RU2489489C1 - Method to determine bactericide properties of blood serum - Google Patents
Method to determine bactericide properties of blood serum Download PDFInfo
- Publication number
- RU2489489C1 RU2489489C1 RU2011153339/10A RU2011153339A RU2489489C1 RU 2489489 C1 RU2489489 C1 RU 2489489C1 RU 2011153339/10 A RU2011153339/10 A RU 2011153339/10A RU 2011153339 A RU2011153339 A RU 2011153339A RU 2489489 C1 RU2489489 C1 RU 2489489C1
- Authority
- RU
- Russia
- Prior art keywords
- blood serum
- beta
- lysine
- level
- bioluminescence
- Prior art date
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Изобретение относится к области биомедицинских измерительных технологий, а именно к способам определения бактерицидных свойств сыворотки крови. Необходимость проведения подобных исследований закреплена в «Номенклатуре клинических лабораторных исследований, применяемых в целях диагностики болезней и слежения за состоянием пациентов в учреждениях здравоохранения Российской Федерации» (п.6.3.2 - Определение общих бактерицидных свойств сыворотки крови), утвержденной Приказом Министерства здравоохранения РФ №64 от 21.02.2000 г.The invention relates to the field of biomedical measuring technologies, and in particular to methods for determining the bactericidal properties of blood serum. The need for such studies is enshrined in the "Nomenclature of clinical laboratory studies used to diagnose diseases and monitor the condition of patients in healthcare facilities of the Russian Federation" (clause 6.3.2 - Determination of the general bactericidal properties of blood serum), approved by Order of the Ministry of Health of the Russian Federation No. 64 from 02.21.2000
В частности, изобретение предназначено для определения бактерицидных свойств сыворотки крови, связанных с присутствием в ней бета-лизина (тромбоцитарного катионного белка).In particular, the invention is intended to determine the bactericidal properties of blood serum associated with the presence of beta-lysine (platelet cationic protein) in it.
Таким образом, заявляемый способ предназначен для использования в лабораториях биологического, медицинского и ветеринарного профиля, решающих вопросы оценки системы естественного (врожденного) иммунитета человека и животных с целью выявления их возможных нарушений и контроля эффективности соответствующих коррекционных мероприятий.Thus, the inventive method is intended for use in laboratories of a biological, medical and veterinary profile, solving the issues of assessing the system of natural (innate) immunity of humans and animals in order to identify their possible violations and monitor the effectiveness of appropriate corrective measures.
Известные из уровня техники способы оценки бактерицидных начал сыворотки крови ориентированы на выявление двух основных систем, первоначально обозначенных Эмилем фон Берингом (Emil von Behring) как термолабильный «альфа-лизин» и термостабильный) «бета-лизин» (Бухарин О.В., Васильев Н.В. Система бета-лизина и ее роль в клинической и экспериментальной медицине. - Томск. Изд-во ТГУ. - 1977. - С.19). Позднее «альфа-лизин» был идентифицирован как система комплемента, активация которого ведет к эффективному лизису грамотрицательных микроорганизмов, а бета-лизин, проявляющий наибольшую активность в отношении грамположительных спорообразующих микроорганизмов, все чаще стал ассоциироваться с действием тромбоцитарного катионного белка (Бухарин О.В., Сулейманов К.Г. Свойства и функции тромбоцитарного катионного белка // Успехи современной биологии. - 1998. - N 2. - С.194-204).Known from the prior art, methods for assessing bactericidal principles of blood serum are focused on identifying two main systems, originally designated by Emil von Behring as thermolabile "alpha-lysine" and thermostable) "beta-lysine" (Bukharin OV, Vasiliev N.V. The beta-lysine system and its role in clinical and experimental medicine. - Tomsk. Publishing house of TSU. - 1977. - P.19). Later, alpha-lysine was identified as a complement system, the activation of which leads to the effective lysis of gram-negative microorganisms, and the beta-lysine, which is most active against gram-positive spore-forming microorganisms, has increasingly become associated with the action of platelet cationic protein (Bukharin O.V. , Suleymanov K.G. Properties and functions of platelet cationic protein // Successes in modern biology. - 1998. - N 2. - S.194-204).
По совокупности существенных признаков наиболее общим методическим подходом к определению активности системы комплемента и бета-лизина в экспериментальных и клинико-диагностических целях является проведение бактериологических исследований на специально отобранных бактериальных культурах, проявляющих высокую чувствительность к повреждающему действию названных факторов. При этом различия в строении поверхностных структур подобных грамотрицательных и грамположительных микроорганизмов позволяют относительно специфично оценивать каждую из исследуемых бактерицидных систем.Based on the set of essential features, the most common methodological approach to determining the activity of the complement system and beta-lysine for experimental and clinical diagnostic purposes is to conduct bacteriological studies on specially selected bacterial cultures that are highly sensitive to the damaging effect of these factors. Moreover, differences in the structure of the surface structures of such gram-negative and gram-positive microorganisms allow relatively specific assessment of each of the studied bactericidal systems.
В частности, целый ряд существующих методов определения комплемент-зависимой бактерицидности основаны на одном и том же принципе - воздействии сыворотки крови на популяцию жизнеспособных серочувствительных грамотрицательных микроорганизмов с последующей оценкой доли клонов, выживших после подобного контакта, по сравнению с контролем - теми же микроорганизмами, инкубированными вне контакта с сывороткой крови. При этом в качестве серочувствительных микроорганизмов обычно используются различные штаммы Escherichia coli: 0111 (Бухарин О.В., Созыкин В.Л. Фотонефелометрический метод определения бактерицидной активности сыворотки крови // Факторы естественного иммунитета. - Оренбург, 1979. - С.43-45), 675 (Красильников А.П., Титов Л.П. Определение бактерицидной активности сыворотки крови методом реплик // Лаб. дело. - 1981. - N 4. - С.245-247), что определяется особенностями строения их клеточной стенки, эффективно разрушаемой под действием комплекса сывороточных факторов.In particular, a number of existing methods for determining complement-dependent bactericidal activity are based on the same principle - the effect of blood serum on a population of viable serosensitive gram-negative microorganisms with the subsequent assessment of the proportion of clones that survived after such contact, compared to the control - by the same microorganisms incubated out of contact with blood serum. Moreover, various strains of Escherichia coli are usually used as sulfur-sensitive microorganisms: 0111 (Bukharin O.V., Sozykin V.L. Photonephelometric method for determining the bactericidal activity of blood serum // Natural immunity factors. - Orenburg, 1979. - P.43-45 ), 675 (Krasilnikov A.P., Titov L.P. Determination of the bactericidal activity of blood serum by the replica method // Lab. Business. - 1981. - N 4. - P.245-247), which is determined by the structural features of their cell wall effectively destroyed by a complex of serum factors.
В свою очередь для оценки бета-лизин-зависимой бактерицидности сыворотки крови традиционно используются штаммы Bacillus subtilis, в силу особенностей организации своих характерных для грамположительных микроорганизмов поверхностных структур, проявляющих преимущественную чувствительность к данной группе веществ с одновременной относительной устойчивостью к литическому действию прочих гуморальных бактерицидных факторов (Саруханов В.Я., Исамов Н.Н., Царин П.Г. Метод определения бета-литической активности крови сельскохозяйственных животных // Сельскохозяйственная биология. - 2007. - N4. - С.123-125).In turn, to assess the beta-lysine-dependent bactericidal activity of blood serum, Bacillus subtilis strains are traditionally used, due to the peculiarities of organizing their surface structures characteristic of gram-positive microorganisms, which are predominantly sensitive to this group of substances with simultaneous relative resistance to the lytic effect of other humoral bactericidal factors ( Sarukhanov V.Ya., Isamov NN, Tsarin P.G. Method for determination of beta-lytic activity of blood of farm animals // Agricultural biology. - 2007. - N4. - P.123-125).
Вычисление значений бактерицидности в обоих случаях производится на основании сходных и имеющих одинаковый биологический смысл формул, оценивающих соотношение микроорганизмов, выросших в опыте и контроле, и выражающих итоговые значения в процентах достигнутого бактерицидного эффекта.The calculation of bactericidal values in both cases is carried out on the basis of similar and identical biological sense formulas that evaluate the ratio of microorganisms grown in experiment and control and express the final values as a percentage of the bactericidal effect achieved.
Однако несмотря на многочисленные попытки уменьшения трудоемкости подобных методов снижения расхода питательных сред (Евтушенко А.Д., Тимохина Т.Х., Аргунова Г.А. Модифицированный способ бактериологического определения бактерицидной активности сыворотки крови // Лаб. дело. - 1982. - N 12. - С.41-42; Слоним А.А., Толчеев Ю.Д. Определение бактерицидной активности сыворотки крови и лимфы // Лаб. дело. - 1989. - N 7. - С.65-66) говорить об их использовании в настоящее время можно только в историческом аспекте. Сказанное определяется несоответствием требованиям, предъявляемым к медико-биологическим технологиям XXI века и оговоренным в «Концепции развития службы клинической лабораторной диагностики Российской Федерации».However, despite numerous attempts to reduce the complexity of such methods of reducing the flow of nutrient media (Evtushenko A.D., Timokhina T.Kh., Argunova G.A. A modified method of bacteriological determination of bactericidal activity of blood serum // Lab. Business. - 1982. - N 12. - P.41-42; Slonim A.A., Tolcheev Yu.D. Determination of the bactericidal activity of blood serum and lymph // Lab. Business. - 1989. - N 7. - P.65-66) talk about them use at present is possible only in the historical aspect. The aforesaid is determined by the discrepancy with the requirements for biomedical technologies of the 21st century and stipulated in the "Concept for the development of the clinical laboratory diagnostics service of the Russian Federation."
Одна их перспектив совершенствования способов оценки бактерицидных систем естественного иммунитета связана с использованием в качестве объектов воздействия люминесцирующих микроорганизмов, изменение (подавление) свечения которых является следствием их разрушения с пространственной дезорганизацией ферментных систем, в результате чего остаточная интенсивность биолюминесценции оказывается пропорциональной числу сохранивших свою жизнеспособность бактериальных клеток-мишеней.One of the prospects for improving methods for assessing the bactericidal systems of natural immunity is associated with the use of luminescent microorganisms as objects of influence, the change (suppression) of the glow of which is a consequence of their destruction with spatial disorganization of the enzyme systems, as a result of which the residual bioluminescence intensity is proportional to the number of bacterial cells that have retained their viability targets.
Впервые возможность оценки активности гуморальных и клеточных бактерицидных систем по их влиянию на уровень светимости люминесцирующих бактерий была продемонстрирована еще в 80-х годах XX века (Barak M., Ulitzur S., Merzbach D. Determination of serum bactericidal activity with the aid of luminous bacteria // J.Clin.Microbiol. - 1983. - Vol.18. - N 2. - P.248-253). При этом в качестве тестерного штамма для проведения подобных исследований использован природный изолят Vibrio cholerae biovar albensis, демонстрирующий высокую чувствительность к повреждающему действию молекулярных и клеточных систем, присутствующих в крови человека и животных. Однако, принадлежность данного микроорганизма к патогенному виду с соответствующим несоответствием требованиям биологической безопасности явилась существенным ограничением для широкого распространения предложенной биолюминесцентной технологии.The ability to evaluate the activity of humoral and cellular bactericidal systems by their influence on the luminosity of luminescent bacteria was first demonstrated as far back as the 80s of the 20th century (Barak M., Ulitzur S., Merzbach D. Determination of serum bactericidal activity with the aid of luminous bacteria // J. Clin. Microbiol. - 1983. - Vol. 18. - N 2. - P.248-253). At the same time, the natural isolate Vibrio cholerae biovar albensis was used as a test strain for such studies, demonstrating high sensitivity to the damaging effects of molecular and cellular systems present in the blood of humans and animals. However, the belonging of this microorganism to a pathogenic species with corresponding non-compliance with the requirements of biological safety was a significant limitation for the wide dissemination of the proposed bioluminescent technology.
Найденное решение этого вопроса заключалось в клонировании генов биолюминесценции (lux-генов) в непатогенных лабораторных микроорганизмах, исходно проявляющих высокую чувствительность к бактерицидным факторам сыворотки крови. В частности, использование рекомбинантного люминесцирующего штамма Escherichia coli K12 TG1 с клонированными luxCDABE-тенами природного морского микроорганизма Photobacterium leiognathi было положено в основу способа оценки бактерицидной активности сыворотки крови, значимыми преимуществами которого стали сокращение длительности исследования, общее снижение трудоемкости с одновременным формированием возможности анализа большого количества проб (Патент РФ №2247987. Способ определения бактерицидной активности сыворотки крови. Опубл. 10.03.2005, Бюл. №7).The found solution to this problem was the cloning of bioluminescence genes (lux genes) in non-pathogenic laboratory microorganisms that initially showed high sensitivity to bactericidal factors of blood serum. In particular, the use of the recombinant luminescent strain of Escherichia coli K12 TG1 with cloned luxCDABE tenes of the natural marine microorganism Photobacterium leiognathi was the basis for a method for evaluating the bactericidal activity of blood serum, whose significant advantages were a reduction in the duration of the study, an overall reduction in the complexity of the study, while simultaneously creating the possibility of analyzing large quantities samples (RF Patent No. 2247987. A method for determining the bactericidal activity of blood serum. Publ. 10.03.2005, Bull. No. 7).
Подтверждением актуальности подобного подхода также является опыт аналогичного использования рекомбинантного люминесцирующего штамма Klebsiella pneumoniae Xen39, конститутивно экспрессирующий полную кассету luxCDABE-генов природного почвенного микроорганизма Photorhabdus luminescence (Nypaver C.M., Thornton M.M., Yin S.M., Bracho D.O., Nelson P.W., Jones A.E., Bortz D.M., Younger J.G. Dynamics of human complement-mediated killing of Klebsiella pneumoniae // Am. J. Respir. Cell. Mol. Biol. - 2010. - Vol.43. - N 5. - P.585-590). В свою очередь принадлежность данного штамма к числу грамотрицательных микроорганизмов, как и в случае Escherichia coli, также обусловила его наибольшую чувствительность к комплемент-зависимой бактерицидной системе сыворотки крови.Confirmation of the relevance of this approach is also the experience of the similar use of the recombinant luminescent strain Klebsiella pneumoniae Xen39, constitutively expressing a complete cassette of luxCDABE genes of the natural soil microorganism Photorhabdus luminescence (Nypaver CM, Thornton MM, Yin SM, Bracho DO, Nelson Pz J, J Nelson PW J, Nelson PW Younger JG Dynamics of human complement-mediated killing of Klebsiella pneumoniae // Am. J. Respir. Cell. Mol. Biol. - 2010. - Vol. 43. - N 5. - P.585-590). In turn, the belonging of this strain to the number of gram-negative microorganisms, as in the case of Escherichia coli, also determined its greatest sensitivity to the complement-dependent bactericidal system of blood serum.
На этом фоне нерешенной является задача оценки бета-лизин-зависимой бактерицидности, формирующей вторую важнейшую антимикробную систему сыворотки крови человека и животных. При этом попытки ее решения с использованием описанных выше лабораторных люминесцирующих штаммов, как и еще одной генно-инженерной конструкции Pseudomonas aeruginosa H1001 (fliC:luxCDABE}, ранее использованной для оценки артифициалыю синтезированных катионных антимикробных пептидов (Hilpert К., Hancock R.E. Use of luminescent bacteria for rapid screening and characterization of short cationic antimicrobial peptides synthesized on cellulose using peptide array technology // Nature Protocols. - 2007. - Vol.2. - P.1652-1660), не могут быть признаны адекватными в связи с возможностью их реагирования на широкий спектр присутствующих в биологических жидкостях сложного компонентного состава бактерицидных факторов и, в первую очередь, систему комплемента.Against this background, the unsolved task is to evaluate beta-lysine-dependent bactericidal activity, which forms the second most important antimicrobial system of human and animal blood serum. At the same time, attempts to solve it using the laboratory luminescent strains described above, as well as another genetic engineering construct Pseudomonas aeruginosa H1001 (fliC: luxCDABE}, previously used to evaluate the artificiality of synthesized cationic antimicrobial peptides (K. Hilpert, Hancock RE Use of luminescent bacteria for rapid screening and characterization of short cationic antimicrobial peptides synthesized on cellulose using peptide array technology // Nature Protocols. - 2007. - Vol.2. - P.1652-1660), cannot be considered adequate due to the possibility of their response to a wide range of complex fluids present in biological fluids about the component composition of bactericidal factors and, first of all, the complement system.
Значительно более специфичный отклик следует ожидать при использовании представителей рода Bacillus, традиционно используемых для исследования бета-литической активности крови человека и животных (Бухарин О.В., Васильев Н.В. Система бета-лизина и ее роль в клинической и экспериментальной медицине. - Томск. Изд-во ТГУ. - 1977. - С.20; Саруханов В.Я., Исамов Н.Н., Царим П.Г. Метод определения бета-литической активности крови сельскохозяйственных животных // Сельскохозяйственная биология. - 2007. - N 4. - С.123-125).A significantly more specific response should be expected when using representatives of the genus Bacillus, traditionally used to study the beta-lytic activity of human and animal blood (Bukharin O.V., Vasiliev N.V. Beta-lysine system and its role in clinical and experimental medicine. - Tomsk, TSU Publishing House. - 1977. - P.20; Sarukhanov V.Ya., Isamov NN, Tsarim PG Method for determination of beta-lytic activity of blood of farm animals // Agricultural Biology. - 2007. - N 4. - S.123-125).
Известный опыт подобной оценки бактерицидных свойств сыворотки крови связан с использованием рекомбинантных люминесцирующих штаммов Bacillus subtilis BR151, также как и Escherichia coli JM109, несущих плазмиду pCSS962 с клонированными в ней генами люциферазы насекомого Pyrophorus plagiophthalamus (Virta M., Karp M., Runnemaa S., Lilius E.-M. Kinetic measurement of the membranolytic activity of serum complement using bioluminescent bacteria // J. Immunol. Meth. - 1997. - Vol.201. - N 2. - P.215-221; Virta M., Lineri S., Kankaanpaa P. at al. Determination of complement-mediated killing of bacteria by viability staining and bioluminescence // Appl. Environ. Microbiol. - 1998. - Vol.64. - N 2. - P.515-519). Однако, природа зафиксированной с их использованием бактерицидности однозначно связывалась авторами с активностью комплемента, хотя какой-либо параллельной оценки данной системы проведено не было. Кроме того, в цитируемых работах дана сравнительная реакция штаммов В.subtilis BR151 и E.coli JM109 лишь на пул сывороток от пяти доноров, что делало невозможным выявление особенностей люминесцентного отклика каждого из них на отдельные присутствующие в данной биологической жидкости бактерицидные системы. Дополнительной технологической сложностью при использовании данных штаммов также являлась необходимость дополнительного внесения субстрата для светлячковой люциферазы (D-люциферина), при значениях pH=7,0 слабо диффундирующего через цитоплазматическую мембрану.The known experience of such an assessment of the bactericidal properties of blood serum is associated with the use of recombinant luminescent strains of Bacillus subtilis BR151, as well as Escherichia coli JM109, carrying the plasmid pCSS962 with the cloned luciferase genes of the insect Pyrophorus plagiophthalamus (Virta M., Karp M. Run, Runa Lilius E.-M. Kinetic measurement of the membranolytic activity of serum complement using bioluminescent bacteria // J. Immunol. Meth. - 1997 .-- Vol. 201 - N 2. - P.215-221; Virta M., Lineri S., Kankaanpaa P. at al. Determination of complement-mediated killing of bacteria by viability staining and bioluminescence // Appl. Environ. Microbiol. - 1998. - Vol. 64. - N 2. - P.515-519). However, the nature of bactericidal activity recorded with their use was unambiguously associated by the authors with complement activity, although no parallel assessment of this system was carried out. In addition, in the cited works, a comparative reaction of strains of B. subtilis BR151 and E. coli JM109 only to a pool of sera from five donors was given, which made it impossible to identify the characteristics of the luminescent response of each of them to individual bactericidal systems present in this biological fluid. An additional technological complexity when using these strains was also the need for additional substrate for firefly luciferase (D-luciferin), at pH = 7.0, weakly diffusing through the cytoplasmic membrane.
В целом анализ научной и научно-технической литературы позволяет констатировать, что по совокупности признаков наиболее близким к заявляемому, и в этой связи характеризуемым как способ-прототип, является нефелометрический метод оценки бета-лизина (Бухарин О.В., Васильев Н.В. Система бета-лизина и ее роль в клинической и экспериментальной медицине. - Томск. Изд-во ТГУ. - 1977. - С.52-53), основанный на изменении оптической плотности мясо-пептонного бульона при росте в нем штамма Bacillus subtilis 83 (ГКИ им. Тарасовича) с добавлением и без добавления испытуемой сыворотки. Соответственно, степень задержки роста штамма Bacillus subtilis 83 при контакте с сывороткой крови после 18 часов инкубации при 37°C по сравнению с контролем позволяет осуществить расчет активности бета-лизина по формуле:In general, an analysis of the scientific and scientific-technical literature allows us to state that the nephelometric method for evaluating beta-lysine (Bukharin O.V., Vasiliev N.V., according to the set of features closest to the claimed and, therefore, characterized as a prototype method) The beta-lysine system and its role in clinical and experimental medicine - Tomsk, TSU Publishing House - 1977. - P. 52-53), based on a change in the optical density of meat-peptone broth with the growth of the Bacillus subtilis 83 strain in it ( GKI named after Tarasovich) with and without testing th serum. Accordingly, the degree of growth retardation of the strain of Bacillus subtilis 83 upon contact with blood serum after 18 hours of incubation at 37 ° C compared with the control allows the calculation of beta-lysine activity by the formula:
где
Основной причиной, препятствующей получению требуемого результата при использовании способа-прототипа, является существенная длительность этапа подращивания (18 часов), лимитируемая скоростью роста индикаторного микроорганизма после контакта с сывороткой крови до значений оптической плотности, доступных для фотонефелометрической регистрации.The main reason that prevents obtaining the desired result when using the prototype method is the significant duration of the growing stage (18 hours), limited by the growth rate of the indicator microorganism after contact with blood serum to the optical density values available for photonephalometric registration.
Таким образом, основной причиной, препятствующей получению требуемого результата, является отсутствие лабораторного люминесцирующего штамма Bacillus, для которого продемонстрирована избирательная чувствительность к бактерицидному действию сыворотки крови, определяемому присутствием в ней системы бета-лизина (тромбоцитарного катионного белка).Thus, the main reason that impedes the desired result is the lack of a laboratory luminescent Bacillus strain, for which selective sensitivity to the bactericidal action of blood serum, which is determined by the presence of the beta-lysine system (platelet cationic protein), has been demonstrated.
Альтернативные подходы, ведущие к устранению данного недостатка, в доступной заявителям литературе не описаны.Alternative approaches leading to the elimination of this drawback are not described in the literature available to applicants.
Сказанное позволяет утверждать, что заявляемый способ не известен из уровня техники, т.е. является новым.The foregoing allows us to state that the claimed method is not known from the prior art, i.e. is new.
Основной задачей, на решение которой направлен заявляемый способ, является экспрессное определение бактерицидных свойств сыворотки крови, определяемой присутствием в ней бета-лизина (тромбоцитарного катионного белка). Дополнительной задачей, решаемой при осуществлении заявляемого способа, является снижение трудоемкости и повышение технологичности его выполнения данного лабораторного исследования.The main task to be solved by the claimed method is directed is the rapid determination of the bactericidal properties of blood serum, determined by the presence of beta-lysine (platelet cationic protein) in it. An additional problem to be solved when implementing the proposed method is to reduce the complexity and increase the manufacturability of its implementation of this laboratory study.
Сущностью заявляемого способа, сформулированной на уровне функционального обобщения и лежащей в его основе, является следующее: при воздействии сыворотки крови человека или животных выраженность подавления свечения лабораторного штамма Bacillus subtilis ВКПМ В-10548, эффективно экспрессирующего luxAB-гены грамотрицательного морского микроорганизма Photobacterium leiognathi, пропорциональна уровню развивающегося в отношении него бактерицидного эффекта, определяемого присутствием бета-лизина (тромбоцитарного катионного белка).The essence of the proposed method, formulated at the level of functional generalization and underlying it, is the following: when exposed to human or animal blood serum, the severity of suppression of the luminescence of the laboratory strain of Bacillus subtilis VKPM B-10548, which efficiently expresses luxAB genes of the gram-negative marine microorganism Photobacterium leiognathi, is proportional to the level developing bactericidal effect against it, determined by the presence of beta-lysine (platelet cationic protein).
Соответственно, при реализации заявляемого способа определения бактерицидных свойств сыворотки крови, характеристика действий, порядок их выполнения и условия осуществления в сравнении со способом-прототипом представляются следующим образом.Accordingly, when implementing the proposed method for determining the bactericidal properties of blood serum, the characteristics of the actions, the order of their implementation and the conditions for implementation in comparison with the prototype method are as follows.
На первом (подготовительном) этапе выращивают штамм Bacillus subtilis ВКПМ В-10548 на LB-агаре в присутствии канамицина (селективного фактора для клонированной плазмиды pLF14ABlei с luxAB генами и генами устойчивости к канамицину) в конечной концентрации 40 мкг/мл при 37°C в течение 24 часов. Полученную биомассу смывают стерильным LB-бульоном, после чего полученную суспензию стандартизуют до оптической плотности 1,2 отн. ед. при 540 им, измеренных в кюветах с длиной оптического пути 1 см.At the first (preparatory) stage, the Bacillus subtilis VKPM B-10548 strain is grown on LB agar in the presence of kanamycin (a selective factor for the cloned plasmid pLF14ABlei with luxAB genes and kanamycin resistance genes) at a final concentration of 40 μg / ml at 37 ° C for 24 hours. The resulting biomass is washed off with sterile LB broth, after which the resulting suspension is standardized to an optical density of 1.2 rel. units at 540 im measured in cuvettes with an optical path length of 1 cm.
Особенностями этапа, отличающими его от такового по способу-прототипу, являются: 1) использование в качестве тест-объекта люминесцирующего штамма Bacillus subtilis ВКПМ В-10548 с клонированными luxAB-генами грамотрицательного морского микроорганизма Photobacterium leiognathi для которого показана количественная зависимость снижения уровня биолюминесценции от выраженности бактерицидного эффекта (см. ниже); 2) выращивание штамма Bacillus subtilis ВКПМ В-10548 на питательной среде, содержащей селективный маркер (канамицин, 40 мкг/мл), что позволяет исключить рост не люминесцирующих штаммов.The features of the stage that distinguish it from that of the prototype method are: 1) using a luminescent strain of Bacillus subtilis VKPM B-10548 as a test object with the cloned luxAB genes of the gram-negative marine microorganism Photobacterium leiognathi for which a quantitative dependence of the decrease in the level of bioluminescence on the severity is shown bactericidal effect (see below); 2) growing a strain of Bacillus subtilis VKPM B-10548 on a nutrient medium containing a selective marker (kanamycin, 40 μg / ml), which allows to exclude the growth of non-luminescent strains.
На втором (основном) этапе смешивают суспензию бактериальных клеток и исследуемого образца сыворотки крови в соотношении 1:1, инкубируют при 37°C в течение 0,5 часа. На 0 и 0,5 часах существования реакционной смеси производят отбор аликвот по 250 мкл в кюветы для биолюминометра, дополнительно вносят в них по 2 мкл деканаля в конечной концентрации 7×10-6 М.At the second (main) stage, the suspension of bacterial cells and the test sample of blood serum is mixed in a ratio of 1: 1, incubated at 37 ° C for 0.5 hours. At 0 and 0.5 hours of the existence of the reaction mixture, aliquots of 250 μl are collected in bioluminometer cuvettes, and 2 μl of decanal is added to them in a final concentration of 7 × 10 -6 M.
Особенностями данного этапа, отличающего его от способа-прототипа, являются: 1) создание соотношения 1:1 в реакционной смеси бактерии: сыворотка крови; 2) контакт бактериальных клеток с исследуемыми образцами сыворотки крови в течение 0,5 часа, что значительно сокращает время проведения анализа; 3) свечение тест-штамма в присутствии экзогенного субстрата (деканаля), окисляемого в присутствии молекулярного кислорода ферментом люциферазой, синтез которой обеспечивается экспрессией клонированных luxAB-генов грамотрицательного морского микроорганизма Photobacterium leiognathiThe features of this stage that distinguishes it from the prototype method are: 1) creating a 1: 1 ratio in the reaction mixture of bacteria: blood serum; 2) contact of bacterial cells with test samples of blood serum within 0.5 hours, which significantly reduces the analysis time; 3) the glow of the test strain in the presence of an exogenous substrate (decanal), oxidized in the presence of molecular oxygen by the enzyme luciferase, the synthesis of which is provided by the expression of the cloned luxAB genes of the gram-negative marine microorganism Photobacterium leiognathi
На завершающем этапе осуществляют регистрацию уровня свечения в пробах в видимой сине-зеленой области спектра (420-600 им). В качестве измерительного прибора при реализации заявляемого способа могут использоваться биохемилюминометр Биотоке-10М, а также прочие отечественные и зарубежные люминометры, работающие в обозначенной области спектра и обеспечивающие соответствующую чувствительность измерений.At the final stage, the level of luminescence in the samples is recorded in the visible blue-green region of the spectrum (420-600 im). As a measuring device when implementing the proposed method, a Biotoke-10M biochemiluminometer, as well as other domestic and foreign luminometers working in the indicated region of the spectrum and providing the corresponding measurement sensitivity, can be used.
Итоговый расчет бактерицидных свойств сыворотки крови, определяемых присутствием в ней бета-лизина, проводят по формуле:The final calculation of the bactericidal properties of blood serum, determined by the presence of beta-lysine in it, is carried out according to the formula:
где
Основным отличием данного этапа от такового в способе-прототипе является использование люминометров, обеспечивающих детекцию уровня свечения в анализируемых пробах.The main difference between this stage and that in the prototype method is the use of luminometers that detect the level of luminescence in the analyzed samples.
Возможность получения технического результата при выполнении перечисленных действий в указанных интервалах значений определяется следующим комплексом причинно-следственных связей:The ability to obtain a technical result when performing the above actions in the indicated ranges of values is determined by the following complex of cause-effect relationships:
1) использование для заявленных целей именно Bacillus subtilis ВКПМ В-10548, во-первых, определяется тем, что, в отличие от известных рекомбинантных люминесцирующих штаммов рода Bacillus он характеризуется высоким уровнем экспрессии (транскрипции и трансляции) luxAB-генов бактериальной люциферазы.1) the use of Bacillus subtilis VKPM B-10548 for the stated purposes, firstly, is determined by the fact that, in contrast to the known recombinant luminescent strains of the genus Bacillus, it is characterized by a high level of expression (transcription and translation) of luxAB bacterial luciferase genes.
Для достижения этого фрагменты ДИК, содержащие гены luxA и luxB, кодирующие альфа- и бета-субъединицы люциферазы Photobacterium leiognathi - ключевого фермента бактериальной биолюминесценции, были амплифицированы с использованием праймеров:To achieve this, DIC fragments containing the luxA and luxB genes encoding the alpha and beta subunits of Photobacterium leiognathi luciferase, a key bacterial bioluminescence enzyme, were amplified using primers:
luxAluxA
LuxADir5' -LuxADir5 '-
GCGTCTCAGATCGGAAGGTGGAAGAAATAATGAAAATTAGTAATATC - 3'G CGTCTC AGATCG GAAGGTGG AAGAAATAATGAAAATTAGTAATATC - 3 '
LuxARev 5' - GCGTCTCGACGTCATAGTTTAAAAAGAACAGCTTACTGAGG - 3'LuxARev 5 '- G CGTCTC GACGTCATAGTTTAAAAAGAACAGCTTACTGAGG - 3'
luxBluxB
LuxBDir5'-LuxBDir5'-
GCGTCTCGACGTCGAAGGTGGAATAAAATATGAATTTCGGGTTATTTTTC - 3'G CGTCTC GACGTC GAAGGTGG AATAAAATATGAATTTCGGGTTATTTTTC - 3 '
LuxBRev 5' - GCGTCTCCAATTGCCGTAATTAAATTATTTAATAAGGTTATC - 3'LuxBRev 5 '- G CGTCTC CAATTGCCGTAATTAAATTATTTAATAAGGTTATC - 3'
важной особенностью которых являлось присутствие рибосом-связывающего сайта грамположительных бактерий (подчеркнут). Кроме того, к 5' концам всех праймеров была добавлена последовательность сайта эндонуклеазы рестрикции BsmBI (помечена жирным шрифтом), обеспечивающая возможность последующего лигирования продуктов амплификации.an important feature of which was the presence of a ribosome-binding site of gram-positive bacteria (underlined). In addition, the sequence of the BsmBI restriction endonuclease site (marked in bold) was added to the 5 'ends of all primers, allowing subsequent ligation of amplification products.
Очищенные при помощи элюции из геля фрагменты ДНК были рестрицированы и лигированы, после чего из полученной лигазной смеси амплифицированы фрагменты ДНК, содержащие искомые гены в последовательности luxAB. В свою очередь клонирование полученных ПЦР-продуктов в Т-векторе на основе рлазмиды pTZ57R (Fermentas, Литва) привело к созданию первичной плазмиды pTZ ABlei, трансформация которой штамма E.coli MC1061 сообщала последнему способность к выраженной биолюминесценции при добавлении субстрата данной реакции - длинноцепочечного альдегида n-деканаля.DNA fragments purified by gel elution were restricted and ligated, after which DNA fragments containing the desired genes in the luxAB sequence were amplified from the obtained ligase mixture. In turn, the cloning of the obtained PCR products in a T-vector based on the plasmid pTZ57R (Fermentas, Lithuania) led to the creation of the primary plasmid pTZ ABlei, the transformation of which strain E. coli MC1061 gave the latter the ability to pronounced bioluminescence by adding a substrate of this reaction, a long-chain aldehyde n-decanal.
С целью интеграции luxAB-геноъ в клетки В. subtilis они по сайгам PstI и EcoRI были переклонированы из pTZ ABlei в челночный вектор pLF14. В свою очередь перенос сформированной гибридной плазмиды pLF14ABlei в клетки В. subtilis 168 с последующим высевом бактериальной биомассы на LB-агар с 25 мкг/мл канамицина позволил получить рекомбинантный штамм В. subtilis DO 0002 pLF14ABlei с высоким уровнем трансляции конститутивно транскрибируемых luxAB-генов, интенсивность свечения которого при добавлении деканаля в концентрации 7×10-6 М не менее чем в 10 раз превышала таковую у известного штамма В.subtilis ВКПМ В-10191 с немодифицированными luxAB-генами V. fischeri (Каримов И.О., Манухов И.В., Котова В.Ю., Омельченко Д.О., Дерябин Д.Г. Особенности люминесцентного отклика рекомбинантного штамма Bacillus subtilis с клонированными luxAB-генами Vibrio fisheri при воздействии термостабильиых компонентов сыворотки крови /// Биотехнология. - 2010. - №2 - С.25-30).In order to integrate the luxAB gene into B. subtilis cells, they were cloned from the pTZ ABlei to the shuttle vector pLF14 in the saigas PstI and EcoRI. In turn, the transfer of the formed hybrid plasmid pLF14ABlei to B. subtilis 168 cells followed by bacterial biomass plating on LB agar with 25 μg / ml kanamycin made it possible to obtain a recombinant strain of B. subtilis DO 0002 pLF14ABlei with a high level of translation of constitutively transcribed luxAB genes, whose luminescence when adding decanal at a concentration of 7 × 10 -6 M was no less than 10 times higher than that of the well-known B. subtilis strain VKPM B-10191 with unmodified luxAB genes V. fischeri (Karimov I.O., Manukhov I.V. ., Kotova V.Yu., Omelchenko D.O., Deryabin D .G. Features of the luminescent response of the recombinant strain of Bacillus subtilis with cloned VIBrio fisheri luxAB genes when exposed to thermostable components of blood serum /// Biotechnology. - 2010. - No. 2 - C.25-30).
Полученный штамм депонирован во Всероссийской коллекции промышленных микроорганизмов (ГосНИИгенетика, Москва) под № В-10548.The resulting strain was deposited in the All-Russian collection of industrial microorganisms (GosNIIgenetika, Moscow) under the number B-10548.
2) Важным обоснованием использования для заявленных целей Bacillus subtilis ВКПМ В-10548 является выявленная в эксперименте прямая достоверная (Р<0,05) корреляция между подавлением интенсивности его биолюминесценции при воздействии сыворотки крови и выраженностью развивающегося в данных условиях бактерицидного эффекта, зафиксированного с использованием классических бактериологических техник.2) An important justification for the use of Bacillus subtilis VKPM B-10548 for the stated purposes is the experimentally identified direct reliable (P <0.05) correlation between the suppression of the intensity of its bioluminescence when exposed to blood serum and the severity of the bactericidal effect developing under these conditions, recorded using classical bacteriological techniques.
Сказанное является ключевым условием использования показателя интенсивности биолюминесценции Bacillus subtilis ВКПМ В-10548 для тестирования бактерицидных свойств сыворотки крови.The above is a key condition for using the Bacillus subtilis VKPM B-10548 bioluminescence intensity indicator for testing the bactericidal properties of blood serum.
3) Другим обоснованием использования для заявленных целей для заявленных целей Bacillus subtilis ВКПМ В-10548 является выявленная в эксперименте избирательная чувствительность данного штамма к бета-лизину (тромбоцитарному катионному белку) в отсутствие таковой к иным присутствующим в сыворотке крови бактерицидным факторам.3) Another justification for using Bacillus subtilis VKPM B-10548 for the stated purposes for the stated purposes is the experimentally detected selective sensitivity of this strain to beta-lysine (platelet cationic protein) in the absence of it to other bactericidal factors present in the blood serum.
Так, сравнение люминесцентного отклика данного штамма с таковым у Escherichia coli с генами люминесцентной системы Photobacterium leiognathi, использование которого для определения бактерицидной активности сыворотки крови закреплено патентом РФ на изобретение №2247987 [9], при общей сонаправленности эффектов исследуемых сывороток крови свидетельствовало о том, что значения подавления биолюминесценции двух сравниваемых микроорганизмов являлись корреляционно независимыми (Р>0,05). В свою очередь сопоставление полученных значений с компонентным составом воздействующих сывороток крови, предварительно оцененным с использованием представительного ряда иммунохимических методов, позволило установить причины подобного различного реагирования использованных рекомбинантных люминесцирующих микроорганизмов.Thus, a comparison of the luminescent response of this strain with that of Escherichia coli with the genes of the luminescent system Photobacterium leiognathi, the use of which is determined by the RF patent for invention No. 2247987 [9] for determining the bactericidal activity of blood serum, with the general co-directionality of the effects of the studied blood serum testified that the bioluminescence suppression values of the two compared microorganisms were correlation independent (P> 0.05). In turn, a comparison of the obtained values with the component composition of the acting blood serums, previously evaluated using a representative series of immunochemical methods, made it possible to establish the reasons for this different reaction of the used recombinant luminescent microorganisms.
В частности, интенсивность подавления свечения Bacillus subtilis ВКПМ В-10548 достоверно коррелировала только с количественным присутствием в исследуемых сыворотках бета-лизина (r=-0,481; Р<0,01).In particular, the intensity of suppression of luminescence of Bacillus subtilis VKPM B-10548 significantly correlated only with the quantitative presence of beta-lysine in the test sera (r = -0.481; P <0.01).
В свою очередь для сравниваемого штамма Escherichia coli с генами люминесцентной системы Photobacterium leiognathi наиболее значимые коэффициенты корреляции были зафиксированы между остаточной биолюминесценцией и характеризуемой значениями СН50 общей активностью комплемента (r=-0,427; Р<0,01), а также активностью бактериологического фермента лизоцима (r=-0,395; Р<0,01). При этом существование подобной зависимости могло определяться как собственной биологической активностью лизоцима, вовлекаемого в процесс разрушения бактериальных клеток после формирования мембраноповреждающих комплексов из «поздних» белков системы комплемента, так и особенностями исследуемой выборки сывороток крови, в которых присутствие данного фактора положительно коррелировало с активностью названной системы (r=0,308; Р<0,05) и количественным содержанием входящих в нее С3- и С5-компонентов (r=0,309 и r=0,295; Р<0,05). Наконец сами названные компоненты, а также вовлекаемый в альтернативный путь активации системы комплемента фактор Н, также объединялись между собой положительными корреляционными связями (r=0,339; Р<0,05 и r=0,516; Р<0,01), формируя единую «корреляционную плеяду», значимую для развития бактерицидного эффекта сыворотки крови в отношении Escherichia coli.In turn, for being compared with a strain of Escherichia coli genes fluorescent Photobacterium leiognathi system most significant correlation coefficients have been fixed between the residual bioluminescence and characterized by values 50 CH total complement activity (r = -0,427; P <0.01), and the activity of the enzyme lysozyme Bacteriological (r = -0.395; P <0.01). Moreover, the existence of such a dependence could be determined both by the biological activity of lysozyme involved in the destruction of bacterial cells after the formation of membrane-damaging complexes from the “late” proteins of the complement system, and by the characteristics of the studied sample of blood serums in which the presence of this factor positively correlated with the activity of the system (r = 0.308; P <0.05) and the quantitative content of the C3 and C5 components included in it (r = 0.309 and r = 0.295; P <0.05). Finally, the aforementioned components themselves, as well as the factor H involved in the alternative pathway of activation of the complement system, were also combined with positive correlation bonds (r = 0.339; P <0.05 and r = 0.516; P <0.01), forming a single “correlation Pleiad ", significant for the development of the bactericidal effect of serum against Escherichia coli.
Таким образом, сказанное позволяет утверждать, что клонирование одних и тех же генов биолюминесценции Photobacterium leiognathi в клетках Bacillus subtilis и Escherichia coli ведет к созданию двух различных сенсорных систем, селективная чувствительность которых к присутствующим в сыворотке крови бактерицидным факторам предположительно определяется особенностями организации поверхностных структур клеток-реципиентов. Тем самым выявленный комплекс причинно-следственных связей является ключевым условием использования показателя интенсивности биолюминесценции Bacillus subtilis ВКПМ В-10548 для тестирования бактерицидных свойств сыворотки крови, определяемых именно присутствием в ней бета-лизина (тромбоцитарного катионного белка).Thus, the foregoing allows us to state that the cloning of the same Photobacterium leiognathi bioluminescence genes in Bacillus subtilis and Escherichia coli cells leads to the creation of two different sensory systems, the selective sensitivity of which to bactericidal factors present in blood serum is presumably determined by the features of the organization of cell surface structures - recipients. Thus, the identified causal relationship complex is a key condition for using the Bacillus subtilis VKPM B-10548 bioluminescence intensity indicator to test the bactericidal properties of blood serum, which are determined precisely by the presence of beta-lysine (platelet cationic protein) in it.
4) Использование бактериальной суспензии с оптической плотностью 1,2 отн. ед. определяется необходимостью достижения уровня свечения пробы, которое возможно зафиксировать с помощью аппаратных средств регистрации люминесценции. При этом использование субстрата реакции - длинноцепочечного альдегида (деканаля) - оптимально в конечной концентрации 7×10-6 М для достижения высокого и стабильного уровня биолюминесценции клеток Bacillus subtilis ВКПМ В-10548, так как дальнейшее уменьшение концентрации деканаля ухудшало стабильность свечения и было недостаточным для формирования аппаратно-регистрируемого уровня свечения, а увеличение уже не вело к дальнейшему росту значений биолюминесценции.4) Use of a bacterial suspension with an optical density of 1.2 rel. units is determined by the need to achieve the level of luminescence of the sample, which can be fixed using hardware for recording luminescence. Moreover, the use of the reaction substrate — long-chain aldehyde (decanal) —is optimal at a final concentration of 7 × 10 -6 M to achieve a high and stable level of bioluminescence of Bacillus subtilis VKPM B-10548 cells, since a further decrease in the decanal concentration worsened the luminescence stability and was insufficient for the formation of a hardware-recorded level of luminescence, and the increase no longer led to a further increase in the values of bioluminescence.
5) Обоснованием времени контакта люминесцируюшего штамма Bacillus subtilis ВКПМ В-10548 с образцом сыворотки крови в течение 0,5 часа является выход к данному времени уровня свечения на «плато эффекта» без дальнейшего изменения уровня люминесценции бактериальных клеток при увеличении времени воздействия.5) The justification of the contact time of the luminescent strain of Bacillus subtilis VKPM B-10548 with a blood serum for 0.5 hours is the output by this time the level of luminescence on the "plateau effect" without further changing the level of luminescence of bacterial cells with an increase in exposure time.
В целом, резюмируя приведенные выше материалы о сущности заявляемого способа, характеристике действий, порядке их выполнения и условия осуществления, можно констатировать, что заявляемый способ не следует из уровня техники и по этому показателю должен быть оценен как соответствующий критерию «изобретательский уровень».In general, summarizing the above materials about the essence of the proposed method, the characteristics of the actions, the order of their implementation and the conditions for implementation, we can state that the claimed method does not follow from the prior art and should be evaluated as meeting the criterion of "inventive step".
Заявляемое изобретение иллюстрируется, но никак не ограничивается следующими примерами.The invention is illustrated, but not limited to the following examples.
ПримерExample
1) Изучено изменение иммунного статуса у крупно рогатого скота при использовании комплексного препарата X, основными действующими веществами которого являются плацента денатурированная эмульгированная и нуклеинат натрия. Для проведения исследований было создано две группы стельных коров по 10 голов в каждой. Пря этом коровам опытной группы внутримышечно вводили препарат Х в дозе 0,025 мл/кг массы тела за 60, 30 и 7 дней отела, а животным контрольной группы препарат не применяли.1) The change in the immune status in cattle was studied using complex preparation X, the main active ingredients of which are denatured emulsified placenta and sodium nucleate. For research, two groups of pregnant cows were created with 10 animals each. Directly, the cows of the experimental group were injected intramuscularly with drug X at a dose of 0.025 ml / kg body weight for 60, 30 and 7 days of calving, and the animals of the control group were not used the drug.
Кровь для анализа бета-литической активности за два, один месяц и 7 дней до отела и через 10 дней после родов, у полученных от них телят в суточном и 30-дневном возрасте. При этом 1 мл сыворотки крови смешивали с аналогичным объемом суспензии бактериальных клеток и отбирали аликвоты по 250 мкл на 0 и 30 минуте существования смеси в кюветы, вносили 2 мкл деканаля в конечной концентрации 7×10-6 М и измеряли уровень свечения на биолюминометре Биотоке-10М. В контрольных пробах вместо сыворотки крови использовали физиологический раствор. Итоговый расчет бактерицидных свойств сыворотки крови, определяемых присутствием в ней бета-лизина, проводят по формуле:Blood for analysis of beta-lytic activity two, one month and 7 days before calving and 10 days after birth, in calves received from them at the daily and 30-day age. In this case, 1 ml of blood serum was mixed with a similar volume of a suspension of bacterial cells and 250 μl aliquots were taken at 0 and 30 minutes of the mixture existence in cuvettes, 2 μl of decanal was added at a final concentration of 7 × 10 -6 M, and the level of luminescence was measured on a Biotoke bioluminometer 10M. In control samples, physiological saline was used instead of blood serum. The final calculation of the bactericidal properties of blood serum, determined by the presence of beta-lysine in it, is carried out according to the formula:
где
К примеру, были получены значения
Было установлено, что бета-литическая активность крови коров и новорожденных телят под действием иммуностимулятора изменялась незначительно. Однако у молодняка тридцатидневного возраста показатель был выше, чем у телят контрольной группы на 6,89% (p<0,05).It was found that the beta-lytic activity of the blood of cows and newborn calves under the influence of an immunostimulant changed slightly. However, in young animals of thirty days of age, the indicator was higher than in calves of the control group by 6.89% (p <0.05).
Наблюдалась тесная взаимосвязь между интенсивностью роста и сохранностью телят контрольной и опытной групп. Из 10 телят опытной группы заболело четыре. Первые признаки желудочно-кишечного заболевания регистрировались на 5-7 день жизни, а у контрольных животных - на 2-4 день. Тяжелая степень заболевания отмечалась у 5 телят контрольной группы, в опытной все животные переболели в легкой форме.A close relationship was observed between the growth rate and the safety of calves in the control and experimental groups. Of the 10 calves of the experimental group, four fell ill. The first signs of a gastrointestinal disease were recorded on the 5-7th day of life, and in the control animals - on the 2nd-4th day. A severe degree of the disease was noted in 5 calves of the control group, in the experimental all animals were ill in a mild form.
Таким образом, положительный результат, полученный при использовании заявляемого способа, выступает в виде сокращения трудоемкости процедуры определения бактерицидной активности сыворотки крови, определяемое активностью бета-лизина.Thus, a positive result obtained using the proposed method, appears in the form of reducing the complexity of the procedure for determining the bactericidal activity of blood serum, determined by the activity of beta-lysine.
2) В инфекционное отделение городской клинической больницы №1 г.Оренбург 2.06.11 в 17 часов поступил больной А с диагнозом «пневмония». Для определения бактерицидных свойств сыворотки крови, определяемых присутствием в ней бета-лизина, было отобрано 10 мл крови. Однако ввиду значительной длительности определения активности бета-лизина фотонефелометрическим методом (18 часов), было проведено экспрессное изучения данного параметра с использованием биолюминесцентного метода.2) Patient A with a diagnosis of pneumonia was admitted to the infectious ward of the city clinical hospital No. 1 of Orenburg on 2.06.11 at 17:00. To determine the bactericidal properties of blood serum, determined by the presence of beta-lysine in it, 10 ml of blood were taken. However, due to the considerable duration of determining the activity of beta-lysine by the photonephalometric method (18 hours), an express study of this parameter was carried out using the bioluminescent method.
При выполнении данного исследования этом 1 мл сыворотки крови смешивали с аналогичным объемом суспензии бактериальных клеток и отбирали аликвоты по 250 мкл на 0 и 0,5 часе существования смеси в кюветы, вносили 2 мкл деканаля в конечной концентрации 7×10-6 М и измеряли уровень свечения на биолюминометре Биотоке-10М. В контрольных пробах вместо сыворотки крови использовали физиологический раствор. Итоговый расчет бактерицидных свойств сыворотки крови, определяемых присутствием в ней бета-лизина, проводят по формуле:In this study, 1 ml of blood serum was mixed with a similar volume of a suspension of bacterial cells and aliquots of 250 μl were taken at 0 and 0.5 hours of the mixture in cuvettes, 2 μl of decanal was added at a final concentration of 7 × 10 -6 M and the level was measured luminescence on a Biotoke-10M bioluminometer. In control samples, physiological saline was used instead of blood serum. The final calculation of the bactericidal properties of blood serum, determined by the presence of beta-lysine in it, is carried out according to the formula:
где
Результаты изучения бактерицидных свойств сыворотки крови люминесцентным методом показали, что активность бета-лизина составляет 15% и характеризуется как «низкий». В связи с этим было принято решение осуществить переливание 200 мл плазмы с целью повышения уровня бактерицидных свойств крови, что было проведено уже через час после поступления пациента в отделение. Полученные на следующий день результаты нефелометрического анализа активности бета-лизина подтвердили результаты, полученные при биолюминометрии (уровень активности бета-лизина 13%).The results of a study of the bactericidal properties of blood serum by the luminescent method showed that the activity of beta-lysine is 15% and is characterized as "low." In this regard, it was decided to transfuse 200 ml of plasma in order to increase the level of bactericidal properties of blood, which was carried out already an hour after the patient was admitted to the department. The results of the nephelometric analysis of beta-lysine activity obtained the next day confirmed the results obtained by bioluminometry (beta-lysine activity level of 13%).
Таким образом, положительный результат, полученный при использовании заявляемого способа, выступает в виде сокращения длительности выполнения процедуры определения бактерицидной активности сыворотки крови, определяемое активностью бета-лизина, и уменьшения его трудоемкости.Thus, a positive result obtained when using the proposed method, appears in the form of a reduction in the duration of the procedure for determining the bactericidal activity of blood serum, determined by the activity of beta-lysine, and reducing its complexity.
Claims (1)
где
Where
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU2011153339/10A RU2489489C1 (en) | 2011-12-26 | 2011-12-26 | Method to determine bactericide properties of blood serum |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU2011153339/10A RU2489489C1 (en) | 2011-12-26 | 2011-12-26 | Method to determine bactericide properties of blood serum |
Publications (2)
Publication Number | Publication Date |
---|---|
RU2011153339A RU2011153339A (en) | 2013-07-10 |
RU2489489C1 true RU2489489C1 (en) | 2013-08-10 |
Family
ID=48787237
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
RU2011153339/10A RU2489489C1 (en) | 2011-12-26 | 2011-12-26 | Method to determine bactericide properties of blood serum |
Country Status (1)
Country | Link |
---|---|
RU (1) | RU2489489C1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2708164C1 (en) * | 2019-01-23 | 2019-12-04 | Федеральное государственное бюджетное образовательное учреждение высшего образования "Санкт-Петербургский государственный технологический институт (технический университет)" | Method for determining toxicity of materials |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2010860C1 (en) * | 1991-02-06 | 1994-04-15 | Отдел персистенции микроорганизмов Института экологии и генетики микроорганизмов Уральского отделения РАН | Method of definition of anticomplementary activity of microorganisms |
RU2120999C1 (en) * | 1997-06-23 | 1998-10-27 | Институт клеточного и внутриклеточного симбиоза Уральского отделения РАН | Method of determination of antiplatelet catione-protein activity of microorganisms |
RU2247987C2 (en) * | 2003-01-22 | 2005-03-10 | Общество с ограниченной ответственностью "Центр научного зондирования" | Method for detecting bactericide activity of blood serum |
-
2011
- 2011-12-26 RU RU2011153339/10A patent/RU2489489C1/en not_active IP Right Cessation
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2010860C1 (en) * | 1991-02-06 | 1994-04-15 | Отдел персистенции микроорганизмов Института экологии и генетики микроорганизмов Уральского отделения РАН | Method of definition of anticomplementary activity of microorganisms |
RU2120999C1 (en) * | 1997-06-23 | 1998-10-27 | Институт клеточного и внутриклеточного симбиоза Уральского отделения РАН | Method of determination of antiplatelet catione-protein activity of microorganisms |
RU2247987C2 (en) * | 2003-01-22 | 2005-03-10 | Общество с ограниченной ответственностью "Центр научного зондирования" | Method for detecting bactericide activity of blood serum |
Non-Patent Citations (1)
Title |
---|
БУХАРИН О.В. и др. Система бета-лизина и ее роль в клинической и экспериментальной медицине. Томск.: изд-во ТГУ, 1977, с.52-53. * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2708164C1 (en) * | 2019-01-23 | 2019-12-04 | Федеральное государственное бюджетное образовательное учреждение высшего образования "Санкт-Петербургский государственный технологический институт (технический университет)" | Method for determining toxicity of materials |
Also Published As
Publication number | Publication date |
---|---|
RU2011153339A (en) | 2013-07-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Price et al. | A map of toll-like receptor expression in the intestinal epithelium reveals distinct spatial, cell type-specific, and temporal patterns | |
Dillen et al. | Clonally expanded γδ T cells protect against Staphylococcus aureus skin reinfection | |
Hombrink et al. | Programs for the persistence, vigilance and control of human CD8+ lung-resident memory T cells | |
Razani et al. | Non-catalytic ubiquitin binding by A20 prevents psoriatic arthritis–like disease and inflammation | |
Feuerstein et al. | Resident macrophages acquire innate immune memory in staphylococcal skin infection | |
Jensen et al. | Sepsis leads to lasting changes in phenotype and function of memory CD8 T cells | |
Gjessing et al. | The Atlantic salmon gill transcriptome response in a natural outbreak of salmon gill pox virus infection reveals new biomarkers of gill pathology and suppression of mucosal defense | |
Staels et al. | A novel homozygous stop mutation in IL23R causes mendelian susceptibility to mycobacterial disease | |
Kormann et al. | Rare TLR2 mutations reduce TLR2 receptor function and can increase atopy risk | |
JP5753778B2 (en) | Method for measuring the biological activity of helminth eggs, especially Trichinella eggs | |
Hennig-Pauka et al. | From stable to lab—investigating key factors for sudden deaths caused by Streptococcus suis | |
Chen et al. | The intracellular innate immune sensor NLRP12 attenuates colon inflammation by maintaining colonic microbial diversity and promoting protective commensal bacterial growth | |
RU2489489C1 (en) | Method to determine bactericide properties of blood serum | |
Fromm et al. | Bartonella taylorii: A model organism for studying Bartonella infection in vitro and in vivo | |
Davies et al. | Adhesion to E‐selectin primes macrophages for activation through AKT and mTOR | |
RU2247987C2 (en) | Method for detecting bactericide activity of blood serum | |
Yu et al. | Focus on FOCIS: the continuing diagnostic challenge of autosomal recessive chronic granulomatous disease | |
Srithanasuwan et al. | Different cellular and molecular responses of Bovine milk phagocytes to persistent and transient strains of Streptococcus uberis causing mastitis | |
Zhong et al. | Genetic susceptibility loci for Chlamydia trachomatis endometrial infection influence expression of genes involved in T cell function, tryptophan metabolism and epithelial integrity | |
Sekiya et al. | Tonic TCR and IL-1β signaling mediate phenotypic alterations of naive CD4+ T cells | |
Priel et al. | Assessment of neutrophil function | |
Trindade et al. | Persistence behavior in African trypanosomes during adipose tissue colonization | |
Arntzen | The role of c-di-AMP in host-microbe interactions | |
Palmer | Investigating the Role of CsgD in Salmonella Biofilm Formation and Virulence | |
JP2006081506A (en) | Method for highly sensitive quick detection of microorganism |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
MM4A | The patent is invalid due to non-payment of fees |
Effective date: 20131227 |