RU2532842C1 - Nucleic acid having activity of short interfering rna, vector containing this nucleic acid coupled operably with sequences of transcription regulation, and method of their application for inhibition of cell proliferation of human pancreatic adenocarcinoma - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to molecular biology, in particular to short interfering RNA (siRNA), and can be used in antitumor therapy. On the basis of genome analysis the sequences of siRNA against the human gene HIF1A with SEQ ID NO:1-2 are designed, siRNA against the human gene HSP8A with SEQ ID NO:3-4, siRNA against the human gene APEX1 with SEQ ID NO:5-6, and siRNA against the human gene CCND3 with SEQ ID NO:7-8, associated with cell proliferation of human pancreatic adenocarcinoma. Using the obtained siRNA, including as part of a lentiviral vector, results in suppression of cell proliferation of human pancreatic adenocarcinoma and tumor destruction. The invention enables to achieve the level of suppression of proliferation up to 65% using siRNA to genes HIF1A and HSP8A associated with stress and responsible for the major proliferative (CCND3) and reparative (APEX-1) ways of cell division.

EFFECT: improving level of suppression of proliferation.

3 cl, 10 dwg, 2 ex

Description

The scope of the invention

The invention relates to molecular biology, in particular to the use of the mechanism of interference of ribonucleic acids (RNAs) due to the introduction of synthetic short double-stranded oligonucleotides: a phenomenon known as the effect of small interfering RNAs. It can be used to treat pancreatic cancer with RNA interference.

State of the art

Pancreatic cancer (PCa) is virtually untreatable; detection frequency is significantly correlated with the lethality of these patients. One of its main types - pancreatic duct adenocarcinoma (PDAC, pancreatic ductal adenocarcinoma), remains one of the most aggressive types of malignant diseases, despite numerous studies in this area and attempts to find methods of treatment.

RNA interference is an evolutionarily ancient conservative process that functions in animal and plant cells. It protects cells from viral invasion by blocking translation and providing targeted degradation of messenger RNA (mRNA) at the ribosome assembly stage [Naqvi et al, Int J Biol Sci. 5, 97-117]. The possibility of targeted mRNA degradation and subsequent blocking of the expression of the desired gene opens up wide prospects for the use of new approaches in the treatment of tumor diseases. SiRNAs (small interfering RNAs, small interfering RNAs) are short double-stranded molecules (up to 30 base pairs), which are an active form for triggering the RNA interference process [Elbashir et al. Nature. 411, 494-8]. SiRNA-induced RNA interference has a post-transcriptional suppression of protein synthesis. As a result of the introduction of siRNA into cells in vitro, 50-60%, less often 80-90%, suppression of the expression of the target gene is observed [Gondi et al. J Cell Physiol. 2009, 220, 285-291; Takeshita F, T. Ochiya. Cancer Science. 2006, 97, 689-696]. Due to the lack of a precursor in siRNA, it is possible to create artificial siRNAs for the target protein.

Currently, there are two main ways to obtain siRNA: synthesis of siRNA in vitro and the introduction of plasmids containing the sequence of genes necessary to obtain siRNA in vivo. Synthetic siRNA is used for direct introduction into the body or in cell culture in vitro. RNA interference using exogenous siRNAs is temporary and never provides 100% inhibition of expression of the desired gene. According to various sources, only in isolated cases can an 80-95% effect be achieved. But this effect is short-term and requires additional introductions of siRNA molecules [Paul et al. Nat Biotechnol. 2002, 20, 505-8]. On the other hand, the expression of these molecules endogenously allows for a longer lasting effect, which is achieved through genetic transformation of cells. Studies on the RNA interference of PDAC cells have been carried out for a large number of genes [Huang et al. Curr Pharm Des. 2011; 17 (21): 2221-2238].

Description of analogues

He revealed analogues of the invention for the treatment of pancreatic cancer, which are at the stage of clinical trials.

Known invention, which describes the possibility of inhibiting the activity of proteins STIP1 and ALDH1 A1 by blocking the expression of their genes. The STIP1 protein is an adapter molecule that coordinates the functional activity of chaperones, such as heat shock proteins HSP10 and HSP90, by regulating ATPase activity and conformation of chaperones in substrate-bound and free states. Protein ALDH1 A1 belongs to the proteins of the aldehyde dehydrogenase family (WO 2009109952).

A known composition based on APEX1 inhibitors, which may be useful for the diagnosis and possibly treatment of cancer (WO 2012148889).

Known composition, which includes antibodies to APEX1 / Ref-1 for the diagnosis of bladder cancer (WO 2012077983).

An invention is known that describes the possibility of using siRNA for APEX1 as part of a drug for treating cancer and simultaneously analyzing damage to the APEX1 repair system (KR 20110066469).

A close invention is known where a recombinant adenovirus vector with integrated siRNA is used that effectively prevents the expression of the APEX1 gene and effectively increases the sensitivity of radiotherapy and chemotherapy of tumor cells (CN 101186930).

Known invention closest to the described. It proposes the use of siRNA to APEX1, as well as cyclin-dependent kinases 3 (CDK3), which are involved in cell cycle regulation and proliferation, for the treatment of cancer and other diseases of cell proliferation (WO 2004007754).

An invention is known that is close to the described invention, in which it is stated that it is possible to use siRNA as an antitumor agent to suppress HIF1A hypoxia factor in order to suppress the proliferation of cancer cells and metastases. For the delivery of siRNA, the invention uses a plasmid with adenoviral, retroviral vectors, as well as the vaccinia virus vector (KR 20120081936).

A known invention is shown to inhibit the activity of HIF1A by influencing gene expression with siRNA to effectively treat, prevent or reduce tumor growth (US 2009192104).

Inventions are known in which rapontingenin and cetuximab are used as an active ingredient to inhibit HIF1A activity in combination with analogs of anti-angiogenic thyroid hormones such as tetrax or triac (KR 20120041390, US 2010255108).

An invention is known in which a decrease in HIF1A expression is caused by the use of oligomeric components from 12-14 nucleotides to hypoxia factor mRNA, which can be used to treat hyperproliferative diseases such as cancer (WO 2009043759).

No patents have been identified describing the constructs for RNA interference of cyclin D3 and HSP8A for cancer therapy; no patent documents have been identified that use the proposed approaches of multiplex RNA interference of the CCND3, APEX1, HIF1A, HSP8A genes for the treatment of pancreatic cancer.

The present invention shows the possibility of suppressing using RNA interference of several genes from different signaling pathways of the cell, which leads to an increase in the antitumor effect. Of the known genes for which a role in the pathogenesis of PDAC is shown, four genes are taken that can potentially interact and enhance each other's action. These are genes encoding heat shock proteins of 70 kDa (HSP8A) [Powers et al. Cancer Cell, 2008; 14: 250-262]; type I hypoxia factor (HIF1A) [Akakura et al. 2001; 61: 6548-54; Chen et al. J. Biol. Chem., 2003; 278: 13595-8.]; cyclin D3 (CCND3) [Al-Aynati et al. Clin Cancer Res. 2004 Oct 1; 10 (19): 6598-605; Ito et al. Anticancer Res. 2001; 21: 1043-1048; Lapenna, S. & Giordano, Drug Discov. 2009; 8, 547-566] and APEX nuclease 1 (APEX1) [Tell et al. Antioxid Redox Signal 2009; 11: 601-620; Cardoso et al. Plos one. 2012; 7 (10): e47462].

The invention solves the problem of suppressing the expression of genes associated with the proliferation of human pancreatic adenocarcinoma cells, which leads to the suppression of their proliferation and tumor death.

The problem is solved by the use of nucleic acids having the activity of small interfering RNAs to the CCDN3, APEX1, HIF1A, HSP8A genes (see sequence listing, SEQ ID No. 1-8). To use these sequences and their combinations in the treatment of pancreatic cancer, the sequences are cloned into vectors to obtain lentiviruses encoding the short hairpin structures (shRNAs) of the corresponding siRNAs, which are produced endogenously upon infection of tumor cells with lentiviruses. The corresponding lentiviruses were obtained in HEK-293T packing cells (Fig. 8). Testing work was carried out in in vitro cultures on PDAC cell lines: AsPC-1, MiaPaCa and control NaCaT human keratinocyte cells. The novelty of the method of application consists in combining siRNA or lentiviral vectors encoding the corresponding shRNAs for stress associated genes such as HIF1A and HSP8A with the genes responsible for the main proliferative (CCND3) and reparative (APEX-1) cell division pathways.

The technical result is the suppression of the expression of these genes in the cells of the human pancreatic adenocarcinoma (Figs. 1-7) and the suppression of the proliferation of human pancreatic adenocarcinoma cells with the use of single lentiviruses, as well as the synergistic effect when using their combinations (up to 65%) (Fig. 9 -10). The effect is not specific to pancreatic cancer. The effect of these RNA sequences is universal for all rapidly proliferating cells, for example, on NaCaT human keratinocytes cells under stress, which is typical for all cancer cells.

The invention is illustrated by the following graphic materials:

Figure 1. Suppression of the expression of APEX1, CCND3, HIF-1a, and HSP8A genes in human pancreatic adenocarcinoma cells BxRS-3 as a result of 48 h of dsRNA interference RNA with the corresponding genes. The interference is carried out by dsRNA of genes once (1x) or twice (2x) for 0 and 24 hours. The data are given as a fraction of the control. In the control, transfection was performed with senseless RNA labeled with a fluorescent dye.

Figure 2. Suppression of the expression of the APEX1, CCND3, HIF1A, and HSP8A genes in human pancreatic adenocarcinoma BxRS-3 cells as a result of 48 h of dsRNA interference RNA with the corresponding genes. Transfection is carried out once. The abscissa indicates the genes whose expression analysis was performed by qPCR. The dsRNA was interfered with the genes indicated on the tab. The level of suppression of the target gene is indicated by hatching. In the control, transfection was performed with senseless RNA labeled with a fluorescent dye.

Figure 3. Suppression of the expression of the APEX1, CCND3, HIF1A, and HSP8A genes in human pancreatic adenocarcinoma BxRS-3 cells as a result of 48 h of dsRNA interference RNA with the corresponding genes. Transfection was performed twice with an interval of 24 hours. The abscissa indicates the genes whose expression analysis was carried out by the method of quantitative polymerase chain reaction. The interference was carried out by dsRNA of the genes indicated on the tab. The level of suppression of the target gene is indicated by hatching. In the control, transfection was performed with senseless RNA labeled with a fluorescent dye.

Figure 4. Comparative expression of APEX-1, CCND3, HIF1A, HSP8A genes in pancreatic adenocarcinoma cells AsPC-1 (upper window) and BxRS-3 (lower window). The results are shown as relative units normalized to actin expression. The data on the 2nd and 5th experiments for the lines AsPC-1 and ВхРС-3, respectively, are presented.

Figure 5. Suppression of the expression of APEX1 and CCND3 genes in human pancreatic adenocarcinoma BxRS-3 cells as a result of 48 hours of RNA interference with dsRNA combinations to the corresponding genes. Transfection was performed once. The abscissa indicates the genes whose expression analysis was carried out by the method of quantitative polymerase chain reaction. The level of suppression of the expression of target genes by specific dsRNA is indicated by oblique hatching. The interference was carried out by combinations of dsRNA genes indicated on the tab, where A is APEX-1; C is CCND3; HI is HIF1A; HS - HSP8A. The level of suppression of expression by a pair of dsRNA, which includes a sequence that is meaningful for a given gene, is indicated by direct hatching. A significant effect (p <0.05) of additional suppression is marked with an asterisk, the absence of effect is marked with an “X”.

6. Suppression of the expression of HIF1A and HSP8A genes in human pancreatic adenocarcinoma BxRS-3 cells as a result of 48 hours of RNA interference with dsRNA combinations to the corresponding genes. Designations see figure 4.

7. Suppression of the expression of target genes in multiplex RNA interference of the APEX1 (A), CCND3 (C), HIF1A (HI) and HSP8 (HS) genes. Suppression of the expression of the APEX-1 gene (upper left figure), CCND3 (upper right figure), HIF1A (lower left figure) and HSP8A (lower right figure) upon interference by individual siRNAs (gray bars) and siRNA combinations (black bars). A significant enhancement of the effect due to multiplex interference is indicated by an asterisk (p <0.05).

Fig. 8. The efficiency of transduction by viruses containing shRNA of the APEX-1 (A) genes; CCND3 (B); HIF1A (B) and HSP8A (D), MiaPaCa cells. Used supernatants of transfected HEK-293T cells at 20, 48, 72 and 96 hours after transfection.

Fig.9. Suppression of proliferation of the line of pancreatic AsPC-1 cells by viruses to the APEX-1, CCND3, HIF1A, HSP8A genes and their combinations. Designations of genes are similar to FIGS. 5-8.

Figure 10. Suppression of proliferation of the human keratinocyte line of NaCaT viruses by the APEX-1, CCND3, HIF1A, HSP8A genes and their combinations. Designations of genes are similar to FIGS. 5-9.

The implementation of the invention

The invention is illustrated by the following examples.

1. RNA interference of the HSP8A, HIF1A, CCND3 and APEX1 genes in pancreatic cells

Evaluation of the effectiveness of suppression of gene expression by engineered siRNA

The expression of target genes using separate siRNA dsRNAs or their combinations to different target genes is evaluated by the method of quantitative real-time PCR (qPCR). To do this, the constructed and synthesized pairs of single-stranded sequences (SEQ ID No. 1-8) are mixed 1/1, incubated for 10 min at 70 ° C to obtain active double-stranded RNA (dsRNA). Pancreatic adenocarcinoma cell lines BxRS-3 (CRL-1687) and AsPC-1 (CRL-1682) are used to analyze gene expression. Cells were cultured under standard conditions on DMEM medium with 7% fetal calf serum, penicillin / streptomycin / glutamine supplements (complete culture medium, PPS) (all reagents from PanEco, Moscow, Russia) in Costar bottles (PanEco, Moscow, Russia). Before the experiment, the cells are removed from the plastic with a trypsin / EDTA solution (PanEco, Moscow, Russia), the concentration is calculated, transferred to PPS without antibiotics and plated in 300-well wells per 24-well plates. Cells grow night. Transfection of dsRNA is carried out using the ScreenFect agent (InCella, distributor Rusbiolink, Moscow, Russia) according to the manufacturer's protocol. To analyze the effectiveness of transfection, fluorescently labeled non-sense dsRNAs are used. Transfection is carried out once by separate dsRNAs or their combinations. Cells with dsRNA are incubated for 48 hours, after which total RNA is isolated from the cells. Isolation of RNA and RNA treatment with DNAse RQ1.

48 hours after plating, the cells were washed with serum-free medium and RNA was isolated from the samples using the Trizol reagent (Invitrogen) following the manufacturer's instructions. To remove genomic DNA impurities, total RNA is treated with DNQ RQ1 (Promega) according to the manufacturer's instructions. Treated RNA is used in first strand synthesis.

First chain synthesis

The synthesis of the first chain from the obtained RNA samples is carried out using a Revert Aid kit (Thermo), following the manufacturer's instructions. As a seed for synthesis, hexamers with a random sequence are used. 0.5-1 μg of total RNA is incubated for 10 min with hexamers and a mixture of four deoxynucleoside triphosphates on ice. Reverse transcriptase buffer and reverse transcriptase are added to the mixture and incubated for 10 min at + 25 ° C and then 30 min at + 50 ° C. To stop the reaction, the mixture is heated for 10 min at 85 ° C. The obtained first chain is then used as a matrix in qPCR.

Real-time PCR (qPCR)

For qPCR, primers are used (sequence listing, SEQ ID No. 9-18). The β-actin gene is used as the reference gene. qPCR for each matrix and corresponding primer is carried out in 2 repetitions. In addition, in each PCR, for all matrices used, reactions with primers for the reference gene are performed (to normalize the mRNA level of the target genes), and a control reaction containing water instead of the matrix is carried out for each primer. For qPCR use reagents manufactured by Synthol, Moscow. Water and a 2.5x reaction mixture containing 2.5x PCR buffer (KCl, Tris-HCl pH 8.8, 6.25 mM MgCl ₂ ), Taq DNA polymerase, a mixture of four deoxynucleoside triphosphates, glycerin are mixed in a 1.5 ml tube , Tween-20, the intercalating dye EvaGreenI and the passive reference dye ROX. Next, the total mixture is divided into the required number of parts corresponding to the number of primers for the target genes plus the reference gene, and a separate pair of primers is added to each part. Next, each part is divided into aliquots, the number of which corresponds to the number of analyzed cDNA samples for a given pair of primers plus one control aliquot, where water is added instead of the template. After adding matrices or water, aliquots are divided into two repetitions and added to the wells of the PCR plate.

Finished samples are placed in a CFX96 instrument (Bio-Rad), reactions are carried out using the following qPCR program (dyes: EvaGreenl / ROX): 95 ° C - 300 sec, 1 cycle; 60 ° C - 40 sec., 95 ° C - 15 sec., 50 cycles.

To confirm the homogeneity of the product, a melting reaction of the obtained fragments is carried out.

When cells are transfected with targeted dsRNAs for all selected siRNA sequences, a decrease in the expression of the target gene is observed, the level of decrease in expression depends on the application of siRNA. The effect of RNA interference is enhanced by double transfection with target siRNA and with multiplex transfection of siRNA to different genes (Figs. 1-7).

2. Obtaining shRNA in lentiviruses and evaluating the ability of these RNAs to suppress cancer cell proliferation

Obtaining lentiviruses containing the siRNA sequences of the APEX-1, CCND3, HIF1A and HSP8A genes

To obtain therapeutic agents, siRNA sequences (SEQ ID Nos. 1-8) are cloned as shRNA hairpins into the pLVneo vector by standard methods. A gene encoding a green fluorescent protein (GFP) is additionally introduced into the plasmid to visualize transfection and transduction. The resulting plasmids are used to obtain lentiviral particles using plasmid packers of vesicular stomatitis VSV and CMV cytomegalovirus. Viral particles are produced in HEK-293T cells. The presence and titers of viruses is determined by the transduction efficiency of MiaPaCa cells with the resulting viruses. It was shown that viruses containing CCND3 and HIF1A are produced within 48-72 hours; viruses containing APEX-1 and HSP8A, a little later with a peak at 96 hours (Fig. 8).

The effect of RNA interference on the proliferation of pancreatic cells

The experiment was performed on AsPC-1 pancreatic adenocarcinoma cell lines and on NaCaT human keratinocyte cells. Cells are cultured in vials in complete DMEM nutrient medium with antibiotics, 7% fetal calf serum, L-glutamine and 2-mercaptoethanol (all from PanEco, Moscow, Russia). Before the experiment, cells are separated from the plate with trypsin, counted and transferred to 96-well plates in a complete nutrient medium with 15 thousand cells per well; polybrin was added to the cells at a final concentration of 8 μg / ml to improve the adhesion of viruses to the cells. Prior to the introduction of the cells, the viruses are applied to the plates (25 ml per well) or a mixture of them in 100 μl, and then the cells are spread. Incubation is carried out for 72 hours in a CO ₂ incubator at 37 ° C. Cell survival is determined using the MTT test. For the last 3 hours of incubation, 10 μl of MTT solution (5 mg / ml, Sigma) was added to each well. At the end of the incubation, the culture fluid is removed by flipping the plate and 100 μl of dimethyl sulfoxide are added to dissolve the crystals of formazan formed as a result of MTT restoration by living cells. The optical density of the contents of each well was measured using a Multiscan FC instrument (Thermo Fisher Scientific, USA) at a wavelength of 540 nm. Cell survival is assessed by the optical density of the formazan solution. Both for cells of the pancreatic line AsPC-1, and for cells of the keratinocyte line NaCaT, the effect of enhancing the action of viruses when combined is observed (Figs. 9-10).

Sequence listing

SEQ ID No. 1

5′-UGUGUCCUUAAACCGGUUGdTdT-3 ′ - direct siRNA to the HIF1A gene

SEQ ID No. 2

5′-CAACCGGUUUAAGGACACAdTdT-3 - reverse siRNA to the HIF1A gene

SEQ ID№3

5′-GAUGAAGGAAAUUGCAGAAdTdT-3 ′ - direct siRNA to the HSP8A gene

SEQ ID No. 4

5′-UUCUGCAAUUUCCUUCAUCdTdT-3 ′ - reverse siRNA to the HSP8A gene

SEQ ID No. 5

5′-GUCUGGUACGACUGGAGUACC-3 ′ - direct siRNA to the APEX1 gene

SEQ ID No. 6

5′-UACUCCAGUCGUACCAGACCU-3 ′ - reverse siRNA to the APEX1 gene

SEQ ID No. 7

5′-GACCAGCACUCCUACAGAUdTdT-3 ′ - direct siRNA to CCND3 gene

SEQ ID No. 8

5′-AUCUGUAGGAGUGCUGGUCdTdT-3 ′ - reverse siRNA to CCND3 gene

SEQ ID No. 9

5′TTCACCTGAGCCTAATAGTCC3 ′ - direct primer to the HIF1A gene

SEQ ID No. 10

5′CAAGTCTAAATCTGTGTCCTGAG3 ′ - reverse primer to the HIF1A gene

SEQ ID No. 11

5′CTTTATGGTGGTGAATGATGCT3 ′ - direct primer to the HSP8A gene

SEQ ID No. 12

5′GGTAACAGTCTTCCCAAGGT3 ′ - reverse primer to the HSP8A gene

SEQ GO No. 13

5′CTTACGGCATAGGCGATGAG3 ′ - direct primer to the APEX1 gene

SEQ ID No. 14

5′TACTCCAGTCGTACCAGACC3 ′ - reverse primer to the APEX1 gene

SEQ ID No. 15

5′GATTTCCTGGCCTTCATTCTG3 ′ - direct primer to the CCND3 gene

SEQ ID No. 16

5′GGCAAAGGTATAATCTGTAGCAC - reverse primer to the CCND3 gene

SEQ ID No. 17

5′CACCACACCTTCTACAATGAG3 ′ - direct primer to the gene B-actin

SEQ ID No. 18

5′GTCTCAAACATGATCTGGGTC3 ′ - reverse primer to the B-actin gene

Claims (3)

1. Nucleic acid to inhibit the proliferation of human pancreatic adenocarcinoma cells, characterized by a nucleotide sequence selected from SEQ ID No: 1-8. 2. A lentiviral vector containing at least one nucleic acid according to claim 1, operably linked to transcriptional regulation sequences, to suppress proliferation of human pancreatic adenocarcinoma cells. 3. A method for inhibiting proliferation of human pancreatic adenocarcinoma cells with at least one nucleic acid according to claim 1 or at least one vector according to claim 2.

Images