RU2509804C2 - Set of differentiating and specific oligonucleotides for identifying dna of acute intestinal infection agents, method of identifying acute intestinal infection, microchip and diagnostic system for carrying out method - Google Patents

Abstract

FIELD: chemistry.

SUBSTANCE: invention relates to molecular biology and can be used in diagnostic studies aimed at detecting acute intestinal infection (AII) agents. Disclosed is a set of differentiating oligonucleotides (probes), which enables to determine, in a biological sample, DNA of pathogenic microorganisms which cause AII, and specific identification thereof, where said microorganisms relate to a group which includes Shigella spp. and Enteroinvasive E.coli (EIEC), Salmonella spp., Campylobacter Jejuni, Proteus mirabilis, Klebsiella pneumoniae.

EFFECT: described is design of a biochip on which is immobilised a set of probes disclosed herein, designed to perform rapid analysis of AII agents in clinical samples and material obtained from environmental media.

2 cl, 4 tbl, 2 dwg, 5 ex

Description

Technical field

The invention relates to the field of biotechnology, molecular biology and genetic engineering, and in particular, to a method for identifying DNA of pathogens of acute intestinal infections (OCI), including the steps of DNA isolation and amplification, subsequent hybridization of amplified DNA on a biological microchip. The invention also discloses the composition of highly specific DNA probes and oligonucleotides for PCR, a set of reagents for identification.

State of the art

The identification and identification of DNA of causative agents of infectious diseases of the gastrointestinal tract is an urgent problem. Acute intestinal infections (ACI) continue to occupy a significant place in the structure of infectious diseases, second only to the prevalence of acute respiratory viral infections. Every year in the world, the number of cases of acute intestinal infections reaches 3-5 billion people, while 5-10 million patients die. In both developing and industrialized countries, despite some successes in diagnosis and treatment, the problem of acute intestinal infections is quite acute.

Currently, the use of PCR and the use of DNA microarrays are more promising for the diagnosis of pathogenic bacteria [1, 2].

Known US patent No. 7,364,898 which examines the possibility of identification using a microchip of bacteria belonging to the group consisting of Staphylococcus, Enterococcus, Streptococcus, Haemolyticus, Pseudomonas, Campylobacter, Enterobacter, Neisseria, Proteus, Salmonella, Simonsiella, Riemerella, Escherocherichia, Moherocella Merciheraceria, Moherocella, Escherichiaration, Moherocella, Escherichia , Kingella, Chromobacterium, Branhamella [3].

Known patent application in the US No. 2006240453, which claims the possibility of identifying a wide group of bacteria, including Escheria coli, Klebsiella pneumoniae, Salmonella, Campylobacter, Shigella species, enteroinvasive E. Coli [4].

Known US application No. 20060194206, which describes a method for identifying diarrhea caused by Shigella and pathogenic E. coli (DEC) using several specific genetic markers that are part of the group consisting of A / EEC & EPEC, ETEC, VTEC, EIEC, ehxA, ipaH genes. According to the invention, multi-primer PCR is performed. The PCR product can be detected either by capillary electrophoresis, or on the surface of membranes (ELISA) or DNA chips, or using Luminex.RTM [5].

Closest to the diagnosis in question is patent application RU No. 2004114259 [6], which addresses the detection and identification of intestinal bacteria using a microchip.

One of the disadvantages of the microchips and identification methods under consideration is the low level of control over the diagnostic process or its absence and difficulties in implementing the identification method due to the poor development of individual stages, which requires further efforts. For example, the disadvantage of the invention RU No. 2004114259 can be attributed to the fact that in the list of markers there are no markers of positive and negative controls.

In addition, usually in these studies, either two-step PCR is used, or asymmetric multi-primer PCR is used, which is quite expensive. There is a known method of identification based on a biochip, in which a simpler symmetric, multi-primer PCR and control over the passage of the diagnostic process are used, but this chmp is designed to identify DNA of transgenic plants [7].

The technical task of the invention is to create a more advanced diagnosis of OKI using a new biological microchip, which has more advanced characteristics at a low cost of screening for the presence of OKI.

Another task is to increase the reliability and reproducibility of the results. This problem is solved by using new, more efficient primer sequences in biological chips for the diagnosis of OCI and by developing a method for processing products of multi-primer symmetric PCR with an enzyme that increases hybridization efficiency, as well as by arranging positive control clusters that simultaneously act as identifiers of the boundaries of the biochip working area .

The next task is to develop a kit for diagnostics, which includes new primers, a new biochip and an enzyme for processing PCR products.

SUMMARY OF THE INVENTION

The proposed diagnostic method is based on the implementation of symmetric multi-primer PCR using specific primers complementary to the sequences of the OKI marker genes, and subsequent hybridization of the PCR products on a microchip containing an original set of differentiating oligonucleotides.

One of the objects of the invention is a method for identifying markers of acute intestinal infections, including obtaining a sample of the studied DNA, direct and reverse primers specific for the DNA of one or more OKI markers, and a microchip, PCR in the presence of a DNA sample and primers specific to the specified one or more markers, the application of PCR products to the working area of the biochip, incubation under hybridization conditions, the detection of the formed hybridization complexes on the biochip. The method uses a microchip that contains differentiating oligonucleotides, the sequences of which are shown in SEQ ID NO: 3, 6, 9, 12, 15, 18, 19, shown in Table 3 and the sequence listing, and oligonucleotides, the sequence of which are used as specific primers selected from the group consisting of SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 17 shown in table 2 and the list of sequences, conduct multi-primer PCR, and in a pair of direct and one reverse primer contains a label that after DNA hybridization det Editin, recorded and used to identify AII markers.

As regards the choice of primers for PCR, a set of 5 pairs of oligonucleotides complementary to the nucleotide sequences of marker genes included in the structure of pathogenic microorganisms belonging to the genus Shigella spp is proposed. and Enferoinvasive E. coli (EIEC), Salmonella spp., Campylobacter jejuni, Proteus mirabilis and Klebsiella pneumoniae. Selected sections of the markers are shown in table 1, and the sequence of specific oligonucleotides used as primers for identifying markers in the method for identifying OKI are presented in table 2.

Another object of the invention are differentiating oligonucleotides, the sequence of which is presented in table 3 and used as probes immobilized on the surface of the biochip.

List of figures

Figure 1. The image of the arrangement of clusters on the working area of the microchip, where: pos. 1 and pos. 8 refer to the positive control, pos. 2 refers to the Shigella spp marker. and Enteroinvasive E. coli (EIEC), pos. 3 and pos. 7 refer to the negative control, pos. 4 refers to the marker Salmonella spp., pos. 5 refers to the marker Campylobacter jejuni, pos. 6 refers to the marker Proteus mirabilis, pos. .9 refers to the marker Klebsiella pneumoniae.

Figure 2 Example of visualization of a positive test result for Shigella Spp., EIEC and Klebsiella pneumonaie. when identifying a sample containing an OCI.

Description of the invention

The method for identifying OKI markers, in the General case, includes the following stages: (a) the preparation of a biological microchip, which consists in modifying the surface of the substrate of the microchip and in the subsequent immobilization of differentiating oligonucleotides shown in table 3;

(b) the implementation of DNA extraction from a clinical sample and the use of a recombinant plasmid described in table 1 to control the process of DNA extraction;

(c) carrying out multiplex symmetric polymerase chain reactions (PCR) of the samples of the isolated DNA using a kit containing biotin-labeled primers described in table No. 2, as well as additional conducting symmetric PCR with the set of recombinant plasmids described in table 1 for positive and negative control of the PCR process;

(d) processing the products of DNA amplified with an exonuclease of phage lambda;

(e) hybridization of the amplified labeled product on a biochip with the formation of perfect and imperfect duplexes and providing positive and negative control of the hybridization process;

(e) conducting a complexation reaction with fluorescently-labeled streptavidin;

(g) recording and interpreting the results of hybridization by comparing the resulting picture with patterns;

Marker selection.

In the process of studying methods for diagnosing OCI and known diagnostic biochips [1-6], most of the known solutions were reviewed related to the selection of known markers for the diagnosis of OCI.

The non-obvious solution in the framework of the present invention can be attributed to the selection of a list of markers with the help of which a wider range of pathogenic microorganisms is identified than in known analogues patents. The list of markers is designed in such a way that it eliminates the disadvantages of known inventions. In the list, in conjunction with well-known markers of genes belonging to the group Shigella spp., EIEC, Salmonella spp., Campylobacter jejuni, Klebsiella pneumoniae [6], an additional gene marker from Proteus mirabilis is included. The choice of Proteus mirabilis is not obvious, since it is mainly used to identify urogenital infections in diagnostic systems based on the identification of Mycobacterium, Mycoplasma, Legionella, Salmonella, Chlamydia, Campylobacter, Proteus mirabilis, Enterococcus, Enterobacter, E. coli, Pseudomisseria g group I 8, 9]. The inclusion of a marker marker gene from Proteus mirabilis in the marker population allows the implementation of the technical task of the invention to increase the diagnostic efficiency, at the same time, quickly and at minimal cost, to diagnose from 1 to 5 OCI markers based on the identification of DNA regions specific for OCI sources.

Table 1 The list of markers for the diagnosis of OKI Organism Primers The length of the PCR fragment, bp Shigella spp., Enteroinvasive E. coli (EIEC) SEQ ID NO: 1 124 SEQ ID NO: 2 Salmonella spp. SEQ ID NO: 4 95 SEQ ID NO: 5 Campylobacter jejuni SEQ ID NO: 7 112 SEQ ID NO: 8 Proteus mirabilis SEQ ID NO: 10 138 SEQ ID NO: 11 Klebsiella pneumoniae SEQ ID NO: 13 82 SEQ ID NO: 14 Internal Control (GE 13) SEQ ID NO: 16 160 SEQ ID NO: 17

Selection of specific oligonucleotides for multi-primer PCR.

When choosing a sequence for specific PCR primers, two conditions were fulfilled.

The first condition related to the selection of a DNA fragment with a new sequence. When searching for new fragments, it was monitored so that the complementarity of the selected new fragment with respect to the known fragment from the prior art was below 80-70%. Moreover, the search for such sequences was carried out in a wider field than the diagnosis of OKI.

In the process of researching the novelty of the developed primers, no patents and applications for inventions were found in which the complementarity between the new claimed and known primers was 100%.

The primers were selected taking into account the requirements of high specificity for conserved regions of the genes of the studied objects Shigella spp., EIEC, Salmonella spp., Campylobacter jejuni, Klebsiella pneumoniae Proteus mirabilis, which allows selectively amplifying DNA fragments of pathogenic microorganisms directly from the isolated biological sample. When choosing primers, the requirements standardly applied to primers are taken into account, which include: the absence of highly stable secondary structures, a small difference in melting temperatures not exceeding 2-3 ° C, and the choice of primer lengths in the range from 15 to 35 n.o [7] .

For the preparation of primers, we used sequences characteristic of identifiable microorganisms and presented in the GenBank database of nucleotide sequences (http://ncbi.nlm.nih.gov), in which the most conserved regions were selected that were not previously used and were not obvious for identification.

Each pair of oligonucleotides for PCR specific to one of the markers of the OCI consists of one unlabeled (not containing any labels necessary for subsequent analysis and interpretation of the results) specific oligonucleotide from the sequences listed in the list with SEQ ID NO: 1, 4, 7 , 8, 11, 14, 17 and labeled (containing one or more labels necessary for subsequent analysis and interpretation of the results) of a specific oligonucleotide from the sequences listed in the list with SEQ ID NO: 2, 5, 8, 11, 14, 17. Below a recap s specific nucleotides (Table 2) used in the present invention.

table 2 Specific oligonucleotides for the specific identification of microorganisms causing OKI ID SEQ No Nucleotide sequence Gene name one 5 'P-GCGCTCACATGGAACAATCTC 3' Shigella spp., EIEC (Enteroinvasive E. coli) 2 5 'biotin-CCAGAATTTCGAGGCGGAAC 3' four 5 'P-CTCCCGTAGCAGTTTACGCTG 3' Salmonella spp. 5 5 'biotin-GTCAGCGCCGAAAGACTCTC 3' 7 5 'P-CAATGCAGTTCTTGTGAAAGTCCTG 3' Campylobacter jejuni 8 5 'biotin-CAGTGTCTAAAGTGCGTTTATTGGCA 3' 10 5 'P-TTAGCTGCAGATCAAGGTCATGG 3' Proteus mirabilis eleven 5 'biotin-CCACCATCTTTTATAGCAGCAGTAG 3' 13 5 'P-CCGCGTTCAGCCGTCCTATCC 3' Klebsiella fourteen 5 'biotin-GGCGAAACGTCAAACTTCACC 3' pneumoniae 16 5 'P-TTGGAAACGGCAGAGAAGGTACTG 3' Positive control 17 5 'biotin-CCAGCCATGCACACTGATACTCTTC 3'

The selection of differentiating oligonucleotides.

Differentiating oligonucleotides were selected taking into account the high specificity requirements for conserved regions of the studied OCI genes, which allows selective hybridization of DNA fragments amplified with specific oligonucleotides by PCR directly from biological samples, as well as on the basis of the absence of highly stable secondary structures, and having a length of 15 to 35 n.a.

It is permissible to use oligonucleotides homologous to the oligonucleotides indicated in the sequence listing by not less than 80%, preferably not less than 90%, most preferably not less than 95%. It is permissible to use oligonucleotides having deletions or insertions of one or more nucleotides.

The following is a list of differentiating oligonucleotides (table No. 3) for the diagnosis of OCI, which include differentiating primers of positive and negative control.

Table 3 Differentiating oligonucleotides for species identification of eight OKI marker genes ID SEQ No Nucleotide sequence Gene name 3 5 'GCATCAGAAGGCCTTTTCGATAATGATACC 3' Shigella spp., EIEC (Enteroinvasive E. coli) 6 5 'TACGATGAAGTGGAGCTGAGGTTGCAACTGCTG 3' Salmonella spp. 9 5 'GCTTTTATACATTAGCGATGTTGGAATTCAATGTTG 3' Campylobacter jejuni 12 5 'TGATGCTCCTTGCTCAATTACTCCTGATACTGA 3' Proteus mirabilis fifteen 5 'CTCAGTCGCTGCGCATAGAAGGTACGGTACGG 3' Klebsiella pneumoniae eighteen 5 'GGAGAAACTGCATCAGCCGATTATCATCACCGAATACG 3' Positive control 19 5 'GGAGAAACTGCATCAGC 3' Negative control

Synthesis of probes and primers

Oligonucleotides are synthesized on an automatic synthesizer (for example, Pharmacia's Gene Assembler model) using the standard amidophosphite method. Differentiating Oligonucleotides contain a 5'- or 3'-terminal group, ensuring their immobilization on the surface of the chip, for example, a 5'-terminal phosphate group, which is introduced by chemical phosphorylation during synthesis. One of a pair of specific oligonucleotides for PCR is modified at the 5'-end with a label that is selected from the group consisting of: catalytic, ligand, fluorescent and radioactive, which is introduced by chemical methods or enzymatically.

DNA isolation and preparation of material for amplification.

DNA isolation is carried out from a biological sample containing OCI using generally accepted methods based, for example, on alkaline lysis, use of detergents, proteinase K, extraction with phenol, chloroform and / or a phenol / chloroform mixture, or purification on diatomaceous earth or using silicon dioxide .

Positive and negative controls. Within the scope of this invention, there are several levels of control over the diagnostic process. In the DNA isolation step, an internal DNA isolation control is added to the isolated mixture. For the formation of the control function of the amplification process, positive and negative control are used. As a positive control, a mixture of recombinant plasmids is used, the names of which are shown in Table 1. The design of each plasmid contains a cloned fragment of one of the marker genes belonging to the Shigella spp group. and Enteroinvasive E. coli (EIEC), Salmonella spp., Campylobacter jejuni, Proteus mirabilis, Klebsiella pneumoniae. The length of the PNR fragments ranges from 82 to 138 bp. The negative control, for subsequent verification of the optimal conditions for the multi-primer PCR procedure, was performed in the form of a plasmid with a cloned GE 13 gene fragment of 160 bp in length.

In addition, differentiating oligonucleotides that act as positive and negative controls for the passage of the hybridization reaction are immobilized on the microchip (see example No.).

Thus, in the framework of this invention provides full control over all stages of the diagnostic process.

Tag selection

A large number of patents are known in which various types of tags are considered for constructing biological chips. The catalytic molecule is selected from the group consisting of hemin, cyanocobalamin or flavin. The ligand molecule is selected from the group consisting of biotin, dioxigenin or dinitrobenzene. The fluorescent molecule is selected from the group consisting of FAM, TAMRA, Cy3, Cy5, Cy7, R6G, R110, ROX or JOE.

Amplification of DNA by PCR

DNA fragments of typical OKI sequences are obtained by symmetric PCR using highly specific primers (see example 4).

PCR conditions.

The total number of pairs of specific oligonucleotides can vary from 1 to 5 in combination to identify markers of the OKI. The composition of the PCR mixture includes from 1 unit. up to 20 units, Taq polymerase activity per 1 μl. The PCR mixture may include reagents that increase the specificity and effectiveness of PCR, for example, such as betaine, ectain and its derivatives, as well as trehalose, dimethyl sulfoxide, glycerol.

The concentration of oligonucleotides in PCR can be from 0.05 μm to 0.3 μm, optimally from 0.1 μm to 0.25 μm.

The volume of the reaction mixture can be from 5 μl to 200 μl, optimally from 20 μl to 50 μl. The reaction can be carried out with or without mineral oil, depending on the design of the DNA amplifier. PCR is performed using a DNA amplifier (for example, “Terzik”, DNA technology, Russia or “Mastercycler”, Eppendorf, Germany) under the conditions shown in Table 4.

Processing of PCR products with an exonuclease of phage lambda.

One of a pair of PCR primers contains a phosphate group at the 5'-end. This is necessary in order for the chain of the DNA fragment that is synthesized during PCR with this primer to be efficiently hydrolyzed by the phage lambda exonuclease. Since the second of the primer pairs at the 5 ′ end contains biotin or a fluorescent label, this DNA strand is protected from degradation by exonuclease. This makes it possible to obtain single-stranded DNA labeled at the 5'-end with biotin or a fluorescent label after processing PCR products with an exonuclease of phage lambda. Hybridization with single-stranded DNA is more efficient, which improves the sensitivity and reproducibility of the diagnosis. To obtain single-stranded DNA, asymmetric PCR is often used. The method of obtaining single-stranded DNA using asymmetric PCR requires a large number of PCR cycles and up to a 50-fold excess of one of the primers, which leads to an increase in PCR time and increases the cost of the reaction. The use of phage lambda exonuclease to obtain single-stranded DNA allows the use of standard symmetric PCR, which is more effective and economical both in terms of the number of reagents and the time taken. For the hydrolysis of PCR products, 2 to 20 activity units per 1 μl are used. exonuclease phage lambda. Processing time is from 30 to 90 minutes. It is more preferable to use 10 units of the enzyme and carry out the reaction for 60 minutes at a temperature of 37 ° C.

Hybridization.

Labeled PCR products hybridize with DNA probes (differentiating oligonucleotides) immobilized on a biochip in a specially selected buffer (see Example 3).

Peroxidase reaction

If PCR products are labeled with biotin, for further identification it is necessary to conduct a reaction with conjugate streptavidin-peroxidase or streptavidin-phosphatase (see example No.).

Biochip structure

The biological microchip in one of the options, which includes, but does not limit other options, is a glass plate of the following sizes: length - 76.0 ± 0.1 mm; width - 26.0 ± 0.1 mm; thickness - 1 ± 0.1 mm. On the surface of the biological microchip, 9 clusters of immobilized oligonucleotides are located in a certain order (see Figure 1). In five clusters, oligonucleotides immobilized corresponding to the DNA sequences of the diagnosed pathogens - Shigella spp. and Enteroinvasive E. coli (EIEC), Salmonella spp., Campylobacter jejuni, Proteus mirabilis, Klebsiella pneumoniae (H-shi, H-sal, H-cam, H-pro, H-kle). Two clusters with the “P” index contain the covalently linked H-GE13 oligonucleotide, designed to test all dial-up reactions and the unique orientation of the biological microchip. Two clusters with an index of "N" contain the oligonucleotide H-17, which does not correspond to the diagnosed sequences and acts as a negative control of hybridization. The location and purpose of the working areas on the surface of biochips corresponds to the arrangement of DNA probes. Differentiating oligonucleotides - probes are deposited in a cluster in four or nine repetitions.

The preferred form of the multichip is a flat rectangular element made of a solid or flexible material of different thicknesses. The thickness of the carrier may be from 0.05 mm to 5 mm. The supporting element of the chip is made of materials included in the group consisting of: polymers, glass, metals, ceramics, or combinations thereof. The polymers are selected from the group consisting of polymethyl methacrylate, polybutyl methacrylate, polyvinyl chloride, polycarbonate, copolymers of methyl methacrylate and / or copolymers of butyl methacrylate with other monomers, such as styrene, acrylonitrile.

The surface of the supporting element can be modified as needed or coated with some material capable of immobilizing oligonucleotides.

Figure 2 shows the hybridization pattern obtained by scanning the biochip, which shows an example of visualization of a positive test result for Shigella Spp., EIEC and Klebsiella pneumonaie. when identifying a sample containing an OCI.

Multi-chip identification

The biochip identifier may include a batch number code and / or production date, information about the list of placed differentiating oligonucleotides. The identifier can be made in the form of a barcode or an element with magnetic recording of information.

The use of a unique biochip code will provide a quick search of information in the databases of all samples during parallel screening of the OCI.

Interpretation of analysis data

The signal intensity of the resulting perfect or imperfect duplexes within each group of clusters is significantly higher than the signal intensity of the negative controls, which allows reliable identification of the OCI. Detection and / or identification of OCI is carried out by comparative analysis of the signal level of the test sample, positive and negative controls. The interpretation of the results is carried out on the basis of a hybridization picture, which is obtained using an experimental setup, including, for example, a scanner, a computer and special software. To read data from a microchip, it is more preferable to use a hardware-software complex — the Fluogen-2 chip detector — manufactured by MMTech, Russia, to interpret the results of the analysis.

The interpretation of the results is as follows. The intensities of fluorescent or colorimetric signals in each group of DNA probes that contain oligonucleotides that are species-specific for one of the 9 OCI markers are compared using special software with the groups of probes of the positive (maximum signal intensity) and negative (minimum signal intensity) control. As a result, a hybridization pattern is formed, which is different for the groups of positive control, negative control and for clusters that characterize OKI markers, which allows one to unambiguously interpret the obtained data.

Diagnostic kit

Another object of the invention is a kit for identifying markers OKI, including:

a) at least one biochip for a one-time diagnosis, containing at least five differentiating oligonucleotides, two of which serve as positive and two as negative controls and are presented in SEQ SEQ ID NO: 3, 6, 9, 12, 15 , 18, 19, respectively;

b) specific oligonucleotides used as PCR primers to identify OKI markers whose sequences are presented in SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, and the specific oligonucleotides presented in SEQ ID NO: 16, 17 which are complementary to the differentiating oligonucleotide of the positive control SEQ ID NO: 18, placed on the biochip in the clusters of the positive control.

c) reagents that are selected from the group consisting of: reagents for sample preparation, reagents for conducting multi-primer symmetric PCR, reagents for hybridization, or combinations thereof and an exonuclease of phage lambda.

The kit additionally contains stickers with the brand name and barcode, which indicates the series number and release date of the diagnostic system.

Examples

The following are examples that include, but are not limited to, the scope of the invention.

Example 1. Preparation of the surface of the biochip (surface modification)

A matrix containing amino groups with a density of 1-2 groups / nm ² is prepared using a solution of 3-aminopropyltriethoxysilane (APTES) in various solvents depending on the type of substrate. For example, glass substrates were incubated for one hour in a solution of 3-aminopropyltriethoxysilane in acetone or ethanol. APTES concentration varied from 0.1 to 10% by volume. If the reaction is carried out in acetone, the glasses are washed three times with acetone for 5 minutes, then ethanol 2 times for 3 minutes and dried at a temperature of 120-130 ° C for 20 minutes.

Example 2. Sewing oligonucleotide probes to the surface of amino-modified glass.

A reaction mixture containing 1 μM oligonucleotide and 60 mM 1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide hydrochloride in 0.1 M 1-methylimidazole, pH 7, was applied to the matrix surface with a robot (Xpress Lane, USA). The droplet volume of each probe is at least 0.005 μl. Matrices coated with oligonucleotides were placed in a sealed container, kept at room temperature for 1 hour in a humid atmosphere, and washed on a shaker with a 0.5 mM NaCl solution for 0.1% SDS for 10 minutes, then with distilled water. The biochip was dried and stored at a temperature of 4 to 8 ° C. The concentration of oligonucleotide in the volume of drops of each probe is from 0.5 to 100 μmol / L.

As probes, oligonucleotides modified with the phosphate group (p) at the 5'-position of ID SEQ No: 59, 68, 90 and 91 were used. The oligonucleotides were applied in clusters of 4 points.

Example 3. Isolation of DNA from the test material.

1 ml of physiological saline and 0.2-0.3 g of feces (which approximately corresponds to a volume of 200-250 μl) are added to the labeled tubes. To do this, use disposable vanes or tips with anti-aerosol filters. Vortex the contents thoroughly until a homogeneous suspension is formed. The coarse fraction is precipitated by centrifugation in a microcentrifuge for 2 minutes at 2000 rpm. The supernatant is transferred to a new tube and centrifuged at maximum speed (12,000 rpm) for 3 minutes. After removal of the supernatant, 1 ml of physiological saline is added to the bacterial sediment, suspended in a vortex for 30-60 seconds. and then precipitated by centrifugation at 12-13 thousand rpm. After final washing, the sediment with the test material is resuspended in 300 μl of physiological saline.

400 μl of lysis buffer and 5 μl of positive control sample KB are added to the marked tubes. Lysis buffer is prepared on Tris-HCl-based deionized water, pH 6.8 - 0.05 M, guanidine thiocyanate - 3.13 M (Amresco ", USA) GTC, EDTA - 0.025 M (Sigma, USA) and sarcosyl - 1%. (company "AppliChem", USA). Then, 100 μl of the test material is added to each tube, 100 μl of deionized water is added to the tube for the negative control of OKV release. Stir and incubate at 65 ° C for 5 minutes. 20 μl of sorbent C is added to each tube, mixed and incubated at room temperature for 10 minutes.

After this, the tubes are centrifuged for 20 seconds at 10 thousand rpm, and the supernatant is removed. 750 μl of the first Tris-HCl-based buffer, pH 6.8 - 0.0585 M, guanidine hydrochloride - 2.34 M (Fluka, USA), and EDTA - 0.0243 M were added to each tube to the pellet. (Sigma company), the suspension is resuspended by vortexing for 30-60 seconds. Centrifuged for 20 sec at 10 thousand rpm, and remove the supernatant.

750 μl of the second Tris-HCl-based buffer (1 M Tris-HCl, pH 8.0 with a final concentration of 0.05 M) was added to each tube to the pellet, the pellet was resuspended by vortexing for 30 sec. Then centrifuged for 20 seconds at 10 thousand rpm, and remove the supernatant. Repeat this operation twice.

Dry the pellets in a thermostat at 55 ° C for 5 minutes (leave the tube lid open). 50-100 μl of elution buffer based on Chelex 100 - 5% (BIO-RAD USA) and Tris-HCl, pH 8.0 - 0.05 M were added to the precipitates. They were vortexed and incubated at 55 ° C for minutes. For more effective elution of DNA, shake the tube every 2 minutes. Then the tubes are centrifuged for 1.5-2 min at 10-12 thousand rpm. Transfer supernatants to clean, labeled microtubes. The extracted DNA is stored at a temperature of minus 20 ° C for a year. Storage at room temperature (from 18 to 25 ° C) is allowed for no more than 24 hours, at a temperature of 4 to 8 ° C - no more than 7 days. The resulting DNA is used for the PCR step.

Example 4. Multiprimer polymerase chain reaction.

A “PCR mixture” is prepared based on the number of samples analyzed plus two tubes for “-” negative and “+” positive controls for PCR. For each sample, 11 μl of a 2-fold reaction buffer, 5 μl of biologically active elements in the form of a composition of oligonucleotide primers SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 17 shown in table No. 2 and 1 μl of Taq DNA polymerase (company "Fermentas", Latvia). Gently mix by pipetting. 2x reaction buffer is prepared on Tris-HCl, (NH ₄ ) ₂ SO ₄ , MgCl ₂ deionized water, dNTP solution is added. Composition: 1 M Tris-HCl, pH 8.8-0.16 M; (NH ₄ ) ₂ SO ₄ - 0.032 M (Sigma, USA); MgCI ₂ (company "Sigma", USA) - 0.004 M; dNTF mixture (Sileks company, Russia) - 0.004 M; Tween 20 (Amresco, USA) - to a final concentration of 0.04%.

Two drops of PCR oil (~ 20-25 μl) are added to previously labeled microtubes for PCR (~ 20-25 μl), and then 15 μl of the PCR mixture. 5 μl of the DNA of the test sample is pipetted into individual test tube tubes. 5 μl of the positive control PC sample is added to the tube marked with the “+” sign (positive PCR control). A PC-positive control sample is a mixture of recombinant plasmids derived from pUC18 and containing the sequence of marker genes of each pathogen at a concentration of 5 pg / μl (or 1.5 × 10 ⁶ DNA molecules in 1 μl). In a test tube marked with the sign “-” (negative PCR control), add 5 μl of a negative control OK (added last). OK - negative control sample - recombinant plasmid obtained on the basis of pUC18 and containing the sequence of the GE13 marker at a concentration of 50 pg / μl (or 15 × 10 ⁶ DNA molecules in 1 μl). The microtubes are centrifuged for 10-15 seconds at 10-12 thousand rpm to precipitate drops of liquid, while the PCR oil should completely cover the PCR mixture.

Transfer the prepared tubes for the reaction to the DNA amplifier and start the amplification program in accordance with the modes shown in table 4.

Table 4 Program step Temperature ° C Incubation time, sec. The number of cycles one 95 120 one 2 95 twenty 42 3 62 twenty four 72 thirty 5 72 180 one

After the end of the amplification program, 1 μl of exonuclease (Fermentas, Latvia) is added to 20 μl of each sample in a buffer solution at a concentration of 2 units. activity / μl., gently mix by pipetting and incubate for 1 hour at 37 ° C. Add to each sample 2 μl of a stop solution, which is prepared on EDTA-based deionized water (Sigma, USA) at a concentration of 0.020 M. PCR products are mixed and precipitated and the sample is incubated for 10 min at 80 ° C. If necessary, after this stage, the sample can be stored at minus 20 ° C for 3 months.

Example 3. Hybridization of PCR products on biochips.

Add to each microtube with PCR fragments obtained in the PCR step, 2.5 μl of 20 × SSC, 2 μl of 1% SDS and mix by pipetting. The resulting mixture is applied to the middle of the microchip working area and covered with a 16 × 21 mm film so that no air bubbles remain under it. The use of film can significantly reduce the consumption of reagents. Place the microchip in a humid chamber (for example, in a Petri dish with a paper filter moistened with distilled water) and incubate for 1 hour in an air thermostat at a temperature of 44 ° C. At the end of the incubation, wash the film off the microchip and wash the chip on an orbital shaker with the following solutions:

2 × SSC, 0.1% SDS - 1 time 5 minutes;

1 × SSC, 0.1% SDS - 1 time 5 minutes;

0.5 × SSC - 2 times for 5 minutes.

After washing, the microchip is dried at room temperature.

Example 4. The reaction of the formation of a complex with fluorescently-labeled streptavidin.

Form a reaction mixture containing 1 × SSC, 10 mg / ml BSA (bovine serum albumin, Amresco, USA) and 0.1 × PMS (Thermo Scintific, USA) at a rate of 10 μl per microchip. It is recommended to prepare this reagent with a small margin. For example, to prepare 210 μl of the reaction mixture (enough to process 20 microarrays), it is necessary to add 157.5 μl bidistilled water, 21 μl BSA to 10.5 μl of 20 × SSC. Stir the reaction mixture and add 20 μl of PMS. Apply 10 μl of the prepared reaction mixture to the working area of the microchip, cover with a film 16 × 21 mm in size and place for 1 hour in a humid chamber at a temperature of 28 ° C. After incubation, the chip is washed on an orbital shaker: in a 1 × SSC solution - 2 times for 5 minutes and in a 0.25 × SSC solution 1 time 5 minutes.

Example 5. Accounting for diagnostic results.

To read data from a microchip, a hardware-software complex is used to detect the presence or absence of specific, fluorescently-labeled DNA sequences associated with it on a microchip. As one of the options, the Fluogen-2 chip detector is used (MMTech, Russia).

Interpretation of the analysis results is carried out by the computer program “Gene Inspector” based on a given algorithm. The algorithm takes into account the magnitude of the signals in the zones of positive and negative controls, as well as areas of the analyzed infections. On the chip, a signal may be observed in the negative control zone, the value of which varies slightly depending on the accuracy of compliance with the hybridization and washing conditions specified in the instructions. The result is considered positive if the difference between the signals in the area of the analyzed infection and the negative control is greater than zero.

The kit provides for the detection of 10 ² -10 ³ DNA copies of each of the causative agents of Shigella spp. and Enteroinvasive E. coli (EIEC), Salmonella spp., Campylobacter jejuni, Proteus mirabilis and Klebsiella pneumoniae in 1 ml of sample.

Literature

1. Schrenzel J. et al. Analytical chip with an array of immobilized specific recognition elements for the determination of clinically relevant bacteria and analytical method based thereon US Patent Application 20070015151 (January 18, 2007).

2. Chang; Tsung Chain; et al. Method for rapidly identifying bacteria and kit thereof. 20060228718 October 12, 2006

3. Peters, et al. Customized micro-array construction and its use for target molecule detection. US patent No. 7,364,898 April 29, 2008

4. Jacobs; Alice A .; et al. Clinically intelligent diagnostic devices and methods. US Patent Applic. No.20060240453 October 26, 2006

5. Persson; Soren; et al. Diagnostics of diarrheagenic escherichia coli (dec) and shigella spp. US Patent Applic No. 20060194206 August 31, 2006

6. Querk S. DETECTION AND IDENTIFICATION OF INTESTINAL BACTERIA Application for invention of the Russian Federation No. 2004114259 (2002.10.01).

7. Granovsky I.E. DIFFERENTIATING AND SPECIFIC OLIGONUCLEOTIDE FOR IDENTIFICATION OF DNA SEQUENCES OF TRANSGENIC PLANTS IN FOOD PRODUCTS, METHOD FOR IDENTIFICATION OF TRANSGENIC PRODUCTS, BIO-NIBLEIOROISON Application RU No. 2007134194/13 (03.20.2009).

8. Hogan Nucleic acid probes and methods for detecting Proteus mirabilis. US patent No. 5,683,876 November 4, 1997.

9. Hogan, et al. Oligonucleotide probes for the detection and / or quantitation of non-viral organisms US patent No. 7,138,516 November 21, 2006.

Claims (2)

1. A set of differentiating oligonucleotides for rapid analysis of species identification of pathogens of acute intestinal infections, the sequence of which is defined in the List of sequences (SEQ ID NO: 3, 6, 9, 12, 15, 18, 19). 2. Biochip for rapid analysis of species identification of pathogens of acute intestinal infections, which is a substrate with a set of immobilized oligonucleotides on it, characterized according to claim 1.

Images