RU2522004C2

RU2522004C2 - Single-chain antibody to carcinoembryonic antigen, chimeric monomolecular t-cell receptor, vector and host cell for provision of such receptor and method of diagnostics or treatment

Info

Publication number: RU2522004C2
Application number: RU2012113790/10A
Authority: RU
Inventors: Владимир Константинович Боженко; Елена Ивановна Шрамова; Андрей Николаевич Шкопоров; Юрий Степанович Лебедин; Сергей Викторович Чуканов
Original assignee: Владимир Константинович Боженко; Елена Ивановна Шрамова; Андрей Николаевич Шкопоров; Юрий Степанович Лебедин; Сергей Викторович Чуканов
Priority date: 2012-04-10
Filing date: 2012-04-10
Publication date: 2014-07-10
Also published as: WO2013154458A2; RU2012113790A; WO2013154458A3

Abstract

FIELD: medicine.

SUBSTANCE: inventions relate to the field of immunology. Claimed are a single-chain antibody, specific to a carcinoembryonic antigen, a chimeric mononuclear T-cell receptor, a vector, a host cell and a method of diagnostics or treatment of diseases, characterised by the presence of antigens, capable of binding with the chimeric receptor. Described is a genetic construction, coding chimeric monomolecular T-cell receptors, in which an effector fragment of the T-cell receptor is combined with an antigen-recognising part, which represents variable fragments of two different antibodies to the carcinoembryonic antigen (CEA).

EFFECT: claimed inventions can be used in T-cell cancer therapy.

7 cl, 4 dwg, 3 ex, 1 tbl

Description

Изобретение относится к области пассивной иммунотерапии онкологических заболеваний, в частности к методу адоптивного переноса клеток, в котором используют генетически модифицированные аутологичные или аллогенные цитотоксические Т-лимфоциты, обладающие приобретенной иммуногенностью против клеток опухоли. И может быть использовано в Т-клеточной терапии рака.The invention relates to the field of passive immunotherapy of cancer, in particular to the method of adaptive cell transfer, which uses genetically modified autologous or allogeneic cytotoxic T-lymphocytes with acquired immunogenicity against tumor cells. And can be used in T-cell cancer therapy.

В настоящее время определено большое количество опухоль-асоциированных антигенов, которые по отдельности или в сочетании могут быть использованы для индукции иммунного ответа, направленного против опухолевой ткани. Разрабатываемые подходы иммунотерапии, такие как вакцинация и адоптивный перенос иммунных клеток продемонстрировали эффективность в ряде доклинических и клинических исследований [1, 2]. Однако, несмотря на огромный интерес исследователей к иммунотерапевтическим подходам и большой потенциал иммунотерапии, случаи полного излечения от раковых заболеваний с помощью таких подходов остаются редкими событиями.Currently, a large number of tumor-associated antigens have been identified, which individually or in combination can be used to induce an immune response directed against tumor tissue. Immunotherapy approaches under development, such as vaccination and adoptive transfer of immune cells, have been shown to be effective in a number of preclinical and clinical studies [1, 2]. However, despite the huge interest of researchers in immunotherapeutic approaches and the great potential of immunotherapy, cases of a complete cure for cancer using such approaches remain rare events.

Особое место в иммунотерапии занимает метод адоптивного переноса клеток, в котором используют генетически модифицированные аутологичные или аллогенные цитотоксические Т-лимфоциты, обладающие рецепторами, специфичными к антигенам клеток опухоли [2]. Исследования показали, что наиболее перспективным является получение лимфоцитов, экспрессирующих химерные иммуноглобулиновые мономолекулярные Т-клеточные рецепторы, в которых антиген-распознающая часть, представляющая собой вариабельный фрагмент антитела, объединена с эффекторным фрагментом Т-клеточного рецептора (обычно с ζ-цепью) [3]. Распознавание антигена таким химерным рецептором за счет иммуноглобулиновой части является независимым от представления антигена клетками главного комплекса гистосовместимости (ГКГ), связывание с антигеном приводит к секреции модифицированными Т-лимфоцитами интерлейкина-2 (ИЛ-2) и ряда других цитокинов и проявлению цитотоксического действия, а объединение в химерном рецепторном комплексе различных костимулирующих доменов позволяет повысить выживаемость лимфоцитов и усилить цитотоксический эффект [4, 5, 6].A special place in immunotherapy is occupied by the method of adaptive cell transfer, which uses genetically modified autologous or allogeneic cytotoxic T-lymphocytes with receptors specific for tumor cell antigens [2]. Studies have shown that the most promising is the production of lymphocytes expressing chimeric immunoglobulin monomolecular T-cell receptors in which the antigen-recognizing part, which is a variable fragment of an antibody, is combined with an effector fragment of a T-cell receptor (usually with a ζ chain) [3] . Recognition of the antigen by such a chimeric receptor due to the immunoglobulin part is independent of the presentation of the antigen by the cells of the main histocompatibility complex (MHC), binding to the antigen leads to the secretion of modified T-lymphocytes of interleukin-2 (IL-2) and a number of other cytokines and a cytotoxic effect, and the combination of different costimulating domains in the chimeric receptor complex allows to increase the survival of lymphocytes and enhance the cytotoxic effect [4, 5, 6].

На сегодняшний день сконструировано множество химерных иммунорецепторов к различным опухолевым антигенам, таким как антиген от клеток нейробластомы [7], простатспецифический мембранный антиген (ПСМА) [8, 9], раково-эмбриональный антиген (РЭА) [10] и др.To date, many chimeric immunoreceptors have been constructed for various tumor antigens, such as an antigen from neuroblastoma cells [7], prostate-specific membrane antigen (PSMA) [8, 9], cancer-embryonic antigen (CEA) [10], etc.

РЭА - гликопротеин, молекулярной массой 180 кДа, экспрессирующийся во всех аденокарциномах желудочно-кишечного тракта, в 50% случаев рака молочной железы и в 70% случаев немелкоклеточного рака легких и в клетках некоторых других видов рака [11]. В норме РЭА экспрессируется в тканях эмбриона в ходе внутриутробного развития, а после рождения его продукция дектируется в клетках желудочных ямок, эпителия толстой кишки и в других отделах желудочно-кишечного тракта, в основном на поверхности микроворсинок. Однако уровень экспрессии РЭА в опухолевых клетках значительно превышает его уровень экспрессии в нормальной ткани (в 35 раз и выше) [12]. Несмотря на успех доклинических экспериментальных исследований, описанные в литературе химерные Т-клеточные рецепторы к РЭА имеют свои недостатки, не позволяющие перейти к стадии клинического применения [13, 14]. В связи с этим остается актуальным создание новых конструкций химерных иммуноглобулиновых Т-клеточных рецепторов к другим эпитопам РЭА. Кроме того, в проявлении цитотоксического действия модифицированных клеток, содержащих химерные рецепторы, остается высокой гибель лимфоцитов после связывания антигена, обусловленная активацией лимфоцитов, не существует универсальных подходов для снижения цитотоксичности за счет введения конструкций, точно не установлен набор сигнальных последовательностей, усиливающих цитотоксическое действие, весьма актуально повышение аффинности химерных рецепторов к антигену.CEA is a glycoprotein with a molecular mass of 180 kDa, which is expressed in all adenocarcinomas of the gastrointestinal tract, in 50% of cases of breast cancer and in 70% of cases of non-small cell lung cancer and in the cells of some other types of cancer [11]. Normally, CEA is expressed in the tissues of the embryo during fetal development, and after birth, its production is decanted in the cells of the gastric fossa, colon epithelium and in other parts of the gastrointestinal tract, mainly on the surface of the microvilli. However, the level of CEA expression in tumor cells significantly exceeds its expression level in normal tissue (35 times or higher) [12]. Despite the success of preclinical experimental studies, the chimeric T-cell receptors for CEA described in the literature have their drawbacks that do not allow transition to the stage of clinical use [13, 14]. In this regard, it remains relevant to create new designs of chimeric immunoglobulin T-cell receptors for other CEA epitopes. In addition, in the manifestation of the cytotoxic effect of modified cells containing chimeric receptors, the death of lymphocytes after antigen binding remains high, due to the activation of lymphocytes, there are no universal approaches to reduce cytotoxicity due to the introduction of constructs, a set of signal sequences that enhance the cytotoxic effect have not been established Actually increasing the affinity of chimeric receptors for antigen.

Задачей данного изобретения стало получение на основе уникальных участков, кодирующих аминокислотную последовательность, проявляющую высокий уровень связывания РЭА, в том числе и в растворе, генетических конструкций, кодирующих мономолекулярные химерные Т-клеточные рецепторы, распознающие различные эпитопы РЭА, трансфекция которыми активированных лимфоцитов человека приводит к экспрессии этих рецепторов на поверхности лимфоцитов.The objective of this invention was to obtain, on the basis of unique sites encoding the amino acid sequence exhibiting a high level of CEA binding, including in solution, genetic constructs encoding monomolecular chimeric T-cell receptors that recognize various CEA epitopes, the transfection of which activated human lymphocytes leads to expression of these receptors on the surface of lymphocytes.

Техническим результатом изобретения является распознавание иммунорецепторами антигена на поверхности РЭА-экспрессирующих клеток, которое приводит к развитию цитотоксического ответа, вызывающего гибель более чем 45% клеток мишеней.The technical result of the invention is the recognition of antigen by immunoreceptors on the surface of CEA-expressing cells, which leads to the development of a cytotoxic response that causes the death of more than 45% of target cells.

Результатом изобретения явилось получение обозначенных объектов биотехнологии.The result of the invention was to obtain the designated objects of biotechnology.

1. Химерный мономолекулярный Т-клеточный рецептор, включающий1. Chimeric monomolecular T-cell receptor, including

распознающий фрагмент антитела к раково-эмбриональному антигену SEQ ID NO 1 или SEQ ID NO 2.recognition fragment of an antibody to a cancer-embryonic antigen of SEQ ID NO 1 or SEQ ID NO 2.

2. Химерный мономолекулярный Т-клеточный рецептор по п.1, чья аминокислотная последовательность представлена на SEQ ID NO 3.2. The chimeric monomolecular T cell receptor according to claim 1, whose amino acid sequence is shown in SEQ ID NO 3.

3. Химерный мономолекулярный Т-клеточный рецептор по п.1, чья аминокислотная последовательность представлена на SEQ ID NO 4.3. The chimeric monomolecular T cell receptor according to claim 1, whose amino acid sequence is shown in SEQ ID NO 4.

4. Экспрессионный вектор, кодирующий распознающий фрагмент антитела к раково-эмбриональному антигену по п.1.4. The expression vector encoding a recognition fragment of an antibody to a cancer-embryonic antigen according to claim 1.

5. Клетка-хозяин, трансформированная экспрессионным вектором по п.4 и продуцирующая распознающий фрагмент антитела к раково-эмбриональному антигену по п.1.5. A host cell transformed with an expression vector according to claim 4 and producing a recognition fragment of an antibody to a cancer-embryonic antigen according to claim 1.

6. Клетка-хозяин, трансформированная экспрессионным вектором по п.4 и продуцирующая распознающий фрагмент антитела к раково-эмбриональному антигену по п.1, отличающаяся тем, что трансфекция осуществлена с помощью электропорации.6. A host cell transformed with an expression vector according to claim 4 and producing a recognition fragment of an antibody to a cancer-embryonic antigen according to claim 1, characterized in that the transfection is carried out by electroporation.

7. Способ связывания экспрессируемого химерного мономолекулярного Т-клеточного рецептора с раково-эмбриональным антигеном, включающий использование по меньшей мере клетки-хозяина по п.5, обладающей рецептором по п.1.7. A method of binding an expressed chimeric monomolecular T-cell receptor to a cancer-embryonic antigen, comprising using at least a host cell according to claim 5, having a receptor according to claim 1.

8. Способ связывания экспрессируемого химерного мономолекулярного Т-клеточного рецептора с раково-эмбриональным антигеном по п.7, где клетка-хозяин подвергалась предварительной активации.8. The method of binding an expressed chimeric monomolecular T-cell receptor to a cancer-embryonic antigen according to claim 7, where the host cell has undergone preliminary activation.

Сущностью предлагаемого изобретения является создание оригинальной генетической конструкции, кодирующей химерные мономолекулярные Т-клеточные рецепторы, в которых эффекторный фрагмент Т-клеточного рецептора объединен с антиген-распознающей частью, представляющей собой вариабельные фрагменты двух различных антител к раково-эмбриональному антигену (РЭА). Было показано, что после трансфекции данные рецепторы экспрессировались на поверхности клеток и связывались с РЭА. Также продемонстрирована высокая цитотоксическая активность трансфицированных описанными конструкциями лимфоцитов периферической крови человека в отношении РЭА-экспрессирующих клеток.The essence of the invention is the creation of an original genetic construct encoding chimeric monomolecular T-cell receptors, in which the effector fragment of the T-cell receptor is combined with an antigen-recognizing part, which is variable fragments of two different antibodies to cancer-embryonic antigen (CEA). It was shown that after transfection, these receptors were expressed on the surface of the cells and bound to CEA. The high cytotoxic activity of human peripheral blood lymphocytes transfected with the described constructs against CEA-expressing cells was also demonstrated.

При осуществлении изобретения клеточные линии человека НСТ116 (карцинома толстой кишки), НТ29 (аденокарцинома толстой кишки), А549 (карцинома легкого) и НЕК293 (почка эмбриона) культивировали в среде DMEM. Мононуклеары периферической крови выделяли из гепаринизированной периферической крови пациентов ФГУ "Российский научный центр рентгенорадиологии" центрифугированием в градиенте фиколла. Лимфоциты культивировали в среде RPMI. Лимфоциты стимулировали к пролиферации добавлением 1 мкг/мл фитогемагглютинина (ФГА) и активировали 50 Ед./мл ИЛ-2 (БИОТЕХ) в течение 72-120 ч.In an embodiment of the invention, human cell lines HCT116 (colon carcinoma), HT29 (colon adenocarcinoma), A549 (lung carcinoma) and HEK293 (embryo kidney) were cultured in DMEM. Peripheral blood mononuclear cells were isolated from heparinized peripheral blood of patients of the Federal State Institution Russian Scientific Center for Radiological Radiology by ficoll gradient centrifugation. Lymphocytes were cultured in RPMI medium. Lymphocytes were stimulated to proliferate by adding 1 μg / ml phytohemagglutinin (PHA) and activated 50 U / ml IL-2 (BIOTECH) for 72-120 hours.

Таблица 1Table 1 Олигонуклеотидные праймеры. Подчеркнуты сайты распознавания рестриктаз XbaI, SmaI, EcoRI. Курсивом выделены последовательности, кодирующие линкерный пептид (G₄S)₃ Oligonucleotide primers. The restriction enzyme recognition sites XbaI, SmaI, EcoRI are highlighted. The sequences encoding the linker peptide (G ₄ S) ₃ are in italics Название олигонуклеотидаThe name of the oligonucleotide Последовательность 5'-3'5'-3 'sequence CD8-FCD8-F ATATTCTAGAGCGAAGCCCACCACGACGATAT TCTAGA GCGAAGCCCACCACGACG CD8-RCD8-R GCAGAGTTTGGGATCATCACAGGCGAAGTCGCAGAGTTTGGGATCATCACAGGCGAAGTC CD247-FCD247-F p-GACTTCGCCTGTGATGATCCCAAACTCTGCp-GACTTCGCCTGTGATGATCCCAAACTCTGC CD247-RCD247-R ATATCCCGGGATACTTCAGTGGCTGAGAAGATAT CCCGGG ATACTTCAGTGGCTGAGAAG 1C6K-F1C6K-F GCGCGCGAATTCGCCACCATGGAGACAGACACACTCCTGTGCGCGC GAATTC GCCACCATGGAGACAGACACACTCCTGT 1C6K-R1C6K-R AGAGCCACCTCCGCCTGAACCGCCTCCACCCCGTTTCAGCTCCAGCTTAGAGCCACCTCCGCCTGAACCGCCTCCACCCCGTTTCAGCTCCAGCTT 1C6G-F1C6G-F GGCGGAGGTGGCTCTGGCGGTGGCGGATCGGATGTGCAGCTTCAGGAGTGGCGGAGGTGGCTCTGGCGGTGGCGGATCGGATGTGCAGCTTCAGGAGT 1C6G-R1C6G-R GCATTCTAGATGAGGAGACGGTGACCGTGGGCAT TCTAGA TGAGGAGACGGTGACCGTGG 3C1G-F3C1G-F GCGCGCGAATTCGCCACCATGAAGTTGTGGCTGAACTGGGCGCGC GAATTC GCCACCATGAAGTTGTGGCTGAACTGG 3C1G-R3C1G-R AGAGCCACCTCCGCCTGAACCGCCTCCACCTGAGGAGACGGTGACAGAGCCACCTCCGCCTGAACCGCCTCCACCTGAGGAGACGGTGAC 3C1K-F3C1K-F GGCGGAGGTGGCTCTGGCGGTGGCGGATCGCAAATTGTTCTCTCCGGCGGAGGTGGCTCTGGCGGTGGCGGATCGCAAATTGTTCTCTCC 3C1K-R3C1K-R GCGCGCTCTAGACCGTTTTATTTCCAGCTTGGGCGCGC TCTAGA CCGTTTTATTTCCAGCTTGG

Получение генетических конструкций. Тотальную РНК из лимфоцитов и культур гибридом выделяли при помощи набора RNeasy Mini Kit. Синтез первой цепи кДНК проводили с использованием праймера олиго-dT и ревертазы RevertAid Н-(Fermentas). ПЦР проводили с помощью полимеразы TaqSE (СибЭнзим) и олигонуклеотидных праймеров, перечисленных в Табл.1.Getting genetic constructs. Total RNA from lymphocytes and hybridomas was isolated using the RNeasy Mini Kit. The synthesis of the first cDNA strand was carried out using oligo-dT primer and RevertAid H- revertase (Fermentas). PCR was performed using TaqSE polymerase (SibEnzyme) and oligonucleotide primers listed in Table 1.

Фрагменты кДНК легких и тяжелых цепей, кодирующие вариабельные домены VL и VH иммуноглобулинов IgG1, были амплифицированы из препаратов РНК гибридом 1С6 и 3С1 с использованием набора вырожденных праймеров и методов, описанных ранее [15]. Полученные ПЦР-продукты клонировали в плазмидный вектор pAL-TA (Евроген) при помощи стандартных методов [16] и секвенировали.Light and heavy chain cDNA fragments encoding the variable domains VL and VH of IgG1 immunoglobulins were amplified from RNA preparations of 1C6 and 3C1 hybridomas using a set of degenerate primers and methods described previously [15]. The obtained PCR products were cloned into the pAL-TA plasmid vector (Eurogen) using standard methods [16] and sequenced.

Для получения конструкций, кодирующих химерные иммунорецепторы, фрагменты кДНК генов CD8 и CD247 амплифицировали на матрице кДНК из лимфоцитов человека с использованием праймеров CD8-F, CD8-R, CD247-F, CD247-R. Полученные продукты лидировали между собой, реамплифицировали с использованием праймеров CD8-F, CD247-R и клонировали в вектор pCI (GE-Amersham) по сайтам рестрикции XbaI и SmaI. Вариабельные фрагменты кДНК легких (κ) и тяжелых (γ) цепей антител 1С6 и 3С1 амплифицировали с использованием праймеров из Табл.1. ПЦР-продукты смешивали попарно для отжига перекрывающихся терминальных участков и реамплифицировали при помощи пар праймеров 1C6K-F/1C6G-R и 3C1G-F/3C1K-R соответственно. Полученные фрагменты клонировали в плазмиду pCI/CD8-CD247 по сайтам EcoRI и XbaI. Сконструированные в итоге плазмиды pCI/1C6-CD8-CD247 и pCI/3C1-CD8-CD247 сокращенно назвали рСЕА-1 и рСЕА-2. Секвенирование рекомбинантных плазмид проводили с использованием автоматического секвенатора CEQ8000 (Beckman-Coulter).To obtain constructs encoding chimeric immunoreceptors, cDNA fragments of the CD8 and CD247 genes were amplified on a cDNA matrix from human lymphocytes using primers CD8-F, CD8-R, CD247-F, CD247-R. The products obtained were leader among themselves, reamplified using CD8-F, CD247-R primers and cloned into the pCI vector (GE-Amersham) at the XbaI and SmaI restriction sites. The variable cDNA fragments of the light (κ) and heavy (γ) chains of antibodies 1C6 and 3C1 were amplified using the primers from Table 1. PCR products were mixed in pairs to anneal the overlapping terminal regions and reamplified using primer pairs 1C6K-F / 1C6G-R and 3C1G-F / 3C1K-R, respectively. The resulting fragments were cloned into the plasmid pCI / CD8-CD247 at EcoRI and XbaI sites. The resulting plasmids pCI / 1C6-CD8-CD247 and pCI / 3C1-CD8-CD247 were abbreviated as pCEA-1 and pCEA-2. Recombinant plasmid sequencing was performed using a CEQ8000 automatic sequencer (Beckman-Coulter).

Трансфекцию клеток НЕК293 проводили с помощью реагента PolyFect (QIAGEN) согласно протоколу производителя. После обработки клетки инкубировали в стандартных условиях в течение 24-48 ч. В качестве положительного контроля использовали плазмиду, кодирующую зеленый флуоресцентный белок (GFP).HEK293 cells were transfected using PolyFect reagent (QIAGEN) according to the manufacturer's protocol. After treatment, the cells were incubated under standard conditions for 24-48 hours. As a positive control, a plasmid encoding a green fluorescent protein (GFP) was used.

Трансфекцию лимфоцитов периферической крови человека проводили методом электропорации на приборе Amaxa Nucleofector с использованием набора Human T Cell Nucleofector Kit (Lonza) согласно инструкциям производителя. Для трансфекции одного образца использовали 4-5 млн клеток и 2 мкг плазмидной ДНК. Непосредственно после импульса клетки культивировали в полной среде RPMI в стандартных условиях в течение 4-5 ч, после чего к клеткам добавляли ИЛ-2 до концентрации 100 Ед./мл. Через 24 ч после электропорации культуральную среду, содержащую ИЛ-2, заменяли новой без добавления интерлейкина. Клетки культивировали еще сутки, после чего подвергали анализу. Экспрессию конструкций, кодирующих химерные Т-клеточные рецепторы, подтверждали методом полимеразной цепной реакции, сопряженной с обратной транскрипцией (ОТ-ПЦР) через 48 ч после трансфекции.Transfection of human peripheral blood lymphocytes was performed by electroporation on an Amaxa Nucleofector instrument using the Human T Cell Nucleofector Kit (Lonza) according to the manufacturer's instructions. For transfection of one sample, 4-5 million cells and 2 μg of plasmid DNA were used. Immediately after the pulse, the cells were cultured in complete RPMI medium under standard conditions for 4-5 hours, after which IL-2 was added to the cells to a concentration of 100 Units / ml. 24 hours after electroporation, the culture medium containing IL-2 was replaced with a new one without the addition of interleukin. Cells were cultured for another day, and then subjected to analysis. Expression of constructs encoding chimeric T-cell receptors was confirmed by reverse transcription polymerase chain reaction (RT-PCR) 48 hours after transfection.

Цитофлуорометрические исследования проводили на проточном цитофлуориметре DAKO Galaxy (Dako). Фиксацию и пермеабилизацию клеток для мечения с помощью антител проводили с использованием соответствующего набора фирмы DakoCytomation. В работе использовали антитела к ζ-цепи Т-клеточного рецептора человека, мышиные антитела к IgG (Dako), биотинилированные антитела 1C11 и 3С5 (Beckman Coulter) поликлональные антитела к РЭА AS229 (Beckman Coulter).Cytofluorometric studies were performed on a DAKO Galaxy Flow Cytometer (Dako). Fixation and permeabilization of cells for labeling using antibodies was performed using the appropriate kit from DakoCytomation. We used antibodies to the ζ-chain of the human T-cell receptor, mouse antibodies to IgG (Dako), biotinylated antibodies 1C11 and 3C5 (Beckman Coulter) polyclonal antibodies to CEA AS229 (Beckman Coulter).

Для оценки способности изучаемых мономолекулярных химерных Т-клеточных рецепторов, экспрессируемых клетками НЕК293, связывать РЭА, клетки спустя 24 после трансфекции инкубировали 30 мин с раствором РЭА, меченного флуоресцентным красителем ФИТЦ (РЭА-ФИТЦ, в конечной концентрации 0.06 мкг/мкл), и анализировали на проточном цитофлуориметре.To assess the ability of the studied monomolecular chimeric T-cell receptors expressed by HEK293 cells to bind CEA, the cells were incubated 24 minutes after transfection for 30 min with a CEA solution labeled with FITC fluorescent dye (CEA-FITC, at a final concentration of 0.06 μg / μl), and analyzed on a flow cytometer.

Оценку способности связывать поверхностно экспрессируемый РЭА биотинилированными моноклональными антителами на различные эпитопы РЭА, а также оценку способности сконструированных мономолекулярных химерных Т-клеточных рецепторов связывать РЭА после трансфекции лимфоцитов проводили методом непрямого иммуноцитохимического окрашивания. Для этого экспрессирующие РЭА клетки или лимфоциты, экспрессирующие мономолекулярные химерные рецепторы, через 48 ч после электропорации промывали раствором ФСБ и окрашивали биотинилированными антителами (около 3 мкл на 106 клеток) в течение 20 мин при комнатной температуре. Для выявления связавшихся антител отмытые клетки окрашивали стрептавидином, меченным фикоэритрином (РЕ), в соответствии с рекомендациями производителя (Beckman Coulter). Окрашенные клетки анализировали на проточном цитофлуориметре. В качестве отрицательного контроля использовали клетки, к которым добавляли только стрептавидин, конъюгированный с РЕ.The ability to bind surface-expressed CEA with biotinylated monoclonal antibodies to various CEA epitopes was assessed, as well as the ability of engineered monomolecular chimeric T-cell receptors to bind CEA after transfection of lymphocytes was assessed by indirect immunocytochemical staining. For this, CEA-expressing cells or lymphocytes expressing monomolecular chimeric receptors were washed 48 hours after electroporation with a PBS solution and stained with biotinylated antibodies (about 3 μl per 106 cells) for 20 minutes at room temperature. To detect binding antibodies, washed cells were stained with phycoerythrin labeled streptavidin (PE) in accordance with the manufacturer's recommendations (Beckman Coulter). Stained cells were analyzed on a flow cytometer. As a negative control, cells were used to which only streptavidin conjugated with PE was added.

Анализ цитотоксического действия лимфоцитов с помощью двойной окраски CFDA-SE:PI. За 48 ч до постановки эксперимента клетки НСТ116 снимали с подложки стандартным методом, подсчитывали количество и окрашивали сукцинимидным эфиром карбоксифлуоресцеин-диацетата (CFDA-SE) в ФСБ в концентрации 0.625 мкг/мл в течение 7-8 мин в инкубаторе. Реакцию останавливали добавлением равного объема сыворотки. Клетки отмывали от невключившегося красителя и рассаживали в чашки Петри в концентрации 2-3×10⁵ кл./мл. Часть неокрашенных клеток рассаживали в такой же концентрации в качестве контроля. В день постановки эксперимента клетки НСТ116 неокрашенные и окрашенные (HCT116/CFDA-SE) снимали с субстрата стандартным способом и смешивали с лимфоцитами в требуемых соотношениях. Эксперименты по цитотоксичности проводили в среде RPMI с добавлением 10% ЭТС. Смешанные культуры инкубировали в стандартных условиях необходимое время. По истечении времени инкубации среду с лимфоцитами отбирали и сохраняли, а прикрепленные клетки НСТ116 промывали и снимали с субстрата минимальным количеством раствора трипсина: ЭДТА стандартным образом. Затем отделенные клетки объединяли с ранее отобранной суспензией лимфоцитов, окрашивали йодидом пропидия (PI, 2.5 мкг/мл) и анализировали на проточном цитофлуориметре.Analysis of the cytotoxic effect of lymphocytes by double staining with CFDA-SE: PI. 48 hours before the experiment, the HCT116 cells were removed from the substrate by the standard method, the number was counted and stained with succinimide ether carboxyfluorescein diacetate (CFDA-SE) in PBS at a concentration of 0.625 μg / ml for 7-8 minutes in an incubator. The reaction was stopped by the addition of an equal volume of serum. Cells were washed from unincorporated dye and plated in Petri dishes at a concentration of 2-3 × 10 ⁵ cells / ml. A portion of the unpainted cells were plated at the same concentration as a control. On the day of the experiment, unstained and stained HCT116 cells (HCT116 / CFDA-SE) were removed from the substrate in a standard manner and mixed with lymphocytes in the required proportions. Cytotoxicity experiments were performed in RPMI medium supplemented with 10% ETS. Mixed cultures were incubated under standard conditions for the required time. After the incubation time, the medium with lymphocytes was selected and stored, and the attached HCT116 cells were washed and removed from the substrate with a minimum amount of trypsin solution: EDTA in a standard manner. Then, the separated cells were combined with a previously selected suspension of lymphocytes, stained with propidium iodide (PI, 2.5 μg / ml) and analyzed on a flow cytometer.

Результатыresults

Серия мышиных моноклональных биотинилированных антител (изотип IgG1), способных связываться с РЭА в растворе, была предоставлена ООО «Хема-Медика» (Россия, Москва). В серию вошли следующие антитела: 2С5, 1С10, 1С11, 1С13, 1С3, 1С6, 3С1, 3С13, 3С2, 3С4, 3С5, 3С6, 3С8 [17]. Для анализа способности антител имеющейся серии связывать РЭА на поверхности экспрессирующих его клеток были выбраны три клеточные линии человека: НТ29, А549 и НСТ116. Антитело 3С1 было отобрано как проявляющее высокий уровень связывания РЭА со всеми исследуемыми клеточными линиями. Антитело 1С6 было выбрано благодаря наибольшей аффинности из всех антител серии к связыванию РЭА в растворе. Фрагменты кДНК иммуноглобулиновых генов, кодирующие вариабельные участки антител (домены VL и VH1) из гибридом 3С1 и 1С6, были ПЦР-амплифицированы и клонированы для определения полной нуклеотидной последовательности.A series of murine monoclonal biotinylated antibodies (IgG1 isotype) capable of binding to CEA in solution was provided by Hema-Medica LLC (Moscow, Russia). The following antibodies were included in the series: 2C5, 1C10, 1C11, 1C13, 1C3, 1C6, 3C1, 3C13, 3C2, 3C4, 3C5, 3C6, 3C8 [17]. To analyze the ability of the antibodies of the existing series to bind CEA on the surface of the cells expressing it, three human cell lines were selected: HT29, A549 and HCT116. The 3C1 antibody was selected as exhibiting a high level of CEA binding to all studied cell lines. Antibody 1C6 was chosen due to the highest affinity of all antibodies in the series for CEA binding in solution. Fragments of the cDNA of immunoglobulin genes encoding the variable regions of antibodies (VL and VH1 domains) from 3C1 and 1C6 hybridomas were PCR amplified and cloned to determine the complete nucleotide sequence.

Конструкции рСЕА-1 и рСЕА-2 были созданы на основе распознающих участков антител 1С6 и 3С1 соответственно путем клонирования в плазмиду pCI участков, кодирующих i) вариабельные фрагменты κ- (легких) и γ- (тяжелых) цепей выбранных моноклональных антител к РЭА, разделенных линкерным пептидом (648)3 (одноцепочечные мини-антитела в scFv-формате), ii) «шарнирный» участок белка CD8 и iii) участок белка CD247 (ζ-цепь Т-клеточного рецептора), включающий трансмембранный и цитоплазматический домены (фиг.1).The pCEA-1 and pCEA-2 constructs were created on the basis of the recognition sites of antibodies 1C6 and 3C1, respectively, by cloning into the plasmid pCI the sections encoding i) the variable fragments of the κ- (light) and γ- (heavy) chains of the selected monoclonal antibodies to CEA, separated the linker peptide (648) 3 (single-chain mini-antibodies in scFv format), ii) the “hinged” portion of the CD8 protein and iii) the portion of the CD247 protein (T-cell receptor ζ chain), including the transmembrane and cytoplasmic domains (FIG. 1 )

Для подтверждения правильного функционирования химерных иммунорецепторов, кодируемых созданными конструкциями, была выполнена трансфекция клеток НЕК293. Через 24 ч после трансфекции методом проточной цитометрии было исследовано связывание с клетками антител к ζ-цепи Т-клеточного рецептора. Было показано, что положительный сигнал обнаруживался в трансфицированных обеими плазмидами клетках, тогда как сигнал в контрольной группе клеток, окрашенных изотипическими контрольными антителами, отсутствовал (фиг.2а, б). Кроме этого трансфицированные обеими конструкциями клетки HEK293, связывали РЭА в растворе, что было показано после инкубации в течение 30 мин клеток с раствором РЭА, меченного ФИТЦ (фиг.2в, г).To confirm the correct functioning of chimeric immunoreceptors encoded by the created constructs, HEK293 cells were transfected. 24 hours after transfection by flow cytometry, the binding of the antibodies to the ζ chain of the T cell receptor was investigated with flow cytometry. It was shown that a positive signal was detected in cells transfected with both plasmids, while the signal in the control group of cells stained with isotypic control antibodies was absent (figa, b). In addition, HEK293 cells transfected with both constructs bound REA in solution, which was shown after incubation for 30 min of cells with a solution of CEA labeled with FITC (Fig. 2c, d).

Далее была проведена трансфекция созданными генетическими конструкциями лимфоцитов человека. В работе использовали мононуклеарные клетки крови, стимулированные к пролиферации с помощью ФГА и активированные рекомбинантным ИЛ-2 человека (50 Ед./мл) в течение 3 суток. По истечении этого времени количество CD3⁺ Т-лимфоцитов среди всей популяции составляло около 60%. Спустя 24 ч после трансфекции в ходе проведения ОТ-ПЦР в лимфоцитах была выявлена экспрессия генов, кодирующих химерные иммунорецепторы с обеих плазмид.Next, transfection with the created genetic constructs of human lymphocytes was carried out. We used mononuclear blood cells stimulated to proliferate using PHA and activated by recombinant human IL-2 (50 Units / ml) for 3 days. After this time, the number of CD3 ⁺ T-lymphocytes among the whole population was about 60%. 24 hours after transfection during RT-PCR, the expression of genes encoding chimeric immunoreceptors from both plasmids was detected in lymphocytes.

Способность трансфицированных лимфоцитов связывать РЭА спустя 24 ч после электропорации была подтверждена методом непрямого иммуноцитохимического окрашивания (фиг.3). При этом количество модифицированных лимфоцитов, связавшихся с РЭА, было примерно в 4 раза выше для предварительно активированных ИЛ-2 лимфоцитов по сравнению с нестимулированными клетками.The ability of transfected lymphocytes to bind CEA 24 hours after electroporation was confirmed by indirect immunocytochemical staining (figure 3). The number of modified lymphocytes bound to CEA was approximately 4 times higher for pre-activated IL-2 lymphocytes compared to unstimulated cells.

Исследование цитотоксичности лимфоцитов, трансфицированных исследуемыми плазмидами, проводили с использованием метода двойной окраски CFDA-SE/PI клеток НСТ116, экспрессирующих поверхностный РЭА. Было показано, что при добавлении к клеткам НСТ116, окрашенных с помощью CFDA-SE, трансфицированных лимфоцитов в соотношении 1:10 максимальный цитотоксический эффект достигался по истечении 5 ч совместной инкубации. При этом процент живых клеток НСТ116 после воздействия лимфоцитов, трансфицированных плазмидой рСЕА-1, составил 47.9%, а в случае с лимфоцитами, трансфицированными рСЕА-2, - 56.9% (фиг.4). Средний процент живых клеток НСТ116, инкубируемых в присутствии контрольных лимфоцитов, составил 86.7%, при инкубации с лимфоцитами, подверженными электрическому импульсу, но без добавления ДНК, процент живых НСТ116 равнялся 70.9%.The study of the cytotoxicity of lymphocytes transfected with the studied plasmids was carried out using the double staining method of CFDA-SE / PI HCT116 cells expressing surface CEA. It was shown that upon addition of transfected lymphocytes in the ratio 1:10 to the HCT116 cells stained with CFDA-SE, the maximum cytotoxic effect was achieved after 5 hours of joint incubation. At the same time, the percentage of living HCT116 cells after exposure to lymphocytes transfected with plasmid pCEA-1 was 47.9%, and in the case of lymphocytes transfected with pCEA-2, it was 56.9% (Fig. 4). The average percentage of live HCT116 cells incubated in the presence of control lymphocytes was 86.7%, while incubating with lymphocytes susceptible to electrical impulse, but without the addition of DNA, the percentage of live HCT116 was 70.9%.

Краткое описание чертежейBrief Description of the Drawings

Фиг.1. Схема плазмиды, кодирующей химерные иммунорецепторы (а), и детализированная структура гена химерного иммунорецептора (б), sp - сигнальный пептид, κ, γ - вариабельные фрагменты кДНК легких и тяжелых цепей антител соответственно; CD8 - «шарнирная» область антигена CD8; CD247 - ζ-цепь Т-клеточного рецептора; ТМ - трансмембранный домен; PCMV - промотор CMV; SV40 polyA - сигнал полиаденилирования SV40; Ampr - ген устойчивости к ампициллину; BglII, HinDIII EcoR1, Xbal, Smal - сайты соответствующих эндонуклеаз рестрикции.Figure 1. Scheme of the plasmid encoding chimeric immunoreceptors (a), and detailed structure of the gene of the chimeric immunoreceptor (b), sp - signal peptide, κ, γ - variable fragments of cDNA of light and heavy chains of antibodies, respectively; CD8 is the “hinge” region of the CD8 antigen; CD247 - ζ-chain of the T-cell receptor; TM - transmembrane domain; PCMV - CMV promoter; SV40 polyA — SV40 polyadenylation signal; Ampr - ampicillin resistance gene; BglII, HinDIII EcoR1, Xbal, Smal - sites of the corresponding restriction endonucleases.

Фиг.2. Данные цитофлуорометрического анализа клеток НЕК293 спустя 24 часа после трансфекции мономолекулярными химерными Т-клеточными рецепторами, а, 6 - связывание с клетками антител к ζ-цепи Т-клеточного рецептора на примере плазмиды рСЕА-2: а - клетки при добавлении антител к ζ-цепи; б - клетки при добавлении изотипических контрольных антител. R1 - область клеток, связавшихся с антителами к ζ-цепи. в, г - связывание клеток, модифицированных плазмидой рСЕА-1 с РЭА в растворе: в - трансфицированные клетки; г - нетрансфицированные клетки (отрицательный контроль). По осям отложены значения флуоресценции в каналах: по оси абсцисс FL2, по оси ординат FL1.Figure 2. Cytofluorometric analysis of HEK293 cells 24 hours after transfection with monomolecular chimeric T-cell receptors, a, 6 - binding to cells of antibodies to the ζ-chain of the T-cell receptor using the example of plasmid pCEA-2: a - cells when antibodies are added to the ζ-chain ; b - cells with the addition of isotypic control antibodies. R1 is the region of cells that bind to antibodies to the ζ chain. c, d - binding of cells modified with plasmid pCEA-1 with CEA in solution: c - transfected cells; g - non-transfected cells (negative control). The fluorescence values in the channels are plotted along the axes: along the abscissa axis FL2, along the ordinate axis FL1.

Фиг.3. Данные цитофлуорометрического анализа лимфоцитов человека, активированных ИЛ-2 и трансфицированных мономолекулярными химерными Т-клеточными рецепторами, по связыванию с РЭА в растворе спустя 24 часа после трансфекции. а, б - лимфоциты, трансфицированные плзмидами рСЕА-1 и рСЕА-2 соответственно; в - нетрансфицированные лимфоциты (отрицательный контроль). RN1 - области клеток с флуоресценцией выше пороговой. По оси абсцисс отложены значения флуоресценции в канале FL2, по оси ординат число флуоресцирующих частиц.Figure 3. Cytofluorometric analysis of human lymphocytes activated by IL-2 and transfected with monomolecular chimeric T-cell receptors for binding to CEA in solution 24 hours after transfection. a, b - lymphocytes transfected with plasmids pCEA-1 and pCEA-2, respectively; c - non-transfected lymphocytes (negative control). RN1 - region of cells with fluorescence above the threshold. The abscissa shows the fluorescence values in the FL2 channel; the ordinate shows the number of fluorescent particles.

Фиг.4. Цитотоксичность лимфоцитов, трансфицированных плазмидами рСЕА-1 (НСТ:р1-1) и рСЕА-2 (НСТ:р1-2), в отношении экспрессирующих РЭА клеток НСТ116 (через 5 ч после добавления соотношение эффекторных клеток и клеток-мишеней 10:1). Приведены средние проценты лизируемых клеток от общего количества клеток-мишеней и стандартные отклонения. HCT:K-pulse - цитотоксичность лимфоцитов, подверженных электрическому пульсу без добавления ДНК. НСТ - клетки НСТ116 без добавления лимфоцитов. * - р<0.05 по сравнению с контрольными нетрансфицированными лимфоцитами (HCT:K-lymph).Figure 4. Cytotoxicity of lymphocytes transfected with plasmids pCEA-1 (HCT: p1-1) and pCEA-2 (HCT: p1-2), in relation to CEA-expressing HCT116 cells (5 hours after addition, the ratio of effector cells and target cells 10: 1) . The average percent of lysed cells of the total number of target cells and standard deviations are given. HCT: K-pulse - cytotoxicity of lymphocytes susceptible to electrical pulse without the addition of DNA. HCT - HCT116 cells without the addition of lymphocytes. * - p <0.05 compared with control untransfected lymphocytes (HCT: K-lymph).

Пример 1. Клеточные линииExample 1. Cell lines

В работе использовались клеточные линии НЕК293 (клетки почки эмбриона человека), Jurkat (CD4(+) клеточная линия Т-клеточного лейкоза), любезно предоставленные ГУ НИИ эпидемиологии и микробиологии имени Н.Ф.Гамалеи.We used HEK293 cell lines (human embryonic kidney cells), Jurkat (CD4 (+) T-cell leukemia cell line), kindly provided by the N.F. Gamalei Research Institute of Epidemiology and Microbiology.

Вся работа с культурами клеток выполнялась в стерильных условиях в ламинарном боксе в специально оборудованной для работы с клетками комнате.All work with cell cultures was performed under sterile conditions in a laminar box in a room specially equipped for working with cells.

Культивирование НЕК293Cultivation of HEK293

Среда для культивирования НЕК293 имела следующий состав: DMEM (ПанЭко, Россия), 10% эмбриональная бычья сыворотка (ПанЭко) и антибиотики пенициллин, и стрептомицин в стандартной концентрации. Клетки культивировали в условиях высокой влажности при 37°С и 5% CO₂. При достижении 80-90% конфлюэнтности клетки пассировали. Для этого клетки 2 раза промывали раствором стерильного фосфатно-солевого буфера (FBS, Invitrogen), обрабатывали 0,25% раствором трипсина-ЭДТА. Для повышения эффективности работы ферментов на этой стадии флаконы с клетками помещали на 37°С на 4-5 минут. После открепления всех клеток от подложки трипсин инактивировали добавлением среды с сывороткой, затем клетки разбивали до получения однородной суспензии, отбирали требуемое количество клеток, а к оставшимся клеткам добавляли соответствующее количество полной культуральной среды и продолжали культивирование.The HEK293 culture medium had the following composition: DMEM (PanEco, Russia), 10% fetal bovine serum (PanEco), and penicillin antibiotics, and streptomycin in standard concentration. Cells were cultured in high humidity at 37 ° C and 5% CO ₂ . Upon reaching 80-90% confluency, the cells were passaged. For this, the cells were washed 2 times with a solution of sterile phosphate-buffered saline (FBS, Invitrogen), treated with 0.25% trypsin-EDTA solution. To increase the efficiency of enzymes at this stage, vials with cells were placed at 37 ° C for 4-5 minutes. After all cells were detached from the substrate, trypsin was inactivated by adding medium with serum, then the cells were broken to obtain a homogeneous suspension, the required number of cells was selected, and the remaining cells were added with the appropriate amount of complete culture medium and cultivation continued.

Заморозка и оттаивание НЕК293Freezing and thawing HEK293

Среда для заморозки имела следующий состав: 90% полной среды для культивирования и 10% ДМСО (ПанЭко).The freezing medium had the following composition: 90% of the complete culture medium and 10% DMSO (PanEco).

От культивируемых клеток отбирали среду, промывали 2 раза PBS, добавляли 0,25% раствора трипсина-ЭДТА. Инкубировали при 37°С в течение 5 минут, пипетировали для получения одноклеточной суспензии, нейтрализовали трипсин полной культуральной средой, содержащей сыворотку. Полученную суспензию центрифугировали 5 минут при 1000 об/мин. Надосадочную жидкость удаляли, осадок суспендировали в соответствующем количестве среды для заморозки, переносили в криопробирки в концентрации 10⁶ клеток в 1 мл среды и сразу помещали на -70°С на 24 часа. Через 24 часа криопробирки переносили в жидкий азот для продолжительного хранения. В одной криопробирке замораживали 1.0-2.0 млн клеток.Medium was taken from cultured cells, washed 2 times with PBS, 0.25% trypsin-EDTA solution was added. Incubated at 37 ° C for 5 minutes, pipetted to obtain a unicellular suspension, neutralized trypsin with a complete culture medium containing serum. The resulting suspension was centrifuged for 5 minutes at 1000 rpm. The supernatant was removed, the precipitate was suspended in an appropriate amount of freezing medium, transferred to cryovials at a concentration of 10 ⁶ cells in 1 ml of medium and immediately placed at -70 ° C for 24 hours. After 24 hours, cryovials were transferred to liquid nitrogen for long-term storage. In one cryovial, 1.0–2.0 million cells were frozen.

Криопробирки оттаивали на водяной бане при 37°С, стерилизовали 70% этанолом, затем их содержимое переносили в пробирку, содержащую среду для культивирования прогретую до 37°С, центрифугировали 5 минут при 1000 об/мин, надосадочную жидкость удаляли, осадок суспендировали в соответствующем количестве среды и переносили в флакон со средой. Клетки равномерно распределяли по культуральной поверхности и помещали в инкубатор на 37°С, 5% CO₂. Через 24 ч, когда клетки прикреплялись к подложке и начинали пролиферировать, заменяли среду для устранения погибших в процессе заморозки клеток.Cryovials were thawed in a water bath at 37 ° C, sterilized with 70% ethanol, then their contents were transferred to a test tube containing culture medium warmed up to 37 ° C, centrifuged for 5 minutes at 1000 rpm, the supernatant was removed, the precipitate was suspended in an appropriate amount medium and transferred into a vial of medium. Cells were evenly distributed over the culture surface and placed in an incubator at 37 ° C, 5% CO ₂ . After 24 hours, when the cells attached to the substrate and began to proliferate, the medium was replaced to eliminate the cells that died during the freezing process.

Культивирование лимфоцитовLymphocyte Culture

Среда для культивирования лимфоцитов имела состав, идентичный составу среды для культивирования Jurkat.The lymphocyte culture medium had a composition identical to that of the Jurkat culture medium.

Выделение лимфоцитов из периферической крови человекаIsolation of lymphocytes from human peripheral blood

Лимфоциты человека получали следующим образом. Свежую кровь человека отбирали в 5 мл стерильную пробирку, обрабатывали антикоагулянтом (цитрат натрия). Цельную кровь либо отстаивали при комнатной температуре в течение часа для осаждения эритроцитов, а затем отбирали плазму, содержащую лейкоциты, либо брали кровь непосредственно после выделения и разбавляли в PBS в соотношении 1:2, полученный раствор наслаивали на раствор фиколла-урографина (ПанЭко) в соотношении 2:1. Разделение клеток проводили центрифугированием в течение 30 мин при 1500 об/мин, после чего отбирали кольцо лимфоцитов. Отмывали лимфоциты от фиколла в 5 мл PBS 2 раза, клетки осаждали центрифугированием в течение 10 мин при 1000 об/мин. Осадок суспендировали в соответствующем количестве среды для культивирования лимфоцитов. Чистоту выделения популяции лимфоцитов и подсчет концентрации проводили на приборе Micros. Обычно среди выделенных клеток процент лимфоцитов составлял около 80-90%. Лимфоциты либо непосредственно использовали для опыта, либо помещали в культуральные чашки и инкубировали в стандартных условиях (37°С, 5% CO₂).Human lymphocytes were obtained as follows. Fresh human blood was taken in a 5 ml sterile tube, treated with an anticoagulant (sodium citrate). Whole blood was either defended at room temperature for an hour to precipitate red blood cells, and then plasma containing leukocytes was taken, or blood was taken immediately after isolation and diluted in PBS in a ratio of 1: 2, the resulting solution was layered on a solution of ficoll-urographin (PanEco) in 2: 1 ratio. Cell separation was carried out by centrifugation for 30 min at 1500 rpm, after which a lymphocyte ring was selected. The lymphocytes were washed from ficoll in 5 ml of PBS 2 times, the cells were precipitated by centrifugation for 10 min at 1000 rpm. The pellet was suspended in an appropriate amount of lymphocyte culture medium. The purity of the selection of the lymphocyte population and the concentration calculation were performed on a Micros instrument. Typically, among the selected cells, the percentage of lymphocytes was about 80-90%. Lymphocytes were either directly used for the experiment or placed in culture dishes and incubated under standard conditions (37 ° C, 5% CO ₂ ).

Пример 2. Введение экзогенной ДНК в клеткиExample 2. The introduction of exogenous DNA into cells

Трансфекция НЕК293Transfection HEK293

Липосомальная трансфекцияLiposomal transfection

PolyFect (Quagene). Трансфекция PolyFect (Quagene) проводилась согласно прилагаемому протоколу производителя. Клетки пассировали за 1 день до трансфекции, рассаживая около 1,0-1,2·10⁵ клеток на лунку 24-луночного планшета в 500 мкл культуральной среды, и инкубировали при 37°С, 5% CO₂. Процент конфлюэнтности на день трансфекции составлял около 60-80%. Всегда использовали 2 контрольных образца: первый - клетки, трансфицированные плазмидной ДНК, кодирующей зеленый флуоресцентный белок (pmaxGFP (Amaxa)), второй - нетрансфицированные клетки. Трансфекция одного образца согласно протоколу проводилась следующим образом. В бессывороточной среде, не содержащей антибиотиков (DMEM), растворяли 0,4 мкг плазмиды до суммарного объема 15 мкл. К раствору ДНК добавляли 4 мкл агента PolyFect, тщательно суспендировали, инкубировали 5-10 мин при комнатной температуре. Клеткам заменяли среду свежей полной культуральной средой до объема 400 мкл. По истечении 5-10 минут к комплексам ДНК-PolyFect добавляли 100 мкл полной среды, пипетировали и немедленно добавляли к клеткам. Помешивали, покачивая планшет, и помещали в инкубатор на 24-48 часов.PolyFect (Quagene). Transfection of PolyFect (Quagene) was performed according to the attached protocol of the manufacturer. Cells were passaged 1 day prior to transfection, seedling about 1.0-1.2 · 10 ⁵ cells per well of a 24-well plate in 500 μl of culture medium, and incubated at 37 ° C, 5% CO ₂ . The percentage of confluence on the day of transfection was about 60-80%. Always used 2 control samples: the first - cells transfected with plasmid DNA encoding a green fluorescent protein (pmaxGFP (Amaxa)), the second - non-transfected cells. Transfection of one sample according to the protocol was carried out as follows. 0.4 μg of plasmid was dissolved in a serum-free antibiotic-free medium (DMEM) to a total volume of 15 μl. To the DNA solution was added 4 μl of PolyFect agent, carefully suspended, incubated for 5-10 minutes at room temperature. The cells were replaced with fresh, complete culture medium to a volume of 400 μl. After 5-10 minutes, 100 μl of complete medium was added to the DNA-PolyFect complexes, pipetted and immediately added to the cells. Stirred by shaking the tablet, and placed in an incubator for 24-48 hours.

Lipofectin (Invitrogene). Трансфекция с использованием lipofectin проводилась согласно прилагаемому протоколу производителя. Клетки рассаживали за 24 часа до трансфекции в количестве около 1,0-1,2·10⁵ клеток на лунку 24-луночного планшета в 500 мкл культуральной среды и инкубировали стандартных условиях. Процент конфлюэнтности на день трансфекции составлял около 60-80%. Всегда использовали 2 контрольных образца: первый - клетки, трансфицированные плазмидной ДНК, кодирующей зеленый флуоресцентный белок (pmaxGFP), второй - нетрансфицированные клетки. Для одной трансфекции 0.4 мкг плазмидной ДНК растворяли в 20 мкл бессывороточной среды в отсутствие антибиотиков. 4 мкл Lipofectin растворяли в 20 мкл среды без сыворотки и антибиотиков, оставляли раствор при комнатной температуре на 30-45 мин. После этого соединяли раствор ДНК и Lipofectin, осторожно их перемешивали и инкубировали при комнатной температуре в течение 10-15 мин. От клеток отбирали среду, промывали 400 мкл среды без сыворотки и антибиотиков. По истечении времени инкубации к комплексам ДНК-lipofectin добавляли 160 мкл (на одну лунку) бессывороточной среды, осторожно перемешивали и добавляли к клеткам. Клетки инкубировали в стандартных условиях 24 часа, затем заменяли среду полной средой для культивирования и инкубировали еще 24 часа. Затем клетки снимали с субстрата стандартным образом и анализировали экспрессию плазмидной ДНК.Lipofectin (Invitrogene). Transfection using lipofectin was performed according to the attached protocol of the manufacturer. Cells were seeded 24 hours before transfection in an amount of about 1.0-1.2 · 10 ⁵ cells per well of a 24-well plate in 500 μl of culture medium and incubated under standard conditions. The percentage of confluence on the day of transfection was about 60-80%. Always used 2 control samples: the first - cells transfected with plasmid DNA encoding a green fluorescent protein (pmaxGFP), the second - non-transfected cells. For one transfection, 0.4 μg of plasmid DNA was dissolved in 20 μl of serum-free medium in the absence of antibiotics. 4 μl of Lipofectin was dissolved in 20 μl of serum-free and antibiotic-free medium, and the solution was left at room temperature for 30-45 minutes. After that, the DNA solution and Lipofectin were combined, they were carefully mixed and incubated at room temperature for 10-15 minutes. Medium was taken from the cells, washed with 400 μl of medium without serum and antibiotics. After the incubation time, 160 μl (per well) of serum-free medium was added to the DNA-lipofectin complexes, gently mixed and added to the cells. Cells were incubated under standard conditions for 24 hours, then the medium was replaced with complete culture medium and incubated for another 24 hours. Then the cells were removed from the substrate in a standard manner and the expression of plasmid DNA was analyzed.

Lipofectamine (Invitrogene). Трансфекция с использованием lipofectamine проводилась согласно протоколу производителя. Клетки рассаживали за 24 часа до трансфекции в количестве около 1,0-1,2·10⁵ клеток на лунку 24-луночного планшета в 500 мкл культуральной среды и инкубировали при 37°С, 5% CO₂. Процент конфлюэнтности на день трансфекции составлял около 60-80%. Всегда использовали 2 контрольных образца: первый - клетки, трансфицированные плазмидной ДНК, кодирующей зеленый флуоресцентный белок (pmaxGFP (Amaxa), второй - нетрансфицированные клетки. Для одной трансфекции 0.4 мкг плазмидной ДНК растворяли в 25 мкл бессывороточной среды в отсутствие антибиотиков. Lipofectamine осторожно перемешивали, на одну трансфекцию брали 4 мкл Lipofectamine, растворяли в 25 мкл среды без сыворотки и антибиотиков, осторожно перемешивали. Затем соединяли раствор ДНК и Lipofectamine, осторожно перемешивали и инкубировали при комнатной температуре в течение 15-45 мин. После этого к комплексам ДНК-Lipofectamine добавляли 150 мкл бессывороточной среды. Среду у клеток заменяли 200 мкл среды без сыворотки и антибиотиков, добавляли комплексы ДНК-Lipofectamine и помешивали, покачивая планшет. Клетки инкубировали в стандартных условиях около 5 часов, затем добавляли среды и соответствующее количество сыворотки до 10% и суммарного объема среды 500-600 мкл. Анализ экспрессии плазмидной ДНК проводили далее спустя 24 часа.Lipofectamine (Invitrogene). Transfection using lipofectamine was performed according to the manufacturer's protocol. Cells were seeded 24 hours before transfection in an amount of about 1.0-1.2 · 10 ⁵ cells per well of a 24-well plate in 500 μl of culture medium and incubated at 37 ° C, 5% CO ₂ . The percentage of confluence on the day of transfection was about 60-80%. Always used 2 control samples: the first - cells transfected with plasmid DNA encoding a green fluorescent protein (pmaxGFP (Amaxa), the second - non-transfected cells. For one transfection, 0.4 μg of plasmid DNA was dissolved in 25 μl of serum-free medium in the absence of antibiotics. Lipofectamine was gently mixed, 4 μl of Lipofectamine was taken per transfection, dissolved in 25 μl of serum-free and antibiotic-free medium, gently mixed, then the DNA solution and Lipofectamine were combined, gently mixed and incubated at room temperature ure for 15-45 minutes, after which 150 μl of serum-free medium was added to the DNA-Lipofectamine complexes, 200 μl of serum-free antibiotic medium was replaced in the cells, DNA-Lipofectamine complexes were added and stirred by shaking the plate.The cells were incubated under standard conditions for about 5 hours, then added the medium and the corresponding amount of serum up to 10% and the total volume of the medium 500-600 μl Analysis of expression of plasmid DNA was carried out further after 24 hours.

ЭлектропорацияElectroporation

Электропорация НЕК293 проводилась на приборе Amaxa Nucleofector (Lonzabio), с использованием набора «Human T Cell Nucleofector Kit» (Amaxa), согласно прилагаемому протоколу. Клетки пассировали за 24 часа до трансфекции стандартным образом в концентрации, достаточной для того, чтобы на день трансфекции достигалось 80-90% конфлюэнтности. Всегда использовали 2 контрольных образца: первый - клетки, трансфицированные плазмидной ДНК, кодирующей зеленый флуоресцентный белок (pmaxGFP), второй - нетрасфецированные клетки. Предварительно готовили и разогревали до комнатной температуры Nucleofection Solution (для трасфекции одного образца добавляли 18 мкл Supplement к 82 мкл Human T Cell Nucleofector Solution из набора Human T Cell Nucleofector Kit). Клетки снимали с субстрата стандартным образом, подсчитывали их количество, помещали нужное количество клеток в отдельную пробирку и осаждали центрифугированием при 1000 об/мин в течение 5 мин. На одну трансфекцию брали около 1-2 млн клеток. После центрифугирования от осадка клеток отбирали досуха среду, добавляли 100 мкл раствора Nucleofection Solution и суспендировали в нем клетки для получения однородной суспензии. Затем в клеточную суспензию добавляли 2 мкг плазмидной ДНК и переносили в кювету (Human T Cell Nucleofector Kit), избегая появления пузырей. Кювету помещали в держатель прибора Amaxa Nucleofector. Для трансфекции использовали программу Q-001. Сразу же после пульса в кювету добавляли 500 мкл предварительно прогретой до комнатной температуры культуральной среды, переносили в чашки Петри диаметром 3 см, содержащие 1,5 мл культуральной среды, предварительно согретой до 37°С. Затем клетки помещали в инкубатор на 37°С, 5% СО₃ на 24-48 часов.NEC293 electroporation was performed on an Amaxa Nucleofector (Lonzabio) instrument using the Human T Cell Nucleofector Kit (Amaxa) according to the attached protocol. Cells were passaged 24 hours before transfection in a standard manner at a concentration sufficient to achieve 80-90% confluence on the day of transfection. Always used 2 control samples: the first - cells transfected with plasmid DNA encoding a green fluorescent protein (pmaxGFP), the second - untransfected cells. The Nucleofection Solution was preliminarily prepared and warmed to room temperature (18 μl Supplement was added to 82 μl Human T Cell Nucleofector Solution from the Human T Cell Nucleofector Kit to transfect one sample). Cells were removed from the substrate in a standard manner, their number was counted, the desired number of cells was placed in a separate tube, and they were precipitated by centrifugation at 1000 rpm for 5 min. About 1-2 million cells were taken per transfection. After centrifugation, the medium was taken to dryness from the cell pellet, 100 μl of the Nucleofection Solution was added and the cells were suspended in it to obtain a uniform suspension. Then, 2 μg of plasmid DNA was added to the cell suspension and transferred to a cuvette (Human T Cell Nucleofector Kit), avoiding the appearance of bubbles. The cuvette was placed in the Amaxa Nucleofector instrument holder. For transfection, the Q-001 program was used. Immediately after the pulse, 500 μl of the culture medium preheated to room temperature was added to the cuvette, transferred to 3 cm diameter Petri dishes containing 1.5 ml of the culture medium preheated to 37 ° C. Then the cells were placed in an incubator at 37 ° C, 5% CO ₃ for 24-48 hours.

Трансфекция лимфоцитов человекаTransfection of human lymphocytes

Трансфекцию проводили с использованием программы V-024, обеспечивающей высокую эффективность трансфекции Т-лимфоцитов на приборе Amaxa Nucleofector. Для трансфекции одного образца использовали 2-3 млн клеток. Остальные условия и процедура трансфекции лимфоцитов человека были идентичны условиям для НЕК293.Transfection was performed using the V-024 program, which provides high efficiency of transfection of T-lymphocytes with an Amaxa Nucleofector instrument. For transfection of one sample used 2-3 million cells. The remaining conditions and the procedure for transfection of human lymphocytes were identical to the conditions for HEK293.

Цитофлуорометрический анализCytofluorometric analysis

Цитофлуорометрический анализ проводился на проточном цитофлуориметре DAKO Galaxy (Дания), в котором в качестве источника излучения используется аргоновый лазер (λ=488 нм). Полученные данные обрабатывали, используя программу FloMax, версия 3.0. Клетки осаждали центрифугированием при 1000 об/мин в течение 5-10 мин. Осадок промывали в 1 мл раствора PBS дважды. К полученному осадку добавляли 2 мл PBS и тщательно пипетировали. Полученный препарат клеток либо сразу анализировали на проточном цитофлуориметре, либо клетки затем подвергали фиксации и пермеабилизации и окраске с помощью антител (см. ниже).Cytofluorometric analysis was carried out on a DAKO Galaxy flow cytometer (Denmark), in which an argon laser (λ = 488 nm) was used as a radiation source. The data obtained were processed using the program FloMax, version 3.0. Cells were besieged by centrifugation at 1000 rpm for 5-10 minutes. The precipitate was washed in 1 ml of PBS solution twice. To the resulting precipitate was added 2 ml of PBS and thoroughly pipetted. The resulting cell preparation was either immediately analyzed on a flow cytometer or the cells were then fixed and permeabilized and stained with antibodies (see below).

Мечение антителами С-цепи Т-клеточного рецептораLabeling T-cell receptor C-chain antibodies

Фиксацию и пермеабилизацию клеток для мечения с помощью антител проводили с использованием набора «Fixation and permeabilization kit for flow cytometry» (DakoCytomation) согласно прилагаемой инструкции. Сухой остаток анализируемых клеток, содержащий не более 2 млн клеток, суспендировали в 100 мкл раствора PBS, разделяли на 2 равные части (опытный образец и изотипический контроль) и к каждой части добавляли 100 мкл фиксирующего реагента А. Клетки тщательно суспендировали и инкубировали при комнатной температуре в течение 15 мин. Образцы промывали в 2 мл PBS, клетки осаждали центрифугированием при 1000 об/мин в течение 5 минут, удаляли супернатант до жидкого остатка в 50 мкл. Затем клетки суспендировали для получения однородной суспензии, добавляли по 100 мкл пермобилизирующего раствора В к каждому образцу и тут же к образцам добавляли антитела на ζ-цепь мышиные антитела на IgG (Dako) в качестве изотопического контроля соответственно, тщательно суспендировали. Образцы инкубировали в течение 15 мин в темноте, затем промывали в 2 мл PBS, осаждали клетки центрифугированием при 1000 об/мин в течение 5 минут. К полученному осадку добавляли 2 мл PBS и тщательно пипетировали. После этого препараты сразу же анализировали на проточном цитофлуориметре способом, описанным выше.Fixation and permeabilization of cells for labeling with antibodies was performed using the Fixation and permeabilization kit for flow cytometry (DakoCytomation) kit according to the attached instructions. The dry residue of the analyzed cells, containing no more than 2 million cells, was suspended in 100 μl of PBS solution, divided into 2 equal parts (test sample and isotypic control), and 100 μl of fixing reagent A was added to each part. The cells were carefully suspended and incubated at room temperature within 15 minutes Samples were washed in 2 ml of PBS, cells were pelleted by centrifugation at 1000 rpm for 5 minutes, the supernatant was removed to a liquid residue of 50 μl. Then the cells were suspended to obtain a homogeneous suspension, 100 μl of permobilizing solution B was added to each sample, and then antibodies on the ζ chain of mouse antibodies on IgG (Dako) were added to the samples as an isotopic control, respectively, carefully suspended. Samples were incubated for 15 min in the dark, then washed in 2 ml of PBS, and cells were pelleted by centrifugation at 1000 rpm for 5 minutes. To the resulting precipitate was added 2 ml of PBS and thoroughly pipetted. After this, the preparations were immediately analyzed on a flow cytometer using the method described above.

Пример 3. Связывание экспрессируемых рецепторов с РЭА-ФИТЦExample 3. The binding of expressed receptors with CEA-FITC

Для оценки способности экспрессируемых химерных Т-клеточных рецепторов связывать РЭА клетки через 24 и 48 часов после трансфекции инкубировали с раствором раково-эмбрионального антигена, меченного флуоресцентным красителем ФИТЦ (РЭА-ФИТЦ), в течение 30 минут. После чего клетки анализировали на проточном цитофлуориметре.To assess the ability of expressed chimeric T-cell receptors to bind CEA, cells were incubated 24 hours and 48 hours after transfection with a solution of cancer-embryonic antigen labeled with fluorescent dye FITC (CEA-FITC) for 30 minutes. Then the cells were analyzed on a flow cytometer.

Список литературыBibliography

1. Murphy A., Westwood J.A., Teng M.W., Moeller M., Darcy P.K., Kershaw M.H. Gene modification strategies to induce tumor immunity // Immunity. - 2005. - V.22. - N.4. - P.403-414.1. Murphy A., Westwood J.A., Teng M.W., Moeller M., Darcy P.K., Kershaw M.H. Gene modification strategies to induce tumor immunity // Immunity. - 2005. - V.22. - N.4. - P.403-414.

2. Yee С.Adoptive therapy using antigen-specific T-cell clones // Cancer J. - 2010. - V.6. - N.4. - P.367-373.2. Yee C. Adaptive therapy using antigen-specific T-cell clones // Cancer J. - 2010. - V.6. - N.4. - P.367-373.

3. Chhabra A. TCR-engineered, customized, antitumor Т cells for cancer immunotherapy: advantages and limitations // Scientific World Joumal. - 2011. - V.11. - P.121-129.3. Chhabra A. TCR-engineered, customized, antitumor T cells for cancer immunotherapy: advantages and limitations // Scientific World Joumal. - 2011. - V.11. - P.121-129.

4. Altenschmidt U., Moritz D., Groner B. Specific cytotoxic Т lymphocytes in gene therapy // J. Mol. Med. - 1997. - V.75. - N.4. - P.259-266.4. Altenschmidt U., Moritz D., Groner B. Specific cytotoxic T lymphocytes in gene therapy // J. Mol. Med. - 1997. - V.75. - N.4. - P.259-266.

5. Chen J., Dave S.K., Simmons A. Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide // Virol J. - 2004. - V.1. - P.11.5. Chen J., Dave S.K., Simmons A. Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide // Virol J. - 2004. - V.1. - P.11.

6. Ma Q.Z., Gonzalo-Daganzo R., Junghans R.P. Genetically engineered Т cells as adoptive immunotherapy of cancer // In: Giaccone, R.; Schlinsky, R.; Sondel, P., editors. Cancer Chemotherapy & Biological Response Modifiers - Annual 20. Oxford: Elsevier Science. - 2002. - P.319-345.6. Ma Q.Z., Gonzalo-Daganzo R., Junghans R.P. Genetically engineered T cells as adoptive immunotherapy of cancer // In: Giaccone, R .; Schlinsky, R .; Sondel, P., editors. Cancer Chemotherapy & Biological Response Modifiers - Annual 20. Oxford: Elsevier Science. - 2002. - P.319-345.

7. Rossig С., Bollard C.M., Nuchtem J.D., Merchant D.A., Brenner M.K. Targeting of GD2-positive tumor cells by human Т lymphocytes engineered to express chimeric T-cell receptor genes // Int J Cancer. - 2001. - V.94. - N.2. - P.228-236.7. Rossig C., Bollard C.M., Nuchtem J.D., Merchant D.A., Brenner M.K. Targeting of GD2-positive tumor cells by human T lymphocytes engineered to express chimeric T-cell receptor genes // Int J Cancer. - 2001. - V.94. - N.2. - P.228-236.

8. Gade T.P., Hassen W., Santos E., Gunset G., Saudemont A., Gong M.C., Brentjens R., Zhong X.S., Stephan M., Stefanski J., Lyddane C., Osbome J.R., Buchanan I.M., Hall S.J., Heston W.D., Riviere I., Larson S.M., Koutcher J.A., Sadelain M. Targeted elimination of prostate cancer by genetically directed human Т lymphocytes // Cancer Res. - 2005. - V.65. - N.19.- P.9080-9088.8. Gade TP, Hassen W., Santos E., Gunset G., Saudemont A., Gong MC, Brentjens R., Zhong XS, Stephan M., Stefanski J., Lyddane C., Osbome JR, Buchanan IM, Hall SJ, Heston WD, Riviere I., Larson SM, Koutcher JA, Sadelain M. Targeted elimination of prostate cancer by genetically directed human T lymphocytes // Cancer Res. - 2005. - V.65. - N.19.- P.9080-9088.

9. Ma Q., Safar M., Holmes E., Wang Y., Boynton A.L., Junghans R.P. Anti-prostate specific membrane antigen designer Т cells for prostate cancer therapy // Prostate. - 2004. - V.61. - N.1. - P.12-25.9. Ma Q., Safar M., Holmes E., Wang Y., Boynton A.L., Junghans R.P. Anti-prostate specific membrane antigen designer T cells for prostate cancer therapy // Prostate. - 2004 .-- V.61. - N.1. - P.12-25.

10. Ma Q., DeMarte L., Wang Y., Stanners C.P., Junghans R.P. Carcinoembryonic antigen-immunoglobulin Fc fusion protein (CEA-Fc) for identification and activation of anti-CEA immunoglobulin-T-cell receptor-modified Т cells, representative of a new class of Ig fusion proteins // Cancer Gene Ther. - 2004. - V.11. - N.4. - P.297-306.10. Ma Q., DeMarte L., Wang Y., Stanners C.P., Junghans R.P. Carcinoembryonic antigen-immunoglobulin Fc fusion protein (CEA-Fc) for identification and activation of anti-CEA immunoglobulin-T-cell receptor-modified T cells, representative of a new class of Ig fusion proteins // Cancer Gene Ther. - 2004. - V.11. - N.4. - P.297-306.

11. Schwartz M.K. Cancer markers // In: DeVita, VT.; Hellman, S.; Rosenberg, SA., editors. Cancer: Principles and Practice of Oncology. Lippincott. - 1993. - P.531-542.11. Schwartz M.K. Cancer markers // In: DeVita, VT .; Hellman, S .; Rosenberg, SA., Editors. Cancer: Principles and Practice of Oncology. Lippincott. - 1993. - P.531-542.

12. Hammarstrom S. The Carcinoembryonic antigen (CEA) family: structures, suggested functions and expression in normal and malignant tissues // Seminars in Cancer Biology. - 1999. - V.9. - N.2. - P.67-81.12. Hammarstrom S. The Carcinoembryonic antigen (CEA) family: structures, suggested functions and expression in normal and malignant tissues // Seminars in Cancer Biology. - 1999. - V.9. - N.2. - P.67-81.

13. Emtage P.C., Lo A.S., Gomes E.M., Liu D.L., Gonzalo-Daganzo R.M., Junghans R.P. Second-generation anti-carcinoembryonic antigen designer Т cells resist activation-induced cell death, proliferate on tumor contact, secrete cytokines, and exhibit superior antitumor activity in vivo: a preclinical evaluation // Clin Cancer Res. - 2008. - V.14. - N.24. - P.8112-8122.13. Emtage P.C., Lo A.S., Gomes E.M., Liu D.L., Gonzalo-Daganzo R.M., Junghans R.P. Second-generation anti-carcinoembryonic antigen designer T cells resist activation-induced cell death, proliferate on tumor contact, secrete cytokines, and exhibit superior antitumor activity in vivo: a preclinical evaluation // Clin Cancer Res. - 2008. - V.14. - N.24. - P.8112-8122.

14. Ma Q., DeMarte L,, Wang Y., Stanners C.P., Junghans R.P. Carcinoembryonic antigen-immunoglobulin Fc fusion protein (CEA-Fc) for identification and activation of anti-CEA immunoglobulin-T-cell receptor-modified Т cells, representative of a new class of Ig fusion proteins // Cancer Gene Ther. - 2004. - V.11. - N.4. - P.297-306.14. Ma Q., DeMarte L ,, Wang Y., Stanners C.P., Junghans R.P. Carcinoembryonic antigen-immunoglobulin Fc fusion protein (CEA-Fc) for identification and activation of anti-CEA immunoglobulin-T-cell receptor-modified T cells, representative of a new class of Ig fusion proteins // Cancer Gene Ther. - 2004. - V.11. - N.4. - P.297-306.

15. Chen J., Dave S.K., Simmons A. Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide // Virol J. - 2004. - V.1. - P.11.15. Chen J., Dave S.K., Simmons A. Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide // Virol J. - 2004. - V.1. - P.11.

16. Sambrook J., Russell D.W. Molecular cloning: a laboratory manual // Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. - 2001.16. Sambrook J., Russell D.W. Molecular cloning: a laboratory manual // Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. - 2001.

17. Bjemer J., Lebedin Y., Bellanger L., Kuroki M., Shively J.E., Varaas Т., Nustad K., Hammarstrom S., Bormer O.P. Protein epitopes in carcinoembryonic antigen. Report of the ISOBM TD8 workshop // Tumour Biol. - 2002. - V.23. - N.4. - P.249-262.17. Bjemer J., Lebedin Y., Bellanger L., Kuroki M., Shively J.E., Varaas T., Nustad K., Hammarstrom S., Bormer O.P. Protein epitopes in carcinoembryonic antigen. Report of the ISOBM TD8 workshop // Tumour Biol. - 2002. - V.23. - N.4. - P.249-262.

Claims

1. A single chain antibody to a cancer-embryonic antigen, which is encoded by the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

2. Chimeric monomolecular T-cell receptor specific for cancer-embryonic antigen, comprising a single chain antibody encoded by the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, according to claim 1.

3. The chimeric monomolecular T cell receptor according to claim 2, encoded by the nucleotide sequence of SEQ ID NO: 3.

4. The chimeric monomolecular T cell receptor according to claim 2, encoded by the nucleotide sequence of SEQ ID NO: 4.

5. A vector for expressing a chimeric monomolecular T cell receptor specific for a cancer-embryonic antigen according to claims 2-4, comprising the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.

6. A host cell producing a chimeric monomolecular T-cell receptor specific for the cancer-embryonic antigen according to claims 2-4, containing the vector according to claim 5.

7. A method for diagnosing or treating diseases characterized by the presence of antigens capable of binding to a chimeric monomolecular T-cell receptor according to claim 2, 3 or 4.