RU2462512C2 - Epigenetic regulatory complex of gene expression control - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: recovered polypeptide complex is involved in epigenetic gene expression control in mammals. The complex contains the protein Blimpl or its homologue PRD1 having site-specific DNA-binding activity, and the protein PRMT5.

EFFECT: complex is able to regulate gene expression in cells, particularly in stem cells in mammals that is ensured by regulated R3 methylation in C-terminal regions of the histones H2A and H4.

12 cl, 8 dwg, 1 tbl, 5 ex

Description

FIELD OF THE INVENTION

This invention relates to the field of epigenetic regulation of gene expression. In particular, this invention relates to compositions and methods comprising histone methyltransferase activity, which are aimed at controlling gene expression in vivo and in vitro.

BACKGROUND OF THE INVENTION

Epigenetics refers to the transfer of information from a cell or multicellular organism to its or its descendants in the absence of coding of this information in the nucleotide sequence of genes. Epigenetic control is usually carried out through chemical modification of the structure of DNA or chromatin. Gene expression can be slowed down, for example, by methylation and acetylation of histones that are associated with genomic DNA. Histone methylation and acetylation are usually carried out in the tail of histones, a domain that is on the surface and has a resulting positive charge due to the abundance of amino acid residues such as arginine (R) and lysine (K). Chemical modification of the histone tail is slowed down by an enzyme having histone methyl transferase activity (HMTase) and histone acetyltransferase activity (HAT).

Epigenetic modification can occur during various periods of the normal development of the body, as well as during the transformation of normal cells into cancer cells. Such modifications often lead to silencing or activation of certain genes. Documentary evidence has convincingly confirmed that with cancer, most tumor cells have abnormal epigenetic DNA imprints (Feinberg AP & Vogelstein B, (1983) Nature 1 (5895): 89-92).

Stem cells are cells capable of both intense self-renewal and differentiation into progenitor cells. Stem cells themselves are also a possible root cause (possible primary source) of cancer. Stem cells can have a longer lifespan during which they acquire genetic mutations and epigenetic modifications, which can increase the tendency to malignant neoplasms. It is suggested that since stem cells occupy a niche that so delicately balances between participation in competitive proliferation and differentiation, small but fundamental epigenetic changes can dramatically shift the equilibrium towards the phenotype of cancer stem cells. Understanding why and how epigenetic modifications are regulated is crucial for understanding, detecting and treating cancer and, in particular, treating (treating) cancer stem cells. In fact, it is believed that one of the features of recurrent and aggressive cancers that are difficult to treat is that tumors may contain cancer stem cells that do not respond to conventional drugs.

Somatic cell nuclear transfer (SCNT) is used to produce animals in animal husbandry (for cloning or for stem cell therapy), protein bioproduction, and for disease modeling (Wilmut I, Beaujean N, de Sousa PA, Dinnyes A, King TJ, Paterson LA, Wells DN, Young LE. (2002) Nature. Oct 10; 419 (6907): 583-6). One of the problems associated with the effectiveness and efficiency of SCNT attempts is that the somatic cell genome contains intense and persistent epigenetic tags that can interfere with successful reprogramming. In addition, the recipient egg can contain factors causing an epigenetic effect, which can also contribute to the failure of the process. Therefore, it is necessary to create compositions and methods for increasing the efficiency of SCNT and, therefore, those applications in bioprocessing that are simplified by this operation.

The specification of primordial (primary sex) germ cells (PZCs, PGCs) in mice provides an attractive experimental model for analyzing the effects of epigenetic modifications in vivo. A population of founder cells (special cells, founder-cells) of approximately 45 PGC (PZC) is first detected in E7.5 in mouse embryos (Ginsburg, M., Snow, M.N. & McLaren, A. ( 1990) Development 110, 521-8). These PGCs then migrate and enter the genital tubercles from E10.5 in front, where further extensive epigenetic programming of germ cells continues. By E13.5, germ cells enter the prophase of meiosis.

Significant epigenetic modifications occur immediately after PGC specification, including histone tail methylation and acetylation with HMTase (HMTase) and HAT, respectively (Surani et al., 2004 (CSH Symposium); Seki et al., 2004; Lachner, M ., O'Sullivan, RJ & Jenuwein, T. (2003) J Cell Sci 116, 2117-24, and Vaquero, A., Loyola, A. & Reinberg, D. (2003) Sci Aging Knowledge Environ 2003, RE4) . Among the candidate genes, presumably involved in the regulation of these epigenetic changes in PGC, are HMTase (NMTases), which belong to the family of proteins with a conserved SET / PR domain.

Therefore, there is a need to create reagents and methods for improving the control of epigenetic regulatory mechanisms in the cell. In particular, compositions (compositions) and methods are needed that allow better control of gene expression in such a way as to influence the decision on the fate of cells in stem cells and cancer cells.

SUMMARY OF THE INVENTION

The first aspect of the invention includes an isolated polypeptide complex containing at least a first domain having a site-specific DNA binding activity and at least a second domain having arginine-methyltransferase activity, the second domain being capable of methylating an arginine residue localized in the tail region of histone H2A.

In a specific embodiment of the invention, the second domain has arginine-methyltransferase activity, which provides symmetrical NG, N'G-dimethylation of the arginine residue, appropriately localized at position 3 in the tail region of histone H2A (H2AR3). Optionally, the second domain is also capable of methylating an arginine residue localized in the tail region of histone H4, an arginine residue appropriately localized at position 3 in the tail region of histone H4 (H4R3). In one embodiment of the invention, arginine-methyltransferase activity is contained in the Prmt5 arginine-methyltransferase domain, or in its derivative, or in its homologue.

According to the invention, the first domain can be specifically directed to binding to one or more consensus sequences in the mammalian genomic DNA that are involved in the control of gene expression. Typically, but not exclusively, such sites may be located in non-coding promoter regions, untranslated regions, or introns. In a specific embodiment of the invention, the DNA binding domain of the invention is capable of binding to a PRDI / Blimp1 type binding site having a consensus sequence of four GGGAAAG motifs, two are located in the 5 'promoter region of the target gene, and two are located 3' from the transcription start site. Accordingly, the DNA-binding domain contains the Blimp1 protein, the DNA-binding region of the PRDI / Blimp1 polypeptide, or a homologue or derivative thereof.

A second aspect of the invention includes a nucleotide expression vector construct that is useful for inducing expression of a polypeptide complex in a mammalian cell, the vector comprising:

one or more coding sequences operably linked to a promoter sequence,

where one or more coding sequences encode at least a first polypeptide domain having a site-specific DNA-binding activity and at least a second polypeptide domain having arginine-methyltransferase activity, wherein the first domain specifically targets binding to one or more consensus sequences in the mammalian genomic DNA that are involved in the control of gene expression, and the second domain has arginine-methyltransferase activity that provides symmetrical NG , N'G-dimethylation of an arginine residue localized in a polypeptide substrate.

According to a particular embodiment of the invention, the polypeptide substrate is a histone. Optionally, the second polypeptide domain is capable of methylating an arginine residue located at position 3 in the “tail” region of histone H2A (H2AR3), as well as an arginine residue located in the “tail” region of histone H4.

Suitable expression vectors include plasmids, cosmids, viral vectors, and artificial chromosomes such as YAC. Optionally, the promoter sequence can be selected either from a constitutive promoter or from an inducible promoter. Suitable inducible promoters include well-described Tet or Tamoxifen-regulated systems. Alternative systems may include heat shock sensitive promoters.

In one embodiment of the invention, the expression vector comprises an expression cassette in which the first coding sequence encodes a first polypeptide domain and the second coding sequence encodes a second polypeptide domain. Optionally, the first coding sequence encodes a PRDI / Blimp1 polypeptide, and the second coding sequence encodes a Prmt5 polypeptide. In particular embodiments of the invention, it may be preferable that the first and second coding sequences are separated by one or more intermediate sequences. One or more intermediate sequences may contain at least one portion of the internal ribosome insertion (IRES) in order to facilitate bicistronic expression of the first and second coding sequences in the cell. The expression vectors of the invention may also contain one or more nucleotide sequences that encode a polypeptide selected from: a selectable marker; antibiotic resistance marker; and the reporter gene.

A third aspect of the invention includes a method for controlling gene expression in a mammalian cell, which comprises inducing the formation of a polypeptide complex in a cell containing at least a first domain having a site-specific DNA-binding activity and at least a second domain having arginine -methyl transferase activity, the second domain being able to methylate an arginine residue localized in the “tail” region of histone H2A. In a particular embodiment of the invention, the formation of the polypeptide complex is induced in the cell by inducing expression of the PRDI / Blimp1 polypeptide, or its homologue or derivative, in the cell.

In a particular embodiment of the invention, expression of the PRDI / Blimp1 polypeptide is induced in the cell by transfection of the cell with an expression vector that encodes a Blimp1 polypeptide, or a derivative or homolog thereof. Optionally, expression of the PRDI / Blimp1 polypeptide is induced in the cell by transfection of the cell with the expression vector described previously. Typically, a mammalian cell is a human tissue cell or is represented as a cell line. In a particular embodiment of the invention, the mammalian cell is a tumor or cancer cell or cell line. The method according to this aspect of the invention can be carried out in vitro or in vivo.

In a particular embodiment of the invention, gene expression control is expression control of one or more genes selected from the group consisting of: c-Myc; Dhx38; Pcdh7; Q8C9T7; Xylt1; DnaH1; Baip2; Nek7; Dusp2; ENSMUSG00000027041; Sirt4; and Blimp1. Induction of a polypeptide complex in a cell can lead to a decrease in the expression of one or more of these genes.

A fourth aspect of the invention includes a method of stimulating self-renewal and inhibition of stem cell differentiation, which comprises inhibiting the formation of a Blimp1 / Prmt5 complex in a stem cell. Optionally, the stem cell is a mammalian stem cell, preferably a human stem cell. In particular embodiments of the invention, the stem cell is selected from the group consisting of an adult stem cell; progenitor stem cell; and pluripotent stem cell. It is understood that the invention in no way relates to human reproductive cloning or the manipulation of human embryos and their use for human reproductive cloning.

In a specific embodiment of this aspect of the invention, the inhibition of the formation of a Blimp1 / Prmt5 complex in a stem cell is accomplished by exposing the cell to a compound inhibiting (inhibiting) Blimp1, to a compound inhibiting Prmt5 and / or to a compound inhibiting the Blimp1 / Prmt5 complex. Preferably, the inhibitor may be selected from a low molecular weight inhibitor; a siRNA molecule (small interfering RNA) that binds to Blimp1 or Prmt5 mRNA; an antisense oligonucleotide that binds to Blimp1 or Prmt5 mRNA; and a dominant negative variant of the Blimp1 or Prmt5 polypeptide.

A further aspect of the invention includes a method for controlling the localization of Prmt5 in a cell, typically the localization of endogenous Prmt5, comprising inducing expression of the Blimp1 polypeptide in the cell, thereby inducing the formation of the Blimp1 / Prmt5 complex in the cell. Blimp1 induced in the cell can be either exogenous Blimp1 or endogenous Blimp1. Preferably, the cell may be a mammalian stem cell.

Another aspect of the invention relates to the use of the polypeptide complexes of the invention for treating cancer, and to cells - preferably mammalian / human cells - containing the expression vector constructs described above.

DESCRIPTION OF FIGURES

Figure 1 presents (a) a summary of the main events in the specification and development of a mouse germ cell from E7.5 to E12.5, and (b) analysis of the expression of candidate genes for the SET / PR domain using PCR cDNA of a single cell from 2 representative founding cells (special cells, founder cells) PGC (gray) and 2 somatic cells (white). Black areas show detection of expression in PGC and somatic cells.

Figure 2 shows that immunoprecipitation-precipitated murine Blimp1 complex exhibits arginine methyltransferase activity, (a) Myc-labeled murine Blimp1 or an appropriate control is expressed as indicated in 293T cells. Mus immunoprecipitates are analyzed by Western blotting using antibodies against the Mus protein; (b) the same immunoprecipitates are used in HMTase assays for purified histone Well; H2A and recombinant H2A (rH2A). For each, a fluorogram (F) and a membrane stained with a Ponceau solution (P) are shown; (c) microsequencing labeled with a radioisotope tag rH2A, the x-axis shows amino acids 1-14 rH2A, the y-axis shows [ ³ H] - the inclusion of individual amino acid residues as the number of pulses per minute (cmp); and (d) alignment showing the preservation of the sequence of the extreme N-terminus of H4 and H2A.1;

Figure 3 shows that the overlapping expression of Blimp1 and Prmt5 in germ cells leads to a specific pattern of H2A / H4R3me, (a, b, c). The expression pattern of Blimp1, Prmt5 and Prmt1 in PGC at various stages is detected by immunostaining with antibodies specific for Blimp1 ( a), Prmt5 (b) and Prmt1, (c) germ cells are detected as shown using anti-stella / PGC7, Oct4 or TG1 / SSEA1 antibodies, pooled (fused) images are shown with DNA stained with DAPI; (d, e) Myc-labeled murine Blimp1 or corresponding controls are expressed as indicated in 293T, Myc, Prmt5 or Prmt1 cells; immunoprecipitates are analyzed by Western blotting using antibodies against Prmt5, Myc or Prmt1, an asterisk indicates a non-specific signal; and (f) H2A / H4 R3 methylation in germ cells is assessed by immunostaining in PGC cells at various indicated stages of H4R3me2s antibody development, germ cells are stained with antibodies against stage-specific markers, namely, Oct4 or TG1 / SSEA1, combined (fused) images are shown with DNA stained using DAPI, scale: 10 μm (scale identical in all figures).

Figure 4 shows the in vivo identification of Blimp1 / Prmt5 binding elements with the Dhx38 genomic locus, (a) the position of the putative Blimp1 binding sites near Dhx38 transcription start (TS) and start codon (ATG), also shows amplification sequences for ChIP analysis (A, B, C, D), (b) The interaction of endogenous Prmt5 with the genomic DNA of the Dhx38 locus using ChIP analysis, the supernatant fraction (s) or the nuclear fraction (n) of cell extracts of isolated genital tubercle cells E10.5 embryos are immunoprecipitated with antibodies to either Prmt5 or to IgG, as They use genomic tail DNA (+) and water (-).

Figure 5 shows that the expression of Dhx38 is activated in germ cells upon translocation of Blimp1 and Prmt5 from the nucleus to the cytoplasm, which leads to a decrease in the levels of modification of H2A / H4R3me2s, immunostaining of (a) Dhx38, (b) Blimp1 and Prmt5, and (c) H2A / H4R3me2s is performed on cryosections of genital tubercles at the indicated developmental stages, germ cells are detected using specific antibodies: stella / Pgc7, Oct4 or TG1 / SSEA1, the combined images are shown with DNA stained with DAPI, scale: 10 μm (scale identical all figures).

Figure 6 shows the analysis of Blimp1, Prmt5 and Dhx38 in pluripotent EG cells and embryonic carcinoma (EC) cells (a) Immunostaining for Blimp1, Prmt5 and Dhx38 is carried out on EG cells, the combined images are shown with DNA stained with DAPI, note the opposite the ratio between the expression of Dhx38 and Blimp1; (b) Western blotting of ES, EG or EC (P19) extracts for Blimp1 and Oct4; (c) Myc-labeled murine Blimp1 is expressed as indicated in P19 EU pluripotent cells, Prmt5 immunoprecipitates are analyzed by Western blotting using antibodies to Prmt5, Blimp1 or Dhx38, and tubulin levels showing an equal load on the input pathway are detected using an anti-tubulin antibody, repression of Dhx38 should be noted when Blimp1 is introduced into EC (P19) cells; (d) Elevated levels of H4R3me2s at the Dhx38 locus in Myc-Blimp1 transfected EC (P19) cells are analyzed by ChIP, cell extracts of P19 cells are immunoprecipitated with antibodies to either Myc or H4R3me2s, A, B, C, D refer to regions B A dhx38 locus containing Blimp1 binding sites, as explained in FIG. 4.

FIG. 7 shows (a) Immunofluorescence analysis of candidate genes for the SET / PR domain using expression screening by the NDP method in E7.5 shown in FIG. 1; immunostaining of isolated cells from E8.5 embryos with specific antibodies against specific histone methyltransferases, as indicated, germ cells are detected using germ-specific antibodies, Oct4 or Stella / PGC7; (b) co-immunostaining of Blimp1 and Prmt5 using the appropriate antibodies in E8.5 PGC, germ cells are labeled using expression of tissue-specific alkaline phosphatase (AP), the combined images are shown with DNA stained using DAPI, scale: 10 μm (scale identical all figures).

Fig. 8 shows the characteristic of H4 R3me2s antibodies, arginine can be modified with a single methyl group (a), or with two methyl groups that are symmetrical (b) or asymmetrically (c); the anti-H4 antibody R3me2s (Abeam ™) is first prepared using an H4 synthetic peptide with R3 symmetric di (e?) methylation, Western blotting is performed to check its specificity; (d) against calf thymus histones (H4, H3, H2A, H2B) are incubated in the presence and absence of immunoprecipitate-precipitated Myc-Blimp1, and (e) according to competitive analysis for H4 peptides, including unmodified, R3me2s and R3me2a, the antibody is clearly recognizes symmetrically dimethylated peptide.

DETAILED DESCRIPTION OF THE INVENTION

Before giving a detailed description of the invention, a number of definitions are provided that will help to understand the invention. All reference materials cited in this description are introduced by reference in its entirety. Unless otherwise specified, all technical and scientific terms used in this description have the meaning that it usually has for ordinary specialists in the field of technology to which this invention relates.

The term "reprogramming" as used herein refers to the stage of changing or removing epigenetic modifications from the cell nucleus. Reprogramming promotes reduction during cell commit and, consequently, the state of differentiation of the cell as a whole and, in particular, the nucleus. In essence, reprogramming consists of the return of the nucleus of a somatic differentiated or committed cell to gene expression, an epigenetic and functional state characteristic of an embryonic, germ or stem cell. Reprogramming somatic cell nuclei is the preferred first step in methods such as SCNT, but it is also of interest to other methods in which cell differentiation control is important, i.e. ability to differentiate, differentiating potency.

The term "cancer" is used herein to refer to tissue localized in a neoplasm (neoplasm, tumor) or possessing properties associated with the neoplasm (neoplasm, tumor). Neoplasms usually have characteristics that distinguish them from normal tissue and normal cells. Such characteristics include, but are not limited to: the degree of anaplasia, changes in cell morphology, irregular shape, decreased adhesion, metastasis, increased levels of angiogenesis, increased invasiveness of cells, decreased levels of cellular apoptosis and, as a rule, increased cell malignancy. The terms corresponding to the term "cancer", and often being synonymous with it, include sarcoma, carcinoma, tumor, epithelium, leukemia (leukemia), lymphoma, polyp, degeneration, neoplasm (neoplasm), etc.

The term "epigenetic modification" refers to the chemical labeling (labeling) of the genome. Epigenetic labels may include DNA methylation (imprints), as well as methylation and acetylation of DNA-associated proteins, such as histones. Expression of genes specific for native parents (either from the maternal or paternal chromosome) is often observed in mammals and is the result of epigenetic modifications. In parental germ lines, epigenetic modification can lead to stable silencing or stable gene activation.

"Bioprocessing" refers to methods in which living cells or their components are used to produce the desired end product. In the context of the present invention, epigenetic modifications in cells can be used to increase this ability of cells for use in bioprocessing. Typically, bioprocessing methods include SCNT.

The terms "derivatives or homologues" of the DNA binding domains and / or arginine methyltransferases as used herein refer to mRNAs and polypeptides that have sequence identities substantially similar to the molecules of the invention, respectively. Derivatives and homologues are believed to include orthologs of sequences from other species and mutants, which nevertheless exhibit a high level of functional equivalence. By practically similar (similar) sequence identity is understood the level of sequence similarity, from about 50%, 60%, 70%, 80%, 90%, 95%, to about 99% identity. The percent sequence identity can be determined using conventional methods (Henikoff and Henikoff, Pros. Natl. Acad. Sci. USA 1992; 89: 10915, and Altschul et al. Nucleic Acids Res. 1997; 25: 3389-3402). Alternatively, the homologs of the polypeptides of the invention may be sequences that can demonstrate the ability to hybridize to the sequences described herein under conditions of high, medium or low stringency.

The term “expression (expression) vector” (“expression vector”) is used to refer to DNA molecules that are either linear or circular into which a fragment of another DNA sequence can be integrated. Such DNA fragment (s) may include additional segments that transcribe the gene encoded by the DNA sequence fragment. Additional segments may include, but are not limited to: promoters, transcriptional terminators, enhancers, regions of internal ribosome insertion, untranslated regions, polyadenylation signals, selective markers, origin of replication, and the like. Expression vectors are often derived from plasmids, cosmids, viral vectors and artificial yeast chromosomes; vectors are often recombinant molecules containing DNA sequences from multiple sources.

The expression "functionally linked", when applied to DNA sequences, for example, in an expression vector, indicates that the sequences are arranged in such a way that they work together to achieve specific goals, namely, the promoter sequence promotes the initiation of transcription, which occurs using the associated coding sequences before the transcription termination signal.

A "polynucleotide" is a single or double-stranded (heavy, chain) covalently linked nucleotide sequence in which the 3 'and 5' ends of each nucleotide are connected by phosphodiester bonds. A polynucleotide may consist of deoxyribonucleotide bases or ribonucleotide bases. Polynucleotides include DNA and RNA and can be obtained synthetically in vitro or isolated from natural sources. The sizes of polynucleotides are usually expressed as the number of base pairs (nucleotide) (nucleotide pairs, bp) for double-stranded polynucleotides, or, in the case of single-stranded polynucleotides, as the number of nucleotides (nt). One thousand bp or nt is equal to kilobase (kb). Polynucleotides less than about 40 nucleotides in length are commonly referred to as "oligonucleotides."

The term "promoter" as used herein refers to a region in a gene to which transcription factors and / or RNA polymerase can (can) bind in such a way as to control the expression of the associated coding sequence. Usually, but not always, promoters are located in 5 'non-coding regions of genes, 5' from the translation initiation codon. The promoter region of a gene may contain one or more consensus sequences that act as recognized binding sites for sequence-specific DNA-binding domains of DNA-binding proteins. However, such binding sites can also be localized in regions outside the promoter, for example, in enhancer regions located in introns or 3 ′ from the coding sequence.

The term "isolated", as applied to a polypeptide or complex (combination) of polypeptides, refers to a polypeptide that is isolated from the body, which is its natural source. It is preferable that the isolated polypeptide practically does not contain other polypeptides native to the proteome of the source organism. Most preferably, the purity of the isolated polypeptide is at least 95%, more preferably more than 99%. In this context, the term “isolated” is intended to include the same polypeptide in alternative physical forms, either in native form, in the form of a denatured protein, in a dimeric / multimeric form, in the form of a glycosylated, crystallized, or derivatized protein. The reference to “complex” (“combining”) in this description includes examples in which the first and second polypeptide domains are in a single polypeptide chain, and in which the first and second domains are part of separate polypeptide chains that are non-covalently linked to in another, as well as in which post-translational covalent bonds are formed that link individual domains into one integrated functional element (unit).

In one embodiment of the present invention, there is provided a novel complex between Blimp1 and Prmt5 capable of regulating gene expression in mammalian cells by an epigenetic control mechanism.

Usually somatic cells develop along the path of differentiation, developing from a state of a less specialized cell to a state of a more specialized or committed cell. Less specialized cells may exhibit the ability to behave like progenitor stem cells, giving rise to some different types of cells. The number of these different types of cells for which a given stem cell can serve as a precursor is commonly called the "potency" of this stem cell. Therefore, pluripotent stem cells can behave as precursors to so many different types of differentiated cells. If a cell can differentiate into all cells of the body, it is a totipotent stem cell; if a cell can differentiate into most types of cells, it is a pluripotent stem cell. Embryonic stem cells are commonly referred to as pluripotent, since they can generate most types of mammalian cells, with the exception of extraembryonic tissues (i.e., trophoctoderm). The present invention includes a method for controlling cell fate selection at the level of gene expression control. The protein complex of the invention, when expressed or otherwise introduced into mammalian cells, shift the fate of the cell to the other side from the choice of pluripotency. In contrast, the inhibition of the activity of the protein complex of the invention, or even one component, Blimp1, in stem cells can shift the fate of the cell towards the choice of pluripotency and self-renewal.

Another related area of utility of the present invention is cancer therapy. Most, if not all, cancers undergo epigenetic changes, including largely the deactivation and silencing of tumor suppressor genes and activation of oncogenes. Reactivation of tumor suppressor genes can reduce the intensity of the cancer phenotype, as it can suppress (negatively regulate) oncogenes. Therefore, a method for controlling gene expression and choosing the fate of cells in vivo represents a very promising direction in cancer therapy.

Protein Maturation (Blimp1) Induced by B Cells

Blimp1 is a 100 kDa protein that contains five DNA-binding zinc finger motifs (GENBANK registration number: NM_007548). The human homologue of Blimp1 is called either PRDI-BF1 or PRDM1 (GENBANK registration by: NM_000198). Blimp1 cDNA was first isolated by subtractive (subtractive) screening for the B cell lymphoma cell line (BCL ₁ ) after treatment with the cytokines IL-2 and IL-5. ectopic expression of Blimp1 is sufficient to induce the final differentiation of BCL ₁ cells. It is believed that Blimp1 is the 'master regulator' (general regulator) of the final development of B cells (Yu J. et al. (2000) Mol. Cell. Biol. 20 (7): 2592-2603).

In humans, PRDI-BF1, the human ortholog of mouse Blimp1, is capable of complexing with H3 lysine methyltransferase G9a. It was shown that this complex is capable of causing silencing of the human interferon-β gene (IFN-β) by the chromatin-mediated mechanism in the promoter region of the gene (Gyory I. et al. (2004) Nat. Imm. 5: 299-308).

It was shown that Blimp1 forms a complex with factors that take part in epigenetic modifications. It is believed that a complex containing Blimp1 and histone deacetylase (HDAC) alters the structure of the nucleosome and inhibits gene transcription by deacetylation of lysine residues on histone tails. Since acetylation of lysine residues effectively neutralizes their positive charge, deacetylation returns the charge and leads to modification of the nucleosome structure due to steric and other effects.

Known Blimp1 targets include c-Myc, IFN-β, CD23, CD22, MHC (MHC) class II, BSAP (Pax 5), early B cell factor, and CIITA. All of these genes undergo transcriptional regression under the influence of Blimp1. Transcription of the c-Myc gene is suppressed by Blimp1 in the process of B-cell differentiation and is an important target of Blimp1 in BCL ₁ lymphoma cells. In order for Blimp1 to suppress the c-Myc promoter, various regions of the Blimp1 molecule are needed, including the N-terminal acid domain and the region between aa 90 and 464 (Yu J. et al., Supra).

Oncoprotein c-Myc is important for the control of growth, apoptosis and / or differentiation regulators, and its dysregulation also causes a wide range of neoplasms. Dysregulation of c-Myc expression in B cells often causes tumors. Chromosomal translocation of the c-Myc gene to Ig gene loci is present in most Burkitt lymphomas and murine plasmacytes (Lin K.I. et al. (2000) Mol. Cell Biol. (20) 23: 8684-8695).

Mouse ES cells can be maintained as a pluripotent, self-renewing population using LIF / STAT3-dependent signaling. STAT3 has been shown to regulate the expression of the transcription factor (transcription factor) Myc. It is also believed that activation of Myc is required for adult stem cells. Using RT-PCR (RT-PCR) analysis, it was shown that transcription of Myc is increased in ES cells. Typically, ES cells require a culture medium that includes LIF, otherwise ES cells tend to differentiate rather than self-renew. It was found that Myc levels in ES cells are rapidly destroyed after removal of LIF from the culture, which indicates that it may be necessary for the differentiation of ES cells. Experiments suggest that Myc alone can maintain the state of ES cells (i.e., the pluripotent phenotype) at a level comparable to LIF, and when Myc is inactivated, the stem cell pool decreases (Cartwright P. et al. (2005) Development 132: 885-896).

Protein Arginine-Methyltransferase 5 (Prmt5)

Two types of histone methyltransferases (HMTase) are known which include any SET domain (Suvar3-9, Zeste enhancer, Trithorax), first found in proteins having lysine-specific methylase activity, or a domain with arginine-specific methylase catalytic activity, found in PRMT . PRMTs are divided into types I and II: type I PRMTs catalyze monomethylation and asymmetric di (e?) Methylation of arginine residues, while type II PRMTs catalyze the formation of monomethylated and symmetrically dimethylated arginine residues. Of the six known PRMTs, only PRMT5 (GENBANK registration No: NM_006109 (human); NM_013768 (mouse)) behave like type II PRMTs that can target histones. Specifically, it has been shown that PRMT5 targets specific arginine residues in the H3 and H4 N-terminal tails.

PRMT5 can be associated with chromatin remodeling complexes based on BRG1 and hBRM hSWI / SNF. In such complexes, PRMT5 is able to stimulate cell growth and anchor-independent growth by methylating the arginine 8 residue of histone H3 (H3R8), and thereby reducing the expression of genes such as ST7 and NM23, which are known to be involved in tumor suppression (Richard S . et al. (2005) Biochem. J. 388: 379-386). PRMT5 is also involved in the transcriptional regression of CYCLIN E and CAD.

Blimp1 / Prmt5 complex

The applicant of the present invention proceeded to identify the possible activity of the Blimp1 SET / PR domain, since no specific histone methyltransferase activity was assigned to Blimp1 itself. The applicant has shown that Blimp1 can form a new complex with PRMT5, a complex that is retained in vivo in the mouse germ cell differentiation line until PGC enters the genital tubercles, suggesting that Blimp1 is constantly involved in the generation sequence of early mammalian germ cells. Further analysis, described in more detail below, shows that the new Blimp1 / Prmt5 complex provides unique characteristic epigenetic traits due to methylation of histones H2A and H4. This is believed to be the first example in which methylation of the tail of histone H2A is shown as an epigenetic regulatory mechanism. Further, the experiments described in more detail below show that while Prmt5 is present in pluripotent EG and ES cells, Blimp1 is absent in them.

The expression of Blimp1 in the EU P19 pluripotent cell line leads to repression of the gene, which is known to be expressed in pluripotent cells at a high level. The experiments suggest that the Blimp1 / Prmt5 complex is an important regulator of gene expression and may have a significant effect on the choice of cell fate, in particular with regard to pluripotency and differentiation. For this reason, one embodiment of the present invention includes a gene control mechanism based on the use of different biological activity, using the Blimp1 / Prmt5 complex in vitro or in vivo as an example.

Without binding themselves to any theory, it is believed that in this complex Blimp1 provides the function of targeting genes, since it has five DNA-binding domains in the form of zinc fingers. Prmt5 provides arginine-methyltransferase activity, which serves as HMTase when localized to DNA, resulting in repression of gene expression. The human ortholog Blimp1 is known to bind to the PRDI site in the promoter region of human IFN-β (Keller A.D. & Maniatis T. (1991) Genes Dev. 5: 868-879). As mentioned above, it is also known that Blimp1 is able to repress the expression of c-Myc. According to this invention, a new subset of genes has been identified which, as shown, are specific targets of the Blimp1 / Prmt5 complex and whose expression can be regulated by the new complex. This subset includes genes that have different functions, but are believed to play an important role in regulating potency, cell cycle, differentiation, cell adhesion, epigenetic reprogramming, and possibly also tumor suppression.

According to the invention, the Blimp1 / Prmt5 repressor complex correlates with high levels of H2A / H4R3me2s in germ cells. However, during the differentiation of B cells into plasma cells, Blimp1 controls G9a-dependent H3K9me2. Thus, Blimp1 is able to control the fate choice and properties of various cells through association with various binding partners, and chromatin remodeling (structure) may be the most important for these processes. In addition to the obvious importance of Blimp1 in the early stages of mouse germ cell specification, the present invention demonstrates the additional involvement of Blimp1 in the formation of a unique characteristic epigenetic trait of chromatin observed in germ cells after PGC specification (PZK). However, Blimp1 / Prmt5 exists thanks to PGC nuclei (PZK) and enters the cytoplasm after E10.5, when extensive programming of the entire (total) genome is detected in germ cells. Thus, an understanding of the relationship between the Blimp1 / Prmt5 complex, the symmetric methylation of arginine 3 on H2A / H4 and the subsequent epigenetic reprogramming of the complete genome in germ cells allows us to gain insight into the mechanism (to understand the mechanism) underlying this important process and to understand how nuclear reprogramming is controlled within the cell.

The invention also provides an understanding of the role of Blimp1 / Prmt5 in pluripotent embryonic (EG) gonad cells, the formation of which from PGC is undoubtedly associated with the loss of Blimp1. The present invention provides direct evidence that Blimp1 is key for the repression of nascent and migrating PGCs from the acquisition of a clearly pluripotent stem cell-like phenotype. Therefore, agonists and antagonists of Blimp1 / Prmt5 activity can play an important role in deterring the fate of cells either to the side of the pluripotent phenotype or to the pluripotent phenotype. In addition, the expression of Blimp1 in cells provides a mechanism for blocking the arginine-methyltransferase activity of Prmt5 in the nucleus and away from potential cytoplasmic substrates. Such an effect may be appropriate during the differentiation of stem cells and during the entire cell cycle in a given cell or cell line.

The specific small nucleotide molecules that are used as Blimp1 and / or Prmt5 inhibitors in the invention are short fragments of double-stranded RNA, known as small (short) interfering RNAs (siRNAs). The technology of interfering RNAs (iPHK, RNAi) allows selective activation of vivo gene function. In the present invention, iPHK (RNAi) can be used to inhibit the expression of Blimp1 and / or Prmt5 in cells. In this process, double-stranded mRNAs are recognized and cleaved by a cutting RNase, resulting in 21-23 nucleotide iPHK fragments (RNAi). These RNAi are incorporated into the RNA inducible silencing complex (RISC) and unwind using this complex. Then a single antisense strand directs RISC to an mRNA containing a complementary sequence, which leads to endonucleolytic cleavage of the mRNA (Elbashir et al. (2001) Nature 411; 494-498). Therefore, this technology provides a method for targeting and cleaving Blimp1 and / or Prmt5 mRNAs in somatic cells intended for use in bioprocessing or in cases where it is necessary to stimulate self-renewal of the pluripotent phenotype. Methods for producing siRNA for Prmt5 are described in the art (Richard S., supra). Examples of suitable siRNA sequences for targeting human PRMT5 include:

5 'CTCATTTGCTGACAATGAA 3' [SEQ ID NO: 1]

5 'GGACCTGAGAGATGATATA 3' [SEQ ID NO: 2]

5 'GTTTCAAGAGGGAGTTCAT 3' [SEQ ID NO: 3]

The Blimp1 / Prmt5 complex can be used to identify other proteins and polypeptides that interact with it in the cellular environment. Conventional methods for determining protein-protein interactions, such as double-hybrid screening in yeast, can be used to identify potential agonists and antagonists of the interactivity of the Blimp1 / Prmt5 complex. Also within the scope of the invention is the identification of small molecules that inhibit the association of Blimp1 with Prmt5, for example, by screening or disrupting interaction with those Blimp1 domains that are known to interact directly with other proteins (Yu J. et al. See above). Protein-protein interactions or protein-small molecule interactions involving Blimp1, Prmt5 and / or the Blimp1 / Prmt5 complex can be studied using methods such as BIAcore ^® , which studies molecular interactions using surface-plasma resonance (BIAcore, Inc ., Piscataway, NJ; see also www.biacore.com ).

The screening of molecules and proteins for binding to the Blimp1 / Prmt5 complex can be carried out by automatic high-throughput screening methods. Therefore, the invention includes methods for identifying molecules interacting with the Blimp1 / Prmt5 complex by detecting a positive binding interaction between the Blimp1 / Prmt5 complex and the target molecule. Additional screening steps can be used to determine if the identified positive binding interaction is indeed pharmacologically significant - i.e. whether the target molecule (target molecule) is capable of reducing (decreasing) the biological activity or function of Blimp1, Prmt5 and / or the Blimp1 / Prmt5 complex. If a molecule with a positive reducing effect is identified, the molecule is classified as a 'hit' (hit or hit), and then it can be evaluated as a potential candidate drug. Additional factors can be taken into account at this time, or earlier, such as, for example, absorption (adsorption), distribution, metabolism and excretion (ADME), bioavailability and toxicity profiles of the molecule. If the molecule of the potential drug meets pharmacological requirements, then consider that it is pharmaceutically compatible. Appropriate compositions can be prepared to test in-vitro and in-vivo activity in accordance with standard methods known in the art.

EXAMPLES

Reagents and Methods

Isolation from embryos. Primordial germ cells are isolated from embryos of outbred MF1 mice at various stages of development. The day of introduction of the vaginal swab is designated E0.5. cDNA libraries from single cells were taken from previously published work (Saitou M., Barton S.C. & Surani M.A. (2002) Nature 418, 293-300).

Immunostaining. Prepared embryos containing germ cells are trypsinized to obtain a single cell suspension. Then the cells are allowed to precipitate on sections coated with poly-L-lysine, fixed with 2% PFA (paraformaldehyde), washed three times with PBS and processed further. Whole embryonic genital tubercles in E11.5 are cut, washed in PBS, fixed for two hours at 4 ° C in 4% PFA, washed in PBS and allowed to precipitate in a 20% sucrose solution at 4 ° C. They are enclosed in O.S.T. (BDH) and cryosections are made. Single cells or sections were permealized in IF buffer (PBS; 0.1% Triton; 10 mg / ml BSA). Primary antibodies were incubated at 4 ° C and then washed three times in IF buffer and incubated with secondary antibodies (Alexa 564, Alexa 488; Molecular Probes) for two hours at room temperature and washed in PBS. Then the slices are enclosed in a Vectashields environment with DAPI (Vector laboratories). Immunofluorescence is observed using a BioRad radiance 2000 confocal microscope. The following antibodies and dilutions are used: PGC7 (from T. Nakano; 1: 2500), Oct4 (BD Transduction Laboratories; 1: 200), TG1 (mouse germ-specific monoclonal antibody against SSEA1; 1: 1), Blimp1 (from K. Calame; 1:10), Prmt5 (Firm Upstate; 1: 250), Prmt1 (Upstate, 1: 200), H4R3me2s (Abeam; 1: 1000), Dhx38 / Prp16 (Proteintech Group; 1: 200), Ezh2 (Upstate; 1:50), G9a (Abeam ™; 1: 100), Pfm1 (Abeam ™; 1:50), Set1 (from W. Herr; 1: 200).

Immunoprecipitation analyzes and preparation of nuclear extracts. The coding region of murine Blimp1 was amplified by RT-PCR and the product was cloned into pcDNA3-MycHisA to obtain the construct pCMV-MycBlimp1. 293T or P19 cells transfected with either the original vector (called pCMV-Myc) or pCMV-MycBlimp1 are washed with PBS and lysed in IP buffer containing 150 mM NaCl, 1% NP40, 0.1% Triton, 50 mM Tris (Tris) pH 8.0 and a complete protease inhibitory cocktail (Roche).

In a typical immunoprecipitation reaction, 2 × 10 ⁷ cells are used. The whole cell extract is incubated with 2 μg of Myc antibodies (New England Biolabs). Alternatively, antibodies to either Prmt5 or Prmt1 (Upstate) are used overnight at 4 ° C. Then add 30 μl of granules of protein A / G Sepharose and incubated for 2 hours at 4 ° C. The granules are washed five times in IP buffer. Bound proteins are eluted by boiling in a Lamley sample buffer. Nuclear extracts of ES, EG, or P19 cells are prepared in accordance with the manufacturer's instructions (nuclear extract kit; Active Motif), and 25 μg of the nuclear fraction is used per load.

In vitro methyltransferase assays. The granules from 293T immunoprecipitation analyzes of cells were transfected with either pCMV-Myc or pCMV-MycBlimp1, treated with additional washing twice in HMTase buffer (25 mM NaCl, 25 mM Tris pH 8.8), and the HMTase assay described in ^{18 was used} , with slight modifications. Briefly, 1 μg H3 or H2A (Roche) or recombinant H2A (kind gift from A. Brehm), as a substrate, and 2 μCi S-adenosyl-L- [methyl- ³ H] methionine ([ ³ H] SAM; Amersham Biosciences), as a methyl group donor, was incubated in a mixture of 20 μl of HMTase assay buffer for three hours at 37 ° C. Proteins were separated in an 18% SDS-PAGE gel, transferred to a PDVF membrane and visualized by Ponceau staining and fluorography. In vitro methylated rH2A microsequenced (determined the primary sequence of the short fragment) stepwise degradation according to Edman (Protein and Nucleic acid Chemistry Facility, Cambridge University, UK), then ³ H inclusion of individual amino acids was determined by scintillation counting. To study Н2А / Н4 specific methylation, Н4, Н3, Н2А and Н2В (Roche) are incubated in the presence of the immunoprecipitated Blimp1 and SAM complex as described above and Western blotting is performed using H4R3me2s antibodies (Abeam ™, Cambridge, UK), which are tested for their specificity by competitive analysis (see appendix, Fig. 8).

Chromatin Immunoprecipitation (ChIP) Cloning and ChIP. Single cell suspensions are crosslinked in 1% formaldehyde for 10 minutes at room temperature. Then the cells are destroyed and the nuclei are lysed in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, followed by centrifugation. The extract is immunoprecipitated as described above, adding purified IgG (Santa Cruz) as a negative control. The granules are then eluted twice in 50 mM NaHCO ₃ , 1% SDS, and the supernatants are treated with proteinase K for 5 hours at 65 ° C, followed by purification with phenol / chloroform and precipitation (precipitation) with alcohol. Then, PRMT5 (Upstate) or H4R3m32 (Abeam ™) ChIP samples are analyzed by standard PCR reaction using the following primers (1for (direct) ccaggaggggtttcatcaactg [SEQ ID NO: 4] and 1rev (reverse) tgttaccgtctcacttggtgtttg [SEq EDgct: [SEQ ID NO: 6] and 2rev ttcgttttctgcgtccgtg [SEQ ID NO: 7]; 3for tttgtcgcagtgtcttatcgtaac [SEQ ID NO: 8] and 3rev taggaaggtgttggggaggg [SEQ ID NO: 9]; 4for atgaggtgtggtggggtgg [SEQ ID NO: 11]). In the case of the ChIP cloning assay, two consecutive immunoprecipitation cycles are performed using anti-Myc antibodies. Next, DNA precipitation (precipitation) is carried out, which is "blunted" at the ends of T4 by DNA polymerase, and then ligated to annealed JW102 and JW103 ²⁵ . Then, the ligation products are PCR amplified with JW102 (one cycle 55 ° C 2 min; 72 ° C 5 min; 94 ° C 2 min and 20 cycles 94 ° C 30 s; 55 ° C 30 s; 72 ° C 1 min and, finally one cycle 72 ° C 5 min). PCR products are cloned into pGEM-T (Promega), colonies are checked for insertion by PCR, and the products are sequenced by standard methods. A software search is then performed using online bioinformatics sources such as Ensembl ( http://www.ensembl.org ).

Example 1: Determination of Blimp1 Activity

Significant epigenetic modifications occur immediately after the specification of murine PGC (PZK), including methylation and acetylation of histone ends with methyltransferases (HMTase) and acetyltransferases (HAT), respectively. Among the candidate genes that can be involved in the regulation of epigenetic changes in PGC are HMTase, which belong to the protein family with a conserved SET / PR domain. Twenty-five genes containing the SET / PR domain are analyzed in E7.5 PGC and in adjacent somatic cells and Blimp1, G9a, Set1, Ezh2 and Pfm1 are expressed in the embryonic region containing PGC (Fig. 1b and Fig. 7). However, only Blimp1 expression is limited to PGC at E7.5, and its expression is then retained in the germ cells.

To study the activity of the Blimp1 domain, SET / PR first established that Myc-labeled murine Blimp1, after transient expression in 293T cells, can be subjected to effective immunoprecipitation using anti-Myc antibodies (Figure 2a). The immunoprecipitate can then be subjected to a standard radioactive assay of histone methyltransferase activity by histone H3 (Rea, S. et al. (2000) Nature 406, 593-9). A relatively weak signal corresponding to H3 is observed, but unexpectedly also noticeable bands are found corresponding to histones H2A and H4 (Fig.2b), and, by Western blotting, the latter is present as a small impurity (low levels) in the H3 preparation (data not are given). It was concluded that a weak signal on H3 could be caused by Blimp1-associated G9a, as previously reported for B cells (Gyory et al., See above). However, germ cells do not show significant dimethylation of lysine 9 in histone H3 (H3K9me2), which is the main modification attributed to G9a, and the loss of G9a function does not significantly affect the PGC specification. Therefore, it was decided to focus on the observed activity obtained by immunoprecipitation of Blimp1 on H2A and H4 histones.

Due to the novelty of the discovery of the H2A tail methylation, it was decided to first test the methyltransferase activity of the immunoprecipitate on preparations of calf thymus and recombinant H2A, and it was found to have strong methylating activity for this histone (Figure 2b). To identify the target (s) amino acid residue (s) on the H2A tail, the radiolabeled recombinant protein product of the methyltransferase activity assay is subjected to stepwise Edman degradation. By counting scintillations in the fraction of liberated amino acids, radioactive labeling of rH2A R3 is detected (Fig. 2c). The same results are obtained on preparations of calf thymus and recombinant H4 (data not shown). This is a logical result, if we take into account the conservation of the amino acid sequence of the first N-terminal residues of histones H2A and H4 (Fig.2d). It is known that methylation of H4 R3 plays an important role in the regulation of transcription. However, these results predict the existence of additional new methylation of R3 on histone H2A.

Example 2: Blimp1 / Prmt5 Complex Identification

Since the SET / PR domains are associated with histone methyl transferase activity only on lysine residues, it was reasonable to assume that the arginine methylating activity detected above could not be caused by Blimp1, but should be associated with another HMTase present in the immunoprecipitate. It was previously reported that two arginine methyltransferase proteins, Prmt1 and Prmt5, mediate histone H4 R3 methylation. Prmt1 is a class I arginine-methyltransferase, resulting in NG-monomethylarginine (Rme1) and asymmetric NG, N'G-dimethylarginine (Rme2a) on various types of substrates. As indicated above, Prmt5 is a class II arginine methyltransferase, which is responsible for arginine monomethylation (Rme1) and symmetrical NG, N'G dimethylation (Rme2s) (Fig. 8) 20. To check whether these proteins can really be associated with In vivo Blimp1, their expression is analyzed in the resulting PGC and neighboring somatic cells using the single cell cDNA libraries described above. It was found that Prmt1 is excluded from PGC in E7.5, while Prmt5 is present in both PGC and somatic cells (data not shown). However, at the protein level, Prmt5 shows nuclear staining and becomes highly enriched in PGC compared to somatic cells from E8.5 onwards (Fig. 3a, b; Fig. C1b and see below). On the other hand, at these stages, Prmt1 is found mainly in the cytoplasm of germ cells (Fig. 3c).

Then it was decided to check which enzyme, Prmt5 or Prmt1, interacts with Blimp1. Indeed, it was found that labeled Myc Blimp1 can undergo effective co-immunoprecipitation with endogenous Prmt5 in 293T cells (Figure 3D). The converse is also true, Prmt5 can also pull the tagged Myc Blimp1 (Fig. 3d). In contrast, no interaction between labeled Myc Blimp1 and endogenous Prmt1 (Fig. 3e) can be detected. These experiments confirm that Blimp1 and Prmt5 can complex in 293T cells. Considering the overlapping expression of these proteins in PGC (Fig. 3a, b; Fig. C1b), it is logical to imagine that Blimp1 and Prmt5 are parts of the same protein complex in PGC and that this complex can occur elsewhere during development or in normal as well as tumor adult tissues.

Example 3: Activity of the Blimp1 / Prmt5 complex in vivo

The specificity of the anti-H4R3me2s antibody was checked and shown to effectively recognize both histones H2A and H4 from the calf thymus (Fig. 8b, left drawing, H2A and H4 are also present as impurities in the preparations H3 and H2B). In a competitive assay, this antibody is effectively titrated with an H4 (1-9C) peptide containing R3me2s (Fig. S2c). In addition, this antibody also recognizes the Blimp1 / Prmt5 HMTase assay product for both H4 and H2A (Fig. 52b, right figure), thereby providing additional evidence that the complex is characterized by the symmetric dimethylating activity of Prmt5 rather than the asymmetric dimethylating activity Prmt1 activity.

When using antibodies specific for the modification of H2 / H4R3me2s, PGCs isolated from early embryos are analyzed by immunohistochemical methods. In E8.5, H2A / H4R3me2s is clearly observed in PGC and somatic cells (Fig.3f), but in E10.5 a significantly higher accumulation of H2A / H4 R3me2s is observed mainly in germ cells (Fig.3f). However, when another antibody is used that recognizes mono- and / or asymmetric dimethylation of H4R3 (H4R3me1 and H4R3me2a), it is observed that this modification in PGC is in E8.5, but not in E10.5 (data not shown). Joint results with these two antibodies show an increase in H2A / H4R3me2s in PGC from E8.5 to E10.5. These results demonstrate the presence of a specific characteristic property of chromatin during germ cell development, which is believed to be determined by the combined presence of Prmt5 and Blimp1. It is important to note that there are many additional modifications of histone tails that contribute to the chromatin structure specific to germ cells. Recently, a loss of Blimp1 function has been shown to lead to abnormal development of PGC-like founder cells that stop proliferating (Ohinata, Y. et al. (2005) Nature 5, 5).

Example 4: In vivo Identification of Blimp1 / Prmt5 Complex Targets

As shown earlier, Blimp1 can direct gene regulation in the process of cell differentiation through the recruitment (attraction, replenishment) of interaction factors to specific sites. To identify the alleged Blimp1 targets, a chromatin-identification cloning method is used in which the Myc-labeled Blimp1 variant is first overexpressed in 293T cells. The nuclear extracts from these 293T cells are immunoprecipitated with anti-Myc antibodies, and the immunoprecipitated DNA is extracted, purified, stapled at the blunt ends using linkers and PCR amplified and cloned. Several clones are selected and analyzed by sequencing followed by BLAST analysis to map cloned inserts. Of the 32 clones, 11 correspond to regions localized near regulatory sequences or in suitable regulatory sequences of known genes (see Table 1).

Table 1 Gene hit (hit, hit) supposed function Dhx38 region 5 'against the course of transcription signal transmission / cell cycle Pcdh7 region 5 'against the course of transcription cell adhesion Q8C9T7 intron chromatin regulation Xylt1 nitron metabolism Dnah1 intron cytoskeleton / sperm motility Balp2 intron signal transmission / organization of the cytoskeleton Nek7 1st intron cell cycle regulation Dusp2 region 5 'against the course of transcription signal transmission / cell cycle ENSMUSG00000027041 intron metabolism Sirt4 2nd intron metabolism / regulation of transcription Blimp1 3'UTR transcription

Example 5: a Study of the control of gene expression of Dhx38 using the complex Blimp1 / Prmt5

Among the possible identified Blimp1 targets, Dhx38 is chosen for study. Dhx38 is a conserved gene encoding a DEAH-boxing RNA helicase (also known as Prp16), which is required in C. elegans for post-translational regulation of sex-determining genes when spermatozoa are switched to oocytes (Graham, PL & Kimble, J. (1993 ). Genetics 133, 919-31). A detailed study of the Dhx38 locus revealed that it contains four GGGAAAG motifs corresponding to the Blimp1 consensus binding site: two in the 5 'region and two in the 3' (downstream) region of the transcription start site (Fig. 4a). Although the currently available anti-Blimp1 antibody works in immunostaining methods, it cannot be used for effective immunoprecipitation of Blimp1 (data not shown). Therefore, Prmt5 is used to find out whether Dhx38 is a target for the Blimp1 / Prmt5 complex in germ cells. ChIP analysis using Prmt5 antibodies is carried out on PGCs contained in suspensions of genital tubercle cells from E10.5 embryos, the phases when Blimp1 and Prmt5 are coexpressed in the nuclei of germ cells (see above). Indeed, it was found that Prmt5 can specifically delay nucleotides that span the sequence from +7152 to +7541, spanning exon 11 of the Dhx38 gene, which contains the Blimp1 consensus binding site (Fig. 4b). The other three putative binding sites are not associated with Prmt5 in our ChIP assay. These results show that Prmt5 are recruited to Blimp1 targets such as Dhx38, suggesting that the Blimp1 / Prmt5 complex regulates the expression of such target genes in germ cells.

The expression / repression of Dhx38 in PGC is considered considering that Dhx38 is a target of the Blimp1 / Prmt5 complex in germ cells. It was found that Dhx38 is not detected in E10.5 and E11.5 (Figa). However, to E12.5, Dhx38 is activated in both female and male PGCs (Fig. 5a), which strikingly exists in parallel with the delocalization of Prmt5 and Blimp1 from the nucleus to the cytoplasm in germ cell B E11.5 (Fig. 5b). In E12.5, both Prmt5 and Blimp1 are absent in PGC nuclei (data not shown). Activation of Dhx38 immediately precedes the blockade of meiosis and mitosis of female and male germ cells, respectively. Therefore, there is an inverse relationship between Blimp1 / Prmt5 and Dhx38 expression. These results indicate that Blimp1 and Prmt5 can function in the repression of transcription of target genes, such as Dhx38, in germline cells. This repression appears to be lifted when germ cells enter the genital tubercle and both Blimp1 and Prmt5 undergo translocation from the nucleus to the cytoplasm. It should be noted that arginine methylation in histone is mainly associated with transcriptional activation, although recently the activity of H3R8me associated with Prmt5 has been associated with reduced gene expression (Pal S. et al., See above). Further, since both Blimp1 and Prmt5 were previously reported to be transcriptional repressors, it is possible that the symmetric dimethylation of the arginine residue associated with the Blimp1 / Prmt5 complex in germ cells presented in this description will facilitate gene repression.

Example 6: Blimp1-Prmt5 Complex in Pluripotent Stem Cells

In order to better understand the role of the Blimp1 / Prmt5 complex, it was decided to study pluripotent embryonic germinal (EG) cells. EG can be obtained from isolated PGCs in vitro and, therefore, can be considered as the closest cell line equivalent to PGC. It was found that EG cells are positive for Prmt5, but unlike PGC, Blimp1 is absent in them (Fig. 6a, b). In accordance with these results, it was found that EG cells are also positive for Dhx38, suggesting that expression of this gene might be caused by the absence of Blimp1 (Fig. 6a, b). To restore the Blimp1 / Prmt5 repression complex, labeled Myc Blimp1 is overexpressed in EG cells. However, these attempts lead to strong cytotoxicity after 12 h of cell transfection, while the viability of control EG cells transfected with pCMV-Myc is not impaired (data not shown). Similar results were also obtained with pluripotent embryonic stem (ES) cells (data not shown).

P19 mouse pluripotent embryonic carcinoma (EC) cells of the P19 line are selected, which also have pluripotency signs similar to EG and ES cells. Indeed, in P19 cells, like ES / EG cells, expression of Prmt5 and Dhx38, but not Blimp1, is observed (Fig. 6b, c). It was found, however, that these cells are tolerant to Blimp1 expression and therefore use precipitation, which has indeed confirmed that overexpressed Myc-Blimp1 interacts with Prmt5 in murine EC cells (Fig. 6c). It should be noted that this unstable (temporary) Blimp1 / Prmt5 complex then causes down regulation of Dhx38 in P19 cells (Fig.6c). ChIP analysis confirms that this down-regulation of Dhx38 is accompanied by elevated levels of H2A / H4R3me2s at the Dhx38 locus (Fig. 6d). These results support the view that the Blimp1 / Prmt5 complex is responsible for the repression of target genes, such as Dhx38, which are also likely in PGC.

Although specific embodiments of the invention are disclosed in detail herein, this is done by way of examples and for purposes of illustration only. The foregoing embodiments of the invention are not intended to limit the scope of the appended claims presented below. Applicants believe that various replacements, changes and modifications can be made to the invention without departing from the essence and scope of the invention in accordance with the claims.

Claims (11)

1. An isolated polypeptide complex that is involved in the epigenetic control of gene expression in a mammal, containing the Blimpl protein or its PRD1 homolog, having a site-specific DNA-binding activity, and the PRMT5 protein having arginine-methyltransferase activity, and the PRMT5 protein is capable of methylating the arginine residue localized at position 3 in the N-terminal region of histone H2A. 2. A method for controlling gene expression in a mammalian cell, which involves inducing the formation of a polypeptide complex in a cell that is involved in the epigenetic control of gene expression in a mammal containing the Blimpl protein or its homologue PRD1 having a site-specific DNA-binding activity and PRMT5 protein, having arginine-methyltransferase activity, moreover, PRMT5 protein is able to methylate an arginine residue located at position 3 in the N-terminal region of histone H2A, and control of gene expression leads to the expression of one or more genes contained in the group consisting of: c-Myc; Dhx38; Pcdh7; Q8C9T7; Xylt1; DnaH1; Baip2; Nek7; Dusp2; ENSMUSG00000027041; Sirt4; and Blimp1. 3. The method according to claim 2, characterized in that the formation of the polypeptide complex is induced in the cell by inducing the expression of a nucleic acid encoding a PRDI / Blimp1 polypeptide in the cell. 4. The method according to claim 3, characterized in that the expression of a nucleic acid encoding a PRDI / Blimp1 polypeptide is induced in the cell by transfection of the cell with an expression vector that encodes a Blimp1 polypeptide. 5. The method according to claim 2, characterized in that the formation of the polypeptide complex is induced in the cell by transfection of the cell with a nucleotide expression vector containing:
one or more coding sequences operably linked to a promoter sequence, wherein one or more coding sequences encode at least a first polypeptide comprising a Blimp1 protein or its PRD1 homolog having a site-specific DNA-binding activity, and at least a second polypeptide comprising a PRJV1T5 protein having arginine methyl transferase activity. 6. The method according to any one of claims 2 to 5, characterized in that the mammalian cell is a human cell. 7. The method according to any one of claims 2 to 6, characterized in that the mammalian cell is a tumor or cancer cell. 8. The method according to any one of claims 2 to 7, characterized in that the method is carried out in vitro. 9. The method according to any one of claims 2 to 7, characterized in that the method is carried out in vivo. 10. The method according to any one of claims 2 to 9, characterized in that the induction of the polypeptide complex in the cell leads to a decrease in the expression of one or more genes presented in claim 2. 11. A method for identifying a molecule capable of antagonizing the biological activity of a polypeptide complex according to claim 1, comprising determining and identifying a candidate compound for binding to PRDI / Blimp1, PRMT5 and / or the PRDI / Blimp-PRMT5 complex compounds as a molecule interacting with the PRDI / Blimp1-PRMT5 complex, characterized in that the compound that binds to PRDI / Blimp1, PRMT5 and / or the PRDI / Blimp-PRMT5 complex and which inhibits the biological activity or function of the PRDI / Blimp1 complex -PRMT5 according to claim 1, is identified as an antagonistic molecule.

Images