RU2532227C1 - Strain enterococcus mundtii producing peptide substance with antilisterial ativity - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: invention refers to microbiology and biotechnology. What is presented is the strain Enterococcus mundtii GKPM (State Collection of Industrial Microorganisms) - Obolensk V-7424 producing a peptide substance having the antilisterial activity.

EFFECT: antimicrobial peptide substance Enterococcus mundtii GKPM - Obolensk V-7424 possesses the activity about 6400 - 12800 antigen units/ml on the test strain Listeria monocytogenes 776 and can be used for the decontamination of bioproducts, as well as materials infected by bacterial pathogens.

2 dwg, 4 tbl, 6 ex

Description

The invention relates to biotechnology and can be used to obtain an antimicrobial peptide substance - bacteriocin, used in the manufacture of food products, for the prevention and treatment of food diseases caused by bacterial pathogens, especially Listeria.

The problem of antibiotic resistance, especially the fight against foodborne pathogens - preservatives that are safe for humans - is relevant.

BACKGROUND

In the last decade, the attention of researchers has been attracted to bacteria from the genus Enterococcus as potential probiotics and producers of antimicrobial substances of peptide nature, which have a high potential for use in the production of food, feed, and biological preservatives.

Despite the large amount of scientific work carried out in this direction and confirming interest in research of this kind, only a few strains producing bacteriocins were brought to practical use (nisin, pediocin). The main problems that developers face in introducing new bacteriocins are the safety of producer strains and the low yield of the target product. Thus, the use of bacteriocin producers from the genus Enterococcus as probiotics causes caution: among them there are strains that cause human and animal diseases, as well as strains that carry vancomycin resistance genes. Virulence factors such as adhesion to cell surfaces, cell aggregation and conjugation, hydrolysis of collagen, hemoglobin, gelatin (gelE), activation of cytolysin, expression of cell wall adhesins (efaAfm) have been identified in a number of strains of this genus. These factors are often associated with strains of the species E. faecalis (Foulquié-Moreno et al., 2006; Mannu et al., 2003) - some of them revealed the genes geIE, efaAfm, and antibiotic resistance to vancomycin (Eaton and Gasson, 2001).

Representatives of the genus Enterosossus, used as producers of bacteriocins such as enterocins, have a good prospect in the fight against bacteria that cause food spoilage and intestinal diseases. However, researchers noted low yields of bacteriocins, which limits the practical use of representatives of this kind of microorganisms.

Thus, the search in the environment for safer and at the same time more productive strains of enterococcus producing bacteriocins, which can be an alternative to antibiotics and chemotherapy, is an urgent task of biotechnology.

A known strain of Enterococcus mundtii ST4SA (Patent US 8444998), which produces a peptide bacteriocin ST4SA (M.V. 3400 Da), which has antimicrobial properties, however, the high bactericidal activity of the drug presented by the authors, refers only to the sensitive test strain of lactobacilli - Lactobacillus caseiHS. Listeria activity was evaluated for only one representative of this genus, the non-pathogenic strain Listeria innocua LMG 13568.

Closest to the proposed invention is a strain of Enterococcus faecium 1073, producing bacteriocin E-1073 (m.v. 3256 Da), isolated from the intestines of broiler chicken, identified and studied in the SSC MPB. This strain under conditions of deep cultivation produced bacteriocin E-1073 in the culture fluid with activity against L. monocytogenes at the level of 800-1600 AU / ml. Such a low yield of the target product required the additional use of specific activators of biosynthesis - competitive bacteria and signal peptides, which generally complicates the technology for producing bacteriocins.

The objective of the present invention is to obtain a new producer of a bactericidal substance of peptide nature (bacteriocin) - a representative of the genus Enterosossus, which has a higher yield of the target product, antilisteriosis activity, is not resistant to vancomycin and is suitable for reducing microbial contamination (decontamination) of labile biological products, as well as materials infected with bacterial pathogens.

The problem is solved by the fact that the proposed strain Enterococcus mundtii PPHS-5-13, producing a substance of peptide nature (bacteriocin) with antilisteriosis activity, not resistant to vancomycin.

The strain Enterococcus mundtii PPHS-5-13 was deposited in the State collection of pathogenic microorganisms and cell cultures "GKPM - Obolensk", registration number B-7424.

The strain Enterococcus mundtii PPHS-5-13 is isolated from a dairy product (rancid milk).

The strain Enterococcus mundtii PPHS-5-13 is characterized by the following features:

Cultural - morphological characters

The strain Enterococcus mundtii PPHS-5-13 is immobile, the colonies are yellow in color with a diameter of 1-1.5 mm, the cells of the strain in smears stained by Gram, have the form of gram-positive "egg-shaped" cocci up to 2 μm in diameter, catalase-negative, grows in the presence of 2.5% sodium chloride, in the temperature range from 10 to 45 ° C. The strain is not hemolytic, microaerophyll.

Biochemical signs

Biochemical properties were determined using rapid ID API 32 STREP systems (Bio-Merieux, France). Hydrolyzes arginine, with the help of glucosidases and galactosidases, they break down some oligosaccharides, but not raffinose and sorbose. It ferments ribose, mannitol, lactose, sucrose, maltose, tagatose, trehalose. Able to form acetylmethylcarbinol from glucose, ferment pentatomic alcohol arabit, but does not have urease activity. Sensitive to vancomycin (MPC - less than 4 mg / ml).

The strain Enterococcus mundtii PPHS-5-13 produces a peptide substance - bacteriocin with antilisteriosis activity.

Studies on the identification of the strain that we isolated using a MALDI - TOF BioTyper mass spectrometer (Microflex, Bruker Daltonik GmbH) yielded fairly high indicators of the level of probability of determination to the level of the species (2,300-2,500 or +++), which made it possible to draw a conclusion about its proximity to a museum strain from the German collection - Enterococcus mundtii 4840 DSM. Specification of the species affiliation of the strain based on DNA genetic typing was carried out in PCR with primers flanking the tuf, spacer 16S-13S rDNA, rpoA, gap genes. The amplicons were synthesized with two pairs of primers: tuf and spacer 16S-13S rDNA. The sequenced spacer sequence and the sequences studied for DNA of isolated colonies coincided over 470 nucleotides in the direction from 23S rDNA. The similarity at the level of 97-98% for E. mundtii ATCC 43186, determined according to the BLAST program, allowed us to confidently attribute the found strain to the species Enterococcus mundtii.

Thus, based on the totality of the studies, the patented strain is classified as Enterococcus mundtii and deposited as Enterococcus mundtii PPHS-5-13 (hereinafter, strain PPHS-5-13).

The peptide substance of strain PPHS-5-13 isolated from the culture medium inhibits the growth of 23 pathogenic strains of the species Listeria monocytogenes, and also inhibits the growth of Acinetobacter lwoffii to varying degrees; Pseudomonas aeruginosa 468; Staphylococcus aureus 46; Klebsiella pneumoniae 114; Enterobacter cloacae 190; Salmonella enteritidis 237; Shigella sonne ½ and Campylobacter jejuni (collection of SSC PMB)

Strain PPHS-5-13 is not toxic to white mice by oral feeding of each individual 100 mg of dry culture, immobilized in a commercial feed pellet. The strain retains the ability to produce bacteriocin in the intestine and after its repeated isolation from the fecal mass of mice.

A method for growing strain PPHS-5-13 on solid and liquid nutrient media based on casein hydrolysates or fish meal produced by the SSC PMB with the addition of glucose or sucrose, yeast extract, citrate, sodium salts, magnesium in fermenters up to 100 liters at a controlled temperature is proposed. pH and optical density. Separation of cells and obtaining acellular fluid containing bacteriocin is carried out by separation in the field of centrifugal forces or membrane filtration. Concentration of acellular liquid (supernatant-permeate) is carried out in two stages: by approximately 10-fold evaporation on a vacuum rotary evaporator, followed by removal of the aqueous phase by spray drying.

Extraction of the active principle (bacteriocin fraction) is carried out by phase separation from the rehydrated supernatant powder using an organic solvent, which allows removal of up to 96-98% (by weight) of ballast components. The presence of the peptide substance - bacteriocin in the concentrate and the assessment of its activity and molecular weight are determined by electrophoresis in the system of tricin-SDS-polyacrylamide gel.

The peptide nature of the bacteriocin substance is confirmed by the presence of a Coomassie-stained strip on the gel plate, its correspondence to the molecular marker and the presence of a listeria inhibition zone at the location of the strip. The peptide nature is also confirmed by the complete loss of activity after treatment of the substance with proteolytic enzymes-chymotrypsin and proteinase K.

The invention is illustrated by the following graphic materials:

Figure 1 - The colony of strain PPHS-5-13 with a diameter of 2 mm gives a zone of 35 mm on the lawn L. monocytogenes 776.

Figure 2 - Biotesting of the supernatant concentrate strain PPHS-5-13 (1) and the active fraction (2), eluted from the HPLS chromatographic column: electrophoresis in the system of tricin-SDS-PAGE, markers (M) Page Ruler from 3.4 to 100 kDa, agar is inoculated with L. monocytogenes 776.

Example 1. Strain PPHS-5-13 is isolated from rancid cow milk according to the following scheme: milk is stored at a temperature of 0-5 ° C in an open plastic container for 3-4 weeks. After signs of spoilage and the smell of rancidity appear, milk samples are taken to isolate the grown crops. The sample is diluted with sterile distilled water (1: 1) and thermostated at 30 ± 1 ° C. After 24 hours, aliquots of the sample are plated on the timing - agar (production of SSC PMB) from a series of ten-fold dilutions, starting from the 5th and the 8th dilution . On colonies of microorganisms grown on a medium in a Petri dish with a number of no more than 50, molten nutrient agar (45 ± 5 ° С), previously inoculated with the test strain Listeria monocytogenes 776, is layered. Inoculated plates are incubated for 18-24 hours at a temperature (37 ± 0.5) ° C. When viewing the cup, the presence of zones of inhibition of the indicator strain around the colonies is noted and the most antagonistically active ones are transferred to fresh nutrient agar for the subsequent production of a pure culture. In FIG. Figure 1 shows the zones of growth inhibition of the test strain of Listeria monocytogenes 776 formed by colonies of pure culture of strain PPHS-5-13.

Colonies that gave the largest dimensions of the zone of inhibition are selected for subsequent studies. After several passages, the pure culture is biochemically identified on test systems API ID 32 STREP and ID 50 CH (Biomerieux, France) in accordance with the manufacturer's instructions.

According to the results of cultural and biochemical properties, strain PPHS-5-13 is defined as capable of growth in the temperature range of 10-45 ° C, in the presence of 2.5% sodium chloride, as optionally anaerobic, non-hemolytic, non-catalase-forming and immobile microorganism, forming yellow pigment.

Out of 49 carbohydrates (galactose, glucose, fructose, mannose, beckon, N-acetylglucosamine, amygdalin, arbutin, esculin, salicin, cellobiose, maltose, lactose, sucrose, trehalose, raffinose, glycogen, gentiobiosis, turanose, tagatosis, etc.) test API 50 CHL strain PPHS-5-13 ferments most (44) of them, with the exception of glycerol, sorbitol, α-methyl-D-mannoside, melibiosis and starch. Table 1 presents comparative data on the biochemical properties of the strain PPHS-5-13 and the known strain of E. mundtii ST4SA.

Table 1 Comparison of the carbohydrate fermentation profiles of the patented strain PPHS-5-13 with the known Enterococcus mundtii ST4SA strain API Test No. 50 ** Carbohydrate Name Carbohydrate Metabolism: Yes (+) or No (-) Enterococcus mundtii PPHS-5-13 Ε. mundtii ST4SA * one Glycerol - + 19 Sorbitol - ++ twenty α-methyl-D-mannoside - ++ thirty Melibiose - ++ 36 Starch - + D-tagatose + - (*) US Pat. 8444998, (**) API 50 CHL (Biomerieux, Marcy-Letual, France)

Strain PPHS-5-13, as follows from the data in table 1, does not ferment glycerol, sorbitol, α-methyl-D-mannoside (methyl mannoside), melibiosis, starch, but ferments tagatose, which distinguishes it from E. mundtii ST4SA.

DNA analysis was performed in PCR with primers flanking the tuf, spacer 16S-23S rDNA, rpoA, gap genes. The amplicons were synthesized with two pairs of primers: tuf and spacer 16S-23S rDNA. The spacer sequence and DNA sequence from isolated colonies coincided for 470 nucleotides in the direction from 23S rDNA, with the exception of one position.

Sequence Passport - KF633469 (Links EMBL, Genbank, DDBJ). Description: Enterococcus mundtii strain SCPM-Obolensk: PPHS-5-13, 16S ribosomal RNA gene, partial sequence; 16S-23S ribosomal intergenic RNA spacer, full sequence; and 23S ribosomal RNA gene, partial sequence. Length 434 pairs, sequence:

1 GTCCCACCACGAGAGTTTGTAACACCTGAAGTCGGTGAGGTAACCTTTTGGAGCCAGCCG 60

61 CCTAAGGTGGGATAGATGATTGGGGTTAGAGTCGTAACAAGGTAGCCGTATCGGAAGGTGC 120

121 GGCTGGATCACCTCCTTTCTAAGGAATATTACGGAGACTACACACGTTTGTCGATACTTT 180

181 GTTCAGTTTTGAGAGGTCTACTCTCAAAATTTTTGTTCATTGAAAACTGGATATTGAAGTA 240

241 AAAATGTAAGTAATACAAACCGAGAACACCGCGTTGAATGAGTTTTTTAATAAGTTCAAT 300

301 TGCTTATTTTTCTTGATTGGACTTCTATCGCTAGAAGAAAGATCAAAACCCAACCGCAAG 360

361 GTTGATAAGGTTAAGTGAATAAGGGGCGCACGGTGGATGCCTTGGCACTAGGAGCCGATGA 420

421 AGGACGGGACTAAC 434

Comparison of the entire fragment presented in BLAST showed that it is similar to E. hirae ATCC 9790, and the intergenic region only to E. mundtii ATCC 43186 (similarity 87-98%). At the same time, similarity with other representatives of the same species is worse both in the gene region and in the intergenic region.

Based on the studies of physiological-biochemical and molecular genetic studies, as well as taking into account the formation of a yellow pigment by the microorganism, which is not characteristic of the species E. hirae, strain PPHS-5-13 is assigned to the species Enterococcus mundtii and deposited as Enterococcus mundtii PPHS-5- 13.

The identified culture of strain PPHS-5-13 is mixed with a lactose-polyglucin protective medium and a suspension with a concentration of microbial cells - about 12 × 10 ⁹ CFU / cm ^{3 is} poured into glass ampoules (3 cm ³ ) of 0.5 cm ³ . Then, the suspension in ampoules is lyophilized on a Virtis 4K (USA) apparatus, and upon completion of the process, the ampoules are filled with inert gas with argon and aseptically sealed. Ampoules are stored at a temperature of (4-8) ° C, followed by re-laying after five years. Saline is used to rehydrate and restore the culture.

Example 2. Conditions and modes of cultivation of strain PPHS-5-13

To determine the ability of strain PPHS-5-13 to grow and produce antimicrobial substances on liquid nutrient media, small (6 L) and large (60 L) working volumes are cultured in flasks and fermenters.

Preparing a nutrient medium of the following composition (g / l): hydrolyzate casein hydrochloric acid - 5; yeast extract - 5; sodium citrate - 3; sucrose - 20; sodium chloride - 3; magnesium sulfate - 0.05; potassium phosphate 2-deputy. - 1. A pH of 6.8-7.1 units. The prepared medium is poured into 150 ml into 10 rocking flasks with a capacity of 750 ml.

The flasks are placed in a shaker 120 rpm, at 30-37 ° C, the cultivation time up to 20 hours. Every 2 hours, one flask is removed to determine the total number of cells (OD _{550 nm} ) and the antimicrobial activity of the culture fluid (supernatant) in relation to the test strain of Listeria monocytogenes 776 listeria. The pH value is previously set in the supernatant to 6.0 ± 0.5 ( KOH additive), and, possibly, hydrogen peroxide present therein is destroyed by the addition of the catalase enzyme (1 mg / ml). The prepared samples are applied (10 μl) to a freshly seeded lawn of a test culture.

Cultivation of the culture in a liquid medium continues until the maximum antimicrobial activity is reached, as a rule, after reaching a maximum, usually by 10-12 hours, the activity begins to decrease and this is a signal to complete the cultivation process. The optimal indicator is the accumulation in the culture fluid of activity at the level of 6400-12800 AU / ml against the test strain Listeria monocytogenes 776.

To prepare a representative amount of the antimicrobial peptide substance, bacteriocin, the cultivation of strain PPHS-5-13 is carried out in a 10-liter laboratory fermenter (NBS, USA; ZU, Russia) using culture from flasks in the following medium (g / l) as seed ): hydrolyzate casein hydrochloric acid - 5; yeast extract - 5; sodium citrate - 3; sucrose - 20; sodium chloride - 3; magnesium sulfate - 0.05; potassium phosphate 2-deputy. - 1. A pH of 6.8-7.1 units.

The nutrient medium of the above composition, poured into the fermenter, is inoculated with seed material of strain PPHS-5-13, containing about 109 microbial cells per ml (according to Tarasevich). The volume of seed is 5% of the volume of the nutrient medium in a 10 liter fermenter. The main parameters and cultivation conditions of the strain PPHS-5-13 in the fermenter are shown in table 1.

Table 1 The cultivation parameters of strain PPHS-5-13 in a 10 L fermenter and the achieved parameters for optical density and antilisterial activity of the culture fluid Growth time, h Temperature ° C PH support * Stirrer rpm Aeration, l / min Reachable ** PO OD (550 nm) According to AA QL 11.0 ± 1.5 34.0 ± 1.0 6.0 ± 0.5 220-450 3 ± 1 2.8 ± 0.6 12800 AU / ml (*) correction by the introduction of a 20% solution of KOH. (**) OD - optical density of the culture fluid (QL), AA - antimicrobial activity against test strain 776 Listeria monocytogenes, measured in arbitration units per ml (AE / ml).

At the end of the cultivation process, the culture fluid (QL) is freed from the cells (Beckmann centrifuge, 8000 rpm, 5 ° C, 45 min) and evaporated on a rotary vacuum evaporator 10 times. The supernatant concentrate is subjected to spray drying at the following parameters: inlet / outlet temperature -110 ° C / 90 ° C, fluid flow - about 17 ml / min, air flow - 100 m / h. The resulting dry powder with a residual moisture content of up to 6% has an activity of 100 to 400 AU / mg and can be used to prepare feed additives, medical or decontaminating solutions. Dry powder can be further purified from impurities and further used for analytical studies.

Example 3. Partial purification of the antimicrobial peptide substance of bacteriocin. For partial purification of the bactericidal substance from the supernatant concentrate, the method of salt precipitation using ammonium sulfate or the phase separation method using an organic solvent is used.

A supernatant powder containing a bactericidal substance with an activity of 100 AU / mg, taken in an amount of 10 g, was diluted in 100 ml of sterile distilled water to a concentration of 100 mg / ml and thoroughly mixed until completely suspended. Then, up to 60% solid ammonium sulfate is added to 100 ml of the suspension, the mixture is stirred and placed in the refrigerator for 24 hours (temperature 4 ° C). After this time, the glasses are placed in a centrifuge and sedimented at 25000 G for 20 minutes at a temperature of 0-5 ° C. The supernatant is removed, and 50-100 ml of distilled water is added to the precipitate in the glasses until the precipitate is completely dissolved. The resulting solution was dialyzed against distilled water for one day. The yield relative to the total estimated amount of bacteriocin was 30%, the specific activity was 10 AU / mg against Listeria monocytogenes 776. The time spent was more than 2 days.

Another method of partial purification of the bacteriocin substance was the use of phase separation using a low-boiling, water-insoluble organic solvent. A supernatant powder containing a bactericidal substance at a concentration of 100 AU / mg, taken in an amount of 10 g, was diluted in 100 ml of sterile distilled water to a concentration of 100 mg / ml and thoroughly mixed until completely suspended. Next, 120 ml of an organic solvent of dichloromethane (DCM) was added to 100 ml of the suspension, and the mixture was homogenized for 30 minutes on a mixer at a speed of 1000 rpm to form a stable emulsion. The resulting emulsion in a volume of 220 ml is poured into 2 metal cups of 110 ml each, installed in a Buckmann centrifuge bucket rotor and centrifuged at 5000 rpm for 30 minutes to collect the concentrated emulsion as an interphase at the phase boundary (water / DCM) films (IFP). The IFP is selected by draining the upper light (water) and then lower heavy phase (DXM), which are then discarded, and the IFP is dried at 90 ° C to constant weight. As a result of phase separation, more than 98% of the ballast mass, which is a component of the nutrient medium, mineral salts and metabolites, is removed. The output of the active substance is up to 95% of the activity from its initial level, while no more than 3 hours are spent for its production. The resulting dry powder with a specific activity of 2000-3000 AU / mg is a coarse fraction of bacteriocin. Further purification for molecular studies can, if necessary, be carried out by conventional column chromatography methods.

Example 4. Physico-chemical and biological properties of the crude fraction of bacteriocin

The peptide nature of the bacteriocin fraction is confirmed by precipitation in the treatment with ammonium sulfate, a classical method widely used for primary protein purification. Other facts proving the peptide nature is the degrading effect of proteolytic enzymes, as well as the identification of an individual peptide band in an electrophoreogram in the Tricin-SDS-PAGE system.

Table 2 presents the results of the influence on the activity of bactericin of proteolytic enzymes, pH and high temperatures.

table 2 The effect of proteolytic enzymes, pH and high temperatures on the activity of bacteriocin. Enzymes *, pH and temperature Activity** Initially, no processing + Chymotrypsin (pH 6-7) - Proteinase K (pH 6-7) - 100 ° C, 30 min (pH 2-10) + 121 ° C, 20 min (pH 6-7) + 121 ° C, 20 min (pH 10) - (*) concentration of enzymes - 10 mg / ml
(**) + there is activity, - there is no activity

From the data presented in table 2, it follows that proteolytic enzymes inactivate bacteriocin activity, a combination of high temperature 121 ° C, 20 min (pH 10) also inactivates bacteriocin, which corresponds to the description of the properties of bacteriocins classified as class 2 according to Yuepppatteg T.R. (1988).

The molecular weight of the bacteriocin in the coarse fraction was determined in the Tricin-SDS-PAGE electrophoresis system using markers at a constant voltage of 200 volts for 2.5 hours. Biotesting, i.e. the antilisterial activity of the detected bands was carried out on a Petri dish in which the stained gel was placed and it was poured with L. monocytogenes 776 test agar culture. Comparison of the peptide bands with the inhibition zone and marker indices makes it possible to evaluate the molecular weight of the studied peptide. The picture of figure 2 shows the results of a biotesting of the bacteriocin fraction Enterococcus mundtii PPHS-5-13: the active peptide is visible in the form of a strip corresponding to a molecular weight of slightly less than 5 kDa.

Example 5. The antimicrobial properties of the bacteriocin of strain PPHS-5-13 were checked by applying a coarse peptide fraction to freshly sown lawns of listeria strains from among those deposited in the collection of microorganisms of the SSC PMB: L. monocytogenes EGDE; 10527; Gim 003; A; EGD; 766; 10357; C644; S-52; 11994; 7973; 4908; 4913; 944; 2; 6; M-5; 12 PI; 13 PI; 20 IP; 46 IP; 53 IP; 766 SP. The growth of all 23 of these strains was inhibited by adding a coarse bacteriocin fraction to the freshly prepared lawn of these cultures at a concentration of 15 mg / ml. Non-pathogenic listeria strains belonging to the species L. ivanovii 4912, L. ivanovii ATCC 19119, L innocua NCTC11288, L. welshimeri, L. seeligeri SLCC5981 were even more sensitive to bacteriocin PPHS-5-13.

Thus, of the 23 species that are most commonly found pathogenic Listeria, all of them were sensitive to the peptide substance of strain PPHS-5-13. The antimicrobial substance of strain PPHS-5-13 was active to varying degrees against other gram-positive and some gram-negative pathogenic microorganisms. So, when determining the minimum inhibitory concentration (MPC) of the coarse fraction of bacteriocin taken at a concentration of 15 mg / ml by dry weight, but calculated on the total protein content, the following results were obtained: Acinetobacter Iwoffii 125 - 0.2 μg / ml; Pseudomonas aeruginosa 468 - 3.45 μg / ml; Staphylococcus aureus 46 - 0.4 μg / ml; Klebsiella pneumoniae 114 - 1.7 μg / ml; Enterobacter cloacae 190 - 0.86 μg / ml; Salmonella enteritidis 237 - 0.86 mcg / ml; Shigella sonne ½ - 0.2 μg / ml and Campylobacter jejuni - 0.86 μg / ml.

The bacteriocin fraction isolated from the cultivation medium of strain PPHS-5-13 inhibited the growth of B. anthracis 34F and B. anthracis 220 strains — the diameter of their inhibition zone was 7.2 and 6 mm, respectively.

Example 6. Decontaminating activity of a liquid preparation of the peptide substance of strain PPHS-5-13 on samples of native broiler skin

The antimicrobial activity of liquid bacteriocin preparations was studied in experiments with native carcass skin of commercial broilers. The broiler skin treatment algorithm is borrowed from Dickens et. al. (2000) on the evaluation of the decontaminating properties of drugs used in the production of broilers in the United States (2005). Skin samples were obtained from commercial broilers stored in the cold after slaughter for 3 days. The skin using a steel punch was cut into circles with an area of 4.5 cm ² each and was infected with a mixture of Listeria and Salmonella taken at a concentration of 2.5 × 10 ⁸ cells / ml of each type (dilutions according to Tarasevich’s GISK standard), and applied in an amount 100 μl per skin sample. After incubation for 30 minutes at room temperature, the surface of the skin samples was irrigated with a liquid preparation of the peptide substance of strain PPHS-5-13, taken in a volume of 100 μl. Treated samples after 1 min of exposure were placed vertically to drip for 3 minutes, and then they were transferred to a refrigerator (3-5) ° C for 45 minutes to prevent possible bacterial growth. After this time, the samples were washed vigorously with sterile distilled water in a volume of 3 ml per sample, and the collected water was examined for the total aerobic content. Table 3 presents the results of a study of the decontaminating effect of the PPHS-5-13 peptide fraction on broiler skin infected with Salmonella and Listeria.

Table 3 Seeding rate of infected broiler skin after treatment with PPHS-5-13 antimicrobial No. of samples Chicken skin samples The content of aerobes in washes, × 10 ³ CFU / ml Incidence rate one Native skin (control) 349 Zero* 2 Salmonella and Listeria infected skin 2330 one hundred% 3 Salmonella and Listeria-infected skin, followed by PPHS-5-13 690 29.6% Note. (*) the level of initial contamination of the skin in the control is taken as zero

From the data presented in table 3, it follows that when the broiler skin was irrigated with a peptide substance PPHS-5-13, the aerobic content decreased by 70.4%, almost to the initial level without the use of chemicals and antibiotics.

Claims (1)

The strain Enterococcus mundtii PPHS-5/13, producing a peptide substance with antilisterial activity, deposited in the State collection of pathogenic microorganisms and cell cultures "GKPM - Obolensk", registration number B-7424.

Images