RU2489489C1 - Method to determine bactericide properties of blood serum - Google Patents

Abstract

FIELD: biotechnologies.

SUBSTANCE: substance of the invention is quantitative assessment of impact of human or animal blood serum at a laboratory strain Bacillus subtilis VKPM B-10548, efficiently expressing luxAB-genes of gram-negative marine microorganism Photobacterium leiognathi. At the same time extent of this strain luminescence suppression is proportionate to the level of bactericide effect developing in its respect. Total calculation of bactericide properties of blood serum determined by availability of beta-lysine in it, is made according to the formula: $$BPB{S}_{\left(BL\right)}=100-\frac{\left(I_{\exp .}^{\mathrm{0,5}}\times I_{contr.}^0\right)}{\left(I_{\exp .}^0\times I_{contr.}^{\mathrm{0,5}}\right)}\times 100.$$

EFFECT: method makes it possible to reduce duration of performance of a procedure for determination of bactericide activity of blood serum determined by beta-lysine activity.

1 tbl, 1 ex

Description

The invention relates to the field of biomedical measuring technologies, and in particular to methods for determining the bactericidal properties of blood serum. The need for such studies is enshrined in the "Nomenclature of clinical laboratory studies used to diagnose diseases and monitor the condition of patients in healthcare facilities of the Russian Federation" (clause 6.3.2 - Determination of the general bactericidal properties of blood serum), approved by Order of the Ministry of Health of the Russian Federation No. 64 from 02.21.2000

In particular, the invention is intended to determine the bactericidal properties of blood serum associated with the presence of beta-lysine (platelet cationic protein) in it.

Thus, the inventive method is intended for use in laboratories of a biological, medical and veterinary profile, solving the issues of assessing the system of natural (innate) immunity of humans and animals in order to identify their possible violations and monitor the effectiveness of appropriate corrective measures.

Known from the prior art, methods for assessing bactericidal principles of blood serum are focused on identifying two main systems, originally designated by Emil von Behring as thermolabile "alpha-lysine" and thermostable) "beta-lysine" (Bukharin OV, Vasiliev N.V. The beta-lysine system and its role in clinical and experimental medicine. - Tomsk. Publishing house of TSU. - 1977. - P.19). Later, alpha-lysine was identified as a complement system, the activation of which leads to the effective lysis of gram-negative microorganisms, and the beta-lysine, which is most active against gram-positive spore-forming microorganisms, has increasingly become associated with the action of platelet cationic protein (Bukharin O.V. , Suleymanov K.G. Properties and functions of platelet cationic protein // Successes in modern biology. - 1998. - N 2. - S.194-204).

Based on the set of essential features, the most common methodological approach to determining the activity of the complement system and beta-lysine for experimental and clinical diagnostic purposes is to conduct bacteriological studies on specially selected bacterial cultures that are highly sensitive to the damaging effect of these factors. Moreover, differences in the structure of the surface structures of such gram-negative and gram-positive microorganisms allow relatively specific assessment of each of the studied bactericidal systems.

In particular, a number of existing methods for determining complement-dependent bactericidal activity are based on the same principle - the effect of blood serum on a population of viable serosensitive gram-negative microorganisms with the subsequent assessment of the proportion of clones that survived after such contact, compared to the control - by the same microorganisms incubated out of contact with blood serum. Moreover, various strains of Escherichia coli are usually used as sulfur-sensitive microorganisms: 0111 (Bukharin O.V., Sozykin V.L. Photonephelometric method for determining the bactericidal activity of blood serum // Natural immunity factors. - Orenburg, 1979. - P.43-45 ), 675 (Krasilnikov A.P., Titov L.P. Determination of the bactericidal activity of blood serum by the replica method // Lab. Business. - 1981. - N 4. - P.245-247), which is determined by the structural features of their cell wall effectively destroyed by a complex of serum factors.

In turn, to assess the beta-lysine-dependent bactericidal activity of blood serum, Bacillus subtilis strains are traditionally used, due to the peculiarities of organizing their surface structures characteristic of gram-positive microorganisms, which are predominantly sensitive to this group of substances with simultaneous relative resistance to the lytic effect of other humoral bactericidal factors ( Sarukhanov V.Ya., Isamov NN, Tsarin P.G. Method for determination of beta-lytic activity of blood of farm animals // Agricultural biology. - 2007. - N4. - P.123-125).

The calculation of bactericidal values in both cases is carried out on the basis of similar and identical biological sense formulas that evaluate the ratio of microorganisms grown in experiment and control and express the final values as a percentage of the bactericidal effect achieved.

However, despite numerous attempts to reduce the complexity of such methods of reducing the flow of nutrient media (Evtushenko A.D., Timokhina T.Kh., Argunova G.A. A modified method of bacteriological determination of bactericidal activity of blood serum // Lab. Business. - 1982. - N 12. - P.41-42; Slonim A.A., Tolcheev Yu.D. Determination of the bactericidal activity of blood serum and lymph // Lab. Business. - 1989. - N 7. - P.65-66) talk about them use at present is possible only in the historical aspect. The aforesaid is determined by the discrepancy with the requirements for biomedical technologies of the 21st century and stipulated in the "Concept for the development of the clinical laboratory diagnostics service of the Russian Federation."

One of the prospects for improving methods for assessing the bactericidal systems of natural immunity is associated with the use of luminescent microorganisms as objects of influence, the change (suppression) of the glow of which is a consequence of their destruction with spatial disorganization of the enzyme systems, as a result of which the residual bioluminescence intensity is proportional to the number of bacterial cells that have retained their viability targets.

The ability to evaluate the activity of humoral and cellular bactericidal systems by their influence on the luminosity of luminescent bacteria was first demonstrated as far back as the 80s of the 20th century (Barak M., Ulitzur S., Merzbach D. Determination of serum bactericidal activity with the aid of luminous bacteria // J. Clin. Microbiol. - 1983. - Vol. 18. - N 2. - P.248-253). At the same time, the natural isolate Vibrio cholerae biovar albensis was used as a test strain for such studies, demonstrating high sensitivity to the damaging effects of molecular and cellular systems present in the blood of humans and animals. However, the belonging of this microorganism to a pathogenic species with corresponding non-compliance with the requirements of biological safety was a significant limitation for the wide dissemination of the proposed bioluminescent technology.

The found solution to this problem was the cloning of bioluminescence genes (lux genes) in non-pathogenic laboratory microorganisms that initially showed high sensitivity to bactericidal factors of blood serum. In particular, the use of the recombinant luminescent strain of Escherichia coli K12 TG1 with cloned luxCDABE tenes of the natural marine microorganism Photobacterium leiognathi was the basis for a method for evaluating the bactericidal activity of blood serum, whose significant advantages were a reduction in the duration of the study, an overall reduction in the complexity of the study, while simultaneously creating the possibility of analyzing large quantities samples (RF Patent No. 2247987. A method for determining the bactericidal activity of blood serum. Publ. 10.03.2005, Bull. No. 7).

Confirmation of the relevance of this approach is also the experience of the similar use of the recombinant luminescent strain Klebsiella pneumoniae Xen39, constitutively expressing a complete cassette of luxCDABE genes of the natural soil microorganism Photorhabdus luminescence (Nypaver CM, Thornton MM, Yin SM, Bracho DO, Nelson Pz J, J Nelson PW J, Nelson PW Younger JG Dynamics of human complement-mediated killing of Klebsiella pneumoniae // Am. J. Respir. Cell. Mol. Biol. - 2010. - Vol. 43. - N 5. - P.585-590). In turn, the belonging of this strain to the number of gram-negative microorganisms, as in the case of Escherichia coli, also determined its greatest sensitivity to the complement-dependent bactericidal system of blood serum.

Against this background, the unsolved task is to evaluate beta-lysine-dependent bactericidal activity, which forms the second most important antimicrobial system of human and animal blood serum. At the same time, attempts to solve it using the laboratory luminescent strains described above, as well as another genetic engineering construct Pseudomonas aeruginosa H1001 (fliC: luxCDABE}, previously used to evaluate the artificiality of synthesized cationic antimicrobial peptides (K. Hilpert, Hancock RE Use of luminescent bacteria for rapid screening and characterization of short cationic antimicrobial peptides synthesized on cellulose using peptide array technology // Nature Protocols. - 2007. - Vol.2. - P.1652-1660), cannot be considered adequate due to the possibility of their response to a wide range of complex fluids present in biological fluids about the component composition of bactericidal factors and, first of all, the complement system.

A significantly more specific response should be expected when using representatives of the genus Bacillus, traditionally used to study the beta-lytic activity of human and animal blood (Bukharin O.V., Vasiliev N.V. Beta-lysine system and its role in clinical and experimental medicine. - Tomsk, TSU Publishing House. - 1977. - P.20; Sarukhanov V.Ya., Isamov NN, Tsarim PG Method for determination of beta-lytic activity of blood of farm animals // Agricultural Biology. - 2007. - N 4. - S.123-125).

The known experience of such an assessment of the bactericidal properties of blood serum is associated with the use of recombinant luminescent strains of Bacillus subtilis BR151, as well as Escherichia coli JM109, carrying the plasmid pCSS962 with the cloned luciferase genes of the insect Pyrophorus plagiophthalamus (Virta M., Karp M. Run, Runa Lilius E.-M. Kinetic measurement of the membranolytic activity of serum complement using bioluminescent bacteria // J. Immunol. Meth. - 1997 .-- Vol. 201 - N 2. - P.215-221; Virta M., Lineri S., Kankaanpaa P. at al. Determination of complement-mediated killing of bacteria by viability staining and bioluminescence // Appl. Environ. Microbiol. - 1998. - Vol. 64. - N 2. - P.515-519). However, the nature of bactericidal activity recorded with their use was unambiguously associated by the authors with complement activity, although no parallel assessment of this system was carried out. In addition, in the cited works, a comparative reaction of strains of B. subtilis BR151 and E. coli JM109 only to a pool of sera from five donors was given, which made it impossible to identify the characteristics of the luminescent response of each of them to individual bactericidal systems present in this biological fluid. An additional technological complexity when using these strains was also the need for additional substrate for firefly luciferase (D-luciferin), at pH = 7.0, weakly diffusing through the cytoplasmic membrane.

In general, an analysis of the scientific and scientific-technical literature allows us to state that the nephelometric method for evaluating beta-lysine (Bukharin O.V., Vasiliev N.V., according to the set of features closest to the claimed and, therefore, characterized as a prototype method) The beta-lysine system and its role in clinical and experimental medicine - Tomsk, TSU Publishing House - 1977. - P. 52-53), based on a change in the optical density of meat-peptone broth with the growth of the Bacillus subtilis 83 strain in it ( GKI named after Tarasovich) with and without testing th serum. Accordingly, the degree of growth retardation of the strain of Bacillus subtilis 83 upon contact with blood serum after 18 hours of incubation at 37 ° C compared with the control allows the calculation of beta-lysine activity by the formula:

$$\mathrm{BUT}BL=\mathrm{one\; hundred}-\frac{\left(O{D}_{\mathrm{about}Pst}^{\mathrm{eighteen}}-O{D}_{\mathrm{about}Pst}^0\right)}{\left(O{D}_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^{\mathrm{eighteen}}-O{D}_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^0\right)}\times \mathrm{one\; hundred,}\left(\mathrm{one}\right)$$

- оптическая плотность опытной пробы после 0 часов контакта;Where $$O{D}_{\mathrm{about}Pst}^0$$

- optical density of the experimental sample after 0 hours of contact;

- оптическая плотность опытной пробы после 18 часов контакта; $$O{D}_{\mathrm{about}Pst}^{\mathrm{eighteen}}$$

- optical density of the experimental sample after 18 hours of contact;

- оптическая плотность контрольной пробы после 0 часов контакта; $$O{D}_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^0$$

- optical density of the control sample after 0 hours of contact;

- оптическая плотность контрольной пробы после 18 часов контакта. $$O{D}_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^{\mathrm{eighteen}}$$

- optical density of the control sample after 18 hours of contact.

The main reason that prevents obtaining the desired result when using the prototype method is the significant duration of the growing stage (18 hours), limited by the growth rate of the indicator microorganism after contact with blood serum to the optical density values available for photonephalometric registration.

Thus, the main reason that impedes the desired result is the lack of a laboratory luminescent Bacillus strain, for which selective sensitivity to the bactericidal action of blood serum, which is determined by the presence of the beta-lysine system (platelet cationic protein), has been demonstrated.

Alternative approaches leading to the elimination of this drawback are not described in the literature available to applicants.

The foregoing allows us to state that the claimed method is not known from the prior art, i.e. is new.

The main task to be solved by the claimed method is directed is the rapid determination of the bactericidal properties of blood serum, determined by the presence of beta-lysine (platelet cationic protein) in it. An additional problem to be solved when implementing the proposed method is to reduce the complexity and increase the manufacturability of its implementation of this laboratory study.

The essence of the proposed method, formulated at the level of functional generalization and underlying it, is the following: when exposed to human or animal blood serum, the severity of suppression of the luminescence of the laboratory strain of Bacillus subtilis VKPM B-10548, which efficiently expresses luxAB genes of the gram-negative marine microorganism Photobacterium leiognathi, is proportional to the level developing bactericidal effect against it, determined by the presence of beta-lysine (platelet cationic protein).

Accordingly, when implementing the proposed method for determining the bactericidal properties of blood serum, the characteristics of the actions, the order of their implementation and the conditions for implementation in comparison with the prototype method are as follows.

At the first (preparatory) stage, the Bacillus subtilis VKPM B-10548 strain is grown on LB agar in the presence of kanamycin (a selective factor for the cloned plasmid pLF14ABlei with luxAB genes and kanamycin resistance genes) at a final concentration of 40 μg / ml at 37 ° C for 24 hours. The resulting biomass is washed off with sterile LB broth, after which the resulting suspension is standardized to an optical density of 1.2 rel. units at 540 im measured in cuvettes with an optical path length of 1 cm.

The features of the stage that distinguish it from that of the prototype method are: 1) using a luminescent strain of Bacillus subtilis VKPM B-10548 as a test object with the cloned luxAB genes of the gram-negative marine microorganism Photobacterium leiognathi for which a quantitative dependence of the decrease in the level of bioluminescence on the severity is shown bactericidal effect (see below); 2) growing a strain of Bacillus subtilis VKPM B-10548 on a nutrient medium containing a selective marker (kanamycin, 40 μg / ml), which allows to exclude the growth of non-luminescent strains.

At the second (main) stage, the suspension of bacterial cells and the test sample of blood serum is mixed in a ratio of 1: 1, incubated at 37 ° C for 0.5 hours. At 0 and 0.5 hours of the existence of the reaction mixture, aliquots of 250 μl are collected in bioluminometer cuvettes, and 2 μl of decanal is added to them in a final concentration of 7 × 10 ^-6 M.

The features of this stage that distinguishes it from the prototype method are: 1) creating a 1: 1 ratio in the reaction mixture of bacteria: blood serum; 2) contact of bacterial cells with test samples of blood serum within 0.5 hours, which significantly reduces the analysis time; 3) the glow of the test strain in the presence of an exogenous substrate (decanal), oxidized in the presence of molecular oxygen by the enzyme luciferase, the synthesis of which is provided by the expression of the cloned luxAB genes of the gram-negative marine microorganism Photobacterium leiognathi

At the final stage, the level of luminescence in the samples is recorded in the visible blue-green region of the spectrum (420-600 im). As a measuring device when implementing the proposed method, a Biotoke-10M biochemiluminometer, as well as other domestic and foreign luminometers working in the indicated region of the spectrum and providing the corresponding measurement sensitivity, can be used.

The final calculation of the bactericidal properties of blood serum, determined by the presence of beta-lysine in it, is carried out according to the formula:

$$B\mathrm{FROM}\mathrm{FROM}{\mathrm{TO}}_{\left(BL\right)}=\mathrm{one\; hundred}-\frac{\left(I_{\mathrm{about}Pst}^{0.5}\times I_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^0\right)}{\left(I_{\mathrm{about}Pst}^0\times I_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^{0.5}\right)}\times \mathrm{one\; hundred,}\left(2\right)$$

- уровень биолюминесценции опытной пробы после 0 часов контакта;Where $$I_{\mathrm{about}Pst}^0$$

- the level of bioluminescence of the experimental sample after 0 hours of contact;

- уровень биолюминесценции опытной пробы после 0,5 часов контакта; $$I_{\mathrm{about}Pst}^{0.5}$$

- the level of bioluminescence of the experimental sample after 0.5 hours of contact;

- уровень биолюминесценции контрольной пробы после 0 часов контакта; $$I_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^0$$

- the level of bioluminescence of the control sample after 0 hours of contact;

- уровень биолюминесценции контрольной пробы после 0,5 часов контакта. $$I_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^{0.5}$$

- the level of bioluminescence of the control sample after 0.5 hours of contact.

The main difference between this stage and that in the prototype method is the use of luminometers that detect the level of luminescence in the analyzed samples.

The ability to obtain a technical result when performing the above actions in the indicated ranges of values is determined by the following complex of cause-effect relationships:

1) the use of Bacillus subtilis VKPM B-10548 for the stated purposes, firstly, is determined by the fact that, in contrast to the known recombinant luminescent strains of the genus Bacillus, it is characterized by a high level of expression (transcription and translation) of luxAB bacterial luciferase genes.

To achieve this, DIC fragments containing the luxA and luxB genes encoding the alpha and beta subunits of Photobacterium leiognathi luciferase, a key bacterial bioluminescence enzyme, were amplified using primers:

luxA

LuxADir5 '-

G CGTCTC AGATCG GAAGGTGG AAGAAATAATGAAAATTAGTAATATC - 3 '

LuxARev 5 '- G CGTCTC GACGTCATAGTTTAAAAAGAACAGCTTACTGAGG - 3'

luxB

LuxBDir5'-

G CGTCTC GACGTC GAAGGTGG AATAAAATATGAATTTCGGGTTATTTTTC - 3 '

LuxBRev 5 '- G CGTCTC CAATTGCCGTAATTAAATTATTTAATAAGGTTATC - 3'

an important feature of which was the presence of a ribosome-binding site of gram-positive bacteria (underlined). In addition, the sequence of the BsmBI restriction endonuclease site (marked in bold) was added to the 5 'ends of all primers, allowing subsequent ligation of amplification products.

DNA fragments purified by gel elution were restricted and ligated, after which DNA fragments containing the desired genes in the luxAB sequence were amplified from the obtained ligase mixture. In turn, the cloning of the obtained PCR products in a T-vector based on the plasmid pTZ57R (Fermentas, Lithuania) led to the creation of the primary plasmid pTZ ABlei, the transformation of which strain E. coli MC1061 gave the latter the ability to pronounced bioluminescence by adding a substrate of this reaction, a long-chain aldehyde n-decanal.

In order to integrate the luxAB gene into B. subtilis cells, they were cloned from the pTZ ABlei to the shuttle vector pLF14 in the saigas PstI and EcoRI. In turn, the transfer of the formed hybrid plasmid pLF14ABlei to B. subtilis 168 cells followed by bacterial biomass plating on LB agar with 25 μg / ml kanamycin made it possible to obtain a recombinant strain of B. subtilis DO 0002 pLF14ABlei with a high level of translation of constitutively transcribed luxAB genes, whose luminescence when adding decanal at a concentration of 7 × 10 ^-6 M was no less than 10 times higher than that of the well-known B. subtilis strain VKPM B-10191 with unmodified luxAB genes V. fischeri (Karimov I.O., Manukhov I.V. ., Kotova V.Yu., Omelchenko D.O., Deryabin D .G. Features of the luminescent response of the recombinant strain of Bacillus subtilis with cloned VIBrio fisheri luxAB genes when exposed to thermostable components of blood serum /// Biotechnology. - 2010. - No. 2 - C.25-30).

The resulting strain was deposited in the All-Russian collection of industrial microorganisms (GosNIIgenetika, Moscow) under the number B-10548.

2) An important justification for the use of Bacillus subtilis VKPM B-10548 for the stated purposes is the experimentally identified direct reliable (P <0.05) correlation between the suppression of the intensity of its bioluminescence when exposed to blood serum and the severity of the bactericidal effect developing under these conditions, recorded using classical bacteriological techniques.

The above is a key condition for using the Bacillus subtilis VKPM B-10548 bioluminescence intensity indicator for testing the bactericidal properties of blood serum.

3) Another justification for using Bacillus subtilis VKPM B-10548 for the stated purposes for the stated purposes is the experimentally detected selective sensitivity of this strain to beta-lysine (platelet cationic protein) in the absence of it to other bactericidal factors present in the blood serum.

Thus, a comparison of the luminescent response of this strain with that of Escherichia coli with the genes of the luminescent system Photobacterium leiognathi, the use of which is determined by the RF patent for invention No. 2247987 [9] for determining the bactericidal activity of blood serum, with the general co-directionality of the effects of the studied blood serum testified that the bioluminescence suppression values of the two compared microorganisms were correlation independent (P> 0.05). In turn, a comparison of the obtained values with the component composition of the acting blood serums, previously evaluated using a representative series of immunochemical methods, made it possible to establish the reasons for this different reaction of the used recombinant luminescent microorganisms.

In particular, the intensity of suppression of luminescence of Bacillus subtilis VKPM B-10548 significantly correlated only with the quantitative presence of beta-lysine in the test sera (r = -0.481; P <0.01).

In turn, for being compared with a strain of Escherichia coli genes fluorescent Photobacterium leiognathi system most significant correlation coefficients have been fixed between the residual bioluminescence and characterized by values ₅₀ CH total complement activity (r = -0,427; P <0.01), and the activity of the enzyme lysozyme Bacteriological (r = -0.395; P <0.01). Moreover, the existence of such a dependence could be determined both by the biological activity of lysozyme involved in the destruction of bacterial cells after the formation of membrane-damaging complexes from the “late” proteins of the complement system, and by the characteristics of the studied sample of blood serums in which the presence of this factor positively correlated with the activity of the system (r = 0.308; P <0.05) and the quantitative content of the C3 and C5 components included in it (r = 0.309 and r = 0.295; P <0.05). Finally, the aforementioned components themselves, as well as the factor H involved in the alternative pathway of activation of the complement system, were also combined with positive correlation bonds (r = 0.339; P <0.05 and r = 0.516; P <0.01), forming a single “correlation Pleiad ", significant for the development of the bactericidal effect of serum against Escherichia coli.

Thus, the foregoing allows us to state that the cloning of the same Photobacterium leiognathi bioluminescence genes in Bacillus subtilis and Escherichia coli cells leads to the creation of two different sensory systems, the selective sensitivity of which to bactericidal factors present in blood serum is presumably determined by the features of the organization of cell surface structures - recipients. Thus, the identified causal relationship complex is a key condition for using the Bacillus subtilis VKPM B-10548 bioluminescence intensity indicator to test the bactericidal properties of blood serum, which are determined precisely by the presence of beta-lysine (platelet cationic protein) in it.

4) Use of a bacterial suspension with an optical density of 1.2 rel. units is determined by the need to achieve the level of luminescence of the sample, which can be fixed using hardware for recording luminescence. Moreover, the use of the reaction substrate — long-chain aldehyde (decanal) —is optimal at a final concentration of 7 × 10 ^-6 M to achieve a high and stable level of bioluminescence of Bacillus subtilis VKPM B-10548 cells, since a further decrease in the decanal concentration worsened the luminescence stability and was insufficient for the formation of a hardware-recorded level of luminescence, and the increase no longer led to a further increase in the values of bioluminescence.

5) The justification of the contact time of the luminescent strain of Bacillus subtilis VKPM B-10548 with a blood serum for 0.5 hours is the output by this time the level of luminescence on the "plateau effect" without further changing the level of luminescence of bacterial cells with an increase in exposure time.

In general, summarizing the above materials about the essence of the proposed method, the characteristics of the actions, the order of their implementation and the conditions for implementation, we can state that the claimed method does not follow from the prior art and should be evaluated as meeting the criterion of "inventive step".

The invention is illustrated, but not limited to the following examples.

Example

1) The change in the immune status in cattle was studied using complex preparation X, the main active ingredients of which are denatured emulsified placenta and sodium nucleate. For research, two groups of pregnant cows were created with 10 animals each. Directly, the cows of the experimental group were injected intramuscularly with drug X at a dose of 0.025 ml / kg body weight for 60, 30 and 7 days of calving, and the animals of the control group were not used the drug.

Blood for analysis of beta-lytic activity two, one month and 7 days before calving and 10 days after birth, in calves received from them at the daily and 30-day age. In this case, 1 ml of blood serum was mixed with a similar volume of a suspension of bacterial cells and 250 μl aliquots were taken at 0 and 30 minutes of the mixture existence in cuvettes, 2 μl of decanal was added at a final concentration of 7 × 10 ^-6 M, and the level of luminescence was measured on a Biotoke bioluminometer 10M. In control samples, physiological saline was used instead of blood serum. The final calculation of the bactericidal properties of blood serum, determined by the presence of beta-lysine in it, is carried out according to the formula:

, $$B\mathrm{FROM}\mathrm{FROM}{\mathrm{TO}}_{\left(BL\right)}=\mathrm{one\; hundred}-\frac{\left(I_{\mathrm{about}Pst}^{0.5}\times I_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^0\right)}{\left(I_{\mathrm{about}Pst}^0\times I_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^{0.5}\right)}\times \mathrm{one\; hundred}$$

,

- уровень биолюминесценции опытной пробы после 0 часов контакта;Where $$I_{\mathrm{about}Pst}^0$$

- the level of bioluminescence of the experimental sample after 0 hours of contact;

- уровень биолюминесценции опытной пробы после 0,5 часов контакта; $$I_{\mathrm{about}Pst}^{0.5}$$

- the level of bioluminescence of the experimental sample after 0.5 hours of contact;

- уровень биолюминесценции контрольной пробы после 0 часов контакта; $$I_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^0$$

- the level of bioluminescence of the control sample after 0 hours of contact;

- уровень биолюминесценции контрольной пробы после 0,5 часов контакта. $$I_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^{0.5}$$

- the level of bioluminescence of the control sample after 0.5 hours of contact.

, $$I_{опыт}^{\mathrm{0,5}}=7050отн.ед.$$

, $$I_{контроль}^0=8120отн.ед.$$

, $$I_{контроль}^{\mathrm{0,5}}=7800отн.ед$$

. При этом получаем:For example, values were obtained $$I_{\mathrm{about}Pst}^0=8200\mathrm{about}tn.ed.$$

, $$I_{\mathrm{about}Pst}^{0.5}=7050\mathrm{about}tn.ed.$$

, $$I_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^0=8120\mathrm{about}tn.ed.$$

, $$I_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^{0.5}=7800\mathrm{about}tn.ed$$

. Thus we get:

$$B\mathrm{FROM}\mathrm{FROM}{\mathrm{TO}}_{\left(BL\right)}=\mathrm{one\; hundred}-\frac{\left(7050\times 8120\right)}{\left(8200\times 7800\right)}\times \mathrm{one\; hundred}=10.50\%$$

It was found that the beta-lytic activity of the blood of cows and newborn calves under the influence of an immunostimulant changed slightly. However, in young animals of thirty days of age, the indicator was higher than in calves of the control group by 6.89% (p <0.05).

Bactericidal properties of blood serum, determined by the presence of beta-lysine of cows in it when using drug X Group of animals bactericidal properties of blood serum control% experienced,% Cows 60 days before calving 10.52 ± 0.85 1.0.84 ± 0.41 Cows 30 days before calving 10.72 ± 0.54 10.82 ± 0.36 Cows 7 days before calving 10.25 ± 0.35 10.69 ± 0.39 Cows after 10 days after calving 11.98 ± 0.66 11.00 ± 0.36 Daily calves 9.33 ± 0.87 9.98 ± 0.97 Thirty day calves 9.76 ± 0.23 10.44 ± 0.34

A close relationship was observed between the growth rate and the safety of calves in the control and experimental groups. Of the 10 calves of the experimental group, four fell ill. The first signs of a gastrointestinal disease were recorded on the 5-7th day of life, and in the control animals - on the 2nd-4th day. A severe degree of the disease was noted in 5 calves of the control group, in the experimental all animals were ill in a mild form.

Thus, a positive result obtained using the proposed method, appears in the form of reducing the complexity of the procedure for determining the bactericidal activity of blood serum, determined by the activity of beta-lysine.

2) Patient A with a diagnosis of pneumonia was admitted to the infectious ward of the city clinical hospital No. 1 of Orenburg on 2.06.11 at 17:00. To determine the bactericidal properties of blood serum, determined by the presence of beta-lysine in it, 10 ml of blood were taken. However, due to the considerable duration of determining the activity of beta-lysine by the photonephalometric method (18 hours), an express study of this parameter was carried out using the bioluminescent method.

In this study, 1 ml of blood serum was mixed with a similar volume of a suspension of bacterial cells and aliquots of 250 μl were taken at 0 and 0.5 hours of the mixture in cuvettes, 2 μl of decanal was added at a final concentration of 7 × 10 ^-6 M and the level was measured luminescence on a Biotoke-10M bioluminometer. In control samples, physiological saline was used instead of blood serum. The final calculation of the bactericidal properties of blood serum, determined by the presence of beta-lysine in it, is carried out according to the formula:

$$B\mathrm{FROM}\mathrm{FROM}{\mathrm{TO}}_{\left(BL\right)}=\mathrm{one\; hundred}-\frac{\left(I_{\mathrm{about}Pst}^{0.5}\times I_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^0\right)}{\left(I_{\mathrm{about}Pst}^0\times I_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^{0.5}\right)}\times \mathrm{one\; hundred}$$

- уровень биолюминесценции опытной пробы после 0 часов контакта;Where $$I_{\mathrm{about}Pst}^0$$

- the level of bioluminescence of the experimental sample after 0 hours of contact;

- уровень биолюминесценции опытной пробы после 0,5 часов контакта; $$I_{\mathrm{about}Pst}^{0.5}$$

- the level of bioluminescence of the experimental sample after 0.5 hours of contact;

- уровень биолюминесценции контрольной пробы после 0 часов контакта; $$I_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^0$$

- the level of bioluminescence of the control sample after 0 hours of contact;

- уровень биолюминесценции контрольной пробы после 0,5 часов контакта. $$I_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^{0.5}$$

- the level of bioluminescence of the control sample after 0.5 hours of contact.

The results of a study of the bactericidal properties of blood serum by the luminescent method showed that the activity of beta-lysine is 15% and is characterized as "low." In this regard, it was decided to transfuse 200 ml of plasma in order to increase the level of bactericidal properties of blood, which was carried out already an hour after the patient was admitted to the department. The results of the nephelometric analysis of beta-lysine activity obtained the next day confirmed the results obtained by bioluminometry (beta-lysine activity level of 13%).

Thus, a positive result obtained when using the proposed method, appears in the form of a reduction in the duration of the procedure for determining the bactericidal activity of blood serum, determined by the activity of beta-lysine, and reducing its complexity.

Claims (1)

A method for determining the bactericidal properties of blood serum, determined by the presence of beta-lysine (platelet cationic protein) in it, by studying its effect on the level of luminescence of the Bacillus subtilis strain VKPM B-10548 carrying a plasmid with PhotoBacterium leiognathi luxAB genes for 0.5 h at 1: 1 ratio compared to the control - the intensity of the glow of the same luminescent bacteria that had no contact with blood serum, after which the value of the bactericidal properties of blood serum, determined by the presence of beta-lysine in it, is calculated according to the forms ole
$$B\mathrm{FROM}\mathrm{FROM}{\mathrm{TO}}_{\left(BL\right)}=\mathrm{one\; hundred}-\frac{\left(I_{\mathrm{about}Pst}^{0.5}\cdot I_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^0\right)}{\left(I_{\mathrm{about}Pst}^0\cdot I_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^{0.5}\right)}\cdot \mathrm{one\; hundred,}$$

Where $$I_{\mathrm{about}Pst}^0$$

- the level of bioluminescence of the experimental sample after 0 hours of contact;
$$I_{\mathrm{about}Pst}^{0.5}$$

- the level of bioluminescence of the experimental sample after 0.5 hours of contact;
$$I_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^0$$

- the level of bioluminescence of the control sample after 0 hours of contact;
$$I_{\mathrm{to}\mathrm{about}ntR\mathrm{about}lb}^{0.5}$$

- the level of bioluminescence of the control sample after 0.5 hours of contact.