RU2539764C2 - Multipurpose cancer-specific promoters and using them in anti-cancer therapy - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, in particular to tumour-specific promoters, and can be used in the anti-cancer therapy. There are constructed the broad-spectrum tumour-specific promoters providing the therapeutic gene expression inside a cancer cell. The invention also involves expression cassettes, expression vectors, pharmaceutical compositions, methods of treating cancer and using the expression cassettes and vectors.

EFFECT: promoters of the present invention provide a high expression level of the operatively linked therapeutic gene in the cancer cells of different origin, wherein the normal cell expression is absent or low.

29 cl, 19 dwg, 4 tbl, 20 ex

Description

FIELD OF THE INVENTION

The present invention relates to biotechnology, in particular genetic engineering, to artificial DNA constructs demonstrating the high activity of the transcriptional promoter, from which the expression of an arbitrary nucleotide sequence transcribed by RNA polymerase II is carried out. The activity of promoters is limited only to cancer cells.

Promoters can be used for gene therapy of tumors of various nature.

State of the art

Cancer is currently the most serious medical problem. It has become increasingly apparent that until recently the concept of molecular targeting of anticancer drugs to the suspected key cancer cell molecules that are involved in tumor development has prevailed (Salk JJ and Fox EJ et al. (2010) Annu Rev Pathol Mech Dis 5: 51-75). The vast majority of agents in this category that have undergone preclinical and clinical trials have been found to be ineffective (Hambley TW and Hait WN (2009) Cancer Res 69: 1259-62). This is a highly anticipated crisis: cancer as a disease combines the complexity of cell organization inherent in other diseases with the complexity of a growing system that can adapt to the effects of drugs through the existence of microheterogeneity within the tumor (Merlo LM and Pepper JW et al. (2006) Nat Rev Cancer 6: 924-35). This leads to the fact that most cancer genes take only a small part in the development of cancer. Because of this, they are difficult to identify for targeting the action of anticancer agents (Salk JJ and Fox EJ et al. (2010) Annu Rev Pathol Mech Dis 5: 51-75). As a result, a critical situation has developed in cancer therapy: on the one hand, medicine has quite effective, but highly toxic chemotherapy, and on the other, low-toxic but ineffective molecular targeted therapy (MTT).

In the last decade, gene therapy for cancer (HT) has begun to develop. The general principle of HT is to deliver regulated genetic material to cancer cells, where products that can destroy cancer cells are produced as a result. GT approaches can be divided into two broad categories (Sverdlov ED (2009) Mol Gen Mikrobiol Virusol 24: 93-113) / (http://link.springer.com/article/10.3103%2FS089141680903001X). The first uses a targeted therapy strategy. Moreover, the target product is the product of a gene introduced in some way into the tumor cell, which is an inhibitor of a product whose concentration in the cancer cell is increased, and this is one of the causes of the cancer process. The reverse technology, delivery of a gene to a tumor, the product of which compensates for the lack of a specific protein in cancer cells, can be attributed to the same category. In both cases, the target of exposure is a certain link in the signal systems of the cell, which changes during cancerous regeneration and contributes to it. Target-based GT options suffer from the same drawbacks as BMT.

The first gene-therapeutic virus for the treatment of head and neck cancer was approved for clinical use in China in 2003 under the name Gendicine. The virus contains p53 as a therapeutic gene (Peng Z (2005) Hum Gene Ther 16: 1016-27, Wilson JM (2005) Hum Gene Ther 16: 1014-5). In combination with radiotherapy, Gendicin caused complete tumor regression in 64% of patients and partial in 29%, while one radiotherapy gave complete regression in 19% and partial in 60%, which, apparently, shows a noticeable improvement in the result of combination therapy ( Peng Z (2005) Hum Gene Ther 16: 1016-27). But these results also show that only 64% respond to treatment, and the further behavior of their illness is unknown. There is reason to expect the appearance of secondary tumor growth, since it has been shown that the introduction of p53 into tumors in which it is initially damaged causes the appearance of p53 resistant variants (Martins CP and Brown-Swigart L et al. (2006) Cell 127: 1323- 34). The data obtained using GT as a molecular targeted therapy suggest that, like the classical MTT and due to the same reasons, it is unlikely to be highly effective or universal.

The second strategy of gene therapy, aimed at the destruction of tumor cells, as such, by using their properties that are characteristic of all cancer cells, for example, an increased rate of mitotic divisions, in this respect is similar to chemotherapy. However, unlike the latter, the toxin, which kills cancer cells by inhibiting the replication systems, is formed inside them, so that the toxicity characteristic of chemotherapy in this case is sharply reduced. This approach is known as gene-directed enzyme prodrug therapy (GDEPT) or suicide gene therapy (Altaner C (2008) Cancer Lett 270: 191-201, Fillat C and Carrio M et al. (2003) Curr Gene Ther 3: 13-26, Portsmouth D and Hlavaty J et al. (2007) Mol Aspects Med 28: 4-41, Seth P (2005) Cancer Biol Ther 4: 512 -7). The approach is not molecularly targeted and therefore devoid of all the disadvantages of MTT.

One of the important elements for the success of cancer gene therapy is an adequate system for the expression of therapeutic genes, since these genes must work in cancer cells and not work in normal cells of the body. In the ideal case, the control system of therapeutic genes in the body should provide (i) strictly tissue-specific and (ii) strong enough transgene expression to ensure safety on the one hand and system efficiency on the other. For this, in constructing vectors, promoters and enhancers that specifically work in tumors of a given tissue are used (Robson T and Hirst DG (2003) J Biomed Biotechnol 2003: 110-137, Saukkonen K and Hemminki A (2004) Expert Opin Biol Ther 4: 683- 96). However, all natural tumor-specific promoters have two significant drawbacks: on the one hand, they are weak, and on the other, they have a high level of activity only in certain cancer cell lines, that is, they are not universal. For example, the AFP promoter is most active in liver carcinoma cells, the PSA promoter in prostate tumor cells, the Cox-2 promoter in cancer cells of the stomach and duodenum, the MK promoter in neuroblastoma cells (Adachi Y and Reynolds PN et al. (2001) Cancer Res 61: 7882-8).

Most tumor-specific promoters have low activity compared to constitutive strong promoters, such as the SV40 and CMV viruses (Van Houdt WJ and Haviv YS et al. (2006) J Neurosurg 104: 583-92, Lu B and Makhija SK et al. ( 2005) Gene Ther 12: 330-8, Rein DT and Breidenbach M et al. (2004) J Gene Med 6: 1281-9).

There is another problem. Even relatively strong tumor-specific promoters, such as the promoter of the BIRC5 gene (hSurv), the encoding apoptosis inhibitor survivin, and the promoter of the human telomerase reverse transcriptase gene (hTERT) with a fairly broad spectrum of activity, do not display it in all cancer cells. For example, the hSurv promoter is active in tumors in only about 60-80% of patients with non-small cell lung cancer (NSLC), and the TERT promoter is active in 60% of patients with NSLC (Hsu CP and Miaw J et al. (2003) Eur J Surg Oncol 29: 594-9). At the same time, significant variability in the relative activity of these promoters in various tumor cell lines is observed. Thus, the activity of the survivin promoter varies from 0.3 to 16% of the activity of the CMV promoter (Chen JS and Liu JC et al. (2004) Cancer Gene Ther 11: 740-7, Konopka K and Spain C et al. (2009 ) Cell Mol Biol Lett 14: 70-89, Zhu ZB and Makhija SK et al. (2004) Cancer Gene Ther 11: 256-62), and the efficiency of the hTERT promoter can vary up to 20 times depending on the cancer cell line (Gu J and Fang B (2003) Cancer Biol Ther 2: S64-70).

The variability of natural tumor-specific promoters in different tumors makes it difficult to select prodrug doses to obtain a therapeutic effect and changes the therapeutic index of the drug from tumor to tumor.

To increase the efficiency of tumor-specific expression of therapeutic genes, combined and double (chimeric) promoters are used. Chimeric promoters may include combinations of known promoters with each other or with individual heterologous regulatory elements to increase the strength and specificity of expression in cancer cells (Wu C and Lin J et al. (2009) Mol Ther 17: 2058-66). An example of a chimeric promoter is the combination of PhTERT with a minimal cytomegalovirus promoter (PhTERT-CMV) (Davis JJ and Wang L et al. (2006) Cancer Gene Ther 13: 720-3); or with a TATA box, which is absent in the native PhTERT. As a rule, the authors of various studies aimed at the efficient use of hybrid promoters follow the path of maximizing the efficiency and specificity of expression in a particular type of cancer. An example of this approach is the work of Poulsen et al. (Poulsen TT and Pedersen N et al. (2008) Cancer Gene Ther 15: 563-75). In this work, two genes that were highly expressed in small cell lung cancer (SCLC) were identified. One of them encodes the transcription factor hASH1, and the other, EZH2, is a member of the Polycomb family. When the promoters of these genes were combined into one construct, the resulting chimeric promoter was able to induce strong transgene expression specifically in SCLC cells. Such a promoter is capable of initiating the expression of killer genes in SCLC, but not in other types of cancer.

This ideology of maximizing the specificity of promoter activity in a particular type of cancer is widespread (see, for example, Farokhimanesh S and Rahbarizadeh F et al. (2010) Biotechnol Prog 26: 505-11). The use of promoters and other regulatory elements that are strictly specific for this tumor has the advantage of maximizing the reduction of side effects by reducing the expression of transgenes in normal tissues. However, the disadvantage of such approaches is their non-universal nature and the associated inevitable increase in the cost of drugs based on such promoters. A compromise option is to use more universal cancer-specific promoters that can work in a wide range of tumors, but not in normal cells. By slightly increasing the risk of damage to normal tissues, this approach is more economically justified: the same constructs can be used in the treatment of a wide range of tumors. There is another important consideration in favor of using promoters with a wider spectrum of action. It is associated with poorly studied specificity of gene expression in metastases of this tumor. There is no strict guarantee that a highly specific promoter that works well in a primary tumor will retain this ability in all its metastases. The use of universal promoters reduces the likelihood of inactivation of the promoter in metastases.

Disclosure of invention

The present invention is aimed at eliminating the disadvantages inherent in the promoters of the prior art, strictly specific in relation to a particular type of cancer, and to create universal promoters with a wide spectrum of action against various types of cancer and their metastases, while still maintaining the ability to function essentially only in tumor cells, but not in normal cells.

The present invention provides artificial universal tumor-specific double promoters with high activity in a wide range of cancer cells, regardless of their type.

Tumor-specific double promoters are based on modified promoters of human telomerase reverse transcriptase genes (hTERT) and human and mouse survivin (Surv). The human survivin gene (BIRC5) encodes a survivin protein, which belongs to the family of apoptosis inhibitor proteins and is one of the key participants in tumor formation. The survivin promoter is highly tumor specific and active in the vast majority (85-90%) of tumors (Takakura M and Kyo S et al. (1999) Cancer Res 59: 551-7, Ambrosini G and Adida C et al. (1997) Nat Med 3: 917-21, Fukuda S and Pelus M (2006) Mol Cancer Ther 5: 1087-98). The hTERT gene encodes a catalytic subunit of human telomerase. The transcriptional activity of this gene is observed during embryonic development and is often present in tumor cells in approximately 85% of cases, while hTERT expression is suppressed in the vast majority of normal body cells (Cong YS and Wright WE et al. (2002) Microbiol Mol Biol Rev 66: 407-25).

It has been shown that the created promoters differ in quantitative and qualitative criteria from their hTERT and Surv promoters.

In experiments on transient transfection of cancer cell lines with plasmid vectors containing the firefly luciferase reporter gene under the control of the created promoters, the high activity of the created promoters was demonstrated, exceeding the activity of both the strong constitutive promoter of the SV40 virus and single promoters of the hTERT and Surv genes. Moreover, in experiments using normal cells (lung fibroblasts), the tumor specificity of the created double promoters was proved.

Also, based on the created double promoters, therapeutic constructs containing the killer gene or the killer gene in combination with the cytokine gene were obtained.

On the panel of cancer and normal cell lines, the therapeutic tumor-specific effect of the resulting constructs was demonstrated.

Based on the created double promoters, plasmid, viral or other vector constructs can be obtained for tumor-specific expression of any gene or various genes in cancer cells. In this case, the size of the promoter can be increased, and other regulatory and genetic elements can be added to the nucleotide sequence of the promoter, providing an increase in the activity of the promoter.

Thus, the present invention in its first aspect relates to a tumor-specific promoter, consisting of:

A) the nucleotide sequence of SEQ ID NO: 2 or its functional derivative, and

B) a nucleotide sequence selected from the group including:

(i) the nucleotide sequence of SEQ ID NO: 1 or a functional derivative thereof;

(ii) the nucleotide sequence of SEQ ID NO: 3 or a functional derivative thereof.

In the promoter of the present invention, the sequence of SEQ ID NO: 2 may be located higher (in the 5′-direction) relative to the sequence of SEQ ID NO: 1 or SEQ ID NO: 3, or the sequence of SEQ ID NO: 2 may be located lower (in 3 ′ direction) relative to the sequence of SEQ IDNO: 1 or SEQ ID NO: 3. The promoter of the present invention may contain other nucleotide sequences that do not affect its activity, for example, a linker sequence.

The most preferred promoter sequences of the present invention are selected from the group consisting of SEQ ID NO: 4-7.

In a second aspect, the present invention relates to an expression cassette comprising, in the direction 5 ′ to 3 ′, a promoter of the present invention, a coding sequence operably linked to a promoter, and a polyadenylation signal, the expression of the coding sequence being controlled by said promoter.

In the expression cassette of the present invention, the coding sequence can encode various therapeutic proteins or peptides, antigens, antisense RNA, or ribozymes. In particular, the expression cassette may comprise a coding sequence that includes therapeutic intervention genes selected from the group consisting of: negative dominant mutants (NDM) of genes involved in oncogenesis; killer genes, genes - angiogenesis inhibitors, cancer suppressor genes, immunostimulant genes, siRNA genes.

Negative dominant mutants (NDMs) of genes can be selected from the group consisting of NDM gene of survivin, NDM gene c-Jun, NDM RAS oncogene. Killer genes can be selected from the group comprising toxin genes and enzyme genes capable of converting a non-toxic agent (prodrug) into a toxin. The latter can be selected from the group comprising the herpes simplex virus thymidine kinase gene and yeast or E. coli cytosine deaminase gene. Angiogenesis inhibitor genes may be selected from the group consisting of angiostatin and endostatin protein genes. The cancer suppressor genome may be, for example, a p53 protein gene. Immunostimulatory genes can be selected from the group comprising the genes IL-1, IL-2, IL-4, IL-6, TNF, GM-CSF, or gamma interferon. The siRNA genes can be selected from the group comprising siRNA to the survivin gene.

In a third aspect, the present invention relates to an expression vector comprising an expression cassette of the present invention. Moreover, the expression vector of the present invention may be viral or non-viral. In the case where the vector of the present invention is a viral vector, it can be selected from the group comprising retroviral, adenovirus, adeno-associated or herpes virus vector. A non-viral vector may be represented, for example, by a plasmid.

In a fourth aspect, the present invention relates to a pharmaceutical composition comprising a therapeutically effective amount of an expression cassette or vector of the present invention and a pharmaceutically acceptable excipient, which without limitation may be a carrier, solvent, excipient, excipient, buffering agent, stabilizer, preservative, etc. .

The pharmaceutical composition of the present invention can be used to treat a wide range of oncological diseases, and the disease can be selected without limitation from the group including lung cancer, pancreatic cancer, melanoma, fibrosarcoma, sarcoma, neck and head cancer.

In a fifth aspect, the present invention relates to a method for treating an oncological disease, comprising administering to a patient a pharmaceutical composition of the present invention.

A method of treating the present invention may include, without limitation, intravenous, intratumoral intramuscular, intraperitoneal, subcutaneous, oral administration of the pharmaceutical composition of the present invention. The method of treatment can be used to treat cancer, without limitation, selected from the group including lung cancer, pancreatic cancer, melanoma, fibrosarcoma, sarcoma, head and neck cancer.

Finally, in a sixth aspect, the present invention relates to the use of an expression cassette or vector of the present invention for the manufacture of a medicament for the treatment of cancer. An oncological disease can be selected without limitation from the group including lung cancer, pancreatic cancer, melanoma, fibrosarcoma, sarcoma, head and neck cancer.

Brief Description of the Drawings

Figure 1. Schematic representation of the expression construct PhSurv269-pGL3. PhSurv 269 - a fragment of the promoter region of the human survivin gene; LUC - firefly luciferase gene, polyA - SV40 polyadenylation site.

Figure 2. Schematic representation of expression constructs. On the left is the name of the structures. PhSurv269 - fragment of the promoter of the human survivin gene; PhTERT fragment of the promoter of the human telomerase reverse transcriptase gene; LUC - firefly luciferase gene.

Figure 3. Schematic representation of the expression construct PhTSurv269-HSVtk-pGL3. PhTERT — fragment of the promoter region of the human telomerase reverse transcriptase gene (hTERT); PhSurv269 - a fragment of the promoter region of the human survivin gene; HSVtk - herpes simplex virus thymidine kinase gene type 1; SV40 late poly (A) signal for polyadenylation of the SV40 virus; Amp (r) - p-lactamase gene.

Figure 4. Schematic representation of the expression construct PhTSurv269-HSVtk-mGM-CSF-pGL3. PhTERT — fragment of the promoter region of the human telomerase reverse transcriptase gene (hTERT); PhSurv269 - a fragment of the promoter region of the human survivin gene; HSVtk - herpes simplex virus thymidine kinase gene type 1; IRES - site of landing of the ribosome of the human encephalomyocarditis virus; mGMCSF — gene of granulocyte-macrophage colony stimulating factor mouse; SV40 late poly (A) - SV40 virus polyadenylation signal; Amp (r) - β-lactamase gene.

Figure 5. Schematic representation of the expression construct PhTSurv269-FCU1-mGM-CSF-pGL3. PhTERT — fragment of the promoter region of the human telomerase reverse transcriptase gene (hTERT); PhSurv269 - a fragment of the promoter region of the human survivin gene; FCU1 - a hybrid gene of cytosine deaminase / uracil phosphoribosyl transferase; IRES - site of landing of the ribosome of the human encephalomyocarditis virus; mGMCSF — gene of granulocyte-macrophage colony stimulating factor mouse; SV40 late poly (A) - SV40 virus polyadenylation signal; Amp (r) - p-lactamase gene.

6. Scheme of the modified PhTSurv269-Cre-LoxP system // pCMV-Stop-FCU1. When killer and activation vectors enter the tumor cell, the following cascade of events will be initiated: 1) activation of the promoter of the PhTSurv269 gene, which will lead to expression of the Cre recombinase gene; 2) the accumulated Cre recombinase will recognize loxP sites as part of the killer vector, and then cut a fragment flanked by these sites; 3) as a result of the removal of the ″ Stop ″ signal, the CMV promoter will ″ start ″ the production of the killer protein CD-UPRT (FCU1 expression product). Stop is a sequence of 705 bp in length consisting of a triple repeat (235 bp × 3) of the SV40 virus polyadenylation signal. NLS (Nuclear Localization Signal) - a nuclear localization signal. Black arrows indicate LoxP sites, empty arrows indicate promoters, empty rectangles indicate structural parts of genes, and an empty circle indicates Stop sequences.

7. The diagram of the relative activity of the studied promoters in various cell lines. The names of the promoters are given at the bottom of the figure. The ordinate shows the relative luciferase activity normalized to luciferase activity in cells transfected with the PV-pGL3 construct. The names of cell lines are given along the abscissa. Calu-1 - epidermoid carcinoma of the human lung, A375 - human melanoma, A549 - carcinoma of the human lung, PANC1 - carcinoma of the exocrine pancreas, HT1080 - fibrosarcoma.

Fig. 8. The activity of universal tumor-specific promoters in various cell lines. The ordinate shows luciferase activity relative to luciferase activity in cells transfected with the PV-pGL3 vector. The abscissa indicates the types of cell lines in which promoter activity was measured. In the upper right corner are the names of the promoters used in the work. The height of the columns reflects the average value of luciferase activity in three independent experiments; standard errors of the mean value (SEM) are given. PV is the SV40 virus promoter, mSurv is a fragment of the promoter region of the mouse survivin gene, hTERT is a fragment of the promoter region of the human telomerase reverse transcriptase gene.

Fig.9. The activity of the created tumor-specific promoters in various cell lines. The ordinate shows luciferase activity relative to luciferase activity in cells transfected with the PV-pGL3 vector. The abscissa indicates the types of cell lines in which promoter activity was measured. In the upper right corner are the names of the promoters used in the work. The height of the columns reflects the average value of luciferase activity in three independent experiments; standard errors of the mean value (SEM) are given.

Figure 10. Western blot analysis of FCU1 protein content in S37 cells transfected with constructs expressing the FCU1 gene. 1 - pCMV-FCU1; 2-3 - different ratios of the vectors PhTSurv269-Cre and pCMV-STOP-FCU1 (cotransfection): 2: 2, 1: 3. Sheep IgG (″ Santa-Cruz ″) (1: 5000) was used as primary antibodies. Secondary antibodies to sheep IgG were conjugated to horseradish peroxidase (″ Santa-Cruz ″). Cell lysates were previously normalized to total protein.

11. Survival of cancer cells of the S37 line (mouse sarcoma) in the presence of 5-fluorocytosine transfected with the following vectors: pCMV-FCU1 vector (positive control), PhTSurv269-Cre vector system (activator) / pCMV-STOP-FCU1 (effector) with activator / effector ratio 2: 2 and 1: 3 by the number of micrograms.

Fig. 12. The survival of cancer cells of the S37 line (mouse sarcoma) in the presence of 5-fluorocytosine transfected with the following vectors: pCMV-FCU1 vector (positive control), PhTSurv269-Cre / pCMV-STOP-FCU1 and PhSurv-Cre / pCMV-STOP-FCU1 vector systems.

Fig.13. Schemes of double promoters and corresponding transcript variants. Rectangles denote the promoters PhTERT, PhSurv, PhSurv269, PmSurv and the firefly luciferase gene - Luc. The names of double promoters are indicated on the left. Under the scheme of each double promoter, the lines indicate transcripts initiated from these promoters. The thickened part of the line denotes the transcript sequence complementary to the sequences of promoters or the luciferase gene, and the thin one to the linker sites. The broken arrow marks the transcription initiation points. Arrows indicate primers. Above the arrows are the names of the primers.

When using primer pairs TSL-F / hSurv_150R, TSL-F / hS269_122R and TSL-F / mS_122R, only transcripts initiated from distal promoters are amplified. The UPF / Luc_202R primer pair allows amplification of the total transcripts.

Fig.14. Electrophoregrams of products obtained as a result of RT-PCR and initiated from distal and proximal promoters. The names of the double promoters are shown above. The position in relation to the controlled gene of the individual promoter elements constituting the double promoter, and the number of PCR cycles are indicated on the left and bottom, respectively. Distal - amplification products of transcripts initiated from the PhTERT promoter using primers TSL-F / hSurv_150R, TSL-F / hS269_122R for the PhTS promoter and primers TSL-F / mS_122R for the promoters, PhTSurv269 and PhTmS. Proximal - amplification products using UPF and Luc_202R primers of total transcripts and / or transcripts initiated from the distal promoter.

Fig.15. Survival in the presence of ganciclovir of cancer cells of the HT1080 line (human fibrosarcoma) transfected with vectors: PhSurv-HSVtk, PhTSurv269-HSVtk, control.

Fig.16. Survival in the presence of 5-fluorocytosine of Calu-1 cancer cells transfected with vectors: PhSurv-FCU1-mGM-CSF, PhTSurv269-FCU1-mGM-CSF, CMV-FCU1-mGM-CSF, control.

Fig.17. Western blot analysis of HSVtk protein in HT1080 cells transfected with constructs expressing the HSVtk gene. 1 - pCMV-HSVtk; PhSurv-HSVtk, PhTSurv269-HSVtk. Sheep IgG (″ Santa-Cruz ″) (1: 5000) was used as primary antibodies. Secondary antibodies to sheep's IgG were conjugated to horseradish peroxidase (″ Santa-Cruz ″). Cell lysates were pre-normalized to total protein.

Fig. 18. The effect of transformation of mouse Lewis lung carcinoma cells (LLC) by genetic engineering constructs on the growth rate of tumors caused by transplantation of these cells into C57B1 / 6 mice. Non-transformed (Control) transformed by the construction of CMV-HSVtk-mGM-CSF-pGL3 (CMV), transformed by the construction of PhSurv-HSVtk-mGM-CSF-pGL3 (PhSurv) and transformed by the construction of PhTSurv269-HSVtk-mGM-CSF-pGL26 cells transplanted into mice. Intraperitoneal injections of ganciclovir (GCV) in an amount of 75 mg / kg twice daily were performed 10 days starting from the third day after cell transplantation. Tumor sizes were measured from day 6 after cell transplantation. Data are average values for a group of 10 animals. The abscissa indicates the time elapsed since the transplantation of the cells.

Fig.19. The effect of transformation of mouse Lewis lung carcinoma cells (LLC) by genetic engineering constructs on the growth rate of tumors caused by transplantation of these cells into C57B1 / 6 mice. Transformed with the CMV-HSVtk-mGM-CSF-pGL3 (CMV) construct, transformed with the PhSurv-HSVtk-mGM-CSF-pGL3 construct (PhSurv) and transformed with the PhTSurv269-HSVtk-mGM-CSF-pGL3 construct (PhTSurv269 cells) Intraperitoneal injections of ganciclovir (GCV) in an amount of 75 mg / kg twice daily were performed 10 days starting from the third day after cell transplantation. Tumor sizes were measured from day 6 after cell transplantation. Data are average values for a group of 10 animals. The abscissa indicates the time elapsed since the transplantation of the cells.

The implementation of the invention

The created double promoters are chimeric double promoters in which the hSurv and hTERT gene promoters are in two positions relative to each other. In the first case, the hSurv gene promoter is located above the hTERT promoter relative to the start codon of the control gene, in the second case, the hTERT gene promoter is located above the hSurv promoter relative to the start codon of the control gene. The created promoters have high activity in human cancer cells, and the activity of the promoters exceeds the activity of the SV40 virus promoter. Promoters can have functional derivatives, that is, modifications of promoters as a result of deletion, replacement, insertion, or other mutations in the original promoter, which do not change or maintain a sufficiently high level of activity compared to the original promoter (examples 2 and 3, table 2).

The obtained promoters can be used for preferential transcription of various genes in cancer cells as part of an expression cassette. An expression cassette (EC), designed for the expression of therapeutic genes in mammalian cells, is a DNA fragment containing all the necessary genetic elements for the expression of genetic information embedded in it. The expression cassette, in the direction from the 5 ′ to the 3 ′ end, consists of 1) a promoter (s); 2) one or more genes, the expression of which is supposed to provide; 3) the polyadenylation signal required to complete transcription and post-transcriptional processing of RNA. The EC may also include additional elements that provide adjustment of the expression conditions of the gene of interest. Thus, to enhance expression of a therapeutic gene, a chimeric intron is sometimes used located between the promoter and therapeutic gene sequences (Gross MK and Kainz MS et al. (1987) Mol Cell Biol 7: 4576-81, Buchman AR and Berg P (1988) Mol Cell Biol 8: 4395-405). The polyadenylation signal used can also have an effect on the level of gene expression by affecting the stability of the synthesized transcript (Azzoni AR and Ribeiro SC (2007) J Gene Med 9: 392-402).

As genes controlled by tumor-specific promoters in expression cassettes, genes for therapeutic intervention of the following groups are usually used:

1. Negative dominant mutants (NDM) of genes involved in oncogenesis

2. Killer genes

3. Genes - angiogenesis inhibitors

4. Cancer suppressor genes

5. Genes immunostimulants

6. siRNA genes

1. Negative dominant mutants (NDM) of genes are used to suppress the action of protein genes involved in oncogenesis, such as oncogenes or apoptosis inhibitors. For example, the introduction of NDM of the mouse survivin gene into prostate cancer cells inhibits their growth (Pan L and Peng XC et al. (2011) J Cancer Res Clin Oncol 137: 19-28). The introduction of NDM of the c-Jun gene into the colon tumor leads to its partial regression (Suto R and Tominaga K et al. (2004) Gene Ther 11: 187-93). NDM of the oncogen RAS inhibits the development of a number of human cancer cell lines, such as cancer of the pancreas, colon, and tongue.

2. Killer genes are toxin genes (type I), as well as enzyme genes that can convert a non-toxic agent (prodrug) into a toxin that kills cancer cells (type II). The most effective type II genes are the herpes simplex virus thymidine kinase (HSVtk) and yeast or E. coli cytosine deaminase genes. Cytosine deaminase is an enzyme that catalyzes the hydrolytic deamination of 5-fluorocytosine to form 5-fluorouracil (5-FU), which kills cancer cells. The antitumor activity of the cytosine deaminase / 5-fluorouracil combination has been shown in animals with tumors such as fibrosarcoma (Mullen CA and Coale MM et al. (1994) Cancer Res 54: 1503-6), carcinoma (Huber BE and Austin EA et al. (1994) Proc Natl Acad Sci US A 91: 8302-6, Bentires-Alj M and Hellin AC et al. (2000) Cancer Gene Ther 7: 20-6, Huber BE and Austin EA et al. (1993) Cancer Res 53: 4619-26, Ohwada A and Hirschowitz EA et al. (1996) Hum Gene Ther 7: 1567-76, Kanai F and Lan KH et al. (1997) Cancer Res 57: 461-5), glioma (Ichikawa T and Tamiya T et al. (2000) Cancer Gene Ther 7: 74-82, Ge K and Xu L et al. (1997) Int J Cancer 71: 675-9) and others.

Herpes simplex virus thymidine kinase is capable of converting the non-toxic antifungal agent Ganciclovir (GCV) into toxic metabolites that, when integrated into the growing DNA chain of cancer cells during division, inhibit its synthesis, thereby leading to the death of the cancer cell. HSVtk / GCV is the only gene therapeutic combination that has reached the third phase of clinical trials (Immonen A and Vapalahti M et al. (2004) Mol Ther 10: 967-72, Evrard A and Cuq P et al. (1999) Int J Cancer 80 : 465-70). In phase I clinical trials, adenovirus carrying an HSVtk gene expression cassette was administered to eight patients with local recurrence of prostate cancer who had previously undergone hormonal therapy. Subsequent administration of GCV resulted in significant partial regression of the tumor (Nasu Y and Saika T et al. (2007) Mol Ther 15: 834-40).

Studies of a phase II clinical trial, in which a replicatively defective adenovirus was used as a vector for HSVtk, showed that the combined use of standard and gene therapy leads to a statistically significant increase in average survival: from 38 to 62 weeks (Immonen A and Vapalahti M et al. ( 2004) Mol Ther 10: 967-72).

3. The expression of genes - inhibitors of angiogenesis in tumor cells leads to the suppression of the formation of new blood vessels in the tumor in the tumor, leading to a slowdown in its growth and degradation due to insufficient intake of nutrients and oxygen. Angiogenesis inhibitors are angiostatin protein genes (inhibits the development of EL-4 lymphoma) and endostatin (kidney carcinoma, melanoma, colorectal carcinoma growth) (Sun X and Kanwar JR et al. (2001) Gene Ther 8: 638-45, Shi W and Teschendorff C et al. (2002) Cancer Gene Ther 9: 513-21, Cichon T and Jamrozy L et al. (2002) Cancer Gene Ther 9: 771-7).

4. Oncosuppressive genes play a key role in maintaining the stability of the cell genome and in regulating cell division and apoptosis (programmed cell death). Tumor cells suppress the work of tumor suppressor genes, etc. avoid apoptosis. The introduction of cancer suppressor genes into cancer cells inhibits their growth and death. The p53 protein is the most famous tumor suppressor. The world's first gene therapy drug, Gendicine ™ ’(Chinese Shenzhen SiBiono Genetechnologies), based on the non-replicating adenovirus that carries the p53 gene, was introduced into clinical practice in 2003 in China and is used to treat squamous cell carcinoma of the head and neck.

5. Immunostimulant genes are able to activate cells of the immune system. It is assumed that the introduction of these genes into cancer cells stimulates the immune system to recognize tumor cells. Examples of immunostimulant genes are IL-1, IL-2, IL-4, IL-6, TNF, GM-CSF, gamma interferon.

For example, the use of GM-CSF in combination with suicidal genes leads to an increase in the effectiveness of cancer therapy. Several studies have shown that tumor regression increases significantly with the combined use of the killer gene and GM-CSF (Hamilton JA (2002) Trends Immunol 23: 403-8, Hamilton JA and Anderson GP (2004) Growth Factors 22: 225-31) . Moreover, some studies have demonstrated the development of specific antitumor immunity after co-expression of HSVtk and GM-CSF in tumor cells (Guo SY and Gu QL et al. (2003) World J Gastroenterol 9: 233-7).

6. The introduction of siRNA genes into cancer cells makes it possible to suppress the expression of oncogenes and, as a result, induces cell death. For example, the introduction of siRNA into cancer cells to the human survivin gene as part of a recombinant plasmid inhibits the expression of the survivin gene, stimulates apoptosis of cancer cells and inhibits their proliferation.

Expression vectors are used to transport the therapeutic gene in the expression cassette into the cancer cell.

An expression vector is a nucleic acid molecule capable of transporting an expression cassette into a cell. Typically, an expression vector is a plasmid or other form of DNA or RNA that has the ability to autonomously replicate in certain cells. A vector molecule must possess some properties: 1) the vector must exist for a long time in a population of host cells, i.e. replicate autonomously or along with cell chromosomes; 2) in any vector there should be biochemical or genetic markers that would make it possible to detect its presence in the cells; 3) the structure of the vector molecule must allow the incorporation into it of a foreign nucleotide sequence without violating its functional integrity.

For the purposes of gene therapy, several types of vectors are used, distinguished by the method of delivery of genetic material. So, vectors are viral and non-viral. Currently, the method of delivering DNA to cancer cells using viruses is the most common. So, 76% of gene therapy tests are carried out with various kinds of viral vectors and 24% with non-viral vectors. A viral vector is a type of vector in which the genetic apparatus of a virus is used to deliver and implement the genetic information embedded in it. By the type of viral vectors used, retroviral, adenoviral, adeno-associated and herpesviral vectors are most often used (Balicki D and Beutler E (2002) Medicine (Baltimore) 81: 69-86, Kovesdi I and Brough DE et al. (1997) Curr Opin Biotechnol 8 : 583-9).

For replication and packaging of adenoviral DNA, only small sequences at both ends containing regions of the onset of replication and a sequence specific for DNA packaging are required. Therefore, almost the entire viral genome can be replaced by foreign DNA by growing a hybrid virus in the presence of a helper virus. One of the drawbacks of such a system is a certain difficulty in getting rid of the helper virus. When using retroviruses, viruses are usually used in which the structural protein and revertase genes are removed. The most progressive as delivery systems are vectors based on adeno-associated viruses, these viruses do not cause disease in humans and therefore are very promising from the point of view of safety of use. The disadvantages of this system are the small capacity for introducing genetic information which is limited to 4800 bp The advantage of viral systems is their high efficiency. The disadvantage is immunogenicity, as well as the complexity and high cost of production (Prestwich RJ and Errington F (2008) Clin Med Oncol 2: 83-96).

Plasmids that can be produced in large quantities in bacterial cultures are usually used as a vector for non-viral delivery.

The plasmid must have special sequences necessary for its production outside the body - the origin of replication, the antibiotic resistance gene, the multiple cloning site (MCS). In contrast to recombinant viruses, plasmids are quite simple to construct and produce in large quantities. In addition, plasmids provide a fairly high level of safety when used compared to viral vectors (Williams PD and Kingston PA (2011) Cardiovasc Res 91: 565-76).

In addition to plasmid and viral systems, other delivery systems have recently appeared. For example, bacterial delivery systems have been proposed that use the natural property of bacteria to accumulate in cancer cells.

Two approaches are used to deliver plasmid vectors to tumor cells.

The first is the conclusion of the plasmid into artificial lipid vesicles - liposomes that can penetrate through the plasma membrane. The second way is to create a DNA complex with a positively charged carrier, for example, polyethyleneimine or polycationic liposomes, however, large complexes are formed that are quite difficult to deliver inside the cell (Wagstaff KM and Jans DA (2007) Biochem J 406: 185-202) .

Peptides / proteins penetrating into the cells (CPP) are also used for delivery. These peptides / proteins, when complexed with DNA, provide direct delivery to cell nuclei (Wagstaff KM and Jans DA (2006) Curr Med Chem 13: 1371-87, Gupta B and Levchenko TS et al. (2005) Adv Drug Deliv Rev 57 : 637-51, Morris MC and Chaloin L et al. (2000) Curr Opin Biotechnol 11: 461-6, Wagstaff KM and Jans DA (2007) Biochem J 406: 185-202, WagstaffKM and Fan JY et al. (2008 ) FASEB J 22: 2232-42). CPPs do not have pronounced antigenic properties and are able to transfer large DNA molecules into the cell (Balicki D and Putnam CD et al. (2002) Proc Nati Acad Sci USA 99: 7467-71). Histone proteins can be used to deliver DNA to cell nuclei. The best activity with respect to the expression of the delivered genes is reported to be in histones H2A and H2B (Kaouass M and Beaulieu R et al. (2006) J Control Release 113: 245-54). The great advantage of histones over other gene delivery systems is their low toxicity.

In general, for effective non-viral delivery, a vector must possess a combination of properties such as the ability to form a complex with DNA, condense DNA into a more compact state, protect it from the action of nucleases, ensure efficient passage through cell and nuclear membranes, and not inhibit DNA transcription. Gene anticancer drugs can be administered to a patient intravenously, intraperitoneally, intratumor, subcutaneously or intramuscularly depending on the location of the tumor and the prevalence of the disease. An example of the effective use of intratumoral introduction of genetic constructs is the test of an adenoviral preparation containing the genes of bacterial cytosine deaminase and thymidine kinase of the herpes simplex virus - Ad5-CD / TKrep. The drug was injected into the prostate and then treated with 5-fluorocytosine and ganciclovir (Freytag SO and Khil M et al. (2002) Cancer Res 62: 4968-76). Subcutaneous and intravenous administration of genetic constructs were also used to treat prostate tumors (Small EJ and Carducci MA et al. (2006) Mol Ther 14: 107-17) (http://www.asco.org/ASCOv2/Meetings/Abstracts?&vmview = abst_detail_view & confID = 26 & ab stractID = 890).

In the treatment of malignant pleural mesotheliomas and lung cancer, intrapleural administration of constructs is used (Sterman DH and Recio A et al. (2005) Clin Cancer Res 11: 7444-53, Tan Y and Xu Metal. (1996) Anticancer Res 16: 1993-8) .

Often, a gene therapeutic drug is lyophilized DNA, since DNA in the form of lyophilized powder is the most convenient for storage and use as an injection. To prevent the loss of transfection activity of DNA during its lyophilization, mono and disaccharides, such as lactose, glucose and sucrose, are used as additives to the plasmid DNA solution before the lyophilization process. Sugars are also used in the lyophilization of DNA complexes and polycations.

Thus, the gene therapeutic pharmaceutical composition must contain: 1) an expression cassette as part of an expression vector that carries a therapeutic gene under the control of a promoter; 2) a carrier for allowing the expression vector containing the expression cassette to penetrate the cell membrane. The carrier may be a virus. In the case of a non-viral carrier, it must be positively charged (liposomes, polyethyleneimine and other polycations). Auxiliary components in the gene therapeutic pharmaceutical composition may be sugars (mono and disaccharides), buffers, antibacterial agents, and others.

Examples

The following examples are intended solely to illustrate certain preferred embodiments, but should not be construed as limiting the scope of the present invention.

Example 1. Creating a PhSurv269-pGL3 construct

Fragment 269 bp the proximal promoter region of the BIRC5 gene (survivin-Surv) was amplified by PCR using the human brain genomic DNA and synthesized primers (pSurv269For-BglII CGGAGATCTCGCGTTCTTTGAAAGCAGTCGTCGG.GCGG.GCGG.GCG.GTG). and containing restriction enzyme recognition sites BglII and HindIII (Fermentas, Canada). The obtained PCR product was intermediate cloned into the pAL-TA vector (Eurogen, Russia) and the obtained intermediate construct PhSurv269-pAL-TA was sequenced to exclude Taq polymerase errors (Eurogen, Russia). Next, the intermediate design of PhSurv269-pAL-TA was treated with BglII / HindIII rextractases, the desired insert of 269 bp isolated from agarose gel and cloned into the pGL3 vector, carrying the firefly luciferase reporter gene, also treated with BglII / HindIII rextractases. Next, the nucleotide sequence of the final PhSurv269-pGL3 construct was determined to exclude nucleotide substitutions (Figure 1).

Example 2. Construction of the PhSurv269 + 130-pGL3 construct, a functional derivative of the PhSurv269 promoter modified by the addition of an insertion

The PhSurv269 + 130 promoter was created, which is a functional derivative of the PhSurv269 promoter. The modified promoter differs from the original PhSurv269 promoter by the presence of an insertion of 130 bp in size. The insertion is located in the proximal position relative to the 5′-end of the PhSurv269 promoter and is a + 269 / + 399 fragment of the sequence of the native human survivin promoter. The insertion is located in the ″ direct ″ position, i.e. in the same orientation as in the native promoter.

Detail of the proximal promoter region BIRC5 gene (survivin, Surv) was amplified by PCR using as a template the genomic DNA of the human brain and synthesized primers (pSurv269 + 130For-BglII CATAGATCTATTTTTAGTAGAGACAAGGTTTCACCGTG and pSurv269 + 130Rev-HindIII CCCAAGCTTGCCGCCGCCGCCACCTCTG), containing recognition sites for restriction enzymes BglII and HindIII (Fermentas, Canada). The obtained PCR product was intermediate cloned into the pAL-TA vector (Eurogen, Russia) and the obtained intermediate construct PhSurv269 + 130-pAL-TA was sequenced to eliminate Taq polymerase errors (Eurogen, Russia). Next, the intermediate construct PhSurv269 + 130-pAL-TA was treated with BglII / HindIII restriction enzymes, the desired insert was isolated from agarose gel and cloned in pGL3 vector carrying the firefly luciferase reporter gene also treated with BglII / HindIII rextractases. Next, the nucleotide sequence of the final PhSurv269 + 130-pGL3 construct was determined to exclude nucleotide substitutions.

Example 3. Comparison of the activity of PhSurv269 + 130, modified by the addition of insertion, with the unmodified promoter PhSurv269

To compare the activity of the functional derivative of the promoter PhT269 (PhT269 + 130) and its unmodified variant PhT269, the following cancer cell lines of various genesis were used: Calu-1 (human lung carcinoma), A375 (human skin melanoma), A549 (human lung adenocarcinoma), PANC -1 (human pancreatic carcinoma), HepG2 (human hepatocellular carcinoma), LLC (Lewis epidermoid carcinoma of the lung).

The experiment was carried out as described in Example 9.

The relative activity of the studied promoters in different cell lines is shown in Table 1. As can be seen from table 1, the activities of the PhT269 and PhT269 + 130 promoters practically coincide in all the studied cell lines, while the activities of the PhT269 and PhT269 + 130 promoters differ in different cell lines, but in each cell line, the activities of these promoters are almost identical. Thus, the functional derivative of the PhT269 promoter has the same activity as the parent PhT269 promoter.

The data obtained allow us to conclude that it is possible to use functional derivative promoters characterized by almost the same or rather high activity compared to the original promoter.

Table 1 Relative activity of the studied promoters in various cell lines. The values represent the activity of promoters as the ratio of the luciferase activity of the studied promoters to the activity obtained with the plasmid PV-pGL3 containing only the SV40 promoter. The standard error of the mean (± SEM) was calculated from three independent experiments A375 A549 Calu1 Hepg2 PANC-1 LLC Pht269 2.26 ± 0.3 6.11 ± 2.6 9.11 ± 1.0 1.76 ± 0.3 2.96 ± 0.1 5.38 ± 0.3 PhT269 + 130 2.58 ± 0.4 5.93 ± 2.7 10.16 ± 1.4 1.71 ± 0.2 3.25 ± 0.1 5.38 ± 0.6

Example 4. Construction of expression vectors based on double promoters PhTSurv269 and PhSurv269T

A fragment of the promoter of the human survivin gene, PhSurv269 (SEQ ID NO: 1), 269 bp in length cloned into the construction of PhTERT-pGL3, obtained on the basis of the plasmid pGL3-basic (Promega, USA), carrying a fragment of the human telomerase reverse transcriptase promoter (PhTERT) and the firefly luciferase reporter gene. The PhSurv269 promoter was inserted into the PhTERT-pGL3 construct in a direct orientation in two positions relative to the PhTERT promoter (SEQ ID NO: 2). For this, cDNA of the promoter region of the human survivin gene of 269 bp was obtained. as a result of the hydrolysis of the plasmid PhSurv269-pGL3 with restriction enzymes BglII and HindIII, followed by treatment with a Klenov fragment. Then, the obtained PhSurv269 fragment was ligated with the PhTERT-pGL3 vector, preliminary linearized at the recognition site with the restriction enzyme HindIII, or at the recognition site with the restriction enzyme XhoI and processed with a large subunit of E. coli polymerase I DNA (Fermentas, Canada). Thus, in the first case, the vector PhTSurv269-pGL3 was obtained, carrying the luciferase gene under the control of the double promoter PhTSurv269, where the PhTERT promoter is higher than the PhSurv269 promoter relative to the start codon of the firefly luciferase gene. In the second case, a PhSurv269T-pGL3 vector was obtained in which the PhSurv269 promoter is located above the PhTERT promoter relative to the start codon of the luciferase gene. The structure of the expression cassettes obtained is illustrated in FIG.

Example 5. Construction of expression vectors based on the double promoters PhTmSurv and PmSurvhT

Fragment of a promoter of the mouse survivin gene (PmSurv) 197 bp (SEQ ID NO: 3), was cloned into the PhTERT-pGL3 construct, created on the basis of the pGL3-basic plasmid (Promega, USA) earlier, carrying the human telomerase reverse transcriptase promoter (PhTERT) and the firefly luciferase reporter gene. The PmSurv promoter was cloned into the PhTERT-pGL3 construct in a direct orientation in two positions relative to the PhTERT promoter. For this, mouse survivin cDNA (pmSurv) was obtained by hydrolysis of the plasmid PmSurv-pGL3 with HindIII restriction enzymes, followed by treatment with the Klenov fragment and NoiI (Fermentas, Canada). Then, the obtained fragment containing mouse survivin gene cDNA (420 bp) was ligated with the PhTERT-pGL3 vector, preliminary linearized at the recognition site with restriction enzyme XhoI and processed with a large subunit of E. coli polymerase I DNA, and then processed with NotI restriction enzyme. Thus, the vector PmSurvhT-pGL3 was obtained, carrying the luciferase gene under the control of the double promoter PmSurvhT, where the PhTERT promoter is located below the PmSurv promoter relative to the start codon of the firefly luciferase gene.

To obtain a plasmid carrying the luciferase gene under the control of the double PhTmSurv promoter, where the PhTERT promoter is higher than the pmSurv promoter relative to the start codon of the firefly luciferase gene, 243 bp human telomerase reverse transcriptase cDNA was obtained. as a result of the hydrolysis of the plasmid PhTERT-pGL3 with HindIII restriction enzymes, followed by treatment with a Klenov fragment and NotI. The resulting fragment containing PhTERT (437 bp) was ligated with the pmSurv-pGL3 vector pretreated with BglII restriction enzymes, followed by treatment with the Klenov fragment and NotI. Thus, the PhTmSurv-pGL3 vector was obtained, carrying the luciferase gene under the control of the double PhTmSurv promoter, where the PhTERT promoter is located above the PmSurv promoter relative to the start codon of the firefly luciferase gene.

Example 6. Construction of expression suicidal vectors based on the double cancer-specific promoter PhTSurv269: PhTSurv269-HSVtk and PhTSurv269-HSVtk-mGM-CSF

herpes simplex virus type 1 thymidine kinase gene cDNA (HSVtk) was cloned into the PhTSurv269-pGL3 construct based on the pGL3-basic plasmid (Promega, USA) carrying a double promoter consisting of a promoter region of the human telomerase reverse transcriptase gene (hTERT) and a shortened region human survivin (PhSurv269, coordinates -268 + 1 [where +1 is the adenine of the triplet encoding the initiating methionine]). HSVtk gene cDNA was inserted into the PhTSurv269-pGL3 construct in the forward orientation. For this, the PhTSurv269-pGL3 vector was treated with restriction enzymes NcoI / BamHI (Fermentas, Canada); as a result, the firefly luciferase gene cDNA sequence was completely removed. Plasmid PhSurv-HSVtk-pGL3, previously obtained, was digested with restriction enzymes NcoI / BamHI. Then, the obtained fragment containing the HSVtk sequence was ligated with the linearized vector PhTSurv269-pGL3. As a result, the PhTSurv269-HSVtk-pGL3 construct was obtained. The sequence of the obtained construct was confirmed by Sanger sequencing. The structure of the resulting expression cassette is illustrated in FIG. 3.

The HSVtk-IRES-mGM-CSF insert containing the herpes simplex virus type 1 thymidine kinase gene (HSVtk), IRES (human encephalomyocarditis virus ribosome planting site), and the mGM-CSF gene (granulocyte macrophage colony stimulating mouse factor) were cloned into construct No. TSGl2626 . The indicated fragment was cloned into the PhTSurv269-pGL3 construct in direct orientation. For this, the vector PhTSurv269-pGL3 was linearized by treatment with BamHI restriction enzyme in combination with the Klenov fragment and further with NcoI restriction enzyme. The HSVtk-IRES-mGM-CSF fragment was obtained by hydrolysis of the plasmid CMV-HSVtk-IRES-mGM-CSF-pGL3 with NcoI / XhoI restriction endonucleases with “blunting” the remainder of the XhoI site by the large Clenov subunit. The resulting DNA fragment was ligated into PhTSurv269-pGL3. As a result, the construct PhTSurv269-HSVtk-IRES-mGM-CSF-pGL3 was obtained. The sequence of the obtained constructs was confirmed by Sanger sequencing. The structure of the resulting expression cassette is illustrated in FIG. 4.

Example 7. The creation of expression vectors carrying the gene cassette FCU1-mGM-CSF under the control of the double promoter PhTSurv269

The design of PhTSurv269-FCU1-mGM-CSF consists of: 1) the promoter PhTSurv269; 2) a 133 bp chimeric intron located between the promoter and the FCU1 gene; 3) FCU1 gene cDNA (a fragment of the cytosine deaminase (FCY1) gene and a fragment of the uracil-phosphoribosyltransferase gene (UPRT, FUR1) from the body of Saccharomyces cerevisiae, coordinates 1002-2120 bp); 4) IRES (plot of the site of ribosome of the human encephalomyocarditis virus) and 5) cDNA of the mGM-CSF gene

To obtain the PhTSwv269-FCU1-mGM-CSF-pGL3 construct, the previously obtained plasmid pCMV-FCU1-pGL3 was linearized by treatment with restriction enzymes HindIII (followed by treatment with a Klenov fragment) and NotI (Fermentas, Canada). The PhTSurv269 insert was obtained by processing the vector PhTSurv269-pGL3 with restriction enzymes NcoI (followed by treatment with a Klenov fragment) and NotI (Fermentas, Canada). Then, the obtained fragment containing the PhTSurv269 promoter was subsidized with the linearized vector CMV-FCU1-pGL3. As a result, the PhTSurv269-FCU1-pGL3 construct was obtained. The sequence of the obtained construct was confirmed by Sanger sequencing.

The target construct PhTSurv269-FCU1-mGM-CSF (FIG. 5) was prepared as follows: the plasmid PhTSurv269-FCU1-pGL3 was digested with BamHI restriction enzyme (Fermentas, Canada), as a result, part of the FCU1 gene and the polyadenylation signal were removed from the vector. The insert FCU1 * (ahfuvtyn) -mGM-CSF was obtained by processing the vector pCMV-FCU1-IRES-mGM-CSF-pGL3 with BamHI restrictase. Then, the obtained fragment containing the FCU1, IRES, mGM-CSF gene fragment, and the polyadenylation signal were subsidized with the linearized vector PhTSurv269-FCU1-pGL3 (from which a portion of the FCU1 gene and the polyadenylation signal were cut). During ligation, the whole FCU1 gene was restored (the gene contains the BamHI restriction site). As a result, the PhTSurv269-FCU1-mGM-CSF-pGL3 construct was obtained. The sequence of the obtained construct was confirmed by Sanger sequencing.

Example 8. Creating a PhTSurv269-Cre construct

To enhance the tumor-specific expression of the hybrid cytosine deaminase / uracil phosphoribosyl transferase (FCU1) gene in tumor cells, we created a modified Cre-LoxP system. Two vectors were constructed: PhTSurv269-Cre-pQC (activator) and CMV-LoxP-Stop-LoxP-FCU1-pGL3 (effector).

The first, activation vector of the binary system carries the Cg recombinase gene with a nuclear localization signal, under the control of the tumor-specific promoter PhTSurv269 that we created. The second, effector, or killer, vector contains the cytomegalovirus (CMV) promoter, separated from the FCU1 ″ Stopw-CHraanoM gene, which consists of a tandem of three SV40 virus polyadenylation signals. In addition, the ″ Stop ″ signal on both sides is flanked by sequences located in the same orientation, recognized by the Cre protein — LoxP sites. The schematic diagram of enhancing the expression of the suicidal FCU1 gene using the Cre / LoxP system is shown in Fig.6.

The design of PhTSurv269-Cre was obtained on the basis of the plasmids PhSurv-Cre-pQXIX and PhTSurv269-pGL3 obtained previously.

The plasmid DNA PhSurv-Cre-pQXIX was hydrolyzed at recognition sites by BglII / NotI restrictase enzymes, then it was treated with a large Klenov subunit. The PhTSurv269 insert obtained by hydrolysis of the DNA of the plasmid PhTSurv269-pGL3 with XhoI / NcoI restrictase enzymes followed by treatment with a Klenov fragment was subsidized with the remaining vector part. Clones in the correct orientation were selected by PCR using specific primers complementary to the Cre recombinase gene (CreSeq-Rev!) And the PhSurv269 promoter (Surv269For). The correctness of the obtained construct was confirmed by determining the nucleotide sequence using specific primers UP-L1, Surv269For and CreSeq-F2.

Example 9. Determination of the activity of universal tumor-specific promoters PhTSurv269 and PhSurv269T in cancer cells

The following cancer cell lines of various genesis were used to test the activity of the obtained promoters: Calu-1 (human lung carcinoma), A375 (human skin melanoma), A549 (human lung adenocarcinoma) HT1080 (human fibrosarcoma), PANC-1 (human pancreatic carcinoma) )

Eukaryotic cells were cultured at 37 ° C in a CO ₂ incubator to achieve 90% confluency in a 25 cm ² culture vial. Next, solutions were prepared containing 9 μg of the plasmid from Examples 1, 4 or 5 or control plasmids BV-pGL3, PV-pGL3 and 1 μg of the normalization plasmid pRL-TK carrying the Remlla reniformis luciferase gene in 200 μl of Opti-MEM serum-free medium (Invitrogen , USA). Then, 200 μl of a solution of LFA2000 in Opti-MEM (25 μl of LFA + 175 μl of Opti-MEM) was added to the plasmid solution, incubated for 5 min at room temperature. Eukaryotic cells were incubated with the obtained lipoplexes for 3-4 hours depending on the cell line.

48 hours after the introduction of one of the constructs of Examples 1.4 or 5, the control plasmids BV-pGL3, PV-pGL3 and the normalization plasmid pRL-TK into the cells, the firefly luciferase and R. reniformis activity in the cell extracts was measured using the Dual- Luciferase Reporter Assay System (Promega, United States). Firefly luciferase activity values were normalized relative to the activity of R. reniformis luciferase of the plasmid pRL-TK in order to reduce the error associated with different efficiency of delivery of expression constructs to cells in a series of independent experiments. In order to increase the visibility and further reduce the experimental error, the data were normalized by the activity of the control structures BV-pGL3 and PV-pGL3.

The average luciferase activity and the standard error of the mean were calculated by the formula S _x-bar = (s ² / n) ^1/2 , where s is the total variance, n is the number of observations.

As a result of the analysis, it was found that the activity of the double tandem promoters PhTSurv269 and PhSurv269T exceeds the activity of single PhTERT and PhSurv269 promoters in all cell lines except the Calu-1 line. The relative activity of the studied promoters in different cell lines is shown in Figs. 7, 8 and Table 2. As can be seen from table 2, the activities of the double promoters PhTSurv269 and PhSurv269T approximately correspond to the sum of the activities of the individual promoters. This is especially true for the PhTSurv269 tandem. The activity of the PhSurv269T tandem is usually slightly lower than the activity of the PhTSurv269 tandem.

It was also shown that the activity of the PmSurvhT double promoter in cancer cells is 2-3 times higher than the activity of a single PmSurv promoter depending on the type of cell line (Fig. 7).

The data obtained allow us to conclude that the use of tandem promoters for gene expression is preferable than the use of each of the single promoters, and the PhTSurv269 tandem is preferable to the PhSurv269T tandem in terms of expression activity in different types of cancer cells (Fig. 8).

table 2 Relative activity of the studied promoters in various cell lines. The values represent the activity of promoters as the ratio of the luciferase activity of the studied promoters to the activity obtained with the plasmid PV-pGL3 containing only the SV40 promoter. The standard error of the mean (± SEM) was calculated from three independent experiments. The ″ + ″ sign in the first column means that the data was obtained by arithmetic addition. The average promoter activity was calculated for five cancer cell lines (Calu-1, A375, A549, PANC-1 and NT1080) as the sum of the activities in each line divided by 5. The far right column is normal lung fibroblasts. The first line shows p53 status cell lines, null - p53 protein is not expressed in the cell line, mut - mutant p53 protein, wt - wild type p53 protein Calu-1 A375 A549 PANC-1 HT1080 The average activity in cancer cells IVL-11NS P53 status null wt wt mut wt wt Phtert 0.80 ± 0.1 2.38 ± 0.2 1.68 ± 0.2 0.78 ± 0.1 1.23 ± 0.2 1.37 0.02 ± 0.002 Phsurv 6.31 ± 0.7 1.46 ± 0.2 1.15 ± 0.2 0.38 ± 0.1 0.84 ± 0.2 2.03 0.12 ± 0.014 PhSurv269 9.1 ± 1.0 2.20 ± 0.2 6.11 ± 2.7 2.98 ± 0.1 1.08 ± 0.3 4.38 0.19 ± 0.014 PhTERT + PhSurv269 10.85 ± 1.1 4.58 ± 0.4 7.79 ± 2.9 3.76 ± 0.2 2.31 ± 0.3 5.86 0.21 ± 0.016 PhTSurv269 8.80 ± 0.1 3.89 ± 0.8 10.91 ± 0.9 3.96 ± 0.2 5.47 ± 1.5 6.61 0.40 ± 0.034 PhSurv269T 3.96 ± 0.1 2.87 ± 0.2 8.97 ± 0.45 3.85 ± 0.1 3.68 ± 0.7 4.67 0.23 ± 0.04

Example 10. Comparison of the efficiency of the double promoters PhSurv269T and PhTSurv269 with the effectiveness of the double promoters PhTS and PhST, which we previously designed

The following cancer cell lines of various genesis were used to compare promoter activity: Calu-1 (human lung carcinoma), A549 (human lung adenocarcinoma) HT1080 (human fibrosarcoma), PANC-1 (human pancreatic carcinoma).

The experiment was carried out as described in Example 9. In Fig. 9, it can be seen that in all cell lines examined, the activity of the PhTSurv269 promoter is higher than the activity of single PhSurv, PhTERT promoters, as well as the activity of artificial double PhTS and PhST promoters.

Example 11. Detection of a hybrid protein of cytosine deaminase / uracil phosphoribosyl transferase (FCU1) using Western blot analysis in transfected cancer cells

At the first stage, cells of the S37 line were transfected with the genetic engineering constructs PhTSurv269-Cre // pCMV-STOP-FCU1 (cotransfection with the vectors pCMV-STOP-FCU1 and PhTSurv269-Cre). Cell transfection was carried out in T-25 culture bottles with Lipofectamine 2000 (″ Invitrogen ″, USA) according to the manufacturer's recommendations. For transfection, 10 μg of plasmid DNA was usually used. After lipofection, the cells were cultured in DMEM / F12 (1: 1) without antibiotics containing 10% fetal calf serum for 48 hours, then cell pellets were obtained for Western blot analysis.

As a comparison vector, we used the pCMV-FCU1 vector, in which the expression of the FCU1 gene was directed by the strong constitutive pCMV promoter. 48 hours after the introduction of the constructs, the cells were detached from the surface of the culture vials with a trypsin solution, then they were suspended in DMEM: F12 medium with antibiotics and the number of cells in the resulting suspension was determined using a Neubauer counting chamber, adding trypan blue in an aliquot of the cell suspension in the ratio 1: one. Then it was centrifuged for 5 minutes at 7 ° C and 160g, the cell pellets were washed twice with 1X phosphate-buffered saline (1.7 mM KH ₂ PO ₄ , 5.2 mM Na ₂ HPO ₄ , 150 mM NaCl) (see below).

Then the cells were suspended in the application buffer (the concentration of cells in the buffer should be 10 ⁷ cells / ml) and incubated for 5 minutes at 95 ° C.

The obtained cell lysates were subjected to denaturing protein polyacrylamide gel electrophoresis according to the Laemmli method (Laemmli U.K. (1970) Nature, Aug 15; 227 (5259): 680-5) followed by transfer of fractionated proteins from the gel to the membrane. The amount of FCU1 protein in the lysates (normalized by total protein) of the transfected cell line was analyzed using Western blot analysis. Sheep IgG (″ Abeam ″) binding to the N-terminal region of FCU1 protein was used as primary antibodies. Secondary antibodies to sheep IgG were conjugated to horseradish peroxidase (″ Santa-Cruz ″). To control the amount of protein in cell extracts, staining with antibodies to actin was used. The result of the Western blot analysis is shown in Fig.10.

In order to determine the most effective ratio of the effector vector and the activator vector, we transient transfections with the vectors PhTSurv269-Cre and pCMV-STOP-FCU1 in ratios by the amount of μg 2: 2 and 1: 3. The maximum amount of DNA that could be taken for transfection is 4 μg (according to the manufacturer's recommendations). The selected ratios of the effector (pCMV-STOP-FCU1) and activator (PhTSurv269-Cre) vectors describe two possible situations: 2: 2 - for the system to work effectively, an equal number of effector and activator vectors is needed; 1: 3 - to maximize the expression of the FCU1 gene, an excess of effector gene is required.

In S37 cell lysates transfected with the pCMV-FCU1 vector, the amount of FCU1 protein is greater than in cell lysates of the same lines co-transfected with the PhTSurv269-Cre // pCMV-STOP-FCU1 binary vector system in both ratios used, however, the activator / effector ratio 1: 3 seems to be somewhat preferable in terms of FCU1 protein production.

Example 12. Determination of cytotoxicity of the created system of vectors PhTSurv269-Cre // DCMV-STOP-FCU1

To determine the cytotoxicity of the PhTSurv269-Cre // pCMV-STOP-FCU1 system, the sensitivity of transfected S37 cells (mouse sarcoma) to 5-fluorocytosine (5-FC) was measured. To quantify the sensitivity of cells, the percentage of surviving cells was determined at various concentrations of 5-FC. By comparing the survival of cells transfected with the pCMV-FCU1 vector and transfected with the binary system of the PhTSurv269-Cre // pCMV-STOP-FCU1 vectors, we can draw conclusions about the effectiveness of the constructs from a therapeutic point of view.

Cells were transiently transfected with the following expression constructs: PhTSurv269-Cre // pCMV-STOP-FCU1 vector system (cotransfection, 2: 2 and 1: 3 ratio of the vectors by the amount of μg) and pCMV-FCU1 vector (positive control). Then, transfected cells were incubated for 120 h in a medium with various concentrations of 5-FC (0, 50, 200, 500, and 1000 μM). Non-transfected S37 cells were used as a control.

Cell survival was assessed using the MTS test according to the manufacturer's recommendations (Promega, USA). Transfection efficiency was determined by FACS analysis (Fluorescence-Activated Cell Sorting, FACS) of cells transfected with pEGFP reporter vector.

As a result of the experiments, it was shown that the effect of the PhTSurv269-Cre // pCMV-STOP-FCU1 vector system is comparable to the effect caused by the pCMV-FCU1 construct. At a concentration of 200 μM of 5-fluorocytosine in a cancer cell culture medium, 90% of the cancer cells die after treatment with the PhTSurv269-Cre // pCMV-STOP-FCU1 system (FIG. 11).

Example 13. Comparison of the cytotoxicity of Promoter-Cre // pCMV-STOP-FCU1 vector systems, where Promoter is PhSurv or PhTSurv269

To compare the cytotoxicity of the PhTSurv269-Cre // pCMV-STOP-FCU1, PhSurv-Cre // pCMV-STOP-FCU1 systems, S37 cells were transfected with the obtained systems and the control construct CMV-FCU1-pGL3, then the transfected cells were treated with a solution of 5-fluorocytosine of various concentrations and 196 hours after treatment, the percentage of surviving cells in each of the groups was measured and determined.

Cell survival was assessed using the MTS test according to the manufacturer's recommendations (Promega, USA). Transfection efficiency was determined by FACS analysis (Fluorescence-Activated Cell Sorting, FACS) of cells transfected with pEGFP reporter vector.

It was shown that the suicidal effect of the PhTSurv269-Cre // pCMV-STOP-FCU1 vector system is superior to the effect of the PhSurv-Cre // pCMV-STOP-FCU1 system and is comparable with the effect caused by the pCMV-FCU1 construct (Fig. 12).

Example 14. Determination of the transcriptional activity of double promoters PhTSurv269, PhTmSurv

Cells of the A375 line (human skin melanoma) were transfected with the constructs PhTSurv269-pGL3, PhTmSurv-pGL3 and the control construct PhTSurv-pGL3, 48 hours after the introduction of the constructs, the cells were harvested and the total RNA was isolated using the RNeasy Mini Kit (Qiagen, USA), then processed DNase I (Quiagen, USA) according to the manufacturer's protocols. The resulting total RNA was used for the synthesis of cDNA with a seed consisting of statistical hexamers (Perkin Elmer, USA). This cDNA was used to determine the presence of transcripts from the PhTERT, PmSurv, and PhSurv269 promoters in tandems. To determine the presence of transcripts from promoters, the semi-quantitative RT-PCR method described previously (Pleshkan VV and Vinogradova TV et al. (2008) Biochim Biophys Acta 1779: 599-605) was used.

To determine the presence of transcripts from the distal promoter of the PhTERT tandem, we selected a common primer TSL-F, which is located in the linker immediately after the studied PhTERT promoter and paired reverse primers for each of the survivin gene promoters: primer hS269_128R for the construction with the PhTSurvS262 promoter, construction for mTS128 promoter with the PhTmSurv promoter and hSurv_150R primer for the construction with the PhTS promoter. Reverse primers were located in the proximal promoter at a distance of not more than 150 bp from its 5′-end, obviously to the proximal promoter transcription initiation sites (FIG. 13). The products obtained as a result of the polymerase chain reaction were analyzed by agarose gel electrophoretic separation. For each construct, at least three independent RT-PCR results were analyzed.

As a result of the analysis, it was shown that in the constructs PhTSurv269-pGL3 and PhTmSurv-pGLS, the distal PhTERT promoter works, while transcripts of the distal PhTERT promoter in the PhTS-pGL3 construct are not detected (Fig. 14, дист distal ’panel).

To determine the presence of transcripts initiated from the proximal and / or both tandem promoters, another pair of primers was used. Used direct UPF primer located immediately after the proximal promoter and the reverse primer Luc_202R to it. Transcripts were detected both in the case of the PhTSurv269-pGL3 and PhTmSurv-pGL3 constructs, and in the case of the PhTS-pGL3 control construct (Fig. 14, “proximal” panel).

Thus, we showed that both promoters work in the studied constructs PhTSurv269-pGL3 and PhTmSurv-pGL3.

Example 15. Functional test for cytotoxicity of HSVtk, controlled by the double tandem promoter PhTSurv269, followed by treatment with ganciclovir

Eukaryotic cells were transfected in six-well plates with the PhTSurv269-HSVtk-mGM-CSF-pGL3 construct and the PhSurv-HSVtk-mGM-CSF-pGL3 control construct using Lipofectamine-2000 (Invitrogen, USA). 48 hours after transfection, a solution of ganciclovir (″ Cymeven, Roche ″, Switzerland) in DMEM / F12 medium (1: 1) with antibiotics at a concentration of 0, 12.5, 50 μM was added to the cells. 192 hours after the addition of ganciclovir, an MTS test was performed to determine the number of living cells (Promega, USA). The results of the experiment are shown in Fig.15. On the HT1080 cell line, it was shown that the survival of the control group of cells (untransfected cells) at a ganciclovir concentration of 0 to 50 μM was about 100%, the survival rate of cells transfected with the PhTSurv269-HSVtk-mGM-CSF-pGL3 construct was approximately in each group 2 times lower than the survival rate of cells transfected with the PhSurv-HSVtk-mGM-CSF-pGL3 construct.

Thus, in this experiment, it was shown that the use of the double tandem promoter PhTSurv269 to control therapeutic genes is more promising than the use of the full-sized survivin promoter.

Example 16. Functional test for cytotoxicity of FCU1, controlled by the double tandem promoter PhTSurv269, followed by treatment with 5-fluorocytosine

Eukaryotic cells of the Calu-1 line were transfected in 25 cm ² vials with the PhTSwv269-FCU1-mGM-CSF-pGL3 construct and the control constructs pCMV-FCU1-mGM-CSF-pGL3 and PhSurv-FCU1-mGM-CSF-pGL3 using Lipofect 2000 Invitrogen, USA). 48 hours after transfection, a solution of 5-fluorocytosine (Sigma-Aldrich, United States) in DMEM / F12 medium (1: 1) with antibiotics at a concentration of 0, 10, 50, 200, and 500 μM was added to the cells. 144 hours after the addition of 5-fluorocytosine, an MTS test was performed to determine the number of living cells (Promega, USA). The results of the experiment are shown in Fig.16. It was shown that the survival of the control group of cells (untransfected cells) at a concentration of 5-fluorocytosine from 0 to 500 μM was about 100%, the survival of cells transfected with the PhTSurv269-FCU1-mGM-CSF-pGL3 construct was lower than the survival of cells transfected construction PhSurv-FCU1-mGM-CSF-pGL3.

Thus, the use of the double tandem promoter PhTSurv269 to control therapeutic genes is more preferable than the use of the full-size promoter of survivin (PhSurv). In combination with the broader tumor specificity of the PhTSurv269 double tandem promoter, this is especially true.

Example 17. The determination of the amount of synthesized cytokine GM-CSF under the control of the double tandem promoter PhTSurv269

Eukaryotic cells were transfected in six-well plates with the PhTSurv269-HSVtk-mGM-CSF-pGL3 construct and the PhSurv-HSVtk-mGM-CSF-pGL3 control construct using Lipofectamine-2000 (Invitrogen, USA). 48 hours after transfection, conditioned media was collected to determine the amount of GM-CSF protein.

Determination of GM-CSF production in transfected cells was carried out by enzyme-linked immunosorbent assay of culture fluid using a commercial ELISA kit manufactured by R&D Systems (USA). The experimental results are shown in Table 3. It was shown that under the control of the PhTSurv269 promoter, using the PhTSurv269-HSVtk-mGM-CSF-pGL3 construct, 2.5-4 times more GM-CSF protein is synthesized depending on the cell line than under the control of the promoter PhSurv using the PhSurv-HSVtk-mGM-CSF-pGL3 construct.

Table 3 The number of mGM-CSF in ng produced by 10 ⁵ cells of the lines Calu-1, HT1080, LLC, transfected with constructs containing the HSVtk-mGM-CSF cassette under the control of the promoters CMV, PhSurv, PhTSurv269, per day Constructions Cell lines Calu-1 HT1080 LLC CMV 6.5 12.5 3.77 Phsurv 0.57 0.27 0.38 PhTSurv269 1.43 1.097 0.41

Example 18. Determination of the amount of synthesized cytokine GM-CSF construct PhTSurv269-FCU1-mGM-CSF-pGL3

Eukaryotic cells of the Calu-1 line were transfected with the constructs PhTSurv269-FCU1-mGM-CSF-pGL3, PhSurv-FCU1-mGM-CSF-pGL3 and the control construct CMV-FCU1-mGM-CSF-pGL3 using Lipofectamine-2000 (Invitrogen, USA). 48 hours after transfection, conditioned medium was collected to determine the amount of mGM-CSF protein.

Determination of mGM-CSF production in transfected cells was carried out by enzyme-linked immunosorbent assay of culture fluid using a commercial ELISA kit manufactured by R&D Systems (USA). The experimental results are shown in Table 4. It was shown that under the control of the PhTSurv269 promoter, using the PhTSurv269-FCU1-mGM-CSF-pGL3 construct, 2.6 times more GM-CSF protein is synthesized depending on the cell line than under the control of the PhSurv promoter when using the construction of PhSurv-FCU1-mGM-CSF-pGL3.

Table 4 The amount of mGM-CSF in ng produced by 10 ⁵ cells of the Calu-1 line transfected with constructs containing the FCU1-mGM-CSF cassette under the control of the CMV, PhSurv, PhTSurv269 promoters, per day Constructions Cell line Calu-1 CMV 1.05 Phsurv 0.007 PhTSurv269 0.02

Example 19. Determination of the amount of HSVtk synthesized by constructs PhTSurv269-HSVtk-mGM-CSF-pGL3 and PhSurv-HSVtk-mGM-CSF-pGL3

At the first stage of operation, cells were transfected in T-25 culture bottles with Lipofectamine 2000 (″ Invitrogen ″, USA) according to the manufacturer's recommendations. For transfection, 10 μg of plasmid DNA was usually used. After lipofection, the cells were cultured in DMEM / F12 medium (1: 1) without antibiotics containing 10% fetal calf serum for 48 hours, then the cells were detached from the surface of the culture vials with trypsin solution, then suspended in DMEM: F12 medium with antibiotics and the number of cells in the resulting suspension was determined using a Neubauer counting chamber by adding 1: 1 trypan blue to an aliquot of the cell suspension. Then it was centrifuged for 5 minutes at 7 ° С and 160g, the cell pellets were washed twice with IX phosphate-buffered saline (1.7 mM KH ₂ PO ₄ , 5.2 mM Na ₂ HPO ₄ , 150 mM NaCl). Then the cells were suspended in the application buffer and incubated for 5 minutes at 95 ° C. Protein samples normalized by concentration were fractionated by electrophoresis in 12-13% SDS page under denaturing conditions. A set of proteins with molecular weights of 6.5-200 kDa was used as a marker. After fractionation into PAG, the proteins from the gel were transferred onto a PVDF Immobilon-P membrane (Millipore, England) using a Bio-Rad Trans-Blot SD cell. The membrane was pre-treated with methanol for 1 min, washed with bidistilled water for 3 minutes and placed in a transfer buffer. The membrane was then incubated with antibodies to the herpes simplex virus thymidine kinase HSV-tk (SC-28038) and GAPDH (SC-47724) (Santa Cruz Biotechnology, USA) at a dilution of 1: 1000 for 16 hours. Then the membrane IX was washed with phosphate-buffered saline (PBS) containing 0.5% Tween-20, 4 times for 10 minutes. The membrane was then incubated with donkey secondary antibodies conjugated to horseradish peroxidase against goat immunoglobulins in the case of HSV-tk protein and goat antibodies against mouse immunoglobulins in the case of GAPDH protein (SC-2302) (″ Santa Cruz Biotechnology ″, USA) in dilution 1: 1000 and washed as described above. Proteins on the membrane were detected by the chemiluminescent method using reagents from Bio-Rad (USA). The calculation of the amount of protein was performed using the Quantity One 4.6.1 program (″ Bio-Rad ″, USA). The results of the experiment are shown in Fig.17. It can be seen that the amount of HSVtk generated under the control of the PhTSurv269 double promoter (lane 3) is higher than the amount of HSVtk produced under the control of the PhSurv promoter (lane 2).

Example 20. Comparative analysis of the effectiveness of the following promoters: CMV (cytomegalovirus promoter), human survivin gene promoter (PhSurv), artificial double promoter (PhTSurv269) ex vivo in mice

To compare the efficacy of the CMV, PhSurv, and PhTSurv269 promoters based on the pGL3 vector (Promega, USA), constructs containing the HSVtk-mGM-CSF therapeutic gene cassette under the control of these promoters were created. The following constructs were created CMV-HSVtk-mGM-CSF-pGL3, PhSurv-HSVtk-mGM-CSF-pGL3, PhTSurv269-HSVtk-mGM-CSF-pGL3 (the construction of the vector is described in Example 4). The HSVtk-mGM-CSF therapeutic gene cassette contained the herpes simplex virus thymidine kinase gene (HSVtk). The product of this gene is able to phosphorylate ganciclovir, a low-toxic guanine analogue. Cells transformed with HSVtk die in the presence of ganciclovir, since cell kinases convert phosphorylated ganciclovir to triphosphates, which, when cell divides, are incorporated into newly synthesized DNA and terminate its further synthesis. The product of the granulocyte-macrophage colony-stimulating factor gene (GM-CSF) gene is capable of activating the growth, development and differentiation of granulocytes and macrophages, thereby stimulating the immune response.

In the experiment were used:

1) Mice (females) of the C57B1 / 6 line, the average weight at the beginning of the experiment was 17.9 ± 1.4 (hereinafter the mean ± standard error of the mean) were kept on standard granular dry food.

2) Cell line LLC (Lewis mouse lung carcinoma).

3) Constructions CMV-HSVtk-mGM-CSF-pGL3, PhSurv-HSVtk-mGM-CSF-pGL3, PhTSurv269-HSVtk-mGM-CSF-pGL3.

LLC cells were transfected into culture vials (75 cm ² ) with plasmids CMV-HSVtk-mGM-CSF-pGL3, PhSurv-HSVtk-mGM-CSF-pGL3, PhTSurv269-HSVtk-mGM-CSF-pGL3, untransfected cells were used as control. For transfection, 30 μg of plasmid DNA and 75 μl of Lipofectamine-2000 per culture plate were used. Transfection was carried out for 3 hours, 24 hours after transfection, the cells were detached from the surface of the culture vial using trypsin solution and suspended in antibiotic DMEM / F12 medium, the cells were transferred to vials and centrifuged (1000 rpm, 160g,) for 5 min. Then the cells were washed twice with PBS and a suspension of LLC cells was prepared in PBS at a concentration of 2 × 10 ⁵ cells / ml for administration to animals.

Cell transplantation into female C57B1 / 6 mice was performed on day 1 subcutaneously in the back of the back in an amount of 2 · 10 ⁵ cells in 100 μl of PBS. 48 hours after tumor inoculation, ganciclovir (GCV) solution was started intraperitoneally for 10 days at the rate of 75 μg per gram of weight (2 injections of 100 μl per 1 mouse per day, ganciclovir concentration 5 mg / ml) 2 times a day.

Starting from the 5th day after cell transplantation, the tumor size was measured in 2 dimensions (smaller (A) and larger (B) tumor diameter) using an electronic caliper and animal mass. Tumor size was calculated according to the formula A · B ^2/2. Tumor diameters were measured every other day. The criterion for euthanasia was the achievement of a tumor larger than 10% by weight of the animal.

In total, 4 groups of animals were formed: 1) mice with transplanted LLC cells transiently transfected with the CMV-HSVtk-mGM-CSF-pGL3 construct, 2) mice with transplanted LLC cells transiently transfected with the PhSurv-HSVtk-mGM-CSF-pGLS construct, 3 ) mice with transplanted LLC cells transiently transfected with the PhTSurv269-HSVtk-mGM-CSF-pGL3 construct; 4) a control group (non-transfected LLC cells). Each group consisted of 10 animals. Animals were evenly distributed in groups according to their weights.

The results of the experiment are shown in Figs. 18 and 19. As can be seen in Figs. 18, 19, tumor growth in the control group begins on the 10th day of the experiment, while in the experimental groups the tumor appears in animals only on the 20th day from the beginning of the experiment. The average tumor size on the 20th day of the experiment in the control group was 1343 mm ³ , which was the basis for removing the animals from the group from the experiment (the tumor mass in animals exceeded 10% of body weight). On day 36 of the experiment, in the CMV group, the tumor was palpated in 1 out of 10 animals, in the PhSurv group - in 2 animals, in the PhTSurv269 group, no animals with palpable tumors were observed. Thus, the created artificial tandem promoter PhTSurv269 in the system with therapeutic genes HSVtk-mGM-CSF is highly efficient. It is tumor-specific, unlike the CMV promoter, and is active in a wider range of cancer cell lines than the PhSurv promoter.

Free text sequence listing:

SEQ ID NO: 1 -

Human survivin gene promoter fragment sequence (PhS269, positions -268 to +1, beat +1 corresponds to adenin of an initiating methionine encoding triplet)

SEQ ID NO: 2 -

Human reverse transcriptase telomerase gene promoter fragment sequence (hTERT)

SEQ ID NO: 3 -

Murine survivin gene promoter fragment sequence

SEQ ID NO: 4 -

PhTSurv269 promoter sequence

SEQ ID NO: 5 -

PhSurv269T promoter sequence

SEQ ID NO: 6 -

PhTmSurv promoter sequence

SEQ ID NO: 7 -

PmSurvhT promoter sequence

Claims (29)

1. Tumor-specific promoter containing:
A) the nucleotide sequence of SEQ ID NO: 2 or its functional derivative; and
B) a nucleotide sequence selected from the group consisting of:
(i) the nucleotide sequence of SEQ ID NO: 1 or a functional derivative thereof; and
(ii) the nucleotide sequence of SEQ ID NO: 3 or its functional derivative,
connected directly or via a linker sequence. 2. The promoter according to claim 1, in which the sequence of SEQ ID NO: 2 is located higher (in the 5′-direction) relative to the sequence of SEQ ID NO: 1 or SEQ ID NO: 3. 3. The promoter according to claim 1, in which the sequence of SEQ ID NO: 2 is located lower (in the 3′-direction) relative to the sequence of SEQ ID NO: 1 or SEQ ID NO: 3. 4. The promoter according to any one of the preceding paragraphs, which further comprises a linker sequence between the sequence according to subparagraph A) and the sequence according to subparagraph B). 5. The promoter according to claim 2, the sequence of which is presented in SEQ ID NO: 4 or SEQ ID NO: 5. 6. The promoter according to claim 3, the sequence of which is presented in SEQ ID NO: 6 or SEQ ID NO: 7. 7. An expression cassette for the directed expression of antitumor agents in tumor cells, containing in the direction from 5 ′ to 3 ′ a promoter according to any one of claims 1 to 6, connected to a coding DNA sequence, which upon transcription produces information RNA encoding an antitumor agent. 8. The expression cassette according to claim 7, in which the coding sequence encodes therapeutic proteins or peptides, antigens, antisense RNA or ribozymes with antitumor activity. 9. The expression cassette of claim 8, in which the coding sequence includes therapeutic intervention genes selected from the group consisting of: negative dominant mutants (NDM) of genes involved in oncogenesis; killer genes; angiogenesis inhibitor genes; cancer suppressor genes; immunostimulant genes; siRNA genes. 10. The expression cassette of claim 8, in which the negative dominant mutants (NDM) of the genes are selected from the group comprising the NDM of the survivin gene, the NDM of the c-Jun gene, the NDM of the RAS oncogen. 11. The expression cassette of claim 8, wherein the killer genes are selected from the group comprising toxin genes and enzyme genes capable of converting a non-toxic agent (prodrug) to a toxin. 12. The expression cassette of claim 11, wherein the genes of enzymes capable of converting a non-toxic agent (prodrug) to a toxin are selected from the group consisting of the herpes simplex virus thymidine kinase gene and yeast or E. coli cytosine deaminase. 13. The expression cassette of claim 8, in which the angiogenesis inhibitor genes are selected from the group comprising angiostatin and endostatin protein genes. 14. The expression cassette of claim 8, wherein the cancer suppressor genes are selected from the group comprising the p53 protein gene. 15. The expression cassette of claim 8, in which the immunostimulant genes are selected from the group comprising the genes IL-1, IL-2, IL-4, IL-6, TNF, GM-CSF, gamma interferon. 16. The expression cassette of claim 8, wherein the siRNA genes are selected from the group comprising siRNA to the survivin gene. 17. An expression vector comprising an expression cassette according to any one of claims 7-16. 18. The expression vector according to 17, which is a viral vector. 19. The expression vector of claim 18, wherein the vector is selected from the group consisting of retroviral, adenovirus, adeno-associated, herpes virus vector. 20. The expression vector according to 17, which is a non-viral vector. 21. The expression vector according to claim 20, where the vector is selected from the group comprising a plasmid. 22. A pharmaceutical composition for treating cancer, comprising a therapeutically effective amount of an expression cassette according to any one of claims 7-16 or a vector according to any one of claims 17-21 and a pharmaceutically acceptable excipient. 23. The pharmaceutical composition according to item 22, intended for the treatment of cancer. 24. The pharmaceutical composition according to item 23, where the disease is selected from the group including: lung cancer, pancreatic cancer, melanoma, fibrosarcoma, sarcoma. 25. A method of treating cancer, comprising administering to a patient a pharmaceutical composition according to any one of claims 22-24. 26. The treatment method according A.25, where the pharmaceutical composition is administered intravenously, intratumor, intramuscularly, intraperitoneally, subcutaneously, orally. 27. The treatment method according to any one of paragraphs.25-26, where the cancer is selected from the group including: lung cancer, pancreatic cancer, melanoma, fibrosarcoma, sarcoma. 28. The use of an expression cassette according to any one of claims 7-16 or a vector according to any one of claims 17-21 for the manufacture of a medicament for the treatment of cancer. 29. The application of claim 28, wherein the cancer is selected from the group consisting of: lung cancer, pancreatic cancer, melanoma, fibrosarcoma, sarcoma.

Images