RU2507253C2 - N-glycan from c jejuni presented in salmonella enterica and its derivatives - Google Patents

Abstract

FIELD: biotechnologies.

SUBSTANCE: invention refers to genetically modified bacteria Salmonella enterica, which contain at least one operon pgI from Campylobacter jejuni or its functional derivative and refers to presentation of at least one N-glycan from Campylobacter jejuni or derivative of this N-glycan on their cell surface. In bacteria one or several genes for biosynthesis of bacillozamine are inactivated by mutation and/or partial or complete deletion of genes pgID, E, F, G. Invention provides method for obtainment of genetically modified bacteria Salmonella enterica. Invention is directed to application of modified bacteria in pharmacological compositions of medical and veterinary purpose and methods for treatment and/or prevention of infections Campylobacter and, not obligatory, Salmonella.

EFFECT: invention provides safety and efficiency of treatment and prevention of infections, which affect people and animals, namely livestock and fowl.

18 cl, 4 dwg, 1 tbl, 6 ex

Description

FIELD OF THE INVENTION

The present invention relates to Salmonella enterica containing at least one pgl operon from Campylobacter jejuni or a functional derivative thereof and relates to the presentation of at least one Campylobacter jejuni N-glycan or derivative of this N-glycan on its cell surface. In addition, the invention is directed to medical applications, pharmacological compositions, food and feed additives, as well as to methods of treating and / or preventing Campylobacter infections, in particular those caused by C. jejuni, C. lari, C. coli, C. upsaliensis, and C .fetus, and optionally Salmonella infections, and methods for preparing these Salmonella strains.

State of the art

Campylobacter jejuni (C.jejuni) is a foodborne pathogen that is the main cause of acute gastroenteritis in developing countries. Its usual owners are livestock, in particular chickens and cows. C. jejuni infections are also associated with several long-term effects, the most serious of which are autoimmune diseases, Miller-Fisher syndrome and Guillain-Barre syndrome. They are caused by host mammalian antibodies against a structure on the surface of a pathogen that mimics mammalian gangliosides, which then also attacks the host’s own gangliosides. This molecular mimicry is one of the reasons why there are no effective vaccines against C.jejuni, since this mimicry precludes the use of attenuated or killed C.jejuni cells as vaccines.

US patent 2007/065461 describes a vaccine consisting of at least one encapsulated polysaccharide (English capsular polysaccharide, CPS) from C. jejuni functionally bound in vitro with a carrier protein. Injection of this conjugate into a mouse and anthropoid apes protects against subsequent intranasal infection with C.jejuni. The preparation of this vaccine requires the isolation and purification of CPS, as well as chemical binding to the carrier protein and additional purification steps.

Poly et al. (Infection and Immunity, 75: 3425-3433, 2008) describes strains of C. jejuni currently tested as vaccine candidates that have lost ganglioside-like structures.

Glycosylation was previously considered a specific phenomenon of eukaryotes, but it was later shown to be widespread both in the Archaea domain and in the Eubacteria domain. Bacterial O- and N-bonds are formed with a wider spectrum of sugars than the spectrum observed in eukaryotic glycoproteins. Glycosidic N-glycosylation of proteins in prokaryotes was first shown in C. jejuni (Szymanski et al., Molecular Microbiology 32: 1022-1030, 1999). The glycosylation mechanism of C. jejuni has been described and even successfully transferred to E. coli, in which successful N-glycosylation of proteins has been demonstrated (Wacker et al., Science, 298: 1790-1793, 2002). The C. jejuni gene locus called pgl (for glycosylation of proteins) is involved in the glycosylation of many proteins. Its mutational silencing leads to a loss of immunogenicity in a variety of proteins.

US Patent Application 2006/0165728 A1 identifies a specific and highly immunogenic heptasaccharide that is common to at least several Campylobacter species and a variety of strains that are important as human and veterinary pathogens. Heptasaccharide has the following formula (I):

GalNAc-a1,4-GalNAc-a1,4- [Glc-β-1,3] GalNAc-a1,4-Gal-NAc-a1,4-GalNAc-a1,3-Bac,

where you (also known as bacillosamine) is 2,4-diacetamido-2,4,6-tridesoxy-D-glucopyranose, GalNAc is N-acetyl-galactosamine, and Glc is glucose. This glycan component is a component of many glycoproteins. In C. jejuni, N-glycan is important for the interaction of C. jejuni with host cells. Mutations in the glycosylation mechanism lead to a decrease in colonization in the intestinal tract in mice. In addition, pharmaceutical compositions are provided comprising either (i) said heptasaccharide or conjugate thereof, or (ii) an antibody directed against said heptasaccharide for use in vaccinating livestock, especially poultry.

The genus Salmonella is a member of the Enterobacteriaceae family. The genus consists of gram-negative bacilli, which are facultative anaerobes and flagellates (motile). They have three main antigens, “H” or flagellar antigen, “O” or somatic antigen (part of the LPS component) and “Vi” or capsular antigen (called “K” in other Enterobacteriaceae}. Salmonellae also have LPS-endotoxin, characteristic for gram-negative bacteria, LPS consists of three domains: a part of lipid A, also known as endotoxin, which anchors LPS in the outer membrane using its fatty acid chains. This part is connected through the inner core, consisting of heptosis and KDO (3-deoxy-D-manno-octulosone acids) with externally cortex containing hexoses and N-acetylhexoses. The outer cortex attached to the last glucose is a polymeric O-antigenic region. This region consists of 16 to> 100 repeats of the oligosaccharide structure containing four to six monosaccharides. The endotoxic part of lipid A causes fever and may activate complement, kinin and coagulation factors.

For some time, Salmonella strains have attracted interest in the production and presentation of bacterial immunogens. For example, genes encoding enzymes for the biosynthesis of Shigella O-antigen were integrated into the genome of the vaccine strain aroA Salmonella enterica serovar Typhimurium, which then produced hybrid LPS (Fait et al., Microbial Pathogenesis 20: 11-30, 1996). Also, the clusters necessary for the biosynthesis of the Salmonella dysenteriae O antigen were cloned into a stable expression vector, which were then transferred to the Ty21a typhoid vaccine strain. The resulting strain produced hybrid LPS and induced immunity against S. dysenteriae infection (DE Qui Xu et al., Vaccine 25: 6167-6175, 2007).

US patent 6,399,074 B1 discloses a live attenuated vaccine with Salmonella to protect birds against infection by avian pathogenic gram-negative microbes. The vaccine is a recombinant strain of Salmonella expressing an O-antigen of an avian pathogenic gram-negative microbe such as E. coli O78, which is pathogenic for poultry. The recombinant Salmonella strain does not express Salmonella O antigen due to mutation in the rfz O antigen polymerase (according to the new wzy gene nomenclature).

In light of the above prior art, the object of the present invention is to provide an effective and safe, easy-to-mass production, long-acting and low-cost vaccine composition for the prevention and / or treatment of Campylobacter infections in humans and animals, in particular livestock, in particular poultry.

This task is accomplished by providing, in a first aspect, Salmonella enterica, which contains at least one pgl operon from Campylobacter jejuni or a functional derivative thereof and presents at least one Campylobacter jejuni N-glycan or a derivative of this N- glycan.

The Salmonella strain useful for the present invention can be any strain that is or can be sufficiently attenuated so that it can be administered in living and / or dead form to humans and / or animals without causing pathology. Preferred Salmonella strains and Salmonella enterica strains are selected from the group consisting of Salmonella Typhimurium, enteriditis, heidelberg, gallinorum, hadar, agona, kentucky, typhi and infantis, more preferably from Salmonella enterica strains of serovar Typhimurium. Salmonella Typhimurium is especially useful for vaccination purposes, because its genomic sequence has been fully characterized and many animal studies confirm its safe use in medicine.

The term "pgl operon" as used herein refers to any physiologically active cluster of N-glycosylation genes in C. jejuni capable of N-glycosylation of homologous or heterologous structures produced by the Salmonella strain of the invention. The pgl operon in C. jejuni encodes all the enzymes necessary for the synthesis of N-glycan heptasaccharide from C. jejuni for its transport through the inner membrane and for transfer to proteins. PglD, E, F encode enzymes involved in the biosynthesis of bacillosamine, PglC transfers phosphorylated bacillosamine to undecaprinyl phosphate, and PglA, H and J add GalNAc residues. Branched Glc is attached using PglI. The complete heptasaccharide is transferred by PglK, and the PglB oligosaccharide transferase transfers N-glycan to the protein.

A functional derivative of the pgl operon is a cluster of genes derived from any pgl operon from C. jejuni having deletions, mutations and / or substitutions of nucleotide (s) or whole genes, but still capable of producing a binding oligo- or polysaccharide that may be associated with homologous or heterologous structures produced by the Salmonella strain of the invention. One or more pgl operons or their derivatives can be integrated into the chromosome of the Salmonella strain, or they can be introduced as part of at least one plasmid. Chromosomal integration is preferred because it is more stable compared to plasmid vectors, the loss of which occurs during cultivation. It should be noted that the Salmonella strain of the invention may contain more than one pgl operon or derivative thereof, producing one or more N-glycans or derivatives thereof. In fact, it is preferable when the strain of the invention has more than one type of pgl operon, resulting in more than one N-glycan structure, which may be advantageous because it elicits a more diverse immune response in humans or animals against different strains of C. jejuni.

It should also be noted that the expression level of N-glycan from C. jejuni can optionally be regulated by applying various promoters above the pgl operon, including, but not limited to, promoters of ribosomal protein genes, for example, spc or rpsm, as well as promoters from genes encoding resistance to antibiotics like bla or similar, and preferably strong promoters. This type of regulation is available for plasmid encoded or integrated pgl operons. Moreover, the stability of plasmids can optionally be enhanced by including irreplaceable genes in the plasmid while removing these genes in the genome of the Salmonella strain of the invention. Preferred targets include, for example, genes encoding tRNA transferases like CysS.

In a preferred embodiment, the Salmonella strain of the invention is a strain comprising at least one pgl operon in which one or more genes for bacillosamine biosynthesis are inactivated by a mutation or a partial or complete deletion, preferably a partial and / or complete deletion of the D, E, F genes , G. In the most preferred embodiment, the pglE, F, and G genes of the pgl operon are completely deleted and the pglD gene is partially removed, for example, when the open reading frame (ORF) of pglD ends after 270 base pairs (full-length ORF contains 612 base pairs).

In another preferred embodiment, the pglB gene of the pgl operon is inactivated, which means that the corresponding oligosaccharyltransferase B is either not expressed, or at least enzymatically inactivated. The pglB gene product transfers N-glycan to a specific polypeptide acceptor site further described below. Inactivation of transferase leads to the fact that N-glycan or an N-glycan derivative is exclusively associated with the lipid A core of the O-antigen acceptor in Salmonella.

In a most preferred embodiment, the pgl derivative is a derivative in which one or more genes for the biosynthesis of bacillosamine, pglD, E, F, G, and transfer are inactivated, and the pglB gene is inactivated as well. This embodiment leads to the exchange of GlcNac for bacillosamine, leading to an increase in its presentation on the cell, as well as to the transfer of the modified heptasaccharide to the lipid A nucleus instead of polypeptide acceptors.

At least one N-glycan from C. jejuni or a derivative of this N-glycan may be any N-glycan produced by the pgl operon from Campylobacter jejuni or a functional derivative thereof. Of course, it is preferable if N-glycan is still immunogenic, i.e. induces an immune response specific for C. jejuni.

In a preferred embodiment, N-glycan is a heptasaccharide of formula (I) as described above, i.e. GalNAc-a1,4-GalNAc-a1,4- [Glc-β-1,3] GalNAc-a1,4-Gal-NAc-a1,4-GalNAc-a1,3-Bac, where you (also known as bacillosamine ) is 2,4-diacetamido-2,4,6-tridesoxy-D-glucopyranose.

The preferred pgl operon, in which the genes for bacillosamine biosynthesis are inactivated, and preferably mostly or completely removed, synthesizes an N-glycan derivative, i.e. polysaccharide of the formula (II), namely GalNAc-a1,4-GalNAc-a1,4- [Glc-β-1,3] GalNAc-a1,4-Gal-NAc-a1,4-GalNAc-a1,3-GlcNAc .

Surprisingly, the N-glycan derivative of the formula (II) in larger amounts than the N-glycan of the formula (I) is presented on the surface of the cells of the Salmonella strains of the present invention and is also immunogenic. This is experimentally confirmed in the examples section below.

In a preferred embodiment, N-glycans or the derivative (s) obtained from at least one pgl operon or its derivative can be associated with at least one homologous or heterologous Salmonella polypeptide, which is ultimately transferred and presented to the cell surface. Preferably, at least one N-glycan or an N-glycan derivative is linked to a polypeptide containing at least one NZS / T consensus sequence (see Nita-Lazar M et al., Glycobiology. 2005; 15 ( 4): 361-7), preferably D / EXNZS / T (SEQ ID NO: 1), where X and Z can be any naturally occurring amino acid except Pro (see Kowarik et al. EMBO J. 2006; 25 (9) : 1957-66).

The polypeptide bound to the N-glycan (derivative) can be any type of polypeptide, such as a pure polypeptide (amino acids only) or a post-translationally modified polypeptide, for example, a polypeptide bound to a lipid.

Preferably, the heterologous polypeptides used as carriers of N-glycan (s) (derivatives) contain the MKKILLSVLTTFVAWLAAC signal sequence (SEQ ID NO: 2) that directs the N-linked conjugate to the outer cell membrane and in which the LAAC motif (SEQ ID NO : 3) is used to acylate a cysteine residue that anchors the polypeptide in the outer membrane (see also Kowarik et al., EMBO J. May 3; 25 (9): 1957-66, 2006).

In a most preferred embodiment, the at least one N-glycan or derivative thereof resulting from the functioning of the at least one pgl operon or derivative thereof is linked to the lipid A nucleus of Salmonella or to the functional equivalent of its derivative. The Salmonella lipid A nucleus is an oligosaccharide structure consisting of hexoses, N-acetylhexoses, heptose and KDO (5-deoxy-D-manno-octulosonic acid) linked through two glucosamine with six chains of fatty acids anchoring the structure in the outer membrane of the bacterium. The functional equivalent of the derivative of the lipid A nucleus is a derivative capable of accepting one or more glycans or their derivatives and presenting them on the surface of the cells. It should be noted that in this case, N-glycan or its derivative is not N-linked because the structural lipid A of Salmonella is not a polypeptide. Preferably, if N-glycan is bound to GIcII in the core of lipid A or a functional derivative thereof.

Preferably, at least one N-glycan or its derivative takes the place of the side chains of the O-antigen in LPS (linopolysaccharides). The external and internal nucleus of lipid A from Salmonella remains unchanged if the biosynthesis of the O antigen is interrupted by a wbaP mutation. Then, N-glycan is transferred by WaaL O-antigen ligase and binds to the GIcII residue of the oligosaccharide structure of the external lipid A.

It is preferred and extremely important for use in medicine that the Salmonella strain of the invention does not cause pathogenic effects when administered to an animal or human in a live or inactivated form. One skilled in the art knows many ways to attenuate the virulent species of Salmonella by mutation. Preferred mutations to attenuate Salmonella strains for use in the present invention are selected from the group consisting of pab, pur, aro, aroA, asd, dap, nadA, pncB, galE, pmi, fur, rpsL, ompR, htrA, hemA, cdt, cya, crp, phoP, phoQ, rfc, poXA and galU. One or more of these mutations may be present. Mutations aroA, cya and / or crp are more preferred.

Salmonella O antigen biosynthesis genes are clustered at the rfb locus of the hypervariable region of the Salmonella chromosome DNA. Partial or complete inactivation has been associated with attenuation of Salmonella strains. On the other hand, O-antigen is also an important antigenic determinant for the induction of immunity in the host.

In a particularly preferred embodiment, the Salmonella strain of the present invention is attenuated by partially or completely inactivating the expression of the O antigen, preferably by one or more mutations and / or divisions in the rfb gene cluster, more preferably in the wbaP gene, with a wbaP gene deletion being most preferred.

It is understood that, as used herein, the terms “rfb locus” and “wbaP gene” are intended to encompass any corresponding locus and gene in any Salmonella strain that is capable of expressing O-antigen or associated antigens.

The wbaP gene product is phosphogalactosyl transferase, which begins the biosynthesis of the O antigen by adding phosphogalactose to undecaprenyl phosphate. Its inactivation / removal leads to the complete abolition of the biosynthesis of O-antigen, the sugar product of which competes with the N-glycan (s) (derivatives) from C. jejuni for the undecaprenyl phosphate lipid carrier and for WaaL ligase transfer. The N-glycosylation induced by the pgl locus and the wzy-dependent synthesis of O-antigen in bacteria are homologous processes. It was found that the WaaL O-antigen ligase from Salmonella has a non-strict substrate specificity and that it can transfer N-glycan from C. jejuni to the lipid A nucleus from Salmonella.

Thus, in a most preferred embodiment, the Salmonella strain of the invention is mutated in the wbaP gene, resulting in inactivation of the phosphogalactosyl transferase enzyme. It should be noted that this type of inactivation of O-antigen has not been described previously for vaccination purposes, and surpasses the currently known negative mutants of the O-antigen, because it is genetically determined and allows you to increase the number of N-glycans (derivatives) from C.jejuni, strains of Salmonella present on the cell surface.

Therefore, and as an independent invention, the present invention also relates to a Salmonella strain with a mutated, preferably delegated and thus inactivated wbaP gene, which is useful for vaccine uses of Salmonella strains per se, as well as uses of Salmonella strains as carriers of heterologous antigens , preferably glycosylated, more preferably N-glycosylated antigens.

In a most preferred embodiment, the invention is directed to Salmonella enterica, preferably to typhimurium serovar, which

(a) contains

(i) at least one pgl operon from Campylobacter jejuni or a functional derivative thereof, preferably at least one pgl operon in which one or more genes for bacillosamine biosynthesis are inactivated, and

(ii) mutations and / or deletions in the wbaP gene, leading to complete inactivation of the biosynthesis of O-antigen,

(b) and presents at least one N-glycan from Campylobacter jejuni or a derivative of such N-glycan, preferably (I) GalNAc-a1,4-GalNAc-a1,4- [Glc-β-1,3] GalNAc -a1,4-Gal-NAc-a1,4-GalNAc-a1,3-2,4-diacetamido-2,4,6-trideoxy-D-glucopyranose and / or (II) GalNAc-a1,4-GalNAc- a1,4- [Glc-β-1,3] GalNAc-a1,4-Gal-NAc-a1,4-GalNAc-a1,3-GlcNAc on the surface of its cell.

The Salmonella strains of the invention described above are highly immunogenic and elicit an immune response against C. jejuni infections. Moreover, obtained once they can easily be reproduced and mass produced. As an added benefit, administering them to an animal or person provides immunity against C. jejuni and Salmonella infections. They can be administered as inactivated or live vaccines, live vaccines that allow long-term cultivation and a stable immune stimulus in the host, as well as complete immune responses without adjuvants.

Therefore, the present invention also relates to the use in medicine of live or inactivated Salmonella strains of the present invention, in particular for the preparation of a medicament, preferably a vaccine.

Preferably, the medicament is useful for the prevention and / or treatment of infections of Campylobacter jejuni and optionally Salmonella, preferably infections of livestock, more preferably cattle and poultry, most preferably poultry such as chickens, turkeys, geese and ducks.

A third aspect of the present invention relates to a pharmaceutical composition, food or feed (supplement) containing the inactivated or live Salmonella enterica of the present invention and a physiologically acceptable excipient.

For example, the pharmaceutical composition of the present invention can be obtained by growing, on a medium or large scale, Salmonella strains of the invention containing at least one plasmid encoded operon pgl or a derivative thereof integrated into the chromosome. These Salmonella can be used directly or can be part of a product intended for a specific purpose - a person or an animal and to a specific route of administration. Pharmaceutical compositions containing live Salmonella are preferred for obvious reasons.

Otherwise, the invention relates to a food product or feed for humans or animals, preferably livestock, more preferably poultry containing the inactivated or live Salmonella enterica of the present invention and a physiologically acceptable excipient and / or food product. For example, such food will significantly reduce the colonization of C. jejuni in flocks of poultry and, therefore, reduce the chance of human infection with C. jejuni, as well as infection through infected Salmonella meat.

A fourth aspect of the present invention is directed to a method for treating and / or preventing infections of C. jejuni and optionally Salmonella, comprising administering a Salmonella enterica, pharmaceutical composition, food or feed of the present invention to a person or animal in need thereof, in a physiologically active amount.

For therapeutic and / or prophylactic use, the pharmaceutical composition of the invention may be administered in any conventional dosage form in any conventional manner. Routes of administration include, but are not limited to, intravenous, intramuscular, subcutaneous, intranasal, intrasinovial, infusion, sublingual, transdermal (percutaneous), oral (e.g., artificial feeding through a tube), topical and inhalation. Preferred modes of administration are oral, intravenous and intranasal, of which intranasal is most preferred.

Salmonella according to the invention can be administered alone or in combination with adjuvants that increase the stability and / or immunogenicity of bacteria, facilitate the administration of pharmaceutical compositions containing them, provide increased dissolution or dispersion, increase reproductive activity, provide auxiliary activity, and the like. including other active ingredients.

The pharmaceutical dosage forms with Salmonella described herein include pharmaceutically acceptable carriers and / or adjuvants known to one skilled in the art. These carriers and adjuvants include, for example, ion exchangers, alumina, aluminum stearate, lecithin, whey proteins, buffers, water, salts, electrolytes, cellulose-based substances, gelatin, water, petroleum jelly, animal or vegetable fat, mineral or synthetic oil , saline, dextrose or other saccharide and glycol compounds such as ethylene glycol, propylene glycol or polyethylene glycol, antioxidants, lactate, and the like. Preferred dosage forms include tablets, capsules, solutions, suspensions, emulsions, reconstituted powders and transdermal patches. Methods for preparing dosage forms are well known, see, for example, N. C. Ansel and NG Popovish, Pharmaceutical Dosage Forms and Drug Delivery Systems, 5th ed., Lea and Febiger (1990) and, in particular, Pastoret et al., Veterinary Vaccinology, Elsevier March 1999). Dosage levels and requirements are widely known in the art and can be selected by one of ordinary skill in the art from the available methods and techniques suitable for a particular patient. One skilled in the art will appreciate that lower or higher doses may be required depending on specific factors. For example, specific dosages and treatment regimens will depend on factors such as the overall health profile of the patient (human or animal), the severity and course of the disorder in the patient, and the disposition to it, and the decision of the attending physician or veterinarian.

In a preferred embodiment for oral vaccination, the regimen consists of administering Salmonella containing the pgl operon or its derivative either in the plasmid or integrated into the chromosome, on the 1st or 2nd day after hatching of the chickens in the amount of about 10 ⁶ CFU (colony forming units) per chicken with repeated administration (boost) on day 14 or 21 after hatching with the same number of bacteria. These two introductions will provide sufficient stimulation of the immune system in order to build a response against N-glycan from C.jejuni or its derivatives, as well as against Salmonella proteins to provide protection against later colonization in chickens. An alternative for vaccinating chickens is the intravenous injection of inactivated, for example, heat-inactivated or formalin-inactivated bacteria, 1 or 2 days after hatching and re-administration on 14 or 21 days. As another option, chickens can also be vaccinated only once at a later time point up to 3 weeks of age, either by intravenously thermally inactivated or formalin-inactivated bacteria, or by intragastrically living bacteria.

Last but not least, the present invention relates to a method for producing Salmonella enterica in accordance with the invention containing stage (s)

(i) introducing into Salmonella enterica preferably at least one plasmid vector or genomic integration of at least one pgl operon from C. jejuni or a functional derivative thereof, preferably at least one pgl operon in which one or several, but preferably all, genes for the biosynthesis of bacillosamine are inactivated, and

(ii) preferably introducing mutations and / or deletions into the wbaP gene, leading to complete inactivation of the biosynthesis of O-antigen.

Further, the present invention will be further illustrated with reference to specific embodiments and experiments, which should not be construed as limiting the scope of claims of the invention represented by the attached claims.

Blueprints

Figure 1 is a schematic representation of an N-glycan display from C. jejuni, on S. enterica sv. Typhimurium.

A) shows the transfer of N-glycan from C. jejuni to the lipid A nucleus from S. Typhimurium in the strain producing the O antigen and having the pgl _mut operon (“mut” means that PglB is inactivated by 2 point mutations);

B) a S. Typhimurium ΔwbaP strain without any O antigen and having the pgl3 _mut operon in which the genes for bacillosamine biosynthesis are deleted is shown;

C) illustrates deletions in the pgl3 _mut operon.

Figure 2 shows the N-glycan display from C. jejuni on S. enterica sv. Typhimurium

A) shows immunoblotting with antibodies that bind N-glycan from C. jejuni after SDS-PAGE of whole protein extracts of wild-type S. typhimurium and ΔwbaP strains carrying these plasmids treated with protein kinase K and showing a display of C. jejuni N-glycan on the nucleus lipid A in S. Typhimurium.

B) is SDS-PAGE stained with silver (left panel) and immunoblotting with antibodies that bind Salmonella O-antigen B group (right panel) after SDS-PAGE treated with whole protein extracts of wild-type S. Typhimurium strains and ΔwbaP strains treated with protein kinase K. The figure confirms the absence of polymeric 0-antigen in the strain ΔwbaP.

C) shows immunoblotting with antibodies binding N-glycan from C. jejuni after SDS-PAGE of strain S. Typhimurium ΔwbaP with integrated blank vector (control) or integrated operon pgl3 _mut and confirms the expression of N-glycan from C. jejuni on lipid A nucleus S. Typhimurium ΔwbaP with the integrated operon pgl3 _mut .

D) the left panel shows immunoblotting with serum from a mouse infected with thermally inactivated S. Typhimurium ΔwbaP, reproducing N-glycan from C. jejuni with GlcNac at the reducing end and encoded by pgl3 _mut . The recognition of wild-type C.jejuni cells, but not C.jejuni 81-176pglB, is obvious. The right panel shows Coomassie-stained SDS-PAGE gel samples used in immunoblot analysis of murine sera.

Figure 3 presents the in vitro tests used to demonstrate attenuation of S. Typhimurium ΔwbaP

A) the increased sensitivity of S. Typhimurium ΔwbaP to human serum components is shown: complement cytolysis of kanamycin-resistant serovar Typhimurium wild-type strain M939, OΔ antigen negative ΔwbaP :: cat (SKI11) and complemented mutant ΔwbaP :: pK19 (pK19) tested by incubation of a 1: 1: 1 mixture of wild-type Salmonella, ΔwbaP and ΔwbaP :: pK19 (SKI33) for the indicated time points together with 20% human serum or 20% heat-inactivated human serum. Survival was analyzed by sieving on differentiating media.

B) the result of experimental conditions A) is displayed, but with the difference consisting in the use of thermally inactivated serum. The survival rate of none of the strains has changed.

C) illustrates the defect of S. Typhimurium ΔwbaP when moving by swimming compared with S. Typhimurium wild-type and immobile strain fliGHI: Tn10.

Figure 4 shows a reduced colonization ability for S. Typhimurium ΔwbaP in an experiment with co-infection with wild-type S. Typhimurium.

A) graphically presents competitive indices (CI; (mutant / wild type) at the exit / (mutant / wild type) at the entrance) of the serovar Typhimurium ΔwbaP (SK112) and wild type, determined 1-3 days after infection in excrement and 4 the day after infection in the contents of the cecum, showing a reduced ability to colonize S. Typhimurium ΔwbaP compared to the wild type.

B) CI in sprays lymph nodes (mLN), spleen, and liver 4 days after infection.

Examples

Bacterial strains and growth conditions

A summary of the bacterial strains used in the experiments listed in the examples is shown in Table 1. The bacteria were grown in Luria-Bertani (LB) medium (10 g / L Bacto-tryptone, 5 g / L Bacto-yeast extract, 5 g / l NaCl). Cups with LB agar were supplemented with 1.5% (w / v) agar. Antibiotics were used in the following final concentrations: ampicillin (amp) 100 μg / ml, kanamycin (kan) 50 μg / ml, chloramphenicol (cam) 25 μg / ml, streptomycin (strep) 50 μg / ml, tetracycline (tet) 10 μg / ml

Example 1. Display of N-glycan from C. jejuni on the lipid A nucleus of Salmonella enterica sv. Typhimurium.

Wzy-dependent biosynthesis of 0-antigen and biosynthesis of N-glycan from C. jejuni are homologous processes (Feldman et al., Proc. Natl. Acad. Sci. USA .; 102 (8): 3016-21, 2005), which are both begin with the assembly of the oligosaccharide structure on the undecaprenyl pyrophosphate linker. Homology of the two pathways, as well as the non-strict substrate specificity of the WaaL O antigen ligase from S. enterica sv. Typhimurium (Fait et al., Microbial Pathogenesis 20: 11-30, 1996; De Qui Xu et al., Vaccine 25: 6167-6175, 2007) were investigated for the possibility of combining paths for the display of N-glycan from C. jejuni on lipid A nucleus from Salmonella.

A plasmid containing the pgl _mut operon from C. jejuni with inactivated PglB (pACYCpgl _mut ; Wacker et al 2002) was introduced into the strain Salmonella enterica serovar Typhimurium by electroporation. The corresponding empty pACYC184 vector was used as a negative control.

Transformant glyconjugates were tested for N-glycan display from C. jejuni using SDS-PAGE and subsequent immunoblotting with C. jejuni N-glycan antiserum (Amber 2008). Samples were prepared as follows: Equivalent to 2 OD ₆₀₀ / ml of log phase growing S. enterica sv Typhimurium cultures containing either pACYC184 or pACYpgl _mut were besieged at 16000 g for 2 minutes and the supernatant was discarded. Cells were resuspended in 100 μl Laemmli sample buffer (0.065 M Tris-HCl pH 6.8, 2% SDS (w / v), 5% β-mercaptoethanol (v / v), 10% glycerol (vol. / vol.), 0.05% bromophenol blue (wt./about.)) and lysed for 5 minutes at 95 ° C. After cooling to room temperature, Proteinase K (Gibco / Life Technologies) (final concentration 0.4 mg / ml) was added, incubated for 1 hour at 60 ° C until equal amounts were added to 15% polyacrylamide gel with sodium dodecyl sulfate (SDS-PAGE) and performed gel electrophoresis. To detect N-glycan from C. jejuni, a rabbit polyclonal antiserum binding N-glycan from C. jejuni was used (S. Amber, PhD. Thesis, ETH Zurich, Department of Biological Science. Zurich, 2008). Signal visualization was carried out with a HRP-conjugate of goat antibodies binding rabbit IgG (Santa Cruz) and ECL (Amersham), as recommended by the manufacturer.

N-glycan from C. jejuni could be detected on the lipid A nucleus of S. enterica sv. Typhimurium when pACYCpgl _{mut was} present in the cells (FIG. 2A lane 2), but not when an empty vector was introduced into the cells (FIG. 2A lane 1). This suggests that WaaL from S. enterica sv Typhimurium transfers N-glycan from C. jejuni from undecaprenyl pyrophosphate to lipid A.

Example 2. Construction of a wbaP deletion in Salmonella enterica sv Typhimurium and increased reproduction of N-glycan from C. jejuni in strain negative for O-antigen

The deletion of O-antigen biosynthesis was supposed to eliminate competition between the O-antigen biosynthesis and the N-glycan biosynthesis from C. jejuni for the undecaprenyl phosphate lipid carrier.

The construction of the wild-type S. Typhimurium deletion mutant SL1344 with wbaP deletion was performed as described (Datsenko and Wanner, PNAS USA 97 (12): 6640-5, 2000). The primers RfbP H1P1 (sequences are shown in Table 1) and RfbP H2P2 were synthesized, which were annealed on template DNA from plasmid pKD3 carrying the chloramphenicol resistance gene flanked by FRT sites (target recognized by FLP). Primers also contain from 40 to 45 additional nucleotides corresponding to regions immediately above and below the wbaP gene. They were used to amplify the deletion gene cassette in the wbaP reading frame, as described (Datsenko and Wanner, see above). After the arabinose induction of the expression of λ Red recombinase from plasmid pKD46 in the wild-type strain SL1344 S. Typhimurium, the target gene is replaced by the chloramphenicol cassette obtained from the PCR product introduced by electroporation by recombination. Transformants were selected by plating on plates with chloramphenicol at 37 ° C overnight, and the presence of the cat gene in the correct position in the genome was confirmed by PCR. The resulting chloramphenicol resistant clone (wbaP :: cat) was named SKI11. Removal of the chloramphenicol resistance cassette was possible using pCP20 encoding FLP recombinase, which recognizes the flanking FRT regions, the resulting clone was called SKI12 after PCR testing (also see Hg, Endt et al., Inf. Immun., 77, 2568, June 2009).

Phenotypic analysis of glycoconjugates of the obtained strain was carried out using SDS-PAGE followed by staining of glycoconjugates with silver. For SDS-PAGE, samples were prepared as follows: Equivalent to 2 OD ₆₀₀ / ml of log-growing cultures of wild-type S. Typhimurium or S. Typhimurium ΔwbaP (SK112) was precipitated at 16000 g for 2 minutes and the supernatant was discarded. Cells were resuspended in 100 μl Laemmli sample buffer (0.065 M Tris-HCl pH 6.8, 2% SDS (w / v), 5% β-mercaptoethanol (v / v), 10% glycerol (vol. / vol.), 0.05% bromophenol blue (wt./about.)) and lysed for 5 minutes at 95 ° C. After cooling to room temperature, Proteinase K (Gibco / Life Technologies) (final concentration 0.4 mg / ml) was added, incubated for 1 hour at 60 ° C until equal amounts were added to 12% polyacrylamide gel with sodium dodecyl sulfate (SDS-PAGE) m performed gel electrophoresis. To detect O-antigen in S. Typhimurium, O-antiserum binding factors of Salmonella group B, 1, 4, 5, 12 (Difco) were used. Signal visualization was carried out with a HRP-conjugate of goat antibodies binding rabbit IgG (Santa Cruz) and ECL (Amersham), as recommended by the manufacturer. For staining, the Tsai and Frasch method was used (Tsai and Frasch, Anal. Biochem. 119 (1): 115-9, 1982).

Deletion of a gene encoding WbaP phosphogalactosyltransferase in wild-type S. enterica results in abolition of the O-antigen biosynthesis, as seen in FIG. SDS-PAGE followed by staining of glucoconjugates with silver, as well as SDS-PAGE followed by immunoblotting with anti-O antiserum specific for Salmonella group B, shows a typical lipopolysaccharide ladder of the polymeric O antigen for the wild-type strain S. enterica sv. Typhimurium and the absence of such a pattern in the ΔwbaP strain.

Data negative for S. enterica sv O antigen. Typhimurium ΔwbaP SK112 was tested for their ability to display N-glycan from C. jejuni on their cell surface. Plasmids pACYCpgl _mut or pACYC184 were introduced by electroporation. Glycoconjugates of transformants were analyzed as described in Example 1. N-glycan from C. jejuni can be detected with higher intensities in the lane containing the ΔwbaP strain compared to the wild type (FIG. 2A lane 4 compared to lane 2). N-glycan from C. jejuni cannot be detected when S. enterica sv. Typhimurium ΔwbaP SK112 of the empty vector pACYC184. This suggests that in the ΔwbaP strain, more N-glycan from C.jejuni is transferred to the lipid A.

Example 3. Construction of the modified pgl _mut operon from C. jejuni, resulting in an enhanced display of N-glycan from C. jejuni on Salmonella enterica sv. Typhimurium

In C. jejuni, N-glycan is synthesized as the heptasaccharide GalNAc5 (Glc) -Bac, where you, the sugar with a reducing end, is 2,4-diacetamido-2,4,6-trideoxyglucopyranose. In E. coli and S. Typhimurium, you are not synthesized in the absence of heterologous expression of the components of the N-glycan biosynthesis system from C. jejuni. It has been shown that in wild-type E. coli cells, co-expressing the components of the N-glycan biosynthesis system from C. jejuni, two different types of N-glycans are synthesized, one of which is with you at the reducing end and one with GlcNAc. This phenomenon can be explained by the action of WecA, UDP-GlcNAc: undecaprenylphosphate GlcNAc-1-phosphate transferase, involved in the biosynthesis of glycolipids (Linton D. et al., Mol. Microbiol., 55 (6): 1695-703, 2005). Due to the fact that the ligase of the WaaL O antigen from Salmonella enterica sv Typhimurium can transfer GlcNAc-containing structures to the lipid A nucleus, it was suggested that the N-glycan containing GlcNac may be a better substrate for WaaL than N-glycan containing you. The pgl _mut operon was designed so that the bacillosamine biosynthesis genes, namely pglD, E, F, G, were removed. The genes encoding PglE1, F, G were completely removed, while the gene encoding PglD was partially removed. The open pglD reading frame (ORF) in the modified pgl operon ends after 270 base pairs, while the full-sized ORF contains 612 base pairs. The procedure for constructing this altered pgl _mut operon using E. coli DH5α as a host strain for reproduction of plasmids was carried out as follows: pACYCpgl _mut DNA was digested with Alw44I and SmaI, then the protruding portion of Alw44I was filled with a Klenov fragment of DNA polymerase I and re-ligated. The resulting operon was named pACYCpgl3 _mut and transformed into the ΔwbaP strain. The glycoconjugates of the resulting transformants were analyzed as described in Example 1. In the track containing the ΔwbaP strain with the pgl3mut operon, N-glycan from C. jejuni is more intense than in the track containing the ΔwbaP strain with the pgl3mut operon when compared with the wild type (FIG. 2A, lane 5 compared to lane 4). In general, when tested with C. jejuni N-glycan antiserum, the ΔwbaP strain with pgl3mut shows the highest intensities and, therefore, shows the highest levels of N-glycan from C. jejuni, presented on the Salmonella enterica sv Typhimurium lipid A nucleus.

Example 4. Integration of the pgl3mut operon into the genome of the O-antigen negative strain Salmonella enterica sv Typhimurium Δ wbaP

To ensure continuous in vivo display of N-glycan from C. jejuni on the lipid A nucleus of Salmonella enterica sv Typhimurium ΔwbaP strain, the pgl3mut operon was integrated into the ΔwbaP strain SK112 genome below the pagC gene.

All cloning steps, including the suicidal plasmid with oriR6K, were carried out in E. coli CC118λpir. The final integrative suicidal plasmid pK115 was constructed as follows: 512 bp the sequence homologous to the target region in the Salmonella genome was amplified by PCR with 3 ′ PagC Fw NotI and 3 ′ PagC Rev SacII primers (for sequences see Table 1). The resulting DNA fragment was inserted using SacII and NotI into pSB377 and, after checking the insert sequence, the plasmid pK114 was named. PK115 was constructed by digesting pACYCpgl3mut DNA with BamHI and EheI, while pKI14 was digested with BamHI and SmaI. A fragment of 11083 bp cut from pACYCpgl3mut then ligated to pKI14 scaffold. Since the electroporation of suicidal plasmids into Salmonella strains is very inefficient, pKI15 or pKI14 was first introduced into E. coli Sm10λpir for electroporation conjugation. Sm10λpir containing pKI15 or pKI14 was then conjugated to SKI12. For conjugation, the equivalents of 4 OD ₆₀₀ Sm10λpir cultures in the late log phase containing pKI15 and SKI12 were centrifuged and washed three times with 1 ml LB. Precipitation was resuspended in 100 μl LB, pooled and smeared on a 3 cm diameter LB agar plate, which was then incubated overnight at 37 ° C. The next morning, bacteria were washed from a 1 ml LB dish and several dilutions were plated on LB (+ strep + tet) to select conjugates. The resulting strains were named SKI34 (SKI12 :: pKI14) and SKI35 (SKI12 :: pKI15).

To test the N-glycan from C. jejuni on the lipid A nucleus from O-antigen negative strains containing either an integrated pgl3mut cluster or an integrated blank vector as a negative control, whole SKI34 and SKI35 cell extracts were prepared and analyzed as described in Example 1. FIG. 2C is an immunoblot, where the assay was performed using C. jejuni N-glycan antiserum, which shows an intense signal in lane 2 containing SKI35 but not in lane 1 containing SKI34. This indicates the efficient transfer of N-glycan from C. jejuni to the Salmonella enterica sv Typhimurium lipid A core from the integrated pgl3mut operon.

Example 5. Immunogenicity of the glycan encoded by the operon pgl3 _mut

In order to investigate the immunogenicity of the glycan encoded by pgl3 _mut , mice were infected with SKI12 + pMLpgl3 _mut thermally inactivated bacteria and their sera were tested for the presence of antibodies binding to N-glycan from C. jejuni. The experiment was carried out as follows:

Mouse infection experiments

Salmonella infections were carried out in individually ventilated cells at RCHCI, Zurich, as previously described (Stecher, Hapfelmeier et al., Infection Infect Immun. 2004 Jul; 72 (7): 4138-50 2004). For intravenous infection, mice were injected with 5 × 10 ⁵ CFU of thermally inactivated S. Typhimurium SL1344ΔwbaP (SKI12) bearing pMLBAD (control) or pMLpgl3 _mut into the tail vein. After analyzing the serum on day 29 after infection, the mice were re-injected with the same bacterial strains on day 36 and the serum was analyzed on day 50.

Analysis of mouse sera

The production of N-glycan binding antibodies from C. jejuni was analyzed in murine sera by immunoblotting of whole cell extracts of C. jejuni 81-176 and 81-l76pglB (negative control). C.jejuni 81-l76pglB does not produce glycosylated proteins and serves as a negative control. Whole-cell extracts were prepared by harvesting C. jejuni from confluent bacterial growth plates in 1 ml PBS. After adjusting the PBS samples to one optical density, the cells were collected by centrifugation for 2 minutes at 16,000 × g at room temperature. Cells were lysed for 5 minutes at 95 ° C in Laemmli sample buffer (0.065 M Tris-HCl pH 6.8, 2% SDS (w / v), 5% β-mercaptoethanol (v / v), 10% glycerol (v / v), 0.05% bromophenol blue (w / v)) was added with PBS to the same final volumes as defined above in order to obtain the same number of cells in each sample. This was confirmed by dividing equal volumes of each sample into SDS-PAGE, followed by protein staining with Coomassie Blue. Additionally, the glycosylated and non-glycosylated AcrA protein was used to visualize the anti-N-glycan immune response from C.jejuni. For the analysis of murine sera, equal volumes of whole-cell extracts, as well as equal amounts of glycosylated and non-glycosylated AcrA, were separated using SDS-PAGE followed by transfer of proteins to a polyvinylidene fluoride membrane for detection by immunoblotting. Mouse sera acted as primary antisera in the first stage of incubation. Bound IgG was identified using a mouse IgG binding HRP conjugate (Bethyl Laboratories). Detection was performed using ECL (Amersham) in accordance with the manufacturer's recommendations.

1D) shows the presence of IgG binding N-glycan from C. jejuni in murine sera at 61 days after reinfection. Antibodies did not recognize non-glycosylated AcrA or non-glycosylated protein extracts from C. jejuni, which thus proves glycan specificity. No specific reaction with C. jejuni N-glycan was observed with the sera of mice infected with control strains (data not shown).

Example 6. The weakened phenotype of S. Typhimurium ΔwbaP

Attenuation of S. Typhimurium ΔwbaP was tested by several in vitro and in vivo methods. The in vitro method consists of testing the mutant together with the wild type for their resistance to serum, motility and resistance to the antimicrobial peptide-simulator polymyxin B. The ability to colonize ΔwbaP was analyzed in an in vivo experiment with simultaneous infection.

Serum Resistance Analysis

In general, the bactericidal activity of complement was tested as described (Bengoechea, Najdenski et al. 2004). Briefly, the serovar Typhimurium wbaP :: cat (SKI11), M939, a kanamycin-resistant derivative of the wild-type strain SL1344 of the serovar Typhimurium (aph, integrated below sopE) and cells from the serovar Typhimurium ΔwbaP :: pK19 (SKI33), taken from exponential growth were mixed in equal amounts (3 × 10 ⁸ CFU / ml for M393; 4 × 10 ⁸ CFU / ml for SK111 and SKI33) and diluted for use 5 × 10 ⁴ times with sterile 1 × PBS. This diluted bacterial culture was mixed 1: 1 with 20% human serum free of antibodies against LPS from Typhimurium serovar and incubated at 37 ° C with slight stirring. Aliquots were taken at 0, 15, and 30 min after mixing and complement activity was stopped by the addition of broth with cardiac extract. Aliquots were kept on ice before plating on LB (strep, kan) for wild-type selection, LB (Sm, Cam) for wbaP :: cat selection and LB (Sm, Tet) for determining CFU ΔwbaP :: pKI9. A similar experiment was performed using serum in which the complement was thermally inactivated at 56 ° C for 30 minutes. Data are presented as the logarithm of CFU ± standard deviation. 3A shows a decrease in serum resistance for S. Typhimurium ΔwbaP when compared with the wild type: After 30 minutes of incubation with 20% human serum, the amount for ΔwbaP was sixty times less than at the beginning of the incubation period. On figa shows the same strain, incubated with heat-inactivated serum as a negative control.

Swimming Movement Analysis

Since bacterial motility is a known virulence factor, bacterial motility was tested on soft agar plates (0.3% (w / v) agar, 5 g / L NaCl, 10 g / L Bacto-tryptone). 1 μl of wild-type overnight cultures of Typhimurium serovar (SL1344), Typhimurium ΔwbaP serovar (SKI12), Typhimurium ΔwbaP serovar :: pKI9 (SKI33) or Typhimurium fliGHI :: Tn10 serovar were placed in the middle of the cup, the mobility was measured and visible and measured after 4.75 hours and 9.5 hours of incubation at 37 ° C. Each experiment was performed three times in two different approaches, the data are presented as mean ± standard deviation. As can be seen in FIG. 3C, mobility decreased strongly in ΔwbaP (SKI12) compared to the wild type, but was higher than in the fixed control fliGHI :: Tn10.

Polymyxin B Resistance Analysis

The equivalent of 1 OD ₆₀₀ / ml of exponentially growing cultures of the wild-type strain of serovar Typhimurium SL1344 or serovar Typhimurium ΔwbaP (SKI12) was precipitated, resuspended in 150 μl of cold sterile 1 × PBS and diluted 5 × 10 ⁶ times before use. For analysis, 45 μl of diluted cultures were mixed with 5 μl of Polymyxin B (Sigma, final concentration 1 μg / ml) or 5 μl of PBS and incubated for 1 hour at 37 ° C with gentle stirring. After adding 80 μl of LB, bacteria were plated in plates with LB agar containing streptomycin. Survival efficiency was calculated by dividing the CFU (colony forming units) of the peptide-treated culture by the CFU of the untreated culture, multiplied by 100. The analysis was performed three times in two independent experiments and the data are presented as mean ± standard deviation. 3D shows a decrease in resistance to polymyxin B in S. Typhimwium ΔwbaP compared to the wild type.

The ability of ΔwbaP to colonize in a co-infection experiment

The colonization ability of S. Typhimurium ΔwbaP was tested in a co-infection experiment in which mice were infected intragastrically with a ΔwbaP mutant together with a wild-type strain. C57BL / 6 mice (SPF; RCHCI colony, Zurich) were pretreated with 20 mg streptomycin using a probe. After 24 hours, the mice were inoculated with 5 × 10 ⁷ CFU of the serovar of Typhimurium strain or a mixture of strains as indicated. Bacterial loads (CFU) in fresh fecal lumps, mesenteric lymph nodes (English mesenteric lymph nodes, mLNs), spleen and in the contents of the cecum were determined by scattering in McConkey agar plates (50 μg / ml streptomycin) as previously described (Barthel, Hapfelmeier et al. 2003). Competitive indices (Eng. Competitive indices, C1) were determined by the formula CI = (mutant / wild type) at the output / (mutant / wild type) at the entrance after sieving. An experiment was conducted with a joint infection of wild-type Typhimurium serovar (M939) and ΔwbaP strain (SKI11). 5 streptomycin-treated mice were infected with a 1: 2 mixture (total CFU 5 × 10 ⁷ ) intragastrically by the ΔwbaP strain (SKI11) and the wild-type strain. The ratio of 2 strains (CI; competitive index, see Materials and Methods) was determined in feces at 1, 2 and 3 days after infection. A decrease in the amount of ΔwbaP compared to the wild type (one logarithmic unit per day) was detected and it was proved that the strain ΔwbaP (SKI11) really has a serious competitive defect in the intestinal tract compared to the wild type of Typhimurium serovar strain (p>0.05; Fig. 4A). Moreover, the CI of two strains at the system sites (ml_N, liver, spleen) on day 4 after infection also showed a significant serovar defect Typhimurium ΔwbaP (SK112). However, the defect was less pronounced than in the intestine (Figure 4B).

Table 1 The strains, plasmids and primers for wbaP deletion used in this work Strains of Salmonella enterica sv Typhimurium Strain Genotype and phenotype Source or Link SL1344 wild type; strepK Hoiseth, S. K. and B. A. Stacker, Nature 291: 238-239, 1981 SKI11 SL1344ΔwbaP :: caf; strep ^R , cam ^R This study SKI12 SL1344ΔwbaP; strep ^R This study SKI34 SKI12 :: pKI14; strep ^R , tet ^R This study SKI35 SKI12 :: pKI15; strep ^R , tet ^R This study Strains of Escherichia coli DH5a SupE44ΔlacU169 (Ф80 / acZΔM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 Hanahan, D., J. Mol. Biol., 5, 166 (4): 557-80, 1983 CC118 λpir Δ (ara-leu), araD, ΔlacX74, galE, galK, phoA20, thi-1, rpsE, rpoB, argE (Am), recA, λpir Herrero, M., V. de Lorenzo, and K. N. Timmis. J Bacteriol 172: 6557-6567. Sm10 λpir thi thr leu tonA lacY supE recAv :: RP4 2-Tc :: Mu λpir, kan ^R Miller, V. L. and J. J. Mekalanos. J. Bacteriol. 170: 2575-2583, 1988. Plasmids Plasmid Genotype Source or Link pSB377 tet ^R oriR6K Mirold et al., Proc. Natl. Acad. Sci. USA 96: 9845-9850, 1999. pKD3 bla FRT cat FRT PSI PS2 oriR6K Datsenko, K. A. and B. L. Wanner, Proc. Natl. Acad. Sci. USA, 97: 6640-6645, 2000. pKD46 bla pbad gam bet exo pSC101 onTS Datsenko, K. A., and B. L. Wanner, Proc. Natl. Acad. Sci. USA, 97: 6640-6645, 2000. pCP20 bla cat c1857 λP _R flp pSC101 or / TS Datsenko, K. A., and B. L. Wanner. Proc. Natl. Acad. Sci. USA, 97: 6640-6645, 2000 pACYC184 Cm ^R , Tc ^R , ori p15A New england biolabs pACYCpgl _mut Cm ^R , ori p15A; pgl cluster from C.jejuni with pglB ^{W458A, D459A} cloned into pACYC184 Science, 298 (5599): 1790-3, 29. Nov. 2002 pACYCpgl3 _mut Cm ^R , ori p15A; pgl cluster from C.jejuni with pglB ^{W458A, D459A} cloned into pACYC184, pglE, F, G divisions and 3'-halves of pglD This study pKI14 Tet ^R , oriR6K, 500 bp region 3'PagC cloned in pSB377 This study pKI15 Tet ^R , oriR6K, pgl3mut cluster from C.jejuni with pglB ^{W458A, D459A} cloned into pKI15 This study

WbaP Removal Primers Rfbph1p1 CTTAATATGCCTATTTTATTTACATTATGCACGGTCAGAGGGTG AGGATTAAGTGTAGGCTGGAGCTGCTTC (SEQ ID NO: 4) RfbP H2P2 GATTTTACGCAGGCTAATTTATACAATTATTATTCAGTACTTCT CGGTAAGCCATATGAATATCCTCCTTAGTTCCTATTCC (SEQ ID NO: 5) Primers for pgl3 _mut integration 3 'PagC Fw NotI AAGCGGCCGCGCATAAGCTATG CGGAAGGTTC (SEQ ID NO: 6) 3 'PagC Rev SacII ACCGCGGGACACTGAGGTAATA ACATTATACG (SEQ ID NO: 7)

Claims (18)

1. Genetically modified bacterium Salmonella enterica for the prevention and / or treatment of Campylobacter jejuni infections, characterized in that it contains at least one pgl operon from Campylobacter jejuni or a functional derivative thereof and presents at least one Campylobacter N-glycan jejuni or a derivative of such N-glycan on its cell surface, where one or more genes for bacillosamine biosynthesis are inactivated by a mutation and / or partial or complete deletion, preferably a partial and / or complete deletion of the pgl D, E, F, G. genes. 2. Salmonella enterica according to claim 1, selected from the group consisting of Salmonella typhimurium, enteriditis, heidelberg, gallinorum, hadar, agona, kentucky and infantis, more preferably from Salmonella enterica strains, Typhimurium serovar. 3. Salmonella enterica according to any one of claims 1 or 2, containing at least one pgl operon in which the pglB gene product is inactivated by mutation and / or deletion. 4. Salmonella enterica according to any one of claims 1 or 2, in which at least one N-glycan derivative has the formula (I)
GalNAc-a1,4-GalNAc-a1,4- [Glc-β-1,3] GalNAc-a1,4-Gal-NAc-a1,4-GalNAc-a1,3-GlcNAc. 5. Salmonella enterica according to any one of claims 1 or 2, wherein the N-glycan (s) or derivative (s) is associated with at least one homologous or heterologous Salmonella polypeptide that is carried and presented on the cell surface, and preferably associated with at least one polypeptide containing at least one HZS / T consensus sequence, more preferably D / EXNZS / T (SEQ ID NO: 1), where X and Z can be any natural amino acid except Pro. 6. Salmonella enterica according to any one of claims 1 or 2, in which at least one N-glycan or its derivative is associated with the lipid A nucleus of Salmonella or with its functional derivative. 7. Salmonella enterica according to any one of claims 1 or 2, in which the Salmonella strain is attenuated, preferably mutations selected from the group consisting of pab, pur, aro, aroA, asd, dap, nadA, pncB, galE, pmi, fur , rpsL, ompR, htrA, hemA, cdt, cya, crp, phoP, phoQ, rfc, poxA and galU, more preferably mutations aroA, cya and crp. 8. Salmonella enterica according to any one of claims 1 or 2, wherein the Salmonella strain is attenuated by partial or complete inactivation of O-antigen expression, preferably by one or more mutations and / or divisions in the rfb gene cluster, more preferably in the wbaP gene, most preferably deletion of the gene wbaP. 9. Salmonella enterica according to any one of claims 1 or 2, preferably a typhimurium serovar strain, characterized in that
(a) it contains
(i) at least one pgl operon from Campylobacter jejuni or a functional derivative thereof, in which one or more genes for bacillosamine biosynthesis are inactivated and
(ii) mutations and / or deletions in the wbaP gene leading to complete inactivation of O-antigen biosynthesis,
(b) and presents on its cell surface at least one Campylobacter jejuni N-glycan or a derivative of such N-glycan, preferably GalNAc-a1,4-GalNAc-a1,4- [Glc-β-1,3] GalNAc-a1,4-Gal-NAc-a1,4-GalNAc-a1,3-GlcNAc. 10. The use of Salmonella enterica, preferably live Salmonella enterica, according to any one of the preceding claims for the preparation of a medicament for the prevention and / or treatment of Campylobacter jejuni infections, preferably a vaccine. 11. The use of claim 10 for the preparation of a medicament, preferably a vaccine, for the prophylaxis and / or treatment of infections of livestock, more preferably cattle and poultry, more preferably poultry, and optionally Salmonella infections. 12. A pharmaceutical composition for the prevention and / or treatment of infections of Campylobacter jejuni and optionally Salmonella, preferably infections in livestock, more preferably in cattle or poultry, more preferably in poultry containing Salmonella enterica, preferably live Salmonella enterica, according to any one of the preceding paragraphs and optionally physiologically acceptable excipients. 13. A food product containing Salmonella enterica, preferably living Salmonella enterica, according to any one of the preceding paragraphs and optionally physiologically acceptable excipients. 14. Food containing Salmonella enterica, preferably live Salmonella enterica, according to any one of the preceding paragraphs and optionally physiologically acceptable excipients. 15. A food supplement containing Salmonella enterica, preferably live Salmonella enterica, according to any one of the preceding paragraphs and optionally physiologically acceptable excipients. 16. A feed additive containing live Salmonella enterica, preferably live Salmonella enterica, according to any one of the preceding paragraphs and optionally physiologically acceptable excipients. 17. A method of treating and / or preventing infections of C. jejuni and, optionally, Salmonella, comprising administering to a person or animal in need of Salmonella enterica according to any one of claims 1 to 9 or a pharmaceutical composition comprising Salmonella enterica according to any one of claims 1 to 9, in a physiologically active amount. 18. A method of obtaining a genetically modified bacterium Salmonella enterica according to any one of claims 1 to 9, including stage (s)
(i) introducing into Salmonella enterica, at least one plasmid vector or genomic integration of at least one pgl operon from C. jejuni or a functional derivative thereof, preferably at least one pgl operon in which one or more , preferably all genes for biosynthesis of bacillosamine are inactivated, and
(ii) preferably introducing mutations and / or deletions into the wbaP gene leading to complete inactivation of O-antigen biosynthesis.

Images