RU2538169C1 - RECOMBINANT PLASMID DNA pET40CmAP/MBL-T CODING HYBRID BIFUNCTIONAL POLYPEPTIDE CmAP/MBL-T WITH PROPERTIES OF HIGH-ACTIVITY ALKALINE PHOSPHATASE CmAP AND MANNAN-BINDING LECTIN OF C-TYPE MBL-T, RECOMBINANT STRAIN E coli Rosetta(DE3)/pET40CmAP/MBL-T - PRODUCER OF HYBRID BIFUNCTIONAL POLYPEPTIDE CmAP/MBL-T, AND METHOD FOR ITS OBTAINING - Google Patents

Abstract

FIELD: biotechnologies.

SUBSTANCE: invention represents plasmid pET40CmAP/MBL-T determining a synthesis of hybrid bifunctional polypeptide CmAP/MBL-T with properties of high-activity alkaline phosphatase of sea bacterium Cobetia marina (CmAP) and mannan-binding lectin of C-type of far-eastern trepang Apostichopus japonicus (MBL-T). The plasmid includes NcoI/SalI - a fragment of plasmid pET-40b(+) (Novagen) and a DNA fragment with size of 2034 pairs of bases, which is a chimeric gene coding structural genes of alkaline phosphatase CmAP and mannan-binding lectin of C-type MBL-T, which are connected to each other with a polynucleotide coding the amino acid sequence of linker (G)₄S(G)₄S(G)₄SEL. The invention describes recombinant strain E.coli Rosetta(DE3)/pET40CmAP/MBL-T transformed by the above plasmid - a producer of hybrid bifunctional protein CmAP/MBL-T. The invention also proposes a method for obtaining hybrid bifunctional protein CmAP/MBL-T using the proposed strain.

EFFECT: invention allows obtaining the specified highly purified preparation of a hybrid protein with properties of recombinant high-activity alkaline phosphatase CmAP and highly specific mannan-binding lectin of C-type MBL-T with regard to carbohydrate components of glycoproteins of cancer cells of uterine cervix and can be used for a high-sensitivity lectin-immunoferment method of early differential diagnostics of cervical cancer.

3 cl, 2 dwg, 3 ex

Description

The invention relates to biotechnology, in particular to genetic engineering, and allows microbiological synthesis using optimized technology to obtain a new hybrid bifunctional polypeptide CmAP / MBL-T with the properties of highly active alkaline phosphatase of a marine bacterium and highly specific cervical tumor markers of C-type mannan-binding lectin Far Eastern trepang, which can be used for early differential diagnosis of cervical cancer, as well as for studying the mechanisms of carcinogenesis in practice tion oncology.

Data on the carbohydrate specificity of pectins and their ability to detect carbohydrate determinants in the composition of glycoconjugates of tumor cells, especially metastatic ones, are widely used in oncology. Lectins are used as a tool for studying the transformation of normal cells into malignant [1-3]. The information obtained, in turn, is an integral part of the study of the mechanism of carcinogenesis. The most interesting from this point of view are pectins with highly directed carbohydrate specificity. We have shown that such pectins include mannan-binding C-type lectin of the Far Eastern trepang Apostichopus japonicus (MBL-T) [4]. Lectin MBL-T does not interact with the components of the blood serum of a healthy person, which is extremely important when used in various diagnostic studies, in particular, using immunocytochemistry methods, which avoids false-positive results and obtain reliable information about structural changes in the carbohydrate chains of glycoconjugates, accompanying pathological changes. The results of studies of the carbohydrate profile of glycoconjugates with pectins find practical application in the development of cancer diagnostic methods [5-7].

The use of pectins for the diagnosis of cancer is implemented in two main directions. The first direction is carried out when pectins identify the carbohydrate determinants of the studied markers in the blood serum on the solid phase or in the gel (lectin-enzyme, lectin-immunoenzyme, lectin-immune methods), and the second direction is the interaction of lectins with the corresponding ligands expressed on the cell surface, obtained by swabs, isolation from the blood, as well as on sections of biopsy material.

A classic example of the prospects of using lectins in diagnostics is the commercial kit of the Japanese company WAKO, which allows for early and differential diagnosis of liver cancer, liver cirrhosis and pregnancy. The method is based on the ability of LCA-A lectins (Lens culinaris agglutinin A - lectin isolated from lentil beans) and PHA-E4 (phaseolus vulgaris isolectin E-4 - lectin isolated from common bean beans) to detect carbohydrate isoforms of alpha-fetoproteins (A ) in blood serum. The method is highly sensitive and informative even at an AFP concentration of 5 ng / ml. The volume of the test sample is 3 μl, the analysis time is 3 hours, the number of simultaneously analyzed samples is 10. The method allows detecting relapse of tumor growth 2-3 months before the first clinical symptoms due to its high sensitivity.

The uniqueness of the carbohydrate specificity of MBL-T lectin of the Far Eastern trepang and the prospects of its use as a diagnostic marker are confirmed by the results of experiments on interaction with cancer embryonic antigens. Trepangin lectin showed the ability to interact with tumor growth markers such as alpha-fetoprotein, cancer embryonic antigen, embryonic alpha-1-acid glycoprotein, embryonic alpha-2-globulin.

Based on the presence of a unique carbohydrate-recognizing domain in MBL-T lectin, which determines its ability to recognize the microheterogeneity of glycoconjugates of cancer and normal cells, the applicant has developed a new method for the diagnosis of cervical cancer [8].

Determining the concentration of pectin-related structures in epithelial secretion is a fundamentally new approach in the detection of malignant neoplasms. However, such an analysis requires an increase in efficiency along with the simplicity of the method. This is possible using genetic engineering methods. Molecular cloning methods have been used to establish the structure of the Far Eastern trepang lectin MBL-T [GenBank, access code AAT42221] and alkaline phosphatase of the marine bacteria CmAP [GenBank, access code ABD92772]. Known 3 method for producing highly active recombinant alkaline phosphatase of the marine bacteria CmAP [9].

The objective of the invention is the construction of a recombinant producer strain of Escherichia coli, carrying such an expressing construct (plasmid), which will allow to produce the target highly purified non-degraded hybrid bifunctional CmAP / MBL-T polypeptide in preparative quantities, while maintaining the immunogenic properties of highly specific MBL-T lectin, and the enzymatic properties of the highly active alkaline phosphatase of the marine bacteria CmAP, used for color visualization of lectin-associated complexes in ektin-ELISA method for early diagnosis of cervical cancer.

The problem is solved by constructing a recombinant plasmid DNA pET40CmAP / MBL-T encoding the chimeric CmAP / MBL-T polypeptide and a recombinant E. coli Rosetta strain (DE3) / pET40CmAP / MBL-T, providing inducible synthesis with high and stable yield of active soluble bifunctional protein CmAP / MBL-T, which has the properties of highly active alkaline phosphatase of the marine bacteria CmAP and highly sensitive mannan-binding lectin C-type Far Eastern trepang MBL-T.

The technical result of the claimed invention is the preparation of an active hybrid bifunctional CmAP / MBL-T polypeptide with the properties of highly active alkaline phosphatase CmAP and highly sensitive mannan-binding C-type lectin of the Far Eastern trepang MBL-T with a high yield and level of purification.

Plasmid pET40CmAP / MBL-T has 8194 base pairs (bp) and is characterized by the presence of an NcoI / SalI fragment of plasmid pET-40b (+) (Novagen) and a 2034 bp DNA fragment sequence containing a chimeric gene starting translation from alkaline phosphatase CmAP (N-terminus) and ending with C-type MBL-T mannan-binding lectin from the C-terminal portion of the recombinant protein molecule connected to alkaline phosphatase by a flexible linker (G) 4S (G) 4S (G) 4SEL.

The figure 1 presents the physical map of the plasmid pET40CmAP / MBL-T and the region of the plasmid responsible for the expression of the hybrid protein CmAP / MBL-T. The nucleotide sequence of the pET40CmAP / MBL-T plasmid fragment flanked by the NcoI and SalI sites contains the CwAP structural gene sequence corresponding to the open reading frame for the StAP protein, the linker linker sequence (G) 4S (G) 4S (G) 4SEL, and the MBL structural gene sequence -T corresponding to the open reading frame for the MBL-T protein (SEQ ID N1).

The recombinant E. coli Rosetta (DE3) / pET40CmAP / MBL-T strain was obtained by transforming E.coli Rosetta (DE3) (Novagen) cells with the pET40CwAP / MBL-T plasmid using traditional genetic engineering technology [10].

The recombinant E. coli Rosetta (DE3) / pET40CmAP / MBL-T strain is characterized by the following features.

Cultural and morphological characters.

The cells of the strain form large round with smooth edges, convex colonies up to 5 mm in diameter, the surface of the colonies is smooth, the mucous consistency. The pigment does not accumulate. Gram-negative, do not form a spore, do not have capsules. Colonies grow well on simple nutrient media (LB). When growing in liquid media, they form an intense smooth haze.

Physico-biological signs.

The recombinant strain of E. coli Rosetta (DE3) / pET40CmAP / MBL-T is speciesotypic in its biochemical properties. The strain does not have gelatinase activity, does not ferment lysine; breaks down glucose, lactose, mannitol, sucrose to acid and gas. It has a mutation in the lac gene, which provides control of the expression level, as well as the translation of rare codons. The optimum temperature for growth is 37 ° C, and for the production of protein CmAP / MBL-T -16 ° C.

Antibiotic resistance.

The cells of the strain are resistant to chloramphenicol (34 μg / ml) and kanamycin (25 μg / ml).

Pathogenicity and toxicity.

The recombinant E. coli Rosetta strain (DE3) / pET400CmAP / MBL-T is neither pathogenic nor toxic to warm-blooded animals.

The strain is stored in the usual way in suspension with glycerol (30%) at -20 ° C.

The inventive method of obtaining a hybrid bifunctional protein CmAP / MBL-T is to cultivate cells of a strain of E. coli Rosetta (DE3) / pET40CmAP / MBL-T in a liquid nutrient medium LB for 12 h at 16 ° C, then the bacterial cells are precipitated by centrifugation, suspension cells are disintegrated in a buffer, then the extract is centrifuged, then the supernatant is placed on a column with an ion-exchange resin, then the protein is eluted, then the protein eluate is placed on a column with a metal-affinity resin, then the active fractions are concentrated on an ion-exchange resin and pour the desired product by gel filtration.

The yield of the recombinant bifunctional hybrid protein CmAP / MBL-T as a result of using the described method is at least 10 mg of recombinant protein with 1 liter of culture with a specific alkaline phosphatase activity of at least 10,000 u / mg protein and immunogenic properties of C-type mannan-binding lectin characteristic for the natural analogue of MBL-T [4, 8].

The recombinant bifunctional hybrid protein CmAP / MBL-T has a molecular weight of 105.5 kDa, including a DsbC plasmid chaperone with a molecular weight of 32.5 kDa, a wide range of temperature values (25-37 ° C) and pH (7.5-9.5 ) for the manifestation of phosphatase activity and affinity properties of lectin in the presence of 2 mm Ca ^{2+ ions} . The plasmid chaperone Dsb does not significantly contribute to the functional ability of both parts of the CmAP / MBL-T chimera; therefore, the step of removing it from the recombinant protein using enterokinase at the restriction site provided by the genetic design is not necessary.

The recombinant hybrid bifunctional CmAP / MBL-T polypeptide was successfully used in preclinical trials of the ability of the lectin component of the chimera to bind to mucin, cancer-embryonic antigen (CEA), and other tumor markers by enzyme-linked immunosorbent assay. The use of mannan-binding lectin in the composition of the hybrid bifunctional CmAP / MBL-T polypeptide with alkaline phosphatase activity reduces the stages and time of enzyme-linked immunosorbent assay, which were previously required to obtain lectin and enzyme conjugates.

Figure 2 presents the results of enzyme-linked immunosorbent assay (ELISA) performed on a mucin sensitized microplate using a hybrid bifunctional CmAP / MBL-T polypeptide obtained from different colonies of the transgenic E. coli Rosetta strain (DE3) / pET40 CmAP / MBL -T. The affinity level of the recombinant hybrid bifunctional CmAP / MBL-T polypeptide was determined by the concentration of pectin-associated complexes with mucin (along the X axis). Lectin-bound complexes were visualized by measuring the phosphatase activity of the recombinant hybrid bifunctional CmAP / MBL-T polypeptide (along the Y axis).

Significant advantages of the proposed method for producing a hybrid bifunctional CmAP / MBL-T polypeptide are:

the use of a recombinant producer strain E. coli Rosetta (DE3) / pET40CmAP / MBL-T, which allows to obtain a large amount of highly active bifunctional hybrid protein CmAP / MBL-T during biosynthesis;

the use of a simple three-stage chromatographic purification of recombinant protein, which allows to obtain a pure hybrid CmAP / MBL-T polypeptide in a short time and with low losses.

A method for producing a functionally active hybrid CmAP / MBL-T polypeptide based on the use of a chimeric gene encoding the alkaline phosphatase of the marine bacteria CmAP and C-type mannan-binding lectin of the Far Eastern trepang MBL-T is illustrated by the following examples.

Example 1. Construction of the plasmid pET40CmAP / MBL-T.

Recombinant plasmid pET40CmAP / MBL-T containing the chimeric gene encoding the full-sized alkaline phosphatase CmAP and the full-size mannan-binding lectin C-type MBL-T, connecting through a flexible linker (G) 4S (G) 4S (G) 4SEL, flanked by restriction sites NcoI and SalI are constructed based on the commercial plasmid pET-40b (+) (Novagen).

A DNA fragment containing the chimeric gene of the hybrid CwAP / MBL-T polypeptide is obtained in two stages. At the first stage, a polymerase chain reaction is carried out using the 40Pho plasmid as a template to obtain the StAP alkaline phosphatase gene and X-PhoN_F and Pho40X-SacI-R primers, where X-PhoN_F is a primer specific for the N-terminal CmAP sequence, including restriction enzyme site NcoI; Pho40X-SacI-R is a reverse primer specific for the C-terminal CmAP sequence, including a polynucleotide encoding the (G) 4S (G) 4S (G) 4SEL linker and the SacI restriction site:

X-PhoN_F: 5'-TATTCCATGGCAGAGATCAAGAATGTCATTCTGAT-3 '

Pho40X-SacI-R: -5'-TTAAGAGCTCAGAACCACCACCACCAGAACCACCACCACCAGAACCACCACCACC CTTCGCTACCACTGTCTTCAGATACTGTCCT-3 '.

This reaction is carried out under the following conditions: 10x Encycio buffer, 50x Encyclo polymerase mixture (Encyclo PCR kit, Eurogen, Moscow), 50x dNTP mixture (10 mM each), primer mixture (5 μM each), 20 ng DNA. The amplification process consists of the following stages: 30 PCR cycles (15 s - 95 ° C, 1 min 30 s - 72 ° C) and 10 min incubation at 72 ° C. After amplification, the PCR product is purified electrophoretically in a 1% agarose gel. The fragment (1 μg) was treated with restriction enzymes NcoI and SacI in optimal buffer (Fermentas) for 3 hours, then the enzymes were removed from the reaction medium according to the standard procedure with phenol (1: 1) [10]. 1/10 volume of 0.3 M Na acetate, pH 5.2 and 1/2 volume of isopropanol alcohol are added to the aqueous fraction containing the fragment and left at -20 ° C for 30 minutes. It is then centrifuged at 14,000 rpm for 20 minutes, the precipitate is washed with 75% ethanol and dried at room temperature. The precipitate was dissolved in 20 μl of deionized water.

2 μg of pET-40b (+) plasmid DNA was digested with restriction enzymes NcoI and SacI in accordance with the procedure described above, and the vector part of the plasmid was isolated from the obtained hydrolyzate in a 1% low-melting agarose gel.

The resulting CmAP gene fragment and the vector part of the pET-40b (+) plasmid were crosslinked by ligase reaction in 50 μl of ligation buffer according to the instructions (Fermentas). 10 μl of the reaction mixture was used to transform competent E. coli Rosetta cells (DE3). Transformants are plated on LB agar containing 25 μg / ml kanamycin. After incubation for 16 hours at 37 ° C, the clones are plated, plasmid DNA is isolated and analyzed for mutations using automatic sequencing. The pET40CmAP plasmid DNA containing the CmAP sequence with the (G) 4S (G) 4S (G) 4SEL linker at the C-terminal portion is selected.

At the second stage, the MBL-T gene is amplified using Far Eastern trepang c-DNA and a pair of Lect-X-dir and Lect-X-rev primers carrying SacI and SalI restriction enzyme sites:

Lect-X-dir: 5'-AGCTGAGCTCTGTCTGACGGCTTGTCCGGAGTTTTG-3

Lect-X-rev: 5'-CAGTGTCGACCTCCAAATGATACTCGATACAGGGAAG-3 '

To create the pET40CmAP / MBL-T construct, the obtained C-type MBL-T mannan-binding pectin gene and 2 μg of pET40CmAP plasmid DNA were treated with SacI and SalI restrictase enzymes in accordance with the procedure described above, and purified on a 1% low-melting agarose gel. The purified MBL-T PCR fragments and the vector portion of the pET40CmAP plasmid are crosslinked by ligase reaction in 50 μl of ligation buffer according to the instructions (Fermentas). 10 μl of the reaction mixture was used to transform competent E. coli Rosetta cells (DE3). Transformants are plated on LB agar containing 25 μg / ml kanamycin. After incubation for 16 hours at 37 ° C, the clones are plated, plasmid DNA is isolated and analyzed for mutations using automatic sequencing. A DNA was selected containing the desired CmAP and MBL-T gene sequences, which was a pET40CmAP / MBL-T plasmid of 8194 bp in size. (figure 1).

Example 2. Obtaining a recombinant strain of E. coli Rosetta (DE3) / pET40CmAP / MBL-T - producer of the hybrid bifunctional CmAP / MBL-T polypeptide.

The recombinant producer strain E. coli Rosetta (DE3) / pET40CmAP / MBL-T is obtained by transforming cells of the E. coli Rosetta (DE3) strain with the recombinant plasmid pET40CmAP / MBL-T. An overnight culture (0.5 ml LB) of the recombinant producer strain of the hybrid bifunctional CmAP / MBL-T polypeptide is grown in a liter flask in LB liquid medium containing 10 g bacto-tryptone, 5 g bacto-yeast extract and 10 g NaCl per liter, 25 mg / ml kanamycin, pH 7.7, on a shaker at 200 rpm at 37 ° C for 2 hours to an optical density of 0.6-0.8 (OD ₆₀₀ ), then an IPTG expression inducer is added to a final concentration 0.2 mmol and incubated further at 16 ° C for 12 hours.

To determine the productivity of the strain, cellular aqueous extracts are analyzed by electrophoresis in 12.5% polyacrylamide gel with sodium dodecyl sulfate. The gel is stained with Coomassie R-250 by a standard method and the relative amount of protein in the strip of the target product is determined. The content of the recombinant protein in the soluble cell fraction is at least 30% of all proteins of this fraction.

Example 3. Isolation and characterization of the hybrid bifunctional CmAP / MBL-T polypeptide.

The recombinant strain producing hybrid bifunctional CmAP / MBL-T polypeptide - E. coli Rosetta (DE3) / pET40CmAP / MBL-T is incubated in a liter flask in LB liquid medium containing 10 g bacto-tryptone, 5 g bacto-yeast extract per liter and 10 g of NaCl, 0.5 mm IPTG, 25 mg / ml kanamycin, pH 7.7, on a shaker at 200 rpm for 12 hours at 16 ° C. Bacterial cells are pelleted in a flow centrifuge at 5000 rpm for 10 minutes. The cell suspension is disintegrated in 20 ml of buffer A (0.05 M Tris-HCl, pH 8.6, 0.01% NaN ₃ ) for 5 × 30 s, cooling in ice. Then centrifuged at 10,000 rpm for 30 minutes The supernatant was collected and placed on a DEAE-52-cellulose column (Whatman). Protein elution is carried out with a NaCl concentration gradient (0.05 M-0.380 M) in buffer A. Active fractions are collected and placed on a column of metal-affinity resin (Qiagen), previously equilibrated with buffer A. Protein elution is carried out with buffer B (50 mM Tris-HCl, pH 8.6, 50 mM EDTA, 0,01% NaN _3). The active fractions were collected, desalted and concentrated on a DEAE-Toyopearl 650M column (Touo Soda), then incubated with enterokinase (Invitrogen) at room temperature for 12 hours. The protein solution is then applied to a gel filtration column with Superdex 200 (Sigma). The recombinant protein yield is 10 mg per 1 liter of culture.

The resulting recombinant polypeptide is determined by the first 10 amino acids on an automatic sequencer. Sequencing of a recombinant protein preparation isolated from cells of the E. coli Rosetta (DE3) / pET40CmAP / MBL-T strain revealed the amino acid sequence A1a-Glu-Ile-Lys-Asn-Val-Ile-Leu-Met-Ile corresponding to the first 10 amino acids of alkaline phosphatase CmAP, which is the N-terminal component of the chimeric protein CmAP / MBL-T.

The enzymatic functionality of the CmAP / MBL-T hybrid polypeptide is checked by alkaline phosphatase activity, which is determined by the cleavage of paranitrophenyl phosphate (p-NFF). A standard incubation mixture in a volume of 500 μl contains 15 mM p-NFF, 1 M diethanolamine (DEA), pH 10.3 and an enzyme or 2 mM p-NFF, 0.1 M Tris-HCl, 0.2 M KCl, pH 9.5 -10.0. After 30 min incubation at 37 ° C, the reaction is stopped by adding 2 ml of 0.5 M NaOH. The amount of p-nitrophenol (p-NF) formed during the enzymatic reaction is determined spectrophotometrically at 400 nm. The unit of alkaline phosphatase activity is the amount of an enzyme that catalyzes the release of 1 μM p-NP (ε ₄₀₀ nm = 18600) during 1 min of incubation. The specific activity is expressed in units of enzyme activity per 1 mg of protein. The protein concentration in the solution is determined by the Bradford method.

The lectin functionality of the CmAP / MBL-T fusion polypeptide is tested for mucin affinity. A solution (0.0015-0.1 mg / ml) of the CmAP / MBL-T hybrid polypeptide was added to a mucin sensitized polystyrene microplate and incubated for 1.5 hours at room temperature. Lectin-bound complexes are washed with 10 mm Tris-HCl buffer, pH 9.0, 0.15 M NaCl, 0.05% Triton X-100, 20 mM CaCl ₂ , 200 μl per well at least 10 times. Then, a buffer for alkaline phosphatase activity with the substrate, as described above, is added to the wells of the microplate to visualize the bound complexes (FIG. 2).

The obtained data on the characteristics and functional activity of the expression product of the artificial chimeric gene of the hybrid bifunctional CmAP / MBL-T polypeptide in the cells of the recombinant E. coli Rosetta (DE3) / pET40CmAP / MBL-T strain indicate the correspondence of the studied polypeptide to its natural analogue - MBL-T pectin used in the lectin-enzyme immunoassay method of early differential diagnosis of cervical cancer [8].

As follows from the above examples, the claimed group of inventions allows to obtain an active recombinant hybrid bifunctional CmAP / MBL-T polypeptide with the properties of highly active alkaline phosphatase of the marine bacteria CmAP and highly specific mannan-binding lectin of the Far Eastern C-type MBL-T trepang in high yield with a relatively simple and reliable technology.

The claimed invention allows you to:

- using a recombinant producer strain of E. coli Rosetta (DE3) / pET40CmAP / MBL-T to obtain by biosynthesis a large amount of the active hybrid bifunctional CmAP / MBL-T polypeptide;

- the use of ion-exchange, metal-affinity and gel filtration chromatography in the purification of a recombinant protein from an aqueous extract of cells of a recombinant producer strain allows one to obtain a hybrid bifunctional CmAP / MBL-T polypeptide with a purity of more than 98% as an analogue of mannan-binding MBL-T C-type lectin conjugated to an enzyme used for enzyme immunoassay.

Literature

1. Chissov V.I., Starinsky V.V., Sotnikova E.N. Early diagnosis of cancer. M .: 1994. P.193.

2. Davina J.H.M., Stadhouders A.M., van Haelst U.J.G.M., Lamers G.E.M., Kenemans P. Concanavalin A Peroxidase labeling in cervical exfoliative cytopathology. Gynecologic Oncology, 1985 .-- Vol. 22. - I.2. - P.212-223.

3. Reddi A. L., Sankaranarayanan K., Arulraj H. S., Devaraj N., Devaraj Enzime-linked PNA lectin-binding assay of serum T-antigen in patient with SCC of the uterine cervix. Cancer letters - 2000. - Vol. 149, - P.207-211.

4. A.A. Bulgakov, M.G. Eliseikina, I.Yu. Petrova, E.L. Nazarenko, S.N. Kovalchuk Isolation and properties of a mannan-bind ing lectin from the holothurian Apostichopus japonicus. Glycobiology 2007, V.17, No. 12, P.1284-1298.

5. Aoyagi Y., Suzuki Y., Isemura M., Nomoto M., Sekini C., Igarashi K., Ichida F. The fucosylation of alfa-fetoprotein and its usefulness in the early diagnosis of hepatocellular carcinoma. Cancer, 1988 .-- Vol. 61. - N.4. P.769-774.

6. 24. Yuan C.C., Wang P.H., Ng H.T., Tsai L.C., Juang C.M., Chiu L.M. Both TPA and SCC-Ag levels are prognostic even in high-risk stage Ib-IIa cervical carcinoma as determined by a stratification analysis. Eur. J. Gynaecol Oncol. 2002; 23 (1): 17-20.

7. Chi-Mou Juang M.D., Peng-Hui Wang M.D., Ming-Shien Yen M.D., Chiung-Ru Lai M.D., Heung-Tat Ng M.D. and Chiou-Chung Yuan M.D. Application of Tumor Markers CEA, TPA, and SCC-Ag in Patients with Low-Risk FIGO Stage IB and IIA Squamous Cell Carcinoma of the Uterine Cervix. Gynecologic Oncology. 2000; 76 (1): 103-106.

8. RU 2343485 C1, 01/10/2009.

9. RU 2447151 C1, 04/10/2012.

10. Sambrook J., Fritsch E.F., Maniatis T. // Molecular Cloning. A. Laboratory Manual. 2bd ed. Cold Spring Harbor, NY 1989.

A list of nucleotide and amino acid sequences is given at the end of the description.

Claims (3)

1. Plasmid pET40CmAP / MBL-T with a size of 8194 base pairs (bp), which determines the synthesis of the recombinant hybrid bifunctional CmAP / MBL-T polypeptide and is characterized by the presence of the following fragments: NcoI / SalI fragment of plasmid pET-40b (+) (Novagen ) and the DNA fragment of 2034 bp containing a chimeric gene consisting of the structural part of the gene of alkaline phosphatase CmAP, including a linker (G) ₄ S (G) ₄ S (G) ₄ SEL, and the structural part of the gene mannan-binding lectin C-type MBL-T (SEQ ID N 1). 2. The recombinant E. coli strain Rosetta (DE3) / pET40CmAP / MBL-T, transformed with the plasmid pET40CmAP / MBL-T according to claim 1, is a producer of the hybrid bifunctional CmAP / MBL-T polypeptide. 3. A method for producing a recombinant hybrid bifunctional CmAP / MBL-T polypeptide, characterized in that the producer strain according to claim 2 is incubated in LB liquid medium for 12 hours at 16 ° C, then the bacterial cells are precipitated by centrifugation, the cell suspension is disintegrated into buffer, then the extract is centrifuged, then the supernatant is placed on a column with an ion exchange resin, then the protein is eluted, then the protein eluate is placed on a column with a metal affinity resin, then the active fractions are concentrated on an ion exchange with mole and isolate the target product by gel filtration.

Images