RU2525934C1 - Method of specific differentiation of viable rhodococcus immobilised in gel carrier - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: granule of biocatalyst with the cells contained in it of one or more species of Rhodococcus is placed in a well of a 96-well plate, a colorant iodine-nitro-tetrazolium (INT) is added. After the appearance of specific purple staining formazan the optical density of granule is measured using a tablet photometer. In the case of a stained substrate or preliminary presence of the immobilised biocatalyst in the soil the extraction of formazan is carried out with 96% ethanol and the optical density of the extract is measured. The amount of viable Rhodococcus in the granule of the gel is determined using the calibration dependency diagram of the optical density on the number of living cells in suspension as determined by traditional method of plating on solid growth medium. Then, from the granule stained by the colorant of the biocatalyst or from the granule after extraction of the colorant the DNA is isolated and PCR is performed using sets of species-specific primers. The specific position of the immobilised Rhodococcus is determined.

EFFECT: invention enables to reduce the time differentiation of Rhodococcus and to improve the accuracy of the method.

2 cl, 3 tbl, 4 dwg, 4 ex

Description

The invention relates to industrial microbiology and biotechnology, in particular to methods for detecting microorganisms in biotechnological preparations and environmental objects, and is intended for differentiated determination of the number of viable actinobacteria of the genus Rhodococcus immobilized in a water-insoluble gel carrier. Rhodococci, characterized by high activity of the oxygenase enzyme complex and dominating in contaminated soil microbiocenoses, are one of the most developed bacterial groups in modern biotechnology, promising for the creation of biocatalysts of the processes of destruction and transformation of organic compounds of all known classes [Ivshina IB State and problems of development of specialized centers of microbiological resources in Russia // Microbiology. - 2012. - T.81. No. 5, - S.551-560]. In connection with the increasing use of immobilized biocatalysts in biotechnology, in particular fermentation processes and in the treatment of contaminated water and soil, an urgent problem is to control the viability of microorganisms enclosed in a carrier matrix.

Known cultural methods for determining the number of living microorganisms in biological products and environmental objects, based on seeding the test sample on a suitable nutrient medium, but they are not intended for the detection of microorganisms immobilized in water-insoluble gels, which is associated with the difficulties of their isolation from the gel carrier. A direct count of the number of microorganisms under a microscope is also used, but its use is limited for opaque samples, in particular gels with microbial cells enclosed in them. Therefore, when studying the viability of cells immobilized in a gel, indirect biochemical methods are mainly used, for example, the luciferin-luciferase method for determining the amount of ATP [Efremenko EN, Tatarinova N.Yu. The effect of long-term storage of cells of microorganisms immobilized in polyvinyl alcohol cryogel on their survival and biosynthesis of target metabolites // Microbiology. - 2007. - T.76, No. 3. - S. 383-389].

The essence of the method is to carry out the ATP reaction catalyzed by the enzyme luciferase with the protein luciferin and oxygen. The biocatalyst granules are placed in DMSO to extract intracellular ATP, then luciferin-luciferase reagent is added to the obtained extract and the luminance intensity is determined using a luminometer. The exact concentration of ATP is determined from the calibration graph using standard ATP solutions of known concentration. Next, calculate the number of viable immobilized microorganisms using the calibration dependence of the concentration of ATP on the number of living cells of the microorganism in suspension, determined by the traditional method of seeding on a solid nutrient medium. The advantages of this method are (1) universality with respect to various carriers and microorganisms of different systematic groups, (2) the absence of a dependence of the intracellular ATP concentration on the physiological state of the cells, and (3) the high sensitivity of the method.

However, in this way it is impossible to detect microorganisms, that is, to determine their species position. The disadvantages of the method can also be attributed to its duration and the complexity associated with obtaining calibration dependencies, as well as the need to use expensive equipment and a set of reagents. In addition, the disadvantage of this method is the inability to control the extraction efficiency of intracellular ATP using DMSO, which can vary significantly among different microorganisms depending on the structure of their cell wall.

A known method of detecting live, damaged and dead cells of microorganisms using flow cytometry [Patent No. 2384624], which allows the detection of microorganisms stained with fluorescent dye at the level of one cell. However, this method is unsuitable for microorganisms immobilized in water-insoluble gels, since it requires the isolation of microorganisms in a liquid medium and the passage of a liquid stream in a flow cell of a cytofluorimeter. In addition, using this method it is impossible to determine the species position of the microorganism.

We previously described a method for determining the number of viable rhodococci immobilized in a polyvinyl alcohol cryogel based on vital staining of gel granules with iodonitrotetrazolium (INT) in a 96-well plate and determining the intensity of the violet color of the granules resulting from the restoration of colorless INT to red-violet formazan in the presence of living actively respiratory microorganisms using a plate photometer [Kuyukina MS, Ivshina I.V., Gavrin A.Yu., Podorozhko EA, Lozinsky VI, Jeffree CE, Philp J.C. Immobilization of hydrocarbon-oxidizing bacteria in polyviny l alchohol) cryogels hydrophobized using a biosurfactant // J. Microbiol. Methods - 2006. - V.65. - P.596-603]. The resulting formazan was extracted from the gel granules with ethyl acetate, and then the optical density of the extract was determined. However, using this method, it is impossible to determine the species position of immobilized bacteria.

There are methods for the differentiated determination of microorganisms immobilized in a gel using immunological methods, in particular the use of antibodies highly specific for certain microorganisms. Thus, an immunofluorescence method is known for the selective determination of the number of lactococcal cells and brevibacteria immobilized in granules of carrageenan gel [Prioult G., Lacroix C., Turcotte C., Fliss I. Simultaneous immunofluorescent detection of coentrapped cells in gel beads // Appl. Environ. Microbiol. - 2000. V. 66 (5). - P.2216-2219; Doleyres Y., Fliss I., Lacroix C. Quantitative determination of the spatial distribution of pure-and mixed-strain immobilized cells in gel beads by immunofluorescence // Appl. Microbiol. Biotechnol. - 2002. - V.59 (2-3). - P.297-302]. The method is based on the use of polyclonal antibodies to these types of bacteria. According to the method, a gel granule with microorganisms enclosed in it was cut in half, washed with a buffer solution and incubated for 2 hours with polyclonal antibodies labeled with ALEXA fluorescent dyes (568 for lactococci and 488 for brevibacteria). After washing 4 times with buffer, the pellet was analyzed using a confocal laser scanning microscope with appropriate emission. Immunofluorescence signals were processed using special software that allows for differentiated determination of the number and distribution of microorganisms in the gel granule.

This method has several significant drawbacks, the main of which is the non-universality of the method and the need to first obtain specific polyclonal antibodies for each type of microorganism that is determined, which makes the method itself very expensive, and the scope of its possible application is very narrow. In addition, a confocal laser scanning microscope is a very expensive equipment. A significant drawback of the method is that the quantitative analysis of microorganisms is complicated by the strong dependence of the fluorescence signal on the physiological state of the cell, the chemical composition of the gel and the liquid medium, as well as the depth of the cells in the thickness of the gel, which makes obtaining reproducible results practically impossible.

Known methods for the detection of living microorganisms in various environments using polymerase chain reaction (PCR). A method for detecting living cells of a microorganism by differentiating living cells from dead cells or damaged cells in a test sample is described [Patent No. 2395583]. The method comprises the step of processing the test sample with topoisomerase poison or DNA gyrase, the step of extracting DNA from the test sample and amplifying the target region of the extracted DNA by PCR, where the length of the target region is from 900 to 3000 nucleotides, and the stage of analysis of the amplification product using gel electrophoresis . The invention allows to determine the presence of living organisms in the test sample.

The disadvantage of this method is the inability to quantify viable microorganisms.

Closest to the claimed method is a method for detecting a living cell of a microorganism in a test sample [Patent No. 2410440], comprising adding to this test sample a crosslinking agent capable of crosslinking DNA when irradiated with light having a wavelength of 350 nm-700 nm; irradiation with light having a wavelength of 350 nm-700 nm; removal of a crosslinking agent; addition of medium and further incubation; adding again a crosslinking agent capable of cross-linking the DNA when irradiated with light having a wavelength of 350 nm-700 nm, to the incubated test sample; re-irradiation with light having a wavelength of 350 nm-700 nm; extraction of DNA from this test sample and amplification of the target region of the extracted DNA; and amplified product analysis.

However, a quantitative assessment of living microorganisms in this way is not possible with simple PCR, but requires real-time PCR, which requires the use of expensive equipment, software and reagents, a more complex design of probes and primers. In addition, this method is not tested for microorganisms immobilized in water-insoluble gel carriers.

The purpose of the present invention is the development of a simple and rapid method for the quantitative detection of live immobilized Rhodococcus cells of various species and control the functional stability of biocatalysts based on water-insoluble polymer gels. The technical result is the ability to continuously monitor the viability of one or more strains of rhodococcus, enclosed in granules of a biocatalyst, quick selection of the most effective biocatalysts, as well as monitoring the survival of immobilized bacteria in biological products during their storage, use in bioreactors or environmental objects. At the same time, the number of viable cells and the species of immobilized bacteria are successively determined in the same biocatalyst granule, which reduces the analysis time, reduces the consumption of the biocatalyst sample, and allows one to selectively evaluate the effectiveness of monocomic (single-component) and polyvid (multicomponent) rhodococcal biocatalysts. The combination of INT staining and conventional PCR proposed in the present method is a simpler and more reliable method for detecting viable bacteria of a certain type. The proposed method involves the simultaneous assessment of the viability of immobilized in the gel rhodococci using vital staining with iodonitrotetrazolium (INT) and their species detection using species-specific PCR. This is necessary, for example, when several species of Rhodococcus are used at once in a bioreactor, or in contaminated water or soil, and representatives of different species are immobilized into the same granules of a gel carrier. The method consists in first determining the number of living Rhodococcus cells in the gel sample by staining with INT and measuring the optical density of the gel, and then in the same gel sample, to determine what kind these bacteria belong to by PCR with species-specific primers. If in a previously published method [Kuyukina M.S., Ivshina I.V., Gavrin A.Yu., Podorozhko E.A., Lozinsky V.I., Jeffree C.E., Philp J.C. Immobilization of hydrocarbon-oxidizing bacteria in poly (vinyl alchohol) cryogels hydrophobized using a biosurfactant // J. Microbiol. Methods - 2006. - V.65. - P.596-603] the resulting formazan was extracted with ethyl acetate, the less toxic and commonly available solvent ethanol is used in the present invention, which has a higher extraction ability with respect to formazan.

A significant difference of the claimed invention is a new combination of sequentially performed actions and the applied analysis methods (namely spectrophotometric and genetic, i.e. specific staining of gel granules, dye extraction and determination of optical density, DNA isolation and species-specific PCR) to quantify the viability of immobilized bacteria different taxonomic groups. The essence of the method lies in the possibility of isolating bacterial DNA from one gel granule pre-stained with INT, or granules from which formazan was previously extracted with 96% ethanol, and obtaining reliable results of species detection of rhodococci by PCR.

Description of the method. One gel granule 5-125 mm ³ in size with the cells of one or more species of Rhodococcus enclosed in it at a concentration of 103-109 cells / ml is placed in a well of a 96-well plate, 200 μl of INT (5 g / l) is added and after the appearance of specific violet staining (within 1-2 hours) measure the optical density of the granules using a tablet photometer at 600-630 nm. In the case when the granule with immobilized Rhodococcus is colored due to the colored gel material, the immobilized biocatalyst is in the stained liquid medium or in the soil, liquid is removed from the well of the plate, the formazan is extracted from the granule by adding 200 μl of 96% ethanol, after incubation for 1 h remove the pellet and measure the absorbance of the extract at 460-500 nm. The number of viable rhodococci in the gel granule is calculated using a calibration graph of the dependence of optical density on the number of living cells in suspension, determined by the traditional method of seeding on a solid nutrient medium.

Then, DNA is extracted from the granule pre-cut into several parts with a scalpel or from the same granule after dye extraction, and the DNA is isolated by a method providing the extraction of the maximum amount of bacterial DNA from the gel, preferably by a modified method [Amita J., Vandana T., Guleria R.S., Verma R.K. Qualitative evaluation of mycobacterial DNA extraction protocols for polymerase chain reaction // Mol. Biol. Today. - 2002. - V.3. - P.43-50], combining thermal and enzymatic lysis of Rhodococcus cells, or using a commercial kit ZR BAC DNA Miniprep Kit (Zymo Research) in accordance with the manufacturer's instructions. If the immobilized biocatalyst granules were previously found in the soil, bacterial DNA was isolated using the modified method [Dong D. Removal of humic substances from soil DNA using aluminum sulfate // J. Microbiol. Methods - 2006. - V. 66. - P. 217-222] or using the commercial ZR BAC Soil DNA Miniprep Kit (Zymo Research) in accordance with the manufacturer's instructions.

Isolated DNA is used for PCR using sets of specific primers for the corresponding species of Rhodococcus. At the same time, the PCR conditions for a specific set of primers are observed. PCR products are analyzed by electrophoresis in a 1.5% agarose gel, after staining the gel with a solution (0.5 μg / ml) of ethidium bromide and the appearance of the corresponding strips in UV light, the species position of the immobilized bacteria is determined.

Specific embodiments of the invention.

Example 1. Two samples of an immobilized biocatalyst were prepared on the basis of polyvinyl alcohol (PVA) cryogel granules with a size of 10 mm ³ with hydrocarbon-oxidizing rhodococci (106 cells / ml) enclosed in each of them — either Rhodococcus ruber IEGM 615 or Rhodococcus opacus IEGM 249 according to the described procedure [Kuyukina MS, Ivshina I.V., Gavrin A.Yu., Podorozhko EA, Lozinsky VI, Jeffree CE, Philp JC Immobilization of hydrocarbon-oxidizing bacteria in polyvinyl alchohol) cryogels hydrophobized using a biosurfactant // J. Microbiol. Methods - 2006. - V.65. - P.596-603]. 50 granules of the biocatalyst (25 granules with R. ruber and 25 granules with R. opacus) were placed in a bioreactor contaminated with petroleum hydrocarbons (2 vol.%) And incubated for 48 h. After that, a comparative assessment of the effectiveness of these strains by their viability in the presence of hydrocarbon contaminated water. For analysis, 10 granules were taken, washed from the residual hydrocarbon using a buffer solution, and placed in the wells of a 96-well plate. The granules were stained with INT for 1 h and the violet staining intensity was determined on a plate photometer at 630 nm. Then 5 colored granules were taken, formazan was extracted from them with 96% ethanol for 1 h, and the intensity of the staining of the extracts was determined on a plate photometer at 490 nm. The results were converted to the number of viable cells in the granule according to the calibration graph of the dependence of optical density on the number of cells for these strains of rhodococcus. Next, each granule was cut into 4 parts with a sterile scalpel, placed in a plastic microtube and bacterial DNA was isolated using the modified method [Amita J., Vandana T., Guleria RS, Verma RK Qualitative evaluation of mycobacterial DNA extraction protocols for polymerase chain reaction // Mol. Biol. Today. - 2002. - V.3. - P.43-50]. For this, 0.2 ml of lysis buffer (10 mM Tris, 1 mM EDTA, pH 8.0) was added to the microtube, heated to 85 ° C for 10 min, and immediately frozen at -20 ° C for 15 min. The mixture was thawed, lysozyme (20 mg / ml) was added, stirred and incubated at 37 ° C for 2 hours. The temperature of the mixture was then increased to 65 ° C, proteinase K (0.25 mg / ml) and sodium dodecyl sulfate (1%) were added. ) and incubated on a shaker for 30 min. CTAB (10%) and NaCl 0.7 M were added to the mixture to a concentration of 1%. The DNA was extracted with chloroform / isoamyl alcohol (24: 1) with gentle shaking for 5 minutes. Then the mixture was centrifuged at 10 thousand rpm for 1 min and the upper supernatant fraction was taken. Bacterial DNA was precipitated by adding 7.5 M ammonium acetate and isopropanol in the ratio 1: 2 at + 4 ° C for 15 min, the mixture was centrifuged at 12 thousand rpm for 10 min. The supernatant was decanted and the precipitate was washed 3 times with 70% ethanol. The resulting DNA pellet was dissolved in 0.5 ml of 0.01 M Tris-HCl, pH 7.6.

DNA isolated from one granule of the gel was used for PCR with primer sets for R. ruber and R. opacus described by [Bell KS, Kuyukina MS, Heidbrink S., Philp JC, Aw DWJ, Ivshina IB, Christofi N. Identification and environmental detection of Rhodococcus species by 16S rDNA-targeted PCR // J. Appl. Microbiol. - 1999. - V.87. - P.472-480], synthesized by Synthol, Moscow.

Used sets of primers of the following composition:

1) specific for R. ruber (the expected length of the amplified product is 302 bp)

a) Rul 5′GTCTAATACCGGATAGGACCTCGGGA3 ′,

b) Ru2 5′TACCGTCACTTGCGCTTCGTCGGTAC3 ′;

2) specific for R. opacus (expected amplified product length 447 bp)

a) Rol 5′TATGACCTTCGGCTGCATGGCTGAG3 ′,

b) Ro2 5 ′ CCGTATCGCCTGGAAGCTCGAG3 ′.

The reaction mixture with a volume of 25 μl had the following composition: 10 mm PCR buffer; 2.5 mM MgCl ₂ (for primers for R. ruber) and 1.5 mM MgCl ₂ (for primers for R. opacus); 0.2 mM mixture of four deoxynucleoside triphosphates (dNTPs); 0.2 μM forward and reverse primers; 0.4 units Taq DNA polymerase; 1 μl of DNA, deionized water. The amplification modes for these primers are as follows: 5 min at 95 ° C and 35 cycles of 30 sec at 95 ° C, 30 sec at 64 ° C (for R. opacus) or 60 ° C (for R. ruber), 30 sec at 72 ° C, then 10 min at 72 ° C. PCR products were visualized by agarose gel electrophoresis. Strains of R. ruber and R. opacus were clearly detected by PCR in the granules of the gel without staining, after staining with INT and after extraction of formazan with ethanol (Fig. 1). The average number of immobilized living cells of R. ruber was 2.7 × 10 ⁶ cells / ml, and R. opacus - 1.7 × 10 ⁶ cells / ml (Table 1). Thus, the survival of R. ruber cells after contact with oil-contaminated water was 1.6 times higher than that of R. opacus cells. The time for the entire analysis was 6-8 hours.

Example 2. Two samples of an immobilized biocatalyst were prepared on the basis of PVA cryogel granules with a size of 125 mm ³ containing hydrocarbon-oxidizing bacteria (106 cells / ml) in each of them, either Rhodococcus ruber IEGM 615 or Rhodococcus erythropolis IEGM 275, as described in Example 1. B the soil contaminated with oil (10 wt.%), 200 granules of biocatalyst (100 granules with R. ruber and 100 granules with R. erythropolis) were applied and incubated for 1-3 weeks. After that, 10 granules were selected and a comparative evaluation of the effectiveness of these strains by their survival in oil-contaminated soil was carried out, as described in Example 1. Since the granules were stained dark after incubation in oil-contaminated soil, quantification of formazan after its extraction with ethanol was carried out by the intensity of staining of the extracts on tablet photometer at 490 nm. As a control, empty (without microorganisms) granules were used after they were incubated in oil-contaminated soil. The results were converted to the number of viable cells in the granule according to the calibration graph of the optical density versus the number of cells for these bacterial strains. Next, each granule was used for DNA isolation using a commercial ZR Soil DNA Miniprep Kit (Zymo Research) in accordance with the manufacturer's instructions. DNA isolated from 1 granule was used for PCR with primer sets for R. ruber and R. erythropolis described [Bell KS, Kuyukina MS, Heidbrink S., Philp JC, Aw DWJ, Ivshina I.V., Christofi N. Identification and environmental detection of Rhodococcus species by 16S rDNA-targeted PCR // J. Appl. Microbiol. - 1999. - V.87. - P.472-480], synthesized by Synthol, Moscow. Used sets of primers of the following composition:

1) specific for R. ruber - as in example 1;

2) specific for R. erythropolis (the expected length of the amplified product is 449 bp)

a) Rel 5′CGTCTAATACCGGATATGACCTCCTATC3 ′,

b) Re2 5′GCAAGCTAGCAGTTGAGCTGCTGGT 3 ′.

The reaction mixture with a volume of 25 μl had the following composition: 10 mm PCR buffer; 2.5 mM MgCl ₂ (for primers for R. ruber) and 1.5 mM MgCl ₂ (for primers for R. erythropolis); 0.2 mM mixture of four deoxynucleoside triphosphates (dNTPs); 0.2 μM forward and reverse primers; 0.4 units Taq DNA polymerase; 1 μl of DNA, deionized water. The amplification modes for these primers are as follows: 5 min at 95 ° C and 35 cycles of 30 sec at 95 ° C, 30 sec at 64 ° C (for R. erythropolis) or 60 ° C (for R. ruber), 30 sec at 72 ° C, then 10 min at 72 ° C. PCR products were visualized by agarose gel electrophoresis. The strains of R. ruber and R. erythropolis were clearly detected by PCR results in gel granules after prolonged exposure to oil-contaminated soil (Fig. 2). The average number of living cells of R. ruber was 3.2 × 10 ⁵ cells / ml, and R. erythropolis was 2.8 × 10 ⁵ cells / ml (Table 2). Thus, these species of rhodococci were successfully detected using the proposed method after a long stay of the immobilized biocatalyst in oil-contaminated soil. The time for the entire analysis was 6-8 hours.

Example 3. Prepared a sample of a polyvide biocatalyst based on PVA cryogel granules with a size of 100 mm ³ containing hydrocarbon-oxidizing bacteria (10 ⁶ cells / ml) R. ruber IEGM 615 and R. opacus IEGM 245, taken in equal proportions, as described in the example 1. After storage of the biocatalyst in the refrigerator (at 5 ° C) for 2 months, the viability of the immobilized rhodococci was determined. For analysis, 10 granules were selected and placed in the wells of a 96-well plate. The granules were stained with INT for 1 h and the violet staining intensity was determined on a plate photometer at 630 nm. The results were converted to the number of viable cells in the granule according to the calibration graph of the dependence of optical density on the number of cells for these strains of rhodococcus. Next, DNA was isolated from each granule using a commercial ZR DNA Miniprep Kit (Zymo Research) in accordance with the manufacturer's instructions and species-specific PCR was performed as shown in Example 1. Both strains of R. ruber and R. opacus, enclosed together in 1 granules of the gel were clearly detected by PCR (figure 3). The average number of living cells of these microorganism strains was 5.7 × 10 ⁶ cells / ml (Table 3). Thus, species differentiation and determination of the viability of immobilized rhodococci were successfully carried out using the proposed method after prolonged storage of the biocatalyst. The entire analysis took 6 hours.

Example 4. Prepared 4 samples of a mono-species biocatalyst based on PVA cryogel granules with a size of 100 mm ³ with enclosed hydrocarbon-oxidizing bacteria R. opacus IEGM 245 taken in various concentrations (10 ³ , 10 ⁴ , 10 ⁶ and 10 ⁸ cells / ml), as described in example 1. For analysis, 5 granules of each sample were taken and placed in the wells of a 96-well plate. The granules were stained with INT for 1 h and the violet staining intensity was determined on a plate photometer at 630 nm. The results were converted to the number of viable cells in the granule according to a calibration graph of the dependence of optical density on the number of cells for these strains of microorganisms. Next, DNA was isolated from each granule as in Example 3 and species-specific PCR was performed as shown in Example 1. R. opacus cells were clearly detected by PCR in all granules even at a low concentration (10 ³ cells / ml) (Fig. 4). The entire analysis took 6 hours.

Thus, the claimed method of species differentiation of viable rhodococci immobilized in water-insoluble gel carriers, in comparison with analogues has several significant advantages, because it allows you to determine the number of living bacterial cells of a certain type in one sample (granule) of the biocatalyst even at low (from 10 ³ cells / ml) concentration, in a short (6-8 h) time, without the need to isolate cells from the gel carrier and cultivate bacteria and without the use of expensive equipment.

Description of figures and tables

Figure 1. The results of PCR amplification of DNA isolated from gel granules with immobilized Rhodococcus ruber and Rhodococcus opacus cells after incubation of the biocatalyst in the presence of hydrocarbon-contaminated water.

Figure 2. The results of PCR amplification of DNA isolated from gel granules with immobilized Rhodococcus ruber and Rhodococcus erythropolis cells after incubating the biocatalyst in oil-contaminated soil for 1 and 3 weeks.

Figure 3. The results of PCR amplification of DNA isolated from gel granules with co-immobilized Rhodococcus ruber and Rhodococcus opacus cells after storage of the biocatalyst.

Figure 4. The results of PCR amplification of DNA isolated from gel granules with Rhodococcus ruber cells immobilized at various concentrations.

Table 1. The results of determining the viability of Rhodococcus ruber and Rhodococcus opacus immobilized in gel cells after incubation of the biocatalyst in the presence of water contaminated with hydrocarbons.

Table 2. The results of determining the viability of Rhodococcus ruber and Rhodococcus erythropolis cells immobilized in a gel after incubation of the biocatalyst in oil-contaminated soil for 1 and 3 weeks.

Table 3. Results of determining the viability of Rhodococcus ruber and Rhodococcus opacus cells immobilized in a gel after storage of the biocatalyst.

Table 1 Types of Rhodococcus Rhodococcus ruber Rhodococcus opacus OD values of _{630 nm} stained INT pellets of gel with immobilized Rhodococcus 1.53 ± 0.12 1.18 ± 0.09 OD values of _{490 nm} of formazan extracts from INT-stained gel granules with immobilized Rhodococcus 0.42 ± 0.02 0.28 ± 0.03 The average number of immobilized living cells of Rhodococcus, cells / ml (2.7 ± 0.16) × 10 ⁶ (1.7 ± 0.08) × 10 ⁶

table 2 Types of microorganisms Rhodococcus ruber Rhodococcus erythropolis OD values of _{490 nm} of formazan extracts from INT stained gel granules with immobilized rhodococci (after 1 week in the soil) 1.08 ± 0.02 1.00 ± 0.04 The average number of immobilized living cells of Rhodococcus (after 1 week in the soil), cells / ml (6.0 ± 0.21) × 10 ⁵ (4.7 ± 0.36) × 10 ⁵ OD values of _{490 nm} of formazan extracts from INT stained gel granules with immobilized rhodococci (after 3 weeks in the soil) 0.87 ± 0.05 0.73 ± 0.09 The average number of immobilized living cells of Rhodococcus (after 3 weeks in the soil), cells / ml (3.2 ± 0.18) × 10 ⁵ (2.8 ± 0.14) × 10 ⁵

Table 3 Types of microorganisms R. ruber + R. Opacus OD values of _{630 nm} stained INT pellets of gel with immobilized Rhodococcus 1.90 ± 0.13 The average number of immobilized living cells of Rhodococcus, cells / ml (5.7 ± 0.42) × 10 ⁶

Claims (2)

1. The method of species differentiation of viable rhodococci immobilized in granules of a water-insoluble gel, which consists in spectrophotometric determination of the number of living cells in a gel-stained iodonitrotetrazolium (INT) sample, DNA extraction from this sample, and PCR using sets of species-specific primers. 2. The method according to claim 1, characterized in that after staining the INT gel sample, extraction of the formed formazan with ethanol is carried out, and then DNA is extracted from this gel sample to form species-specific PCR.

Images