS. Then on ice for 30 minutes. After centrifugation for one minute, the upper part was collected. This is the one gathered 4x laemmli It was mixed with tainpon and boiled at 95 °C for 10 minutes. The remaining sub or incubate for 40 minutes at 45 0C using either 75 µl of 9M urea buffer. lysed (extracted) or mixed with 100 µl of 2x laemmli buffer for 20 It was boiled at 95 DC for minutes. Upon lysis, urea solution 25 pl 4x It was mixed with laernined buffer and boiled at 95 °C for 10 minutes. Finally, Samples were analyzed using the western blot technique. 2.5. treatments Interferon was ordered from Roche. Arsenic and MG132, respectively Sigma Purchased from Aldrich and Calbiochem. Interferon was used at 2000 IU/ml. 2 µM Arsenic cells were used for treatment. MGl 32 at 2 µM overnight or used at 10 µM for 6 hours. 2 .6. Cell Lysis and Western Blot Cell lysis 48 hours after transfection, quantified according to cell density It was done using 2x laemmli buffer varying between 200-400 µl. 12mm In order to lyse the cells grown in the culture dishes, first, the culture fluids After one minute of incubation with gentle shaking, samples were collected and It was boiled at 95 0C for minutes. Samples if within the same day If not used, it has been removed to the -20 0C cabinet. Before the samples are loaded onto the gel, centrifuged at high speed for 10 minutes. 20 of each sample 1.11 SDS-PAGE loaded into the gel. Proteins will be at 70 V and then at 150 V. was carried out. After the separation stage, the proteins are transferred to the nitrocellulose membrane. (Amersham, GE Life Sciences, UK) at 100 V for 3 hours transferred by wet transfer. Then the membranes Blocked with 5% skim milk dissolved in TBS-T for 1 hour at temperature was done. After blocking, the primary prepared in the blocking solution They were incubated with antibodies on the rotor at 4 OC overnight. Next day, to remove unwanted binding, the membranes were rinsed with TBS-T for 5 minutes. washed once. Then, with secondary antibodies prepared in the blocking solution, They were incubated for 1 hour at room temperature. Specific in Meinbranes 3 times with TBS-T for 5 minutes to remove non-binding washing has been carried out. Finally, the membranes of horseradish peroxidase substrates (Thermo Fisher, USA) and protein bands using the chemiluminescence visualization system (Gbox Chemi, Syngene, United Kingdom) was displayed. genetools for analyzing protein data and For immunofluorescence experiments, coverslips were placed in 12 mm” culture dishes. and then HEK293 cells were seeded on these coverslips. cells room 4% cold PFA dissolved in PBS for 20 minutes at temperature fixed using After 2 washing steps with cold PBS, the cells 15 with PBS containing 0.25% Triton X-100 to permeabilize cell membranes. minutes incubated. Cells were then rinsed with PBS for 3 min for 5 min. washed once. Cells were dissolved in PBS-T for 1 hour at room temperature. 1 hour with primary antibodies prepared in blocking solution in a chamber was incubated at room temperature. When the antibody incubation is finished, the cells first It was washed 3 times with PBS-T for 5 minutes. Then the cells, in the dark, fluorescent dye in the block solution for 1 hour at room temperature in the chamber incubated with conjugated secondary antibodies. From secondary antibody incubation Then, 3 washes were performed with PBS-T for 5 minutes. More then cells were incubated with DAPI (1 µg/ml) for 3 minutes, then washed with PBS. Then the coverslips were attached to the slides using fluoroshield liquid. it is closed. Finally, the coverslips were covered with nail polish. images confocal microscope (Leica TCS SP8, USA) and Image J and LASX software analyzed using packages. 2 .8. RNA Isolation, cDNA Synthesis and qPCR To isolate RNA, Direct-zolTM RNA MiniPrep Plus (Zymo Research, USA) kit was used. Briefly, cells were washed once with cold PBS and added to 1 ml were collected in cold PBS. They were then transferred to 1.5 ml tubes and They were centrifuged for 3 minutes at g. Afterwards, the Supernatant was removed and cells were resuspended in 300 µl of Tri agent. After suspension Equal amount of ethanol was added to the mixture. This mixture is fed into a spin column. transferred and centrifuged at 12000 g for 30 seconds. After that, rotate The column was washed with 400 111 RNA wash buffer and removed from DNA residues. DNaseI treatment was performed to get rid of it. Next, RNA wash buffers 3 washing steps were performed with RNA, DNase/RNase-free water. was obtained using After elution, a total of 1 µg of RNA, SensiFASTTM to cDNA using the cDNA Synthesis Kit (Bioline, UK) converted. The amounts of the components and the PCR conditions are given in the tables below. (Tables 2.3 and 2.4). After PCR, cDNA in 1:5 fold ratio diluted. SensiFASTTM SYBR ® No-ROX Kit for qPCR analysis (Bioline, United Kingdom) was used. PCR conditions and components are in the tables below. performed using the qPCR system. Data ZM& using the method analyzed.

Table 2.3: Components of cDNA Synthesis.

Component Volume (pl) total RNA (1 Mg) variable 5x TransAmp Buffer 4 reverse transcriptase 1 DNase/RNase-free water up to 20 Grand Total 20 Table 2.4: PCR Conditions for cDNA Synthesis.

Temperature oC Time Cycle 10 min 1 42 15 min 1 48 15 min 1 85 5 min 1 Table 2.5: qPCR Components.

Component Volume (nl) SensiFast SYBR Mastermix (Bioline) 5 Forward primer (10 µM) 0.25 Reverse primer (10 HM) 0.25 Diluted cDNA l Grand Total 10 Table 2.6: qPCR Conditions.

Temperature 0C Time Cycle 95 2 min 1 95 5 sec 6] 10 sec 40 72 10 sec 2.9. Immunoprecipitation: Immunoprecipitation: Co-transfected with NEKI or tNEK1 with plasmids SUMO1 or SUM02 Distilled cells were grown with a solution of 10 mM N-ethylmaleimide (NEM) in PBS. was washed. Your cells; 2% SDS, 20 mM NEM, protease inhibitor cocktail (PIK) and Sonication after lysis with buffer containing 50 mM Tris pH: 8 Done. The lysates were then 250 mM NaCl, 50 mM Tris pH: 8, 1% NP-40 and It was diluted 10-fold with RIPA buffer containing PIK. Lysates were first cooled at room temperature. It was purified by one minute A/G bead incubation. Purified lysates, GST was incubated with the antibody at 4 OC for 2 hours. Lysate, antibody and beads After incubation, the beads were washed 5 times with RIPA buffer and once with PBS. washed and eluted with laein buffer. Samples Analysis by Western blot 3. EXPERIMENTS AND RESULTS To elucidate how NEKl mutations drive the pathogenesis of ALS For this, one of the most common NEC1 variants found in ALS patients was generated.

This mutant produces a premature termination/stop at amino acid position 812. contains the codon and is called NEKl (tNEKl) clipped by the inventors. produces a protein called (Brenner, D., K. Et. al. “NEK1 mutations in familia] amyotrophic lateral sclerosis”, Brain, Vol. 139, No. 5, p. e28-e28, 5 2016) (Figure la). To generate this ALS-linked NEK] mutant, As described in detail under the heading of methods above, wild] (WT: Wild type) targeted using appropriate primers on NEK1 inutagenesis was performed (2.1. targeted mutagenesis). polymerase chain DpnI endonuclease enzyme for destruction of WT NEK1 after reaction cut was made. PCR amplification and elimination of WT plasmid confirmed by agarose gel electrophoresis (Figure 1b) and the desired mutation addition was confirmed by sequencing (Figure 10). Finally, the mutation protein level was confirmed. For this, HEK293 cells WT or tNEK1 transfected with encoding plasmids. Lysates were collected and after transfection 48 One hour later Western blot was performed. As expected, WT NEKl is around 190 kDa. appears, the tNEK1 protein signal is around 130 kDa due to clipping. observed (Figure 1d). 3.2. Subcellular localization of WT and spliced NEK1: tNEKl to the nucleus is trapped First step to investigate the effect of this NEK1 mutation associated with ALS is the study of the subcellular localization of the mutant protein. For this, HEK293 cells were transfected with plasmids encoding WT or tNEK1.

Cells were fixed 24 hours after transfection and WT and tNEK1 immunofluorescence and confocal proteins using anti-GST antibody] viewed under the microscope (both WT and tNEKl variant N-terminal labeled with the GST peptide at the ends, that is, they are tagged).

The results showed a dramatic difference in the localization of the two proteins: WT NEKl is predominantly in the cytoplasm while tNEKl is trapped in the nucleus is in the C-terminal end of the protein (due to splicing) This can be explained by the disappearance of two nuclear export signals found (Figure 2).

Interestingly, aggregate-like structures were observed in cells expressing tNEK1, all of these structures were seen within the cell nucleus. Similar structures WT NEKl not observed in expressing cells. 3.3. TNEKl precipitates significantly and forms aggregates In the nuclei of cells expressing tNEKl in immunofluorescence experiments aggregate-like structures were detected, these structures expressing WT NEKl. was not detected in cells. For a slightly more detailed review, tNEKl expression HEK293 cells were treated with anti-GST antibody 24 hours after transfection. stained and 2D and 3D images using a confocal microscope obtained (Figure 3).

The results confirmed the presence of aggregate structures in cells expressing tNEK1. he did. The numbers and sizes of the aggregates with very clear boundaries are different. they vary in cells and are only found in the nucleus, This is consistent with tNEK`1 being confined to the core. TNCL aggregates not seen in all cells, suggesting a dynamic process of aggregate formation indicates that it is. The potentially toxic nature of the aggregates is also may make them difficult to detect in all cells. 3.4. TNEKl protein loses solubility In order to investigate the aggregation tendency of tNEKl in more detail, HEK293 cells were transfected with plazinides encoding WT or tNEK1. Later on cells were blasted with NP-4O, a relatively weak nonionic detergent. 40 extracts soluble proteins but dissolves protein aggregates becomes ineffective. Then, the insoluble proteins were removed by ultracentrifugation. precipitated, followed by extraction in SDS, a strong and ionic detergent. (= insoluble fraction). soluble (extracted in NP-40) or insoluble (extracted in SDS, insoluble with NP-40) proteins containing fractions were then run in SDS-PAGE and then this Presence of WT NEK1 or tNEK1 proteins in fractions Western detected by blot.

The results showed that more than half of the tNEK1 protein was present in the insoluble fraction. that only an insignificant and very small amount of WT NEK1 showed that it was present in the fraction (Figure 4). Almost all of WT NEK]” It was seen in the (soluble) fraction extracted with NP-40. As a result, both immunofluorescence analyzes and the above-mentioned biochemical extraction experiments showed that tNEKl suffered a serious loss of solubility and indicated that it formed intracellular aggregates. 3. 5. VIN is subject to excessive (hyper) SUMOization Aggregate of proteins associated with neurodegeneration of SUMO It has been shown before that it colocalizes with similar structures. In addition, Some are associated with neurodegeneration, such as huntingtin, ataxin-1, tau, and alpha-synuclein. important proteins are also known to be SUMO. Therefore, the invention between “SUMO-association” and “tNEKl-associated ALS pathogenesis”. examined the potential link. The researchers first found that the NEK] protein really wanted to show that it was modified with SUMO. about this before no data is available. HEK293 cells encoding GST-NEK1 were transfected with plasmid either alone or co-transfected with SUMO1-GFP. NEKl protein was precipitated from cell lysate using GST antibody (immunoprecipitation: IP), and SUMO on modification of anti-SUMO1 or anti-SUM02 by Western blot detected using antibodies (n=3). Figure 5, SUMOl of GST-NEK1 indicates that it has been SUMOated by

A particular consensus motif of the SUMO peptide on target proteins Since it is known to bind covalently to the lysines in the researchers performed in silico analyzes on NEKl and with SUMO identified 3 lysines with the potential to be modified: K385, K465 and K914.

By targeted mutagenesis, all 3 lysines are converted to arginine and their potential to become SUMO It was destroyed. NEKI, NEK] carrying the K385R mutation from this stage onwards. one; NEK1, NEK1.2 carrying the K465R mutation; carrying the K914R mutation NEK1, NEK1.3 and NEK1, which carries all 3 mutations together, as NEK1.3KR was named.

In order to determine the SUMOation levels of these mutants, the above-mentioned It was determined that each of the motifs contributes to NEKl SUMO uptake. and the SUMOization of NEKI disappeared as a result of the degradation of all 3 motifs. shown.

Following detection of the NEK1 protein being SUMO, ALS-associated It was also tested whether mutations alter NEKl SUMOization.

For this, the above mentioned IP and then SUMOI Western blot tests were applied. Quite interestingly, the tNEK1 mutant associated with ALS a much more severe hyper-SUMOlanina (excessive SUMO) than normal exposure was shown (Figure 6). (This is probably because tNEK's PML catalyzes the incorporation into particles and the hyper-SUMOization within the particles. is discussed in sections 3.7 and 3.8 below). 3.6. Investigation of the effect of SUMO on NEC] solubility SUMO is one of the peptides with the highest known solubility. Therefore, SUMO The solubility of target proteins is greatly increased as a result of modification with

In the laboratory, during recombinant protein expression in bacteria, SUMO, It can be fused (fusion) to related proteins to increase their solubility.

As noted above, many neurodegenerative diseases, including ALS SUMOation defects have been observed in disease-causing proteins.

The inventors of the present invention describe a method in SUMOization of NEK] (or tNEKl). Contributes to the solubility loss and aggregation of kusui tNEK1° they assumed it could be found.

Test the effect of NEKl SUMOlysin on the solubility of this protein. non-SUMO-able inutant forms of both WT and TNEK1 to by converting the consensus target lysines on them to arginines. was created (Figure 5). Lysine-arginine conversion SUMOization consensus It maintains the positive charge in its inotif, ensuring the correct folding and function of the protein. however, it prevents SUMO from covalently binding to this motif.

In HEK293 cells, both SUMOable and non-SUMOable WT or TNEK1 proteins were expressed. As mentioned above, soluble or insoluble NEK1 and tNEK1 protein ratios by NP-4O or SDS extraction analyzed. In order to better extract the insoluble tNEKl forms, this urea was used instead of SDS. As seen in previous experiments, WT NEKl in completely soluble (extracted with NP-40) fraction tNEKl is mostly found in SDS or urea-extracted, i.e. There is no difference in resolution between WT or tNEKl forms that cannot be SUMO. These results suggest that tNEKl aggregation is due to a defect in SUMO. not originate from, possibly the cilia at the C-terminal end of the protein. indicates that it may be caused by incorrect folding. Conclusion As a result, tNEK1 was used by the inventors of ALS patients' motor Deposition and aggregation strong enough to cause toxicity in neurons It has been shown to have a tendency. 3.7. TNEKl enters PML particles Based on the following observations, the inventors of the present invention He thought there might be a PML partner protein that enters the PML particles: l) tNEKl being trapped in the cell nucleus, 2) The presence of SUMO-interaction motifs (SIMs) over samples (previously that these motifs are the elements that carry the proteins into PML particles. shown), 3) PML particles can selectively recognize misfolded proteins which is a part of tNEKl, which may have been misfolded due to shearing. It strengthens the possibility of becoming a PML partner, 4) Similar to other PML partner proteins of tNEKl, they are over- (hyper) Exposure to SUMOization (Figures 5 and 6). HEK293 to test if tNEK']” enters PML particles tNEK1 (or WT NEKI as control) was transiently expressed in cells and its intracellular localization were analyzed in detail (confocal microscope under). As a result of these analyzes, there is a partial separation between tNEKl and PML particles. co-localization was observed.

Arsenic trioxide (arsenic, AS) treatment reduces the formation of PML particles and triggers the calling of partner proteins. 2 µM AS for two hours In the given cells, it was determined that tNEKP was included in the tainamen PML particles. observed (full/full co-localization). WT NEKl with 11 SIM motifs not detected in particles under these conditions. These results shows that PML particles selectively cleave the spliced NEK1 mutant. (tNEKl) (Figure 8), this is probably because both tNEKl's trapped in the cell nucleus as well as possibly misfolded is that.

Triggers SUMO.

Following the results from previous experiments, the inventors of the present invention Whether tNEKl hyper-SUMOization is indeed a PML-related process. found that it wasn't. For this purpose, tNEKl SUMOization of PML overexpression effect has not been studied. SUMOLED TANKl forms SDS-PAGE easily because they have a relatively high molecular mass on can be detected. Each SUMO covalently bound to the target protein The peptide increases the mass of the protein by 18 kDa.

tNEK1, SUMO1, and PML proteins in HEK293 cells by transfection expressed temporarily. Cells were blasted 48 hours after transfection and analysis by Western blot after separation of proteins on SDS-PAGE was done. In conditions where PML and SUMO1 are overexpressed with tNEK1 high molecular mass forms of tNEK1 were observed to occur, these forms probably represents SUMO-modified TNEK1. Multiple The appearance of bands (ladder pattern) is also probably the poly- It indicates that it is SUMO (Figure 9a). That is, the PML excess expression tNEK It causes SUMO formation.

In addition, shedding light on the subcellular localization of SUMOylated tNEKl overexpression of tNEK1 in HEK293 cells together with GFP-SUMOI. and tNEK1/GFP-SUMO1 co-localization was analyzed. For this analysis Immunofluorescence method was used. Remarkably, tNEKl, GF P- It was seen co-localized with SUMO1 only in PML granules (Figure 9b).

This indicates that the SUMOated TNEK is contained in the PML particles. is doing. As a result, these data are embedded in the tNEK of PML particles. and excessive (hyper) SUMOization of this inutant protein in situ. indicates that it has caused. 3.9. Penetration of tNEKP into PML particles as a result of IFN treatment tNEKl's PML particles, especially arsenic infusion created Upon the demonstration that it enters under oxidative stress conditions, researchers have a interferon alfa°y1 (IFN), another PML granule-inducing drug/molecule test they did. After HEK293 cells were transfected with tNEK1, this time 24 treated with IFN for one hour. After the cells are fixed, tNEK1 and PML particles were detected by immunofluorescence. in control cells It was seen that the TNEC touched the PML particles from the outside, complete co-localization not detected. As a result of IFN treatment, tNEKl and PML particles Despite the increase in contact between the particles, tNEKl could not be detected in the particles.

Following this, the inventors' next hypothesis is that tNEK's PML particles After entering, it was destroyed in situ inside (tNEK'in particles into particles) It is impossible for the protein to be destroyed as soon as it enters, to detect the protein in these particles. storeroom). This phenomenon is common in many PMLs, such as the HTLV-1 Tax oncprotein. partner protein. Therefore, inventors cells have both IFN and treated with MG132, which blocks proteasomal degradation. Attention attractively, tNEK1 results from the IFN/MG132 combination treatment. Observed in PML particles, PML of tNEK under these conditions It was determined that it accumulated in the particles and showed full (full) co-localization. was done. According to these results, indeed, IFN, tNEKl in PML particles it increases its employment and causes its eventual destruction (Figure 10). Only per MG132 treatment also reduces tNEKl signals in PML NB particles. slightly increased. This result is obtained even if PML particles do not have IFN inclusions. indicates a basal level of tNEKl destruction, this destruction IFN can be strongly induced by treatment. 3.10. Induction of tNEK1 degradation by IFN The inventors of the present invention, tNEK1, which has a tendency to aggregate, It showed that it was entering the PML particles. granules penetrating into particles destruction as a result of hyper-SUMOization, possibly catalyzed by PML is coming. A small amount of tNEKl is basal in quiescent cells under normal conditions. Although this is destroyed at the level, this process has a dramatic effect with the IFN treatment. can be induced. HEK293 expressing tNEK in order to investigate the destruction of TNEK in more detail cells were treated with AS and IFN. TNEKl protein level this time It was followed by western blot. Indeed, tNEK as a result of IFN treatment It was observed that the protein level was greatly reduced (Figure 11). AS treatment It did not trigger the destruction of TNEKl. Increase of PML protein expression and PML granule Occurs within approximately 24 hours following IFN treatment is taking place. qPCR analysis, NEK1 mRNA of IFN treatment showed that it did not cause any decrease in the level of IFN and tNEKl affects the stability of the protein, but tNEK1 mRNA and gene expression (WT and tNEK] expressions on the same plasmid type and 3 extracted from the same promoter) (Fig. 12).

As a result, these data show that IFN inuainelesin ALS-linked tNEK] protein. shows that it triggers proteasomal degradation. 3.11. IFN-driven TNEK] destruction is a PML dependent operation The next step is to ensure that IFN-inducible degradation of tNEK1 is truly PML. was to test whether it was facilitated by For this purpose, TNEKl In HEK293 cells expressing PML, expression was silenced with siRNA. PML In the absence of IFN, the effect of IFN is almost completely lost, i.e. IFN treatment. As a result, it was observed that tNEKl breakdown did not occur (Figure 13). These data Within the PML particles of TNEKl, in situ degradation actually via PML and that this destruction is induced by IFN.

At the same time, tNEKl of IFN treatment is much more efficient than WT NEKl. It was observed that it was destroyed (Figure 14). In other words, normally PML Until the IFN treatment of WT NEKl, whose particles do not enter into it, until tNEKl shown to be insensitive. 3.12 . IFN treatment/treatment attenuates tNEK1 aggregation. It may also reduce aggregation from tNEK1 if

To test this exciting idea, the inventors treated IFN (or not) from HEK293 cells with NP-40 as described above protein extracted (soluble) or extracted with urea (insoluble) analyzed its fractions and examined the solubility level of tNEK1. Attention Attractively, the tNEKl protein was insoluble in IFN treatment. was almost undetectable in the fraction (ie, extracted with urea). These data indicates that IFN treatment triggers the destruction of the tNEK1 mutant and does not allow for aggregation (Figure 15). 3.13. Effect of IFN treatment on tNEK1 aggregates Until now, inventors have found that IFN treatment is prone to aggregation. It has been shown that it reduces the amount of insoluble tNEKl by triggering its destruction. A The next step is to ensure that aggregates of tNEK1 in IFN-treated cells to examine his destiny. GST-tNEK1 was again expressed in HEK293 cells, For immunofluorescence analyzes after cells were treated with IFN, anti- It was stained with the GST antibody and the aforementioned aggregate-like structures examined (shown in Figure 3°). Remarkably, tNEKl aggregates Concomitant treatment with the blocking MG132 blunted the effect of IFN°. all this The results showed that the aggregation-prone tNEKl protein is IFN-directed proteasomal supports that its destruction can prevent tNEKl aggregation (Fig. 3.14. The role of SUMO in IFN-directed TNEK] degradation The inventors of this invention have been shown that tNEK1 and aggregates with IFN treatment/treatment It showed that it can be destroyed. In addition, IFN-driven TNEKl destruction has been linked to PML. (and thus to PML particles) and to the proteasome. This The results are described in the introduction to the “PML/SUMO/RNF4-mediated protein mechanistic IFN-driven tNEKl destruction It indicates that it has created the teinelin. Finally, tNEKl SUMO In order to test its essential role in this process, inventors tNEKl The non-SUMO form (2KR-tNEKl mentioned in Figure 7 above) mutant) in HEK293 cells. If PML particles are granulated] if it catalyzes the hyper-SUMOification and destruction due to this SUMOlamna, The tNEK mutant that cannot be SUMO should be resistant to IFN treatment. Really As shown in Figure 173, IFN treatment increased the protein level of tNEK1. cause a serious change in 2KR-tNEKl protein level while reducing it didn't happen. Consequently, these data suggest that SUMOization of TNEK1 for IFN-directed degradation of the protein in PML particles

Claims (1)

REQUESTS . Interferon for use in the treatment of a neurodegenerative disorder. . The interferon for use according to claim 1, wherein the neurodegenerative disorder is amyotrophic lateral sclerosis (ALS). . The interferon for use according to claim Z, wherein the ALS is caused by a mutation in NEK1. . The interferon for use according to claim 3, wherein the mutation includes a premature stop codon at amino acid position 812. . Interferon for use according to claims 1 to 4, wherein the interferon is selected from the group consisting of interferon-alpha, interferon-beta and interferon-gamma. . Interferon for use according to claim 5, wherein the interferon is interferon-alpha. . Interferon for use according to claims 2 to 6, wherein ALS exhibits protein expression of the cilinis NEKI (tNEK1). . A method of treating a patient with ALS who exhibits an NEK1 mutation, which provides the patient with a therapeutically effective amount. 9. A method according to claim 8, wherein the mutation contains a premature stop codon at ainino acid position 812. 10. A method according to claim 8 or 9, wherein interferon is a method of treating a patient with interferon-11 ALS, in a therapeutically effective amount upon detection of a mutation in the NEK1 gene.