RU2487942C1 - Set of oligonucleotide primers and fluorescent-marked probes for type-specific express identification of ebola-zaire virus by method of polymerase chain reaction - Google Patents

Abstract

FIELD: biotechnologies.

SUBSTANCE: invention relates to a set of oligonucleotide primers and fluorescent-marked probes for type-specific express-identification of the Ebola-Zaire virus by the method of polymerase chain reaction in real time. The set includes sequences that are type-specific for the Ebola-Zaire virus: external: 5'→' 5' CCACTTTTCTCAACCAAAATTATTAGTGA 3' 3'←5' 5'TTCTCTAAATCAGTTACAAARCTACTCCC 3' internal: 5'→3' 5'TGGGATCCAGTHTIYGARCC 3' 3'←5' 5' ACTACCATCATATTGCTAGGAAATGCTT 3' probe: FAM - TACTACCACAATATCGGAACTTTTCTTTCTCATTGAA - BHQ1.

EFFECT: invention may be used in medicine for quick detection of genetic material of Ebola-Zaire virus.

1 dwg, 3 tbl, 2 ex

Description

The invention relates to biotechnology, in particular to genetic engineering, and can be used in medicine to detect the genetic material (RNA) of the Ebola-Zaire virus in clinical or sectional samples, in environmental samples for the purpose of diagnosis or treatment correction, as well as for solving research tasks to study the properties of filoviruses, the creation of diagnostic, prophylactic or therapeutic drugs against filoviruses. Using a set of diagnostic primers, it is possible to simultaneously identify the genetic material (REK) of the Ebola-Zaire viruses in the test sample.

Ebola viruses are part of the Filoviridae family. The Filoviridae family, in accordance with the latest decisions of the International Taxonomy Committee, includes two genera: Marburgvirus and Ebolavirus (http://www.ncbi.nlm.nih.gov/ICTVdb/Ictv/index.htm).

The genus Ebolavirus includes 4 species:

- Ebolavirus Reston (Reston ebolavirus - REBOV);

- Sudan ebolavirus (Sudan ebolavirus - SEBOV);

- Tai Forest ebolavirus - TFEBOV;

- Zaire ebolavirus (Zaire ebolavirus - ZEBOV).

Diseases caused by the Ebola virus occur with the same clinical manifestations. The need to diagnose filoviruses from each other is caused by at least two reasons. First, the differentiation of Marburg hemorrhagic fever from Ebola hemorrhagic fever is necessary because specific immunoglobulin can be used to treat these diseases. There is no antigenic crossing between the Marburg virus and the Ebola virus, and immunoglobulins from one disease will not help in the treatment of another. The second reason for the identification of the type of filovirus is due to the fact that the correct molecular-epidemiological conclusion is necessary for adequate and timely sanitary-epidemiological surveillance.

Known primers (analogue) for determining the genetic material of the Marburg and Ebola viruses [Zhai J., Palacios G., Towner J.S et al Rapid Molecular Strategy for Filovirus Detection and Characterization // J. Clin. Microbiol., 2007, 45 (1): 224-6.].

However, the accumulation of data on the genomic diversity of filoviruses and a detailed analysis of these data showed that in some cases this set of primers may not provide reliable identification of filoviruses, since virus genovariants were identified for which the above sets of primers do not have sufficient specificity to ensure reliable synthesis of target DNA fragments. For PCR, primers not labeled with a fluorophore were used, and this does not allow determining the amount of virus RNA in the analyzed sample. In addition, using the proposed primers, only one round of PCR can be performed, and according to the literature [Towner J.S., Rollin R.E., Bausch D.G. et al. Rapid Diagnosis of Ebola Hemorrhagic Fever by Reverse Transcription-PCR in an Outbreak Setting and Assessment of Patient Viral Load as a Predictor of Outcome // J. Virol., 2004, 78 (8): 4330-11] sensitivity of test systems using single-round PCR, is 100-1000 virus RNA. The one-round test system, due to its low sensitivity, may not determine the presence of virus RNA, as was the case with a tourist from Colorado (2008), who, after returning from Uganda 10 days after the onset of clinical signs of Marburg virus RNA disease, was not detected . When the same sample was rearranged by two-round PCR already after 6 months (when the ELISA test showed an increase in antibodies to Marburg virus), Marburg virus RNA was detected [Fujita N., Miller A., Gershman K. et al. Imported Case of Marburg Hemorrhagic Fever, Colorado, 2008 // JAMA, 2010, 303 (5): 413-5. (Reprinted MMWR. 2009; 58: 1377-1381)].

The closest analogue (prototype) are family-specific oligonucleotide primers that allow the presence of one of the representatives of the filovirus family in the sample by PCR [Grolla A., Lucht A., Dick D., Strong J. E., Feldmann N. Laboratory diagnosis of Ebola and Marburg hemorrhagic fever // Bull Soc Pathol Exot, 2005, 98 (3): 205-209].

However, family-specific primers are used for PCR to detect the presence of one of the representatives of the filovirus family in the sample and not to identify the type of virus. When treating a patient with serum or plasma, it is important to know what type the virus that caused the disease belongs to, otherwise the effectiveness of the treatment will be significantly reduced. In addition, the determination of the type of filovirus is also very important for the organization of anti-epidemic measures.

The technical result of the claimed invention is the creation of a more specific set of oligonucleotide primers and probes for the identification of the genetic material of the Ebola-Zaire virus in clinical samples and biological fluids, environmental samples and other virus-containing samples (culture virus-containing liquid, etc.) by real-time multiplex PCR time.

The indicated technical result is achieved by the constructed set of oligonucleotide primers and fluorescently labeled probes (to the conserved region of the L gene encoding the Ebola-Zaire virus RNA polymerase for the species-specific express identification of the Ebola virus by real-time polymerase chain reaction, including sequences that are species-specific Ebola-Zaire virus:

external:

5 '→ 3' 5 'CCACTTTTCTCAACCAAAATTATTAGTGA 3'

3 '← 5' 5 'TTCTCTAAATCAGTTACAAARCTACTCCC 3'

internal:

5 '→ 3' 5 'TGGGATGCAGTHTTYGARCC 3'

3 '← 5' 5 'ACTACCATCATATTGCTAGGAAATGCTT 3'

probe:

FAM - TACTACCACAATATCGGAACTTTTCTTTCTCATTGAA -BHQ1

At the initial stage, pairs of specific oligonucleotide primers and probes for hybridization-fluorescence detection of PNR products were selected and synthesized for each virus.

Table 1 Ebola-Zaire virus primers and probes Virus Primers and probes The structure of the oligonucleotide sequence T annealing (° C) Amplicon size Ebola Zaire F12981 CCACTTTTCTCAACCAAAATTATTAGTGA 56 504 R13485 TTCTCTAAATCAGTTACAAARCTACTCCC 56 F13060 TGGGATGCAGTHTTYGARCC 55 307 R13367 ACTACCATCATATTGCTAGGAAATGCTT 56 Z13201 Kp * -TACTACCACAATATCGGAACTTTTCTTTCTCATTGAA-BHQ1 64 - Note; Kp * - dye (FAM)

For this, the most conservative sections of the Ebola-Zaire virus genomes were selected in the NCBI Mega BLAST database (http://www.ncbi.nlm.nih.gov/). We analyzed all the literature sequences of each of the viruses. For all filoviruses, the genome target regions corresponded to the L gene encoding the main component of RNA polymerase. The sequence of primers and probes, the temperature of their annealing, and the size of the amplification products are presented in table 1.

The selection and analysis of the properties of oligonucleotide primers and probes was carried out using the Vector NTI 9.0.0 software (InforMax).

Example 1. Verification of the analytical sensitivity of a set of primers and probes.

To control amplification, positive control samples were obtained, which are recombinant plasmids carrying virus-specific inserts, which are the matrix for the amplification of virus-specific DNA fragments.

For real-time PCR, recombinant plasmid DNA was used as the analyzed samples, including a DNA insert corresponding to the detected regions of the Ebola-Zaire virus genomes.

The amplification conditions were optimized by the following parameters: the concentration of magnesium ions in the reaction mixture; the concentration of primers and probes in the reaction mixture; primer annealing temperature.

To determine the sensitivity of the kit, concentrated 10-fold dilutions were prepared from a concentrated plasmid DNA solution. Dilution of the DNA concentration in the primer sensitivity study was carried out using a QUBIT fluorimeter (Invitrogen, USA) and manufacturer's reagent kits.

Real-time PCR and the results were recorded in a Rotor Gene 6000 instrument (Corbett Research, Australia) using the Green (470 nm / 510 nm) and Yellow (530 nm / 555 nm) channels.

As a result of the experiments, the minimum amount of recombinant plasmid DNA containing a fragment of the Ebola-Zaire virus genome was determined. When using external primers to the genome of the Ebola-Zaire virus - 0.03 plasmid DNA.

To determine the analytical sensitivity of the monovariants of the primer-probe systems, successive 10-fold dilutions were prepared for the detection of each virus from concentrated solutions of positive control samples. The concentration of DNA in the dilutions was determined by studying the sensitivity of the primers using a commercial kit Quant-iT dsDNA, HS (Invitrogen, USA) and a QUBIT fluorimeter (Invitrogen, USA). The minimum number of DNA templates detected using the inventive primers and probes after optimizing the reaction conditions, expressed in GE (genomic equivalents) in 30 μl of the reaction mixture, are presented in table 2.

table 2 Analytical sensitivity of monovariants of the systems "primers-probe" Virus name Analytical sensitivity (GE) Ebola Zaire 7.0 × 10 ³ Ebola Sudan 1.0 × 10 ⁵

Example 2. Determination of RNA of the Ebola-Zaire virus in virus-containing samples

Evaluation of the effectiveness of detecting the genetic material of viruses was carried out on a Mayinga strain of the Ebola-Zaire virus. The Ebola virus strain infected 10 BALB / c mice. On day 5, animals were bled and the presence of specific viral RNA was determined.

Preliminary inactivation of samples and RNA isolation was carried out under the conditions regulated by the Methodological Instructions of MU 1.3. 2569 -09 “Organization of the work of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV”.

The procedure for isolating RNA from the studied material was carried out using the kit “Kit of reagents for the isolation of DNA / RNA from serum or plasma” (NPF Litekh, Russia) in accordance with the instructions for use.

Real-time PCR was performed with F13060 and R13367 primers flanking a 307 bp DNA section in a reaction mixture of the following composition (for 1 study):

cDNA 5 μl l0 × Taq buffer without Mg ²⁺ 3 μl 100 mM MgCl ₂ solution 0.7 μl 5 mM dNTP solution 1 μl A mixture of primers 2 μl (concentration of each 10-15 μmol / l) Probe (concentration of 5-10 μmol / l) 1 μl SmartTaq DNA Polymerase 0.3 μl Water for PCR 17 μl Overall volume 30 μl

The reverse transcription reaction was performed using the Revert-L reagent kit (TsNIIE, Russia) in accordance with the instructions for use.

As a negative control, TE buffer was added to the reaction mixture.

Real-time PCR and results were recorded in a Rotor Gene 6000 instrument (Corbett Research, Australia) according to the following program, shown in table 3:

Table 3 PCR modes Temperature (° C) Time (minutes: seconds) The number of cycles 95 05:00 one 95 00:15 45 55 00:15 72 00:30

The fluorescence signal was detected at a cycle step of 55 ° C on the Green channel (470 nm / 510 nm) for Ebola-Zaire viruses.

The results were interpreted on the basis of the presence (or absence) of the intersection of the fluorescence curve with the threshold line set at the appropriate level, which corresponds to the presence (or absence) of the threshold cycle Ct in the corresponding column in the results table. The result was considered positive if the fluorescence accumulation curve for the corresponding sample had a characteristic "sigmoid" shape and crossed the threshold line. In this case, the Ct value for this sample was not more than 40 (Fig. 1).

Figure 1 shows the fluorescence curves on the three optical channels of a Rotor Gene 6000 amplifier (Corbett Research, Australia). Fluorescence in samples containing: genetic material: Ebola-Zaire and Ebola-Sudan (EBOV) - 4 samples on the Green channel.

Thus, from the above examples 1 and 2 shows the achievement of the claimed technical result: created

species-specific set of oligonucleotide primers and probes for identification of the genetic material of the Ebola-Zaire virus in clinical samples and biological fluids, environmental samples and other virus-containing samples (culture virus-containing liquid, etc.) by real-time multiplex PCR.

Application. Sequence listing

Ebola-Zaire virus-specific sequences:

external:

5 '→ 3' 5 'CCACTTTTCTCAACCAAAATTATTAGTGA 3'

3 '← 5' 5'TTCTCTAAATCAGTTACAAARCTACTCCC 3 '

internal:

5 '→ 3' 5 'TGGGATGCAGTHTTYGARCC 3'

3 '← 5' 5 'ACTACCATCATATTGCTAGGAAATGCTT 3'

probe:

FAM - TACTACCACAATATCGGAACTTTTCTTTCTCATTGAA - BHQ1.

Claims (1)

A set of oligonucleotide primers and fluorescently-labeled probes for species-specific rapid identification of the Ebola-Zaire virus by real-time polymerase chain reaction, including sequences that are species-specific for the Ebola-Zaire virus: external:
5 '→'3'5'CCACTTTTCTCAACCAAAATTATTAGTGA3'
3 '← 5'5' TTCTCTAAATCAGTTACAAARCTACTCCC 3 '
internal:
5 '→ 3'5' TGGGATGCAGTHTTYGARCC 3 '
3 '← 5'5' ACTACCATCATATTGCTAGGAAATGCTT 3 '
probe:
FAM - TACTACCACAATATCGGAACTTTTCTTTCTCATTGAA - BHQ1.

Images