BRPI0710324A2 - complex epigenetic report for controlling gene expression - Google Patents

Abstract

EPIGENETIC REGULATORY COMPLEX FOR THE CONTROL OF GENETIC EXPRESSION An epigenetic regulatory complex of polypeptides contains, at least, a first domain with dirty-specific DNA binding activity and at least a second domain with an arginine methyltransferase activity, in which the second domain is capable of methylation of an arginine residue located in the caudal region of an H2A histone. The complex is capable of regulating gene expression in cells, especially in mammalian stem cells, by controlling R3 methylation in the caudal regions of histones H2A and H4. The complex is exemplified by a polypeptide complex that comprises Blimpi's DNA-binding activity and Prmt5 arginine methyltransferase activity

Description

REGULATORY EPIGENETIC COMPLEX FOR CONTROL OF GENETIC EXPRESSION

FIELD

The invention is in the field of epigenetic regulation of genetic expression. The invention is particularly related to compositions and methods comprising the activity of histone methyltransferase, which targets in vivo and in vitro control of gene expression.

HISTORIC

Epigenetics refers to the transmission of information from a cell or a multicellular organism to its descendants without encoding that information in the nucleotide sequence of genes. Epigenetic controls are typically established by chemical modification of DNA or structured chromatin. Gene expression may be moderated, for example, by methylation and acetylation of histones associated with genomic DNA. Histone methylation and acetylation tend to occur at the histone tail, a domain that has an exposed surface and has a positive net charge due to an abundance of amino acid residues such as arginine (R) and lysine (Κ). The chemical modification of the histone flow rate is moderated by enzymes with histone methyltransferase activity (HMTases) and histone acetyltransferase activity (HATs).

Epigenetic changes may occur at different times during the normal development of an organism, and may also occur during the transformation of normal cells into cancer cells. These modifications often result in the silencing or activation of certain genes. In cancer, it is well documented that most tumor cells show abnormal epigenetic DNA impressions (Feinberg AP & Vogelstein B, (1983) Nature 1 (5895): 89-92).

Stem cells are cells capable of both extensive self-renewal and differentiation in progenitors. Thus, they are also potential candidates for the origin of cancers. Stem cells may have a long life span, as they acquire genetic mutations and epigenetic modifications that may increase the tendency of malignancy. It is postulated that, since stem cells occupy a very delicate niche equilibrium between competing interests of proliferation and differentiation, small but profound epigenetic changes may cause imbalances in favor of a cancerous stem cell phenotype. An assessment of why and how epigenetic changes are regulated is critical for understanding, detecting and treating cancer, and specifically treating cancer stem cells. Indeed, it is believed that one of the factors present in recurrent, aggressive, and difficult-to-treat cancers is the fact that ostumus may contain cancerous stem cells that do not respond to conventional therapies.

Somatic cell nuclear transfer (SCNT) is used to generate animals for livestock production (for cloning or stem cell therapy), for protein abiofabrication and for the generation of disease models (Wilmut I, BeaujeanN, de Sousa PA, Dinnyes A, King TJ, Paterson LA, Wells DN, Young LE (2002) Nature Oct 10: 419 (6907): 583-6). One of the problems associated with SCNT's efficiency and success rates is that the somatic cell genome comprises extensive and stable epigenetic markings that can obstruct successful reprogramming. In addition, the recipient egg may comprise factors that exert epigenetic effects that may also contribute to the failure of the procedure. Thus, there is a need to provide compositions and methods that improve the efficiency of SCNT and, consequently, bioprocessing applications that are facilitated by this procedure.

Specifying primordial germ cells (PGCs) in mice has provided an attractive experimental model for analyzing the effects of epigenetic modifications in vivo. A founding population of approximately 45 PGCs is first detected at E7.5 in mouse embryos (Ginsburg, M., Snow, H., & McLaren, A. (1990) Development 110, 521-8). After that, these PGCs migrate and enter the genital bridges from E 10.5 onwards, where extended germ cell epigenetic programming continues. By E 13.5, germ cells enter female nagoned meiotic prophase and mitotic arrest in male gonads.

Significant epigenetic changes follow immediately after PGC specification, including methylation and acetylation of histone tails by MHTases and HATs, respectively (Surani et al., 2004 (CSH Symposium); Seki et al. 2004; Lachner, M., O1SuIIivan, RJ & Jenuwein, T. (2003) J Cell Sci 116, 2117-24, and Vaquero, A., Loyola, A. & Reinberg, D. (2003) Sci Aging Knowledge Environ 2003, RE4). Among the presumed candidate genes to play a role in regulating these epigenetic changes in PGCs are the HMTases that belong to the SET / PR domain protein family.

Consequently, there is a need to provide reagents and methods that improve the control of epigenetic regulatory mechanisms in the cell. There is a special need for compositions and methods that allow greater control of gene expression in order to influence cell fate decisions in stem cells and cancer cells.

SUMMARY A first aspect of the invention provides an isolated polypeptide complex which contains at least one first domain with site-specific DNA binding activity and at least a second domain with arginine methyltransferase activity, in which the second domain is capable of methylation of an arginine residue located in the caudal region of a H2A histone.

In a specific embodiment of the invention, the second domain has an arginine methyltransferase activity that provides a symmetrical NG, N'G dimethylation of an arginine residue, suitably an arginine residue located at position 3 in the caudal region of a H2A histone (H2AR3). Optionally, the second domain is still capable of methylating an arginine residue located in the caudal region of histone H4, suitably an arginine residue located in position 3 in the caudal region of a histone H4 (H4R3). In one embodiment of the invention, the activity of arginine methyltransferase is comprised of a domain of arginine methyltransferase Prmt5 or a derivative or homologue thereof.

According to the invention, the first domain may be specifically targeted for binding to one or more consensus sequences in a mammalian genomic DNA involved in controlling gene expression. Typically, but not exclusively, such sites may be located in non-coding promoter regions, untranslated regions, or introns. In a specific embodiment, the DNA binding domain of the invention is capable of binding to a PRDI / Blimpl-like binding site, which has a four GGGAAAG motif consensus sequence, two 5 'promoter region of the target gene, and two below, at the site of transcription initiation. Suitably, the DNA binding domain comprises a Blimp 1 protein, a DNA binding protein of a PRDI / Blimpl polypeptide or a homolog or derivative thereof.

A second aspect of the invention provides a nucleic acid expression vector construct which is suitable for inducing expression of a polypeptide complex in a mammalian cell, wherein the vector comprises: one or more coding sequences operably linked to a promoter sequence , wherein one or more coding sequences encode at least a first site-specific DNA-binding polypeptide domain and at least one second arginine methyltransferase activity polypeptide domain, where the first domain is specifically directed for binding to one or more consensus sequences in a mammalian genomic DNA that are involved in gene expression control and the second domain has arginine methyltransferase activity that provides a symmetrical NG, N'G dimethylation of an argininalised residue on a polypeptide substrate.

According to a specific embodiment of the invention, the polypeptide substrate is a histone. Optionally, the second polypeptide domain is capable of methylating an arginine residue located at position 3 of the caudal region of a histone H2A (H2AR3) and also an arginine residue located in the caudal region of histone H4.

Suitable expression vectors include plasmids, cosmids, viral vectors and artificial chromosomes, such as YACs. Optionally, the promoter sequence may be selected from a constitutive promoter or an inducible promoter. Suitable inducible promoters include the well characterized Tet or Tamoxifen regulated systems. Alternative systems may include heat shock sensitive promoters.

In one embodiment of the invention, the expression vector comprises an expression cassette in which a first coding sequence encodes the first polypeptide domain and a second coding sequence expresses the second polypeptide domain. Optionally, the first coding sequence encodes a PRDI / Blimpl polypeptide and the second coding sequence encodes Prmt5 opolipeptide. In specific embodiments, it may be advantageous for the first and second coding sequences to be separated by one or more interposed sequences. Suitably, one or more intervention sequences may comprise at least one internal ribosome input sequence (IRES) so as to facilitate bicistronic expression of the first and second decoding sequence in the cell. Expression vectors of the invention may also comprise one or more nucleic acid sequences encoding a polypeptide selected from: a selection marker; a marker of antibiotic resistance; and a rapporteur.

A third aspect of the invention provides a method for controlling gene expression in a mammalian cell comprising inducing cell formation of a polypeptide complex that contains at least a first domain with site-specific DNA binding activity and at least , a second domain with arginine methyltransferase activity, in which the second domain is capable of methylating an arginine residue located in the caudal region of a H2A histone. In a specific embodiment, the formation of the polypeptide complex is induced in the cell by inducing expression of a PRDI / Blimpl polypeptide, or a homologue or derivative thereof, in the cell. In a specific embodiment, expression of the PRDI / Blimpl polypeptide is induced in the cell by transfecting the cell with an expression vector encoding a Blimpl polypeptide, or a derivative or homologue thereof. Optionally, expression of the PRDI / Blimpl polypeptide is induced in the cell by transfecting the cell as an expression vector previously described. Typically, the mammalian cell is a human cell derived from the tissue or in the form of a cell line. In a particular embodiment of the invention, the mammalian cell is a neoplastic or cancer cell or lineage. Suitably, the method of this aspect of the invention may be performed in vitro and in vivo.

In a specific embodiment of the invention, control of gene expression results in the control of expression of one or more of the selected c-Myc group-consisting genes; Dhx38; Pcdh7; Q8C9T7; Xyltl; DnaHl; Baip2; Nek7; Dusp2; ENSMUSG00000027041; Sirt4; and Blimpl. Induction of the polypeptide complex in the cell may lead to a reduction in expression of one or more of these genes.

A fourth aspect of the invention provides a method for promoting self-renewal and inhibiting stem cell differentiation which involves inhibiting the deformation of a Blimp 1 / Prmt5 complex in the stem cell. Optionally, the stem cell is a mammalian stem cell, suitably a human stem cell. In specific embodiments of the invention, the stem cell is selected from the group consisting of an adult stem cell; a stem cell parent; and a pluripotent stem cell. It will be interesting if the invention is in no way directed at human reproductive cloning or manipulation and use of human embryos for purposes of facilitating human reproductive cloning.

In a specific embodiment of this aspect of the invention, inhibition of the formation of a Blimpl / Prmt5 complex in the stem cell is accomplished by exposing the cell to a Blimpl inhibitor compound, a Prmt5 inhibitor compound and / or a Bllimpl / Prmt5 complex inhibitor. Suitably, the inhibitor compound may be selected from a small molecule inhibitor; a siRNA molecule that binds to Blimpl or Prmt5 mRNA; an antisense oligonucleotide that binds to Blimpl or Prmt5 mRNA; and a predominantly negative version of the Blimpl or Prmt5 polypeptide.

A further aspect of the invention provides a method for controlling localization of Prmt5 in a cell, the typical localization of endogenous Prmt5 comprising inducing cell expression of a Blimpl polypeptide, thereby inducing the formation of a Blimpl / Prmt5 complex in the cell. Cell-induced Blimpl may be exogenous Blimpl or endogenous Blimpl. Suitably, the cell may be a mammalian stem cell. Further aspects of the invention provide uses of the polypeptide complexes of the invention in the treatment of cancer, and for cells - suitably mammalian / human cells - comprising the expression vector constructs described above.

DESCRIPTION OF DRAWINGS

Figure 1 shows (a) a summary of major events during germ cell specification and development in E7.5-E12.5 mice, and (t>) analysis of SET / PR domain gene expression by PCR of cDNAs from single cells of 2 representative founding PGCs (gray) and 2 somatic cells (white). Black fields indicate detection of expression in PGCs and somatic cells;

Figure 2 shows the Blimpl complex of the immunoprecipitated mouse exhibiting arginine methyltransferase activity, (a) Myc-labeled mouse Blimpl or corresponding control was expressed as indicated in 293T cells. Myc immunoprecipitates were analyzed by the Western Blot technique using Myc antibodies; (b) the same immunoprecipitates were used for purified HMTasecontra histone H3 assays; Recombinant H2A and H2A (rH2A). Fluorogram (F) and Ponceau stained membrane (P) are shown for each; (c) rH2A radiolabeled microsequence, the χ axis shows amino acids 1 through 14 of rH2A, the y axis indicates the [3H] -incorporation of individual amino acid residues as counts per minute (cpm); and (d) Alignment showing the conservation of the N-end extreme sequence! of H4 and H2A.1;

Figure 3 shows overlapping expression of Blimpl and Prmt5 in germ cells leads to specific H2A / H4R3me pattern, (a, b, c) The expression pattern of Bllimpl, Prmt5 and Prmtl in PGCs at different developmental stages was detected by immunostaining with Blimpl (a), Prmt5 (b) and Prmtl (c) specific antibodies, germ cells were detected as shown using antibodies against stella / PGC7, Oct4 or TG1 / SSEA1, fused images are shown with DAPI stained DNA; (d, e) Myc-labeled mouse Blimpl or corresponding control was expressed as indicated in 293T cells, immunoprecipitated Myc, Prmt5 or Prmtl were analyzed by Western Blot technique using Prmt5, Myc or Prmtl antibodies, the asterisk marks a non-specific signal; and (f) germ cell H2A / H4 R3 methylation was assessed by immunostaining in PGCs at different indicated stages of development with H4R3me2s antibodies, germ cells are co-stained with stage-specific countermarking antibodies, called Oct4 or TG1 / SSEA1, fused images are shown with DAPI-stained DNA, scale bar: 10 μm (scale is identical in all figures). Figure 4 shows in vivo identification of Dhx38 genomic nolocal Blimpl / Prmt5 linkers, (a) positions of Putative Blimpl binding sites Dhx38 transcription start (TS) and start codon (ATG) transcriptional neighborhood, amplified sequences for the ChIP assay are also shown (A, B, C, D) (b) Interaction of Prmt5endcene with genomic DNA of the Dhx38 site by ChIP assay, supernatant (s) or nuclear (n) fractions of embryo-isolated genital bridge cell extracts isolated from embryos E 10.5 were immunoprecipitated and Prmt5 or IgG antibodies, caudal (+) genomic DNA, and water (-) were used as controls.

Figure 5 shows Dhx38 expression is stimulated in germ cells as Blimpl and Prmt5 translocation of the cytoplasm nucleus, resulting in a decrease in the modification levels of H2A / H4R3me2s; immunostaining of (a) Dhx38, (b) Blimpl ePrmt5, and (c) H2A / H4R3me2s was performed on genital bridge cryosections at the developmental stages as indicated; germ cells were detected using specific antibodies; stella / Pgc7, Oct4 or TG1 / SSEA1, fused images are shown with DAPI-stained DNA, scale scale: 10 μιτι (scale is identical for all figures).

Figure 6 shows analysis of Blimpl, Prmt5 and Dhx38 in pluripotent EG cells and embryonic carcinoma (EC) (a) Immunostaining for Blimpl, Prmt5 and Dhx38 was performed on EG cells, fused images are shown with DAPI stained DNA; inverse relationship between the expression of Dhx38 and Blimpl; (b) Western blot analysis of ES, EG or EC extracts (p19) for Blimpl and Oct4; (c) Blimpl from Myc-labeled mouse was expressed as indicated in Pm pluripotent EC cells, Prmt5 immunoprecipitated cells were analyzed by Western blot technique using Prmt5, Blimpl or Dhx38 antibodies, tubulin levels showing equal line loading were detected using anti-HIV antibody. tubulin; note Dhx38 repression when Blimpl is introduced into EC cells (P19); (d) High levels of H4R3me2s at theDhx38 site of Myc-Blimpl (P19) transfected EC cells tested by ChIP, P9 cell extracts were immunoprecipitated with Myc or H4R3m22s antibodies; A, B, C, D refer to regions at the Dhx38 site containing Blimpl binding sites as explained in Figure 4.

Figure 7 shows (a) immunofluorescence analysis of SET / PRcandidate domain genes from the E7.5 PCR expression screen shown in Figure 1; immunostaining of cells isolated from E8.5 embryos with specific antibodies against specific histone methyltransferase as indicated; germ cells were detected using germ cell specific antibodies, Oct4 or Stella / PGC7; (b) co-immunostaining of Blimpl and Prmt5 using corresponding antibodies in E8.5 PGCs, germ cells are marked by tissue non-specific alkaline phosphatase (AP) expression, fused images are shown with DAPI stained DNA, scale bar: 10 μιτι (scale is identical for all figures).

Figure 8 shows the characterization of H4 R3me2s antibodies; arginine may be modified with a single methyl group (a), or with two methyl groups which may be arranged symmetrically (b) or asymmetrically (c); H4 antibody R3me2s (AbcamTM) was originally generated using a synthetic R4 demethylation H4 peptide to test its specificity, Western blot analysis was performed; (d) against histones (H4. H3, H2A, H2B) of calf thymus incubated with and without Myc-Blimplimunoprecipitate, and (e) following a competitive assay against H4 peptides including unmodified R3me2s and R3me2a, the antibody strongly recognizes the dimethylated peptides.

DETAILED DESCRIPTION

Before proceeding with the detailed description of the invention, various definitions are given which will aid in understanding the same. All references cited herein are incorporated by reference in their entirety. Unless otherwise defined, all technical and scientific terms used herein have the same meaning commonly understood by one of ordinary skill in the art to which the invention belongs.

The term "reprogramming" as used herein refers to the step of altering or removing epigenetic modifications of the nucleus of a cell. Reprogramming facilitates a reduction in the cellular fate compromise and, consequently, the differentiation state of the cell as a whole and, in particular, the nucleus. Essentially, programming consists in bringing a differentiated or compromised somatic nucleus back to a genetic expression, an epigenetic and functional state characteristic of an embryonic, germ cell or stem cell. Reprogramming somatic cell nuclei is a preferred first step in procedures such as SCNT, but is also of interest in other procedures in which control of the state of cell differentiation - ie potency - is important.

The term "cancer" is used herein to denote a tissue or cell located in a neoplasm or with properties associated with a neoplasm. Neoplasmas usually have characteristics that differentiate them from normal tissues and cells. These features include, but are not limited to: a degree of anaplasia, alterations in cell morphology, shape irregularity, reduced cell adhesiveness, metastatic ability, increased levels of angiogenesis, increased invasiveness of cells, decreased levels of cell apoptosis, and usually greater cellular malignancy. Termspertinent α and often synonymous with "cancer" include sarcoma, carcinoma, tumor, epithelioma, leukemia, lymphoma, polyp, transformation, neoplasm and the like.

The term "epigenetic modification" refers to the chemical marking of the gsnoma. Epigenetic marks may include DNA methylation (impressions) as well as methylation and ketylation of proteins associated with DNA, such as histones. The specific genetic expression of paternal origin (of the maternal or paternal chromosome) is often observed in mammals and is due to epigenetic modifications. In parental germlines, epigenetic modification may lead to silencing or activation of gene stable.

"Bioprocessing" refers to techniques in which living cells, or their components, are used to produce a desired end product. In the context of the present invention, epigenetic modifications in cells may be used to enhance the ability of such cells to be used in bioprocessing. Typical bioprocessing techniques include SCNT.

The terms "derivative or homologous" of the DNA and / or arginine methyltransferase binding domains are used herein to refer to mRNA and polypeptides that have sequence identity substantially similar to the molecules of the invention, respectively. Derivatives and homologues are considered to include orthologs of the sequences of other species and mutants which nonetheless exhibit a high level of functional equivalence. By "substantially similar sequence identity," we mean that the level of sequence similarity is approximately 50%, 60%, 70%, 80%, 90%, 95% to approximately 99% identity. Percent identity of the sequence can be determined using standard methods (Henikoff and Henikoff Proc. Natl. Acad. Sci. USA 1992; 89: 10915, and Altschu et al. Nucleic Acids Res. 1997; 25: 3389-3402). Alternatively, homologues of the polypeptides of the invention may be those sequences capable of demonstrating the ability to hydrolyze the sequences described herein under high, medium or low stringency conditions.

The term "expression vector" is used to denote a linear or circular DNA molecule into which another appropriately sized DNA sequence fragment can be integrated. These DNA fragment (s) may include additional segments that provide the transcription of a gene encoded by the DNA sequence fragment. Additional segments may include and are not limited to: promoters, transcription terminators, enhancers, internal deribosome entry sites, untranslated regions, polyadenylation signals, selectable markers, origins of replication, and the like. Expression vectors are often derived from plasmids, cosmids, viral vectors, and fungal artificial chromosomes; vectors are often recombinant molecules containing DNA sequences from various sources.

The term "operably linked", when applied to DNA sequences (for example, in an expression vector), indicates that the sequences are arranged so that they function cooperatively to achieve their intended purpose, that is, a promoter sequence permits initiation. from transcription proceeding to a coding sequence linked to the termination signal.

A "polynucleotide" is a sequence covalently linked to a single or double strand of nucleotides in which the 3 'and 5' termini on each nucleotide are joined by phosphodiester bonds. The polynucleotide may be formed with deoxyribonucleotide bases or ribonucleotide bases. Polynucleotides include eRNA DNA, and may be synthetically produced in vitro or isolated from natural sources. Polynucleotide sizes are typically expressed as the number of base pairs (bp) for double-stranded polynucleotides or, in the case of single-stranded polynucleotides, as the number of nucleotides (nt). One thousand bp or nt equals one kilobase (kb). Polynucleotides less than approximately 40 nucleotides are commonly referred to as "oligonucleotides".

The term "promoter" as used herein denotes a region of a gene in which transcription factors and / or RNA polymerase may bind to control expression of an associated coding sequence. Promoters are commonly, but not always, located in the 5 'non-coding regions of the genes above the transduction initiation codon. The promoter region of a gene may comprise one or more consensus sequences that act as recognizable binding sites for DNA binding domains with specific sequence of DNA binding proteins. However, such binding sites may also be located in regions outside the dopromotor, for example, in regions of enhancers located at or above the coding sequence.

The term "isolated" when applied to a polypeptide or polypeptide complex is a polypeptide that has been removed from its native organism of origin. It is preferable that the isolated polypeptide be substantially free of other native polypeptides for the originating organism's proteome. It is preferable that the isolated polypeptide is at least 95% pure, even more preferably 99% pure. In the present context, the term "isolated" is intended to include the same polypeptide in alternative physical forms, whether in native, denatured, dimeric / multimeric, glycosylated, crystallized or derivatized forms. Reference to a "complex" as used herein includes examples where the first and second polypeptide domains are comprised in a single polypeptide chain, also in which the first and second domains are included in distinct polypeptide chains that are not covalently associated with each other. another, as well as in which post-transduction covalent bonds are formed to join separate domains into an associated functional unit;

In one embodiment of the present invention, a novel complex between Blimpl and Prmt5 is provided; This complex is capable of regulating the genetic expression of demamiferous cells through an epigenetic control mechanism.

Somatic cells typically develop along a differentiation pathway, progressing from a less specialized state to a more specialized or compromised one. Less specialized somatic cells can demonstrate the ability to act as progenitor stem cells, giving rise to several different cell types. The amount of these different cell types that a given stem cell can act as a parent is often referred to as the "potency" of that stem cell. Thus, pluripotent stem cells may act as progenitors of many differentiated cell types. If a cell can differentiate into all types of cells in the body, it is totipotent. If it can differentiate into most cell types, it is pluripotent. Embryonic stem cells are usually called depluripotent when they are capable of generating most cell types in mammals except for extra-embryonic tissues (ie trophectoderm). The present invention provides a means of controlling cellular fate decisions at the level of control of gene expression. The protein complex of the invention when expressed or otherwise introduced into mammalian cells causes bias in decisions of cellular fates that deviate from pluripotency. On the other hand, inhibition of the activity of the inventive protein complex in stem cells, or even of the Blimpl component alone, may cause bias in the decisions of cell fate for pluripotency and self-renewal.

Another area of utility related to the present invention is cancer therapy. Most, if not all cancers, undergo epigenetic changes, including significantly repression and silencing of tumor suppressors and stimulation of oncogenes. Reactivation of tumor suppressor genes may improve the cancer phenotype as it may suppress oncogenes. Thus, a method for controlling gene expression and cell fate decisions in vivo is a very promising pathway for cancer therapy.

B-lymphocyte-induced maturation protein (Blimp1)

Blimp1 is a 100 kDA protein that contains five zinc finger deletion motifs to DNA (GENBANK consent number: NM_007548). The human counterpart of Blimpl is called PRDI-BFl or PRDMl (GENBANK consent number: NM_000198). Blimpl cDNA was originally isolated on a subtractive screen of a B cell lymphoma cell line (BCL1) following treatment with IL-2 and IL-5 cytokines. Ectopic Blimpl expression is sufficient to cause terminal differentiation of BCL1 cells. Blimpl is considered a "master regulator" of terminal B cell development (Yu J. et al. (2000) Mol. Cell. Biol. 20 (7): 2592-2603).

In humans, PRDI-BFl, the human ortholog of Blimpl murine, is capable of forming a complex with lysine methyltransferase H3 G9a. This complex has been shown to be able to disrupt the human interferon-β (IFN-β) gene via a chromatin-mediated mechanism promoter region of the gene (Gyory I. et al. (2004) Nt. Imm. 5: 299-308).

Blimpl has been shown to form a complex with factors involved in epigenetic modifications. A complex comprising Blimpl and a histonadeacetylase (HDAC) is believed to alter the structure of the nucleosome and inhibit gene transcription by deacetylation of lysine residues in histone tails. Since lysine waste acetylation effectively neutralizes its positive charge, deacetylation restores burden and leads to modification of the nucleosome structure due to stearic effects and other effects.

Known targets of Blimpl include c-Myc, IFN-β, CD23, CD22, MHC class II, BSAP (Pax 5), B-cell primordial factors and CIITA. All of these genes are subject to transcriptional regression by Blimpl. C-Myc gene transcription is suppressed by Blimpl during B cell differentiation and is an important target of Blimpl in BLC1 lymphoma cells. Multiple regions of the Blimpl molecule, including the N-terminal acidic domain and the region between 90 and 464 , are required for Blimpl to repress the c-Myc promoter (Yu J. et al., supra).

C-Myc oncoprotein is critical for regulating growth control, apoptosis and / or differentiation, and its dysregulation also plays a causal role in a wide variety of neoplasms. Deregulation of c-Myc expression in B cells is often tumorigenic. Chromosomal translocations of the c-Myc gene to Igg Ig are present in most Burkitt lymphomas and murine plasmacytomas (Lin K.l et al. (2000) Mol. Cell Bio. (20) 23: 8684: 8695).

Murine ES cells can be maintained as a self-renewing pluripotent population by LIF / STAT3-dependent signaling. STAT3 has been shown to regulate Myc transcription factor expression. Adult stem cells are also believed to require Myc activation. RT-PCR analysis demonstrated that Myc transcription is high in ES cells. ES cells typically require culture media including LIF; otherwise ES cells tend toward differentiation rather than self-renewal. It has been seen that Myc levels in ES cells rapidly collapse after LIF removal from culture conditions, indicating that this may be a requirement for ES cell differentiation. Experiments suggest that only Mycé capable of maintaining ES cell status (ie, a pluripotent phenotype) at a level comparable to LIF and that when Myc is not active, the stem cell group falls (Cartwright P. et al. (2005 ) Development 132: 885-896).

Arginine Methyltransferase 5 Protein (Prmt5)

There are two known types of histone methyltransferases (HMTases) that include a SET domain (Suvar3-9, Enhancer of Zeste, Trithorax) found primarily with lysine-specific methylase activity, or an arginine-specific catalytic domain found in PRMTs. Type I and Type II PRMTs are divided: Type I PRMTs catalyze the monomethylation and asymmetric demethylation of arginine residues, while Type II PRMTs catalyze the formation of monomethylated and symmetrically dimethylated arginines. Of the six known PRMTs, only PRMT5 (GENBANK Consent Numbers: NM_006109 (human); NM_013768 (mouse)) behaves like a type II PRMT that can target histones. Specifically, PRMT5 has been shown to target specific arginine residues on the N-terminal tails of H3 and H4.

PRMT5 can be associated with hSWI / SNF chromatin remodeling complexes based on BRG1 and hBRM. In these complexes, PRMT5 has the ability to stimulate cell growth and anchorage-independent growth by histone H3 arginine 8 (H3R8) methylation and thus reduce the expression of genes such as ST7e NM23 which are known to play roles in tumor suppression (Richard S. et al. (2005) Biochem, J. 388: 379-386). PRMT5 has also been implicated in CYCLIN E and CAD transcriptional repression.

Blimpl / Prmt5 Complex

The present inventors aim to identify a possible activity of the Blimpl SET / PR domain, since no specific histone methyltranspheres activity has yet been attributed to Blimpl alone. The inventors have shown that Blimpl can form a new complex with PRMT5, a complex that in vivo persists in the mouse germ cell line until PGC enters the genital bridges, suggesting that Blimpl has a continuing role in the early mammalian germ cell line. Further analysis, described in more detail below, shows that the newBlimp 1 / Prmt5 complex compromises a single epigenetic signature by methylation of histonesH2A and H4. This is believed to be the first example in which histone tail methylation H2A and H4. This is believed to be the first example in which histone H2A tail methylation was shown to be an epigenetic regulatory mechanism. In addition, experiments described in more detail below show that while Prmt5 is present in pluripotent EG and ES cells, Blimpl is not.

Expression of Blimpl in a Pl9 pluripotent EC cell line results in the expression of a gene known to be expressed at high levels in pluripotent cells. Experiments suggest that the Blimp 1 / Prmt5 complex is an important regulator of gene expression and may exert significant effects on cell targeting, especially with regard to pluripotency and differentiation. Thus, an embodiment of the present invention provides a mechanism for genetic control based on the use of biological activities exemplified by the invitro or in vivo Blimp 1 / Prmt5 complex.

Without wishing to be bound by theory, it is believed that the Blimpl complex provides gene targeting function as it has the five finger binding domains of the ten finger DNA. Prmt5 provides an arginine methyltransferase activity that acts as HMTase when it is located in DNA; thereby leading to repression of gene expression. Blimpl's human orortologist is known to bind at the PRDI site in the human IFN-β promoter region (Keller A. D. & Maniatis T. (1991) Genes Dev. 5: 868-879). As noted above, it is also known that Blimpl is capable of suppressing c-Myc expression. According to the invention, a new subset of genes has been identified; This subset has been shown to be a specific target of the Blimpl / Prmt5 complex and has expression that can be regulated by the new complex. This subset includes genes with various functions, but which are considered to be of major participation in the regulation of potency, cell cycle, differentiation, cell adhesion, epigenetic reprogramming, and possibly tumor suppression.

According to the invention, the presence of the Blimpl / Prmt5 repressor complex correlates with high levels of H2A / H4R3me2s in germ cells. However, during B cell differentiation into plasma cells, Blimpl targets G9a-dependent H3K9me2. Thus, Blimpl is capable of several direct decisions and properties about cellular fate by associating with different binding partners, and chromatin remodeling may be central to these processes. In addition to the obvious importance of Blimpl during the early stages of mouse germ cell specification, the present invention demonstrates an additional involvement of Blimpl in the formation of a single epigenetic chromatin signature, as seen in germ cells after the specification of PGCs. However, Blimpl / Prmt5 leaves the PGC nuclei and enters the cytoplasm after E 10.5, when extensive genomic programming is detected in germ cells. An understanding of the relationship between the Blimp 1 / Prmt5 complex, symmetric methylation of arginine 3 into H2A / H4 and the subsequent genomic epigenetic reprogramming in germ cells thus provides insight into the mechanism underlying this critical process and how nuclear reprogramming is controlled in the cell.

The invention also provides insight into the role of Blimpl / Prmt5 in pluripotent embryonic (EG) cells whose derivation of PGCs is clearly associated with loss of Blimpl. The present invention provides direct evidence that Blimpl is crucial for suppressing nascent and migrant PGCs to acquire an evidently pluripotent stem cell as a phenotype. Thus, Blimpl / Prmt5 activity agonists and antagonists may play an important role in moderating cell fate decisions far or toward a pluripotent phenotype, respectively. In addition, Blimpl expression in cells provides a mechanism for sequestering Prmt5 arginine methyltransferase activity in the nucleus and away from potential cytoplasmic substrates. Such an effect may be desirable during stem cell differentiation and during overall cell cycle progression in the desired cell or cell line.

Specific small nucleic acid molecules for use in the invention as Blimpl and / or Prmt5 inhibitors are short stretches of double-stranded RNA known as short-interfering RNAs (siRNAs). These interfering RNA (RNAi) techniques allow selective inactivation of genetic function in vivo. In the present invention, RNAi can be used to lower the expression of Blimpl and / or Prmt5 in cells. In this process, the double-stranded mRNAs are recognized and cleaved by the RNase dicer, resulting in long stretches of 21-23 RNAi nucleotides. These RNAis are incorporated into and unfolded by the RNA induction silencing complex (RISC). The single antisense tape then guides the RISC to mRNA containing the complementary sequence, resulting in mRNA endonucleolytic cleavage (Elbashir et al. (2001) Nature 411; 494-498). Thus, this technique provides a means for targeting and degradation of Blimpl and / or Prmt5 mRNA in somatic cells intended for use in bioprocessing applications or when promoting a self-renewing pluripotent phenotype. Techniques for siRNA generation for Prmt5 have been described in the art (Richard S., supra). Examples of suitable siRNA sequences for human PRMT5 target include:

5 'CTCATTTGCTGACAATGAA 3' [SEQUENCE ID: 1] 5 'GGACCTGAGAGATGATATA 3' [SEQUENCE ID: 2] 5 'GTTTCAAGAGGGTTCAT 3' [SEQUENCE ID: 3]

The Blimp1 / Prmt5 complex of the present invention may be used to identify other proteins and polypeptides that interact with it in the cellular environment. Conventional techniques for determining protein-protein interactions, such as mesh with two fungal hybrids, can be used to identify potential agonists and antagonists of the interactivity of the Blimpl / Prmt5 complex. It is also within the scope of the invention to identify small molecules that inhibit the association of Blimpl with Prmt5, for example by masking or disrupting interaction with those Blimpl domains which are known to interact directly with other proteins (Yu J. et al. Supra). Protein-protein interactions of Blimpl, Prmt5 and / or Blimp 1 / Prmt5 complex or small molecule protein interactions can be investigated using technologies such as BlAcore®, which detects molecular interactions using surface plasmon resonance (BlAcore, Inc., Piscataway, NJ; see also www.biacore.com).

Screening of molecules and proteins for binding to the Blimpl / Prmt5 complex can be accomplished via automated high pass screening procedures. Thus, the invention provides methods for identifying molecules that interact with the Blimp 1 / Prmt5 complex via detection of a positive binding interaction between the Blimpl / Prmt5 complex and a target molecule. Additional screening steps can be used to determine if the identified positive binding interaction is of pharmacological importance - that is, whether the target molecule is able to moderate the biological activity or function of Blimp 1, Prmt5 and / or Blimp 1 / Prmt5 complex. If a moderately positive molecule is identified, the molecule is classified as a "result" and can then be evaluated as a potential candidate drug. Additional factors may be taken into account at this time or earlier, such as absorption, distribution, metabolism and excretion (ADME), bioavailability profiles and molecule toxicity, for example. If the potential drug molecule meets the pharmacological requirements, it is considered pharmaceutically compatible. Suitable compositions may be formulated to test activity in vitro and in vivo according to standard procedures known in the art.

EXAMPLES

Methods and reagents

Embryo Isolation. Primordial germ cells were isolated from embryos at different developmental stages of outbred MFl mice. The vaginal buffer day was designated as E05. Previously published work-originated single cell cDNA libraries (Saitou, M., Barton, S.C. & Surani, M.A. (2002) Nature 418, 293-300).

Immunostaining. Dissected embryonic pieces containing germ cells were trypsin-treated to prepare a single cell suspension. The cells were subsequently allowed to settle on poly-L-lysine coated slides, fixed with 2% PFA and washed three times with PBS and further processed. Entire genital embryonic bridges at El 1.5 were dissected, washed in PBS, fixed for two hours at 4 ° C in 4% PFA, washed in PBS and allowed to settle at 20% sucrose overnight at 4 ° C. They were soaked in O.C.T. (BDH) and cryosected. Single cells or sections were permeabilized in IF buffer (PBS; 0.1% triton; 10 mg / ml sw BSA). Primary antibody incubation was performed overnight at 4 ° C, followed by three IF buffer washes and secondary antibody incubation (Alexa 564, Alexa 488; Molecular Probes) for two hours at room temperature, and washed in PBS. The slides were then mounted on Vectashields with DAPI (Vector Laboratories). Immunofluorescence was visualized on a 2000 BioRad radiance confocal microscope. The following antibodies and dilutions were used: PGC7 (from T. Nakano; 1: 2500), Oct4 (BDTransduction Laboratories; 1: 200), TGl (anti-SSEAl specific monoclonal antibody) mouse germ cells; 1: 1), Blimpl (by K. Calame; 1:10), Prmt5 (üpstate; 1: 250), Prmtl (Upstate, 1: 200), H4R3me2s (Abcam; 1: 1000), Dhx38 / Prpl6 (Proteintech Group; 15 1: 200), Ezh2 (Upstate; 1:50), G9a (Abcam ™; 1: 100), Pfml (Abcam ™; 1:50), Setl (from W. Herr; 1: 200) .

Immunoprecipitation assays and preparation of nuclear extracts. The Blimpl decoding region of the mice was amplified by RT-PCR and the product cloned into pcDNA3-MycHisA resulting in the pCMV-MycBlimpl construct. 293T or P19 cells transfected with original vector (called pCMV-Myc) or pCMV-MycBlimplins were washed with PBS and lysed in IP buffer containing 150mM NaCI, 1% NP40.0.1% triton, 50mM Tris pH 8.0 and a complete protease inhibitor cocktail (Roche). In a typical immunoprecipitation reaction, 2 χ 107 cells were used. Whole cell extracts were incubated with 2 pg of Myc antibodies (New England Biolabs). Alternatively, Prmt5 or Prmtl (Upstate) antibodies were used throughout the evening at 4oC. A total of 30 μΙ of protein A / G sepharose beads were then added at 4oC for 2 hours. The beads were washed five times in IP buffer. Binding proteins were eluted by boiling in Laemli sample buffer. Nuclear extracts for ES, EG or Pl9 cells were prepared according to the manufacturer's instruction (extratonuclear kit; Active Motif), and 25 pg of nuclear fraction was used per loading.

In vitro methyltransferase assays. Immunoprecipitation Assay Beads of pCMV-Myc or pCMV-MycBlimpl-transfected 293T cells were run by two additional washes in HMTase buffer (25MM NaCl, 25rrM Tris pH 8.8) used in HMTase assay as described 16 with mild modifications. Briefly, 1 pg of H3 or H2A (Roche) or recombinant H2A (kindly donated by A. Brehm) as the substrate and 2pCI of S adenosyl-L [methyl-3H] methionine ([3H] SAM; Amersham Biosciences) as the methyl donor, They were incubated in a 20μΙ mixture of HMTasepor buffer for three hours at 37oC. Proteins were dissolved in 18% SDS-Page gel, transferred onto a PDVF membrane and visualized by Ponceau staining and fluorography. In vitro methylated rH2 was microsequenced by Edman degradation sequence (Protein and Nucleic acid Chemistry Facility, Cambridge University, UK) followed by the determination of 3 H incorporation of individual amino acids by decintillation counting. To examine specific methylation of H2A / H4, H4, H3, H2A and H2B (Roche) were incubated in the presence of immunoprecipitated Blimpl complex and SAM as described above and Western Blot analysis was performed using H4R3me2s antibodies (AbcamTM, Cambridge, UK) , which were tested for their specificity by competition assay (see supplementary data in Figure 8).

Chromatin Immunoprecipitation Cloning (ChIP) and ChIP. Single cell suspensions were crossed in 1% formaldehyde for 10 min. at room temperature. The cells were subsequently disrupted and the nuclei were lysed in 50mM Tris pH 8.0, 10mM EDTA, 1% SDS followed by sonication. The extract was subjected to immunoprecipitation described below, with the addition of purified IgG (Santa Cruz) with negative control. Beads were then eluted twice in 50mM NaHCO 3, 1% SDS and supernatants were treated with proteinase K for 5 h at 65 ° C, followed by phenol / chloroform purification and ethanol precipitation. Samples chip PRMT5 (Upstate) or H4R3m32 (AbcamTM) were then analyzed by PCR reaction padrãousando the following primers (lfor ccaggaggggtttcatcaactg [node DASEQÜÊNCIA ID: 4] and Irev tgttaccgtctcacttggtgtttg [In IDENTIFICATION OF SEQUENCE: 5j; 2For acctcacaactgctgggattac [In IDENTIFICATION OF SEQUENCE: 6] and 2revttcgttttctgcgtccgtg [In IDENTIFICATION OF SEQUENCE: 7]; 3fortttgtcgcagtgtcttatcgtaac [In IDENTIFICATION OF SEQUENCE: 8] and 3revtaggaaggtgttggggaggg [In IDENTIFICATION OF SEQUENCE: 9]; 4foratgaggtttgagaagtgtggc [In IDENTIFICATION OF SEQUENCE: 10 ] and 4revatcagcggtggtggtgacagc (Sequence ID: 11)). In the case of the ChIP cloning assay, two successive rounds of immunoprecipitation using anti-Myc antibodies were performed. They were followed by DNA precipitation that was slowed down by T4 DNA polymetase and then bound to annealed JW102 and JW10325. The deletion products were then PCR amplified with JW102 (one cycle at 55 ° C for 2 min; at 94 ° C for 2min and 20 cycles at 94 ° C for 30s; 55 ° C for 30s; 72 ° C for 1 min and finally one cycle at 72 ° C (5 min). PCR products were cloned into pGEM-T (Promega), colonies were checked for insects by PCR, and products sequenced by standard methods. Damage searches were subsequently done using an online bioinformatics feature such as Ensembl (http: // www.ensembl.org).

Example 1: Blimp1 Activity Identification

Significant epigenetic changes follow immediately after mouse PGCs are specified, including methylation and acetylation of histone tails by methyltransferases (HMTases) and acetyltransferases (HATs), respectively. Among the candidate genes to play a role in regulating these epigenetic changes in PGCs are HMTases. which belong to the SET / PR dodomain protein family. Twenty-five candidate SET / PR domains containing overscanned genes for expression in E7.5 PGCs and neighboring somatic cells, and it was found that Blimpl, G9a, Setl, Ezh2 and Pfml are expressed in the embryonic region containing PGCs (Figure Ib and Figure 7). . However, only Blimpl expression was restricted to PGCs in E7.5, and its expression persisted thereafter in germ cells.

To investigate Blimpl SET / PR domain activity, it was first established that a Myc-labeled mouse Blimpl when transiently expressed in 293T cells could be effectively immunoprecipitated using Myc antibodies (Figure 2a). The immunoprecipitate was then subjected to a histone methyltransferase assay. radioactive pattern in histone H3 (Rea, S. et al. (2000) Nature 406, 593-9). A comparatively weak signal corresponding to H3 was observed, but surprisingly, significant ranges were also detected corresponding to histones H2A and H4 (Figure 2b), with the latter being present as low level contaminants in the H3 preparation as determined by the Western Blot technique (data not shown). ). It has been suggested that H3 signaling in vitro could be due to G9a associated with previously conforming Blimpl in B cells (Gyory et al, supra). However, germ cells do not exhibit significant dimethylation of histone H3 Lysine 9 (H3K9me2), which is the primary modification attributed to G9a, nor is the PGC specification visibly affected by loss of G9a function. It was therefore decided to focus on the observed activity of immunoprecipitated Blimpl histones in H2A and H4.

Due to the novelty of the discovery of H2A tail methylation, it was first decided to test the immunoprecipitate methyltransferase activity in calf thymus and recombinant H2A preparations, and it was found that there is a methylation forteactivity for this histone (Figure 2b). To identify the amino acid residue (s) at the tail of H2A, the radiolabeled recombinant protein product from the methyltransferase assay was subjected to Edman sequential degradation. Scintillation counting of the released amino acid fraction detected radiolabeling of rH2A R3 (Figure 2c). The same results were obtained with calf thymus and recombinant H4 preparations (data not shown). This is a consistent finding when considering amino acid sequence conservation between the first N-terminal residues of histones H2A and H4 (Figure 2d). Methylation of H4 R3 is known to play an important role in transcriptional regulation. However, these results predict the existence of additional new methylation of R3 in histone H2a.

Example 2: Identifying a Blimp 1 / Prmt5 Complex

As SET / PR domains are associated with histonamethyltransferase activity only in lysine residues, it was suggested that the arginine methylation activity detected above could not be due to Blimp 1, and should imply the presence of another HMTase in the immunoprecipitate. Two deprotein arginine methyltransferases, Prmtl and Prmt5, have previously been reported to mediate histoneH4 R3 methylation. Pmrtl is a class I arginine methyltransferase leading to NG-monomethylarginine (Rmel) and asymmetric N'G-dimethylarginine (Rme2a) in various substrates. As mentioned above, Prmt5 belongs to class II arginine methyltransferase, which is responsible for monomethylation. (Rmel) and dimethylation-NG, symmetrical N'G (Rme2s) (Figure 8) 20. To test whether any of these proteins could be associated with Blimpl in vivo, their expression was analyzed in nascent PGCs and neighboring somatic cells using single cell cDNA as described above. Prmtl was found to be excluded from PGCs in E7.5, while Prmt5 was present in both PGCs and somatic cells (data not shown). At the protein level, however, Prmt5 showed nuclear staining and became highly PGCs enriched compared to somatic cells from E8.5 onwards (Figure 3a, b; Figure Slb and see below). Prmtl, on the other hand, was detected mainly in the germ cell cytoplasm at these stages (Figure 3c).

It was then decided to investigate whether it is Prmt5 or Prmtl that interacts with Blimpl. Indeed, it was found that Myc-labeled Blimpl could effectively co-immunoprecipitate endogenous Prmt5 in 293T cells (Figure 3d). On the other hand, Prmt5 could also crack down on Myc-markedBlimpl (Figure 3d). By contrast, no detection of any interaction between Myc-labeled Blimpl and endogenous Prmtl could be found (Figure 3e). These experiments confirmed that Blimpl and Prmt5 can form a complex in 293T cells. Considering the overlapping expression of these proteins in PGCs (Figure 3a, FigureSlb), it is suggested that Blimpl and Prmt5 are part of the same protein complex in PGCs, and that this complex may occur elsewhere during development or normal adult as well as neoplastic tissues. .

Example 3: Blimp 1 / Prmt5 complex activity in vivo. High antibody specificity against H4R3me2s was tested and showed that it effectively recognizes both calf thymus histones H2A and H4 (Figure 8b, left-hand panels, H2A and H4 are also present as contaminants in preparations of H3 and H2B). In a competition assay, this antibody was efficiently titrated by an H4 (1-9C) peptide containing R3me2s (Figure S2c). In addition, this antibody also recognized the Blimpl / Prmt5 HMTase assay product in both H4 and H2a (Figure S2b, right panel), thus increasing the evidence that it is the symmetric dimethylation activity of Prmt5 and not the asymmetric dimethylation activity of Prmtl. is attributed to the complex.

Using the specific antibody by H2 / H4R3me2s modification, PGCs isolated from premature embryos were analyzed by immunocytochemistry. In E8.5, H2A / H4 / H4R3me2s was evident in both PGCs and somatic cells (Figure 3f), but in El 0.5, much larger accumulation of H2A / H4 R3me2s was predominantly observed in germ cells (Figure 3f). However, when another antibody was used, either recognizing monomethylation and / or asymmetric dimethylation of H4R3 (H4R3mel and H4R3me2a), it was observed that this modification in PGCs occurred at E8.5, but not at E 10.5 (data not shown). The data combined with these two antibodies show a progression to H2A / H4R3me2s in PGCs from E8.5 to El 0.5. These results demonstrate the presence of a specific chromatin signature during germ cell development, which is believed to be due to the combined presence of Prmt5 and Blimpl. It is important to note that there are multiple additional modifications to the histone tail that contribute to the germ cell-specific chromatin state. It has recently been shown that loss of Blimpl function leads to the aberrant development of proliferating founder PGC-like cells (Ohinata, Yet al (2005) Nature 5, 5).

Example 4: Identification of Blimp 1 / Prmt5 Complex In Vivo Targets

As previously shown, Blimpl can direct genetic regulation during cell differentiation via the recruitment of interaction factors for specific sites. To identify putative Blimpl targets, a chromatin immunoprecipitation deconditioning approach was adopted, in which a Myc-labeled version of Blimpl was first overexpressed in 293T cells. Nuclear extracts from these 293T cells were then immunoprecipitated with Myc1 antibodies and the purified immunoprecipitated DNA was slowed by associated ligators, PCR amplified and cloned. Several clones were selected and analyzed by sequencing, followed by Blast co-analysis to map the cloned inserts. Of 32 clones, 11 corresponded to nearby regions or likely regulatory sequences of known genes (see Table 1).

Table 1

<table> table see original document page 23 </column> </row> <table>

Example 5: Characterization of Dhx38 Gene Expression Control by Blimpl / Prmt5 Complex

Among the putative Blimpl targets identified, Dhx38 was chosen for further study. Dhx38 is a conserved gene encoding a DEAH box containing RNA helicase (also known as Prpl6), which in C. elegans is essential for post-translational regulation of sex-determining genes during oocyte sperm passage (Graham, PL & Kimble, J. (1993) Genetics 133, 919-31).

When the Dhx38 site was examined in detail, it was found to contain four GGGAAAG motifs, corresponding to the Blimpl consensus binding site; two in the 5 'region and two below the transcription start site (Figure 4a). Although the currently available Blimpl antibody works for immunostaining procedures, it cannot be used to effectively immunoprecipitate Blimpl (data not shown). Thus, Prmt5 was used to assess whether Dhx38 is a target of the Blimp 1 / Prmt5 complex in germ cells. A ChIP assay using Prmt5 antibodies was performed on PGCs contained in the genomic bridging cell suspensions of El 0.5 embryos, a stage where Bllimpl and Prmt5 are co-expressed in germ cell nuclei (see above). Indeed, it was found that Prmt5 could specifically pull down a selected sequence by spreading nucleotides +7152 to +7541, spanning exon 11 of the Dhx38 gene, which contains a Blimpl consensus binding site (Figure 4b). The other three putative deletion sites were not associated with Prmt5 in our ChIP trial. These results indicate that Prmt5 is recruited to Blimp 1 targets, such as Dhx38, thus suggesting that the Blimp 1 / Prmt5 complex regulates the expression of these target genes in germ cells.

With the evidence that Dhx38 is a target of the Blimp 1 / Prmt5 complex in germ cells, the expression / repression of Dhx38 in PGCs was examined. It was found that DHx38 was not detectable in E10.5 and El 1.5 (Figure 5a). However, by E12.5, Dhx38 is estimated in PGCs in both sexes (Figure 5a), which surprisingly occurs at the same time as the displacement of Prmt5 and Blimpl from the nucleus to the cytoplasm in E1.5 germ cells (Figure 5b). In E12.5, neither Prmt5 nor Blimp.l are present in PGC cores (data not shown). Dhx38 stimulation immediately precedes meiotic and mitotic arrest of female and male germ cells, respectively. Thus, there is an inverse relationship between the Blimpl / Prmt5 expression ofDhx38. These results indicate that Blimpl and Prmt5 may function in the transcriptional repression of target genes, such as Dhx38, in the germline. This repression appears to be released when germ cells enter the genital bridge and both Blimpl and Prmt5 are submitted to core to cytoplasmic translocation. It should be noted that histone arginine methylation was mainly associated with transcriptional activation, although recently H3R8me activity associated with Prmt5 was correlated with reduced gene expression (Pai S. et al, supra). Furthermore, since both Blimpl and Prmt5 have been reported to be repressor-transcriptional, it is possible that the symmetric arginine dimethylation associated with the Blimpl / Prmt5 complex in germ cells described herein would favor genetic repression.

Example 6: Blimpl -Prmt5 Complex on Pluripotent Stem Cells

To gain further insight into the role of the Blimp 1 / Prmt5 complex, it was decided to examine pluripotent embryonic germ cells (EG). EG cells may be derived from PGCs isolated in vitro and are therefore considered to be the closest cell alignment equivalent of PGCs. EG cells are also found to be Prmt5 positive, but unlike PGCs, they do not have Blimpl (Figure 6a, b). Consistent with this observation, it has been found that EG cells are also Dhx38 positive, suggesting that the expression of this gene may be due to the absence of Blimpl (Figure 6a, b). To restore the Blimpl / Prmt5 repression complex, Myc-labeled Blimpl was overexpressed in EG cells. However, such attempts lead to fortecitotoxicity after only 12 h of cell transfection, although the cell viability of pCMV-Myc transfected control EG cells has not been compromised (data not shown). Similar results were also obtained with pluripotent embryonic stem cells (SS) (data not shown).

A pluripotent mouse embryonic carcinoma (EC) 1 cell line that also has pluripotency characteristics similar to EG and ES cells was then chosen. In fact, P19 cells, such as ES / EG cells, show expression of Prmt5 andDhx38, but not of Blimpl (Figure 6b, c). However, it was found that these cells could tolerate Blimpl expression and therefore immunoprecipitation was used, which confirmed that overexpressed Myc-Blimpl interacts with endogenous Prmt5 in mouse EC cells (Figure 6C). Notably, this transient Blimpl / Prmt5 complex subsequently caused repression of Dhx38 in P19 cells (Figure 6c). ChIP analysis confirmed this repression of Dhx38 is accompanied by increases in H2A / H4R3me2s at the Dhx38 site (Figure 6d). These observations support the notion that the Blimp 1 / Prmt5 complex is responsible for repressing target genes, such as Dhx38, which is also likely in PGCs.

While particular embodiments of the invention have been disclosed herein in detail, this has been done by way of example and for illustration purposes only. The above embodiments are not intended to be limiting with respect to the scope of the following appended claims. It is contemplated by the inventors that various substitutions, changes and modifications may be made to the invention without departing from the spirit and scope of the invention as defined by the claims.

Claims (35)

1. An isolated polypeptide complex containing at least a first domain with site-specific DNA binding activity and at least a second domain with arginine methyltransferase activity, characterized in that the second domain is capable of methylating an arginine residue located in the region. flow rate of a histone H2A. The polypeptide complex according to claim 1, characterized in that the second domain has an arginine methyltransferase activity that provides a symmetrical NG, N'G dimethylation of an arginine residue. The polypeptide complex according to claims 1 and 2, characterized in that the second domain is capable of methylating a 3-position argininal residue in the caudal region of a histone H2A (H2AR3). The polypeptide complex according to any of the preceding claims, characterized in that the second domain is further capable of methylating a dearginine residue located in the histone H4 caudal region. The polypeptide complex according to claim 4, characterized in that the second domain is capable of methylating an arginine residue located at the 3-position in the caudal region of a histone H4 (H4R3). Polypeptide complex according to any one of the preceding claims, characterized in that the activity of arginine methyltransferase is comprised in a domain of arginine methyltransferase Prmt5 or a derivative or homologue thereof. The polypeptide complex according to any of the preceding claims, characterized in that the first domain is specifically directed to targeting one or more consensus sequences in a mammalian genomic DNA involved in controlling gene expression. The polypeptide complex according to claim 7, characterized in that the first domain specifically binds to a PRDI / Blimpl-like consensus binding site. The polypeptide complex according to any preceding claim, wherein the first domain comprises the PRDI / Blimpl polypeptide, a DNA binding portion of the PRDI / Blimpl polypeptide; or derivative thereof. An isolated polypeptide comprising a first domain with site-specific DNA binding activity and at least a second domain with dearginine methyltransferase activity, characterized in that the first domain is specifically targeted for binding to one or more consensus sequences in genomic DNA. of a mammal involved in gene expression control and the second domain has an arginine methyltransferase activity that provides a NG, N'G symmetric dimethylation of an arginine residue. The isoated polypeptide according to claim 10, characterized in that the first domain specifically binds to a PRDI-Blimp 1 type consensus binding site. The isolated polypeptide according to claim 10 or 11, characterized in that the arginine methyltransferase activity is comprised in a Prmt5 arginine methyltransferase domain or a derivative or homologue thereof. 13. A nucleic acid expression vector construct which is suitable for inducing expression of a polypeptide complex in a mammalian cell, with the vector comprising: one or more coding sequences operably linked to a promoter sequence, characterized by one or more more decoding sequences encode at least a first domain polypeptide domain with site-specific DNA-binding activity and at least a second polypeptide domain with arginine methyltransferase activity, in which the first domain is specifically targeted for binding to one or more consensus sequences in a mammalian genomic DNA involved in controlling gene expression, and the second domain has an arginine methyltransferase activity that provides a symmetrical NG, N'G dimethylation of an arginine residue located on a polypeptide substrate. The expression vector according to claim 13, characterized in that the polypeptide substrate is a histone. The expression vector according to claims 13 and 14, characterized in that the second polypeptide domain is capable of methylating an arginine residue located at position 3 in the caudal region of a histone H2A (H2AR3). The expression vector according to any one of claims 13 to 15, characterized in that the second polypeptide domain is further capable of methylating an arginine residue located in the histone H4 caudal region. The expression vector according to claim 16, characterized in that the second domain is capable of methylating an arginine residue located at the caudal position 3 of a histone H4 (H4R3). The expression vector according to any one of claims 13 to 17, characterized in that the arginine methyltransferase activity is comprised in a Prmt5 arginine methyltransferase domain or a derivative or homologue thereof. The expression vector according to any one of claims 13 to 18, characterized in that the first domain is specifically directed to the binding to one or more consensus sequences in a mammalian genomic DNA involved in gene expression control. The expression vector of claim 19, wherein the first domain specifically binds to a PRDI / Blimpl-like consensus binding site. The expression vector of claim 20, wherein the first domain comprises the PRDI / Blimpl polypeptide; a portion of the DNA binding of the PRDI / Blimpl polypeptide; or even a derivative thereof. The expression vector according to any one of claims 13 to 21, characterized in that the promoter is an inducible promoter. The expression vector according to any one of claims 13 to 21, characterized in that the promoter is a promoter having active constitution. The expression vector according to any one of claims 13 to 23, characterized in that the vector comprises an expression cassette in which a first coding sequence encodes the first polypeptide domain and a second coding sequence expresses the second polypeptide domain. . The expression vector according to claim 24, characterized in that the first coding sequence encodes the PRDI / Blimpl polypeptide and the second sequence encodes the Prmt5 polypeptide. The expression vector according to any one of claims 13 to 24, characterized in that the first and second coding sequences are separated by one or more intervention sequences. The expression vector according to claim 26, characterized in that one or more intervention sequences comprises at least one internal ribosome-entered sequence (IRES). The expression vector of any one of claims 13 to 27, further comprising one or more amino acid sequences that encode a polypeptide selected from: a selection marker; an antibiotic resistance marker; and a rapporteur. 29. A method for controlling gene expression in a mammalian cell comprising inducing cell formation of a polypeptide complex containing at least a first domain with site-specific DNA binding activity and at least one second domain with arginine methyltransferase activity, characterized in that the second domain is capable of methylating an argininalised residue in the caudal region of a histone H2A. The method according to claim 29, characterized in that the formation of the polypeptide complex is induced in the cell by inducing the expression of a PRDI / Blpnp1 polypeptide, or a homologue or derivative thereof, in the cell. The method according to claim 30, characterized in that expression of PRDI / Blirnp polypeptide is induced in the cell by transfecting the cell with an expression vector encoding a Blimpl polypeptide, or a derivative or homologue thereof. The method according to claim 30, characterized in that the expression PRDI / Blpnp1 polypeptide is induced in the cell by transfecting the cell with the expression vector of claims 13 to 28. The method according to any one of claims 29 to 32, characterized in that the mammalian cell is a human cell. The method according to any one of claims 29 and 33, characterized in that the mammalian cell is a neoplastic or cancer cell. The method according to any one of claims 29 to 34, characterized in that the method occurs in vitro.