RU2525938C1 - Set of oligonucleotide primers and fluorescently labelled probe for species-specific express-identification of rna of junin virus by method of polymerase chain reaction in real time - Google Patents

Abstract

FIELD: chemistry.

SUBSTANCE: invention deals with a set of oligonucleotide primers and a fluorescently labelled probe for species-specific express-identification of RNA of the Junin virus by a method of a polymerase chain reaction in real time. The claimed set includes sequences of oligonucleotides, species-specific for the Junin virus and having the following structure: external: 5'→3' 5' TCTTCTTCCCCCYTTTTAGTCTTTCT 3' internal: 5'→3' 5' CGCACAGTGGATCCTAGGCA 3' probe: FAM - TGAGTCCATCTAAAGCTTGGNACCTCCTT - BHQ1.

EFFECT: possibility of the application in medicine and epidemiology for determination of a genetic material of the Junin virus in clinical or sectional samples.

2 dwg, 1 tbl, 2 ex

Description

The invention relates to sets of oligonucleotide primers and a fluorescently labeled probe for species-specific rapid identification of Junin virus RNA by real-time polymerase chain reaction and can be used in medical practice to identify the genetic material of Junin virus in clinical or sectional samples to clarify the diagnosis, as well as to solve research tasks to study the properties of the Junin virus, the creation of diagnostic, prophylactic or therapeutic drugs against the virus unin. The use of specific primers and probes makes it possible to identify the genetic material of the Junin virus in the studied samples by the method of polymerase chain reaction (PCR) with hybridization-fluorescence detection in real time.

The Junin virus is a member of the genus Arenavirus of the Arenaviridae family (http://www.ictvonline.org/virusTaxonomy.asp?version=2011). The viral genome is segmented (L- and S-segments) and is represented by single-stranded RNA.

Junin virus is the causative agent of Argentine hemorrhagic fever - an acute infectious disease characterized by natural foci; aspiration (air-dust path), fecal-oral and contact pathogen transmission mechanisms; severe course with general intoxication syndrome, exanthema, hemorrhagic syndrome.

The endemic areas for infection, with a total area of about 150,000 km ² , are the provinces of Argentina. Outbreaks of the disease with the number of cases from 100 to 3500 people are recorded annually. However, according to rough estimates, the potential risk in the endemic territory of this infection is for 5 million people. The carriers of the Junin virus and the source of infection for humans are rodents Calomis laucha and Calomis musculinus, which secrete the virus with saliva and urine. People become infected through contact with infected animals, their excrement, and urine containing the virus. The disease is recorded more often among residents of rural areas [Markin V.A., Pantiukhov V.B., Markov V.I., Bondarev V.P. Argentine hemorrhagic fever // ZhMEI. - 2012. - 2. - Page 78-87].

Mortality in cases of Argentine hemorrhagic fever disease ranges from 15 to 30%.

The relevance of timely diagnosis of Junin fever in countries that are not endemic territories is associated with the possibility of importation of this infection from South America.

          A known test system for the diagnosis of Argentine hemorrhagic fever based on the ELISA method with the ability to determine the presence of specific immunoglobulins for the Junin virus [S., H., T. et al. Serological Assays Based on Recombinant Viral Proteins for the Diagnosis of Arenavirus Hemorrhagic Fevers // Viruses. - 2012 .-- 4 (10). - P.2097-114].

     However, class M immunoglobulins appear 10-20 days after infection, which leads to late diagnosis of the disease.

     The closest analogue (prototype) is a PCR test system for detecting Junin virus RNA by real-time reverse transcription. [Vieth S., Drosten Ch., Charrel R. et al. Establishment of conventional and fluorescence resonance energy transfer-based real-time PCR assays for detection of pathogenic New World arenaviruses // J. Clin. Virol. - 2005. - 32. - P.229-35]. Polymerase chain reaction (PCR) is a method of early diagnosis of this infection and allows you to detect Junin RNA in the early days of the onset of clinical signs [Lozano M.E., Enría D., Maiztegui J.I. et al. Rapid diagnosis of Argentine hemorrhagic fever by reverse transcriptase PCR-based assay. // J Clin Microbiol. - 1995 .-- 33 (5). - P.1327-1332].

However, the sensitivity of the above test system was about 50 TCD ₅₀ / reaction, and the analytical sensitivity was about 1000 genomic equivalents / reaction.

The technical result of the claimed invention is the development of a more sensitive set of specific oligonucleotide primers and probe for detecting the genetic material of the Junin virus in clinical samples and biological fluids, environmental samples and other virus-containing samples (culture virus-containing liquid, etc.) by RT-PCR with hybridization-fluorescence real time detection.

The specified technical result is achieved by the fact that the set of oligonucleotide primers and fluorescently labeled probe for species-specific rapid identification of RNA of the Junin virus by real-time polymerase chain reaction includes oligonucleotide sequences species-specific for the Junin virus and having the following structure:

external:

5΄ → 3΄ 5΄ TCTTCTTCCCCCYTTTTAGTCTTTCT 3΄

interior:

5΄ → 3΄ 5΄ CGCACAGTGGATCCTAGGCA 3΄

probe:

FAM - TGAGTCCATCTAAAGCTTGGNACCTCCTT - BHQ1

The invention is illustrated by the following graphic materials. In FIG. Figures 1 and 2 show the fluorescence curves on the R6G / Yellow channel (530 nm / 555 nm) of the Rotor Gene 6000 amplifier.

The appendix contains oligonucleotide sequences, species-specific RNA of the Junin virus.

The method of obtaining a set of primers and probe. Diagnostic primers and a fluorescently-labeled probe were designed for the S-segment of the Junin virus genome and optimization of the concentrations of the components of the reaction mixture and PCR conditions. To control amplification, recombinant plasmids containing the virus-specific region of the DNA template were obtained.

At the initial stage, the analysis of the nucleotide sequences of the Hunin virus genomes available in the NCBI database (http://www.ncbi.nlm.nih.gov/) was performed, and conservative sites were determined. As a target for diagnostic primers and a probe, a section of the N gene encoding a nucleocapsid protein located in the S segment of the viral genome was selected.

The analysis of the properties of oligonucleotide primers and probes was carried out using the Vector NTI 9.0.0 (InforMax) program.

To identify the genetic material of the Junin virus by real-time PCR, primers and probe were selected, which are presented below:

F / junv TCTTCTTCCCCCYTTTTAGTCTTTCT R / JUNV CGCACAGTGGATCCTAGGCA Z / JUNV (FAM) -TGAGTCCATCTAAAGCTTGGNACCTCCTT- (BHQ1)

Example 1. Verification of the analytical sensitivity of a set of primers and probes.

To control amplification, positive control samples (PSC) were obtained, which are recombinant plasmids carrying virus-specific inserts, which are the template for amplification of virus-specific DNA fragments.

For real-time PCR, recombinant plasmid DNA was used as the analyzed samples, including a DNA insert corresponding to the detected part of the Junin virus genome.

The amplification conditions were optimized by the following parameters: the concentration of magnesium ions in the reaction mixture; the concentration of primers and probe in the reaction mixture; primer annealing temperature.

To determine the analytical sensitivity of the concentrated plasmid DNA solution, serial 10-fold dilutions were prepared. DNA concentration was determined using a QUBIT fluorimeter (Invitrogen, USA) and reagent kits of the same manufacturer. Real-time PCR for detecting the genetic material of the Junin virus was carried out in a Rotor Gene 6000 instrument (Corbett Research, Australia), the amplification results were detected (Figure 1) using the FAM / Green channel (470 nm / 510 nm).

In FIG. Figure 1 shows the fluorescence curves on the FAM / Green channel (470 nm / 510 nm) of the Rotor Gene 6000 amplifier (Corbett Research, Australia). Designation of samples containing different concentrations of the DNA template and positive control sample (FFP): 1 - 10 ⁹ GE; 2 - 10 ⁸ HE; 3 - 10 ⁷ HE; 4 - 10 ⁶ HE; 5 - FFP; 6 - 10 ⁵ HE; 7 - 10 ⁴ HE; 8 - 10 ³ HE; 9 - 10 ² HE in the sample.

The minimum amount of DNA matrices detected in PCR after optimization of the reaction conditions, expressed in GE (genomic equivalents), was 10 ² GE in the sample.

Example 2. The definition of RNA of the Junin virus in virus-containing samples.

Samples were inactivated and RNA was isolated under the conditions regulated by the Methodological Instructions of MU 1.3. 2569 -09 “Organization of the work of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I – IV”.

To assess the specificity, several samples of the virus-containing culture fluid were used, obtained using various cell cultures - Vero, Vero E6 and brain homogenates of mouse suckers with a Junin virus titer from 2.6 × 10 ⁴ TCD ₅₀ / ml to 8.9 × 10 ⁵ TCD ₅₀ / ml.

The procedure for isolating RNA from the test material was carried out using the Ribo-sorb reagent kit (FGUN TsNIIE Rospotrebnadzor) in accordance with the instructions for use.

The reverse transcription reaction was carried out using the Revert-L reagent kit (FGUN TsNIIE Rospotrebnadzor) in accordance with the instructions for use.

Real-time PCR was carried out in the reaction mixture of the following composition (for 1 study):

cDNA 5 μl 10 × Taq buffer without Mg ²⁺ 3 μl 100 mM MgCl ₂ solution 1 μl 5 mM dNTP solution 1 μl A mixture of primers and probes (2 p.u. each) 1 μl each Smart Taq DNA Polymerase 5 u / μl 0.3 μl Water for PCR Up to 30 μl of total volume

Real-time PCR and results were recorded in a Rotor Gene 6000 instrument (Corbett Research, Australia) according to the following program, presented in table 1.

Table 1. PCR program

Temperature ( ^° C) Time (minutes: seconds) The number of cycles 95 05:00 one 95 00:10 45 54 00:20 72 00:20

Fluorescence was measured at a temperature of 54 ^° C on the FAM / Green channel.

The results were interpreted based on the presence (or absence) of the intersection of the fluorescence curve with the threshold line set at the appropriate level, which corresponds to the presence (or absence) of the threshold cycle Ct in the corresponding column in the results table. The result was considered positive if the fluorescence accumulation curve for the corresponding sample had a characteristic "sigmoid" shape and crossed the threshold line. In this case, the Ct value for this sample was no more than 40 (Figure 1).

In FIG. Figure 2 shows the fluorescence curves of samples containing Junin virus cDNA on the FAM / Green channel (470 nm / 510 nm) of the Rotor Gene 6000 amplifier (Corbett Research, Australia).

In all samples used for analysis under optimized conditions for the PCR reaction, the primers and probes used allowed the detection of Junin virus RNA.

Thus, the minimum amount of virus RNA detected in PCR after optimization of the reaction conditions, expressed in HE (genomic equivalents), was 100 GE in the sample, as a result of which the sensitivity of the claimed primers is significantly higher than the prototype.

application

<110> Federal budget institution of science "State

  Scientific Center of Virology and Biotechnology "Vector" »(FBUN

  SSC WB "Vector")

<120> A set of oligonucleotide primers and fluorescently labeled probe for species-specific rapid identification of Hunin virus RNA by real-time polymerase chain reaction

<210> 1

<223> Sequence-specific oligonucleotides for the Junin virus,

<400> 1 for the detection of Junin virus RNA:

external:

5΄ → 3΄ 5΄ TCTTCTTCCCCCYTTTTAGTCTTTCT 3΄

interior:

5΄ → 3΄ 5΄ CGCACAGTGGATCCTAGGCA 3΄

probe:

FAM - TGAGTCCATCTAAAGCTTGGNACCTCCTT - BHQ1

Claims (1)

A set of oligonucleotide primers and a fluorescently labeled probe for species-specific rapid identification of Junin virus RNA by real-time polymerase chain reaction, including oligonucleotide sequences species-specific for Junin virus and having the following structure:
external:
5΄ → 3΄ 5΄ TCTTCTTCCCCCYTTTTAGTCTTTCT 3΄
interior:
5΄ → 3΄ 5΄ CGCACAGTGGATCCTAGGCA 3΄
probe:
FAM - TGAGTCCATCTAAAGCTTGGNACCTCCTT - BHQ1

Images