RU2457249C2 - Method for stabilising tularemia vaccine strain - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: method for stabilising tularemia vaccine strain consists in introducing a gene recA deletion into a chromosomal DNA F, tularensis 15/10 with a suicide plasmid pPYΔrecA as a result of the allelic exchange of the modified DNA fragment with the deleted gene recA and a homologous region of the chromosomal DNA of the vaccine strain.

EFFECT: invention enables avoiding reversion of the vaccine properties and promotes the consistency of a genome of the vaccine tularemia microbial strain.

2 cl, 2 dwg, 6 tbl

Description

The invention relates to the field of biotechnology and molecular genetics and can be used to stabilize the vaccine strain Francisella tularensis. The first live attenuated vaccine was received in the 40s. in the USSR. Attenuation of the strain was achieved by repeated passages of the natural isolate on a nutrient medium containing normal serum (LMK Hatenever, 1943. The allergic diagnosis, specific prophylaxis and vaccine therapy of tularemia.//In EB; Balsky, IGKochergin, and VVPorin (ed .), Microbiology and epidemiology. Medical Publications Ltd, London, United Kingdom, p. 62-79). In 1934, B.Ya. Elbert and his staff inoculated animals with the attenuated strain Moscow, as a result of which the immunized animals became resistant to infection with virulent strains of tularemia microbe. This strain was later used to immunize people (Tularemia. / Under the editorship of Olsufiev N.G. and Rudnev G.P. M: MEDGIZ. 1960). The effectiveness of immunization with the Moscow strain was successfully demonstrated by volunteers, however, during storage, the vaccine properties of the Moscow strain were lost (Tularemia. / Ed. Olsufieva N.G. and Rudneva G.P. M .: MEDGIZ. 1960.) (WDTigertt. Soviet viable Pasteurella tularensis vaccines: a review of selected articles. 1962. Bacteriol. Rev. 26: 354-373). According to a similar scheme, an attenuated vaccine strain 15 was created, which was successfully used to vaccinate people (Emelianova O.S. 1959. Variation of the tularemia organism under artificial conditions, p.109-115. In VDTimakov, ed., Microbial variation. Pergamon Press translation, New York; Emelyanova, O.S. 1959. Various storage of Pasteurella tularensis in different laboratory conditions. ZhMEI. N.3, 22-26).

However, during the production of live tularemia vaccine, strain 15 became more attenuated and less virulent for mice (Tularemia. / Under the editorship of Olsufiev N.G. and Rudnev G.P. M .: MEDGIZ. 1960.). The weakened strain after passage through animals restored the protective properties, and as a result, strain 15 was restored.

A strain 15 (reconstituted) vaccine preparation was transferred to the United States. (Sandstrom, G. 1994. The tularemia vaccine. J. Chem. Tech. Biotech. 59: 315-320). However, the bacterial colonies grown from the transferred ampoule differed morphologically - the colonies were “blue” and “gray”. Moreover, the "blue" colonies had immunogenic properties, and the "gray" did not possess such properties, which additionally testified to the instability of the vaccine properties of the vaccine tularemia strain 15.

As can be seen from the above, the previously obtained tularemia vaccine strains were unstable.

One of the mechanisms of variation is known to be intragenomic homologous recombination, and the recA gene product is a key enzyme in the process of homologous recombination (SCKowalczykowski, DADixon, A.K. Eggleston, SDLauder, and WMRehrauer. Biochemistry of homologous recombination in Escherichia coli // 1994. Microbial. Rev. Vol. 58, No.3. P. 401-465).

The tuberculosis vaccine based on the Bacille Calmette-Guerin (BCG) strain, which was obtained from Mycobacterium bovis, is now widely used in the world. In different countries, live tuberculosis vaccine is prepared on the basis of BCG strain variants - Pasteur, Frappier, Denmark, Russia. Among the variants, only the strain Russia, which has a defective recA gene, practically does not differ in the level of expression of protective antigens, immunogenicity, and protective effect from the original BCG strain, while other strains have evolved and exhibit different protective activity (M. Keller, E.C. Boettger , P. Sand. // Tuberculosis vaccine strain Mycobacterium bovis BCG Russia is a natural recA mutant. Nature Precedings. 2008). This observation is additional evidence of the effect of the recA gene product on bacterial variability.

Only one work is known on the inactivation of the recA gene in the natural subspecies F.tularensis subsp. novicida (J.M. Berg, E. Khisimuzi MDLULI, F. Nano. Infect. and immun. 1992. p. 690-693. V.60. N.2). But in this work, there was no data on the effect of this mutation on the homologous recombination and immunogenicity of F. tularensis subsp. novicida. Methods for stabilizing the vaccine properties of the tularemia strain by inactivating the recA gene in the F.tularensis genome are not known in the literature.

The present invention is the inactivation of the recA gene, eliminating homologous recombination and contributing to the constancy of the genome of the vaccine strain of tularemia microbe.

The problem is solved by the fact that a method for stabilizing vaccine tularemia shamma by introducing a deletion of the recA gene into the F.tularensis 15/10 chromosomal DNA using the suicide plasmid pPVΔrecA carrying the region of the F. tularensis chromosome with the deleted recA gene as a result of allelic exchange between the modified fragment is proposed DNA with the deleted gene recA and the homologous region of the chromosomal DNA of the vaccine strain.

The suicide plasmid pPVΔrecA was created on the basis of plasmid pUC19, DNA fragments with the sacB, cat, mob genes and a fragment of the chromosomal DNA F.tularensis 15/10 with a deletion of the recA gene.

A fragment of chromosomal DNA of F.tularensis 15/10 with a size of 2984 bp is used to create pPVΔrecA. with a deletion of the structural region of the recA 1060 bp gene that is inserted into the pPV plasmid vector constructed on the basis of the pUC19 plasmid incapable of replication in F.tularensis containing the sacB, cat, mob genes.

Inactivation of the recA gene inhibits homologous recombination and contributes to the constancy of the genome of the vaccine strain of tularemia microbe. Such a modified strain retains useful vaccine properties.

The strain Francisella tularensis 15 / 10ΔrecA is deposited in the collection of microorganisms of the Federal State Institution of Science "State Scientific Center for Applied Microbiology and Biotechnology" (FGUN SSC PMB) collection number 6622.

The strain is based on a strain of Francisella tularensis. subsp. holarctica 15/10 and differs from the original strain by the absence of the recA gene in the genome.

The strain was obtained as a result of allelic exchange of a DNA region with the deleted recA gene from plasmid pPVΔrecA for a natural variant in the F.tularensis chromosome 15/10. Clones with the Cm ^r phenotype were selected on a medium with chloramphenicol (3 μg / ml). To eliminate plasmid pPVΔrecA, the culture was grown on sucrose medium. Isolated colonies were analyzed by PCR. As a result, a clone with a deleted genome fragment of 2.949 kb was selected. without recA gene.

The strain is intended as a model to study the stabilization of the protective properties of the vaccine strain and to create stable producer strains of antigens.

The absence of the recA gene was confirmed by PCR using specific primers.

Culture media for cultivation

Dense erythritol agar supplemented with black albumin. Liquid medium (medium composition per 1 liter): 5 g of casein enzymatic hydrolyzate, 5 g of yeast extract, 5 g of sodium chloride, 12 g of monosubstituted potassium phosphate, pH 7.2, 1% glucose, 10 mg of cysteine, 10 mg of ferric chloride. In the environment, you can add polymyxin in a concentration of 100 μg ml ^-1 to suppress extraneous microflora.

Storage method

In the lyophilized state: 40% sucrose-gelatin protective environment, storage at a temperature of (4-8) ° C, re-laying after 5 years.

Cultural and morphological features of the strain

It grows on nutrient media enriched with natural substrates (blood, egg yolk). The pace of development is slow. The optimum temperature of cultivation is 37 ° C, pH 7.0-7.5. On a dense erythritol agar-based medium with the addition of black albumin in 48-72 hours, colonies with a diameter of about 2.0-2.5 mm are formed, convex, shiny, smooth, bluish-white, opaque, homogeneous. Under the microscope, the bacterial cells are visible as very small gram-negative coccoid cells of about 0.5 μm, immobile, do not form spores and capsules.

Genetic features of the strain

A chromosomal DNA fragment with the recA gene has been deleted.

Resistance (sensitivity) to antibiotics, phages, etc.

Resistant to 100 μg / ml polymyxin, 100 μg / ml ampicillin, 50 μg / ml erythromycin. Lysis phages were not detected. Resistant to the bactericidal action of normal animal serum.

Other genetic features

Auxotroph.

The invention is illustrated by the following examples.

Example 1. Construction of plasmids for allelic exchange pPVΔrecA

The creation of a plasmid for allelic exchange pPVΔrecA for homologous recombination is presented in scheme 1.

To obtain a chromosomal DNA fragment with a deletion of the recA gene, two amplicons are obtained (two DNA fragments are amplified) with dimensions of 1592 bp using primers FSA and RBA and 1392 bp using FBA and RSA primers (table 1, scheme 2). Primers are calculated using the nucleotide sequence of the F.tularensis ssp holarctica LVS genome (AM233362) taken from the gene bank (www.ncbi.nlm.nih.gov). Primers are synthesized in Syntol CJSC. The 5 ′ end portion of the FSA primer contains the SalI restriction site, the 5 ′ end portion of the RBA primer contains the BamHI restriction site and the TTA stop codon, similarly, the 5 ′ end portion of the FBA primer contains the BamHI restriction site and the stop codon TAA, and the RSA primer The 5'-end contains a SalI restriction site.

PCR is carried out using high-precision polymerase (High fidelity enzymes mix, "Fermentas", Lithuania). The reaction mixture contains 10x DNA polymerase buffer, Fermentas, Lithuania (75 mM Tris-HCl pH 8.8, 20 mM (NH ₄ ) ₂ SO ₄ , 0.01% Tween 20), 2.5 mM MgCl ₂ ; 0.5 μM forward and reverse primers (primers are shown in table 1), 0.2 μM of each dNTP (10 mM dNTP) and 1 unit Taq DNA polymerase of the company "Fermentas", Lithuania; 50-100 ng of DNA. PCR amplification is carried out in the following mode: 95 ° C - 3 min, 1 cycle; 94 ° C - 30 sec, 51 ° C (53 ° C for 4.0 kbp of fragment containing the recA gene) - 30 sec, 72 ° C - 1 min (4 min for 4.0 tp a fragment containing the recA gene), 30 cycles; 72 ° C for 7 min (10 min for a 4.0 kbp fragment of the recA gene), 1 cycle. The reaction products are separated by electrophoresis in a 0.7% agarose gel.

Table 1 Primers used for amplification of the recA gene Title 5'-3 'sequence Target gene FSA AAAGTCGACCTGGTGGTTTGATGGTT RecA (left shoulder) Rba AAAGGATCCTTAAACTGATTCTAGCGCCTTT RecA (left shoulder) Fba AAAGGATCCTAAGCAGTTACTCAAGATGAG RecA (right shoulder) RSA AAAGTCGAC TACCATTCTCAAGGTACT RecA (right shoulder)

Amplicon purification was performed using the DNA Extraction Kit (Fermentas, Lithuania). Amplicons measuring 1592 bp and 1392 bp treated with restriction enzymes Sa1I and BamHI and inserted into the Sa1I restriction site of the vector plasmid pPV, previously linearized with restriction enzyme Sa1I.

The resulting recombinant plasmid was transferred to the cells of E. coli strain DH5α by calcium transformation. Transformants with plasmid pPVΔrecA were selected based on ampicillin resistance and the presence of a F.tularensis 15/10 chromosomal DNA fragment with deletion of the recA gene by PCR using FSA and RSA primers.

Example 2. Obtaining strain F.tularensis 15 / 10ΔrecA and its properties

The creation of strain E. coli S17-1 for transfer of plasmid pPVΔrecA in F.tularensis 15/10

Plasmid pPVΔrecA is transferred to the cells of E. coli strain S17-1 (thi, thr, leu, tonA, lacY, supE, recA :: RP4-2-Tc :: Mu, Kn :: Tn7) by the calcium transformation method. Transformants with plasmid pPVΔrecA were selected based on resistance to ampicillin, chloramphenicol, sensitivity to sucrose, and the presence of a chromosomal DNA fragment F.tularensis 15/10 with deletion of the recA gene by PCR using primers FSA and RSA.

Conjugation transfer of pPVΔrecA to F.tularensis

For crossing, a suspension of 100 μl is prepared, containing 1 · 10 ⁸ cells of the donor strain E. coli S17-1 (pPVΔrecA) and 3 · 10 ¹⁰ cells of the recipient strain F.tularensis 15/10, stained with 25 μl on Luria agar medium Bertani (LB) and incubated at a temperature of 25 ° C for 18 hours.

Bacterial culture of the spots is collected, suspended in buffered saline (PBS) and plated from the appropriate ten-fold dilutions on solid nutrient medium FT-agar (FGUN SSC PMB).

100 μg ml ^{-1 of} polymyxin B and 3 μg ml ^{-1 of} chloramphenicol are added to the medium, and the crops are incubated at a temperature of 37 ° C. After 120 hours of incubation, the grown colonies are subcultured onto FT-agar medium containing 100 μg ml ^{-1 of} polymyxin B and 5% sucrose to isolated colonies and incubated at 37 ° C.

Among the grown colonies, after 48 hours of incubation, colonies with the Cm ^S phenotype capable of growing on FT-agar with 5% sucrose were selected. Selected colonies are checked in PCR using primers FSA and RSA. Clones possessing a deletion variant of the recA gene produce a synthesis of a shortened amplicon of 2949 bp, while clones of the original strain 15/10 give synthesis of a amplicon of 4009 bp. As a result, clone F.tularensis 15/10 with the ΔrecA genotype was selected. This clone was tested by PCR for the absence of the cat gene (which determines the resistance to chloramphenicol) using primers CCF (5'-ACAATTGGAAGAGAAAAGA-3 ') and CCR (5'-CTATCTGACAATTCCTGA-3'). The investigated clone lacked the cat gene.

Growth Features of F.tularensis 15 / 10ΔrecA

To study the growth dynamics of the vaccine strain F.tularensis 15 / 10ΔrecA using liquid nutrient medium F2 (g / l) of the following composition:

casein acid hydrolyzate - 5 g;

yeast extract - 5 g;

cysteine hydrochloride monohydrate - 0.1 g;

potassium phosphate monosubstituted - 12 g;

potassium hydroxide - 3.9 g;

sodium chloride - 5 g;

iron (II) sulfate seven-water - 6 mg;

glucose - 10 g;

water - up to 1 l;

pH is 7.2.

Autoclaving the medium is carried out at 1 atm for 30 minutes.

Cultivation is carried out in 750 ml rocking flasks containing 30 ml of F2 medium. Cultivation is carried out on a rocking chair with stirring at 200 rpm and a temperature of 37 ° C. To compare the growth dynamics of the studied strain using the original vaccine strain F.tularensis 15/10.

Data on the values of OD (optical density of the suspension at a wavelength of 590 nm) and BK (cell concentration according to seeding on a solid nutrient medium) of growing cultures are shown in table 3.

Table 3 Growth dynamics of vaccine strains F. tularensis 15/10 and F.tularensis 15 / 10ΔrecA Incubation time, h Optical density / Lg CFU / ml F.tularensis 15/10 F.tularensis 15/10 ΔrecA 0 0.05 / 9.38 0,046 / 9.11 one 0,043 0,052 2 0,0504 / 9.07 0,053 / 8.95 3 0.08 0,063 four 0.119 / 9.20 0,0761 / 9.14 5 0.148 0.103 6 0.186 / 9.88 0.19 / 9.92 7 0.21 0.215

The results presented in the table indicate that the mutation in the recA gene does not affect cellular processes that affect the growth of F.tularensis 15 / 10ΔrecA.

Frequencies of homologous recombination in F.tularensis 15 / 10ΔrecA and F.tularensis 15/10

To verify the absence of homologous recombination in the obtained strain of F.tularensis 15 / 10ΔrecA defective in the recA gene, conjugation transfer of plasmids pPV / ΔiglC (plasmid pPV containing a fragment of the chromosome F.tularensis 15/10 with the inactivated iglC gene) is carried out from E. coli S17-1 in F.tularensis 15 / 10ΔrecA. As a control, the original strain F.tularensis 15/10 is used, into which the plasmid pPV // ΔiglC is also transferred. To determine the efficiency of transfer of plasmids from E. coli S17-1 to the studied F.tularensis strains, E. coli S17-1 with a plasmid pHV33-mob capable of autonomously replicating in a tularemia microbe was used.

Inoculation of the conjugates is carried out on FT-agar containing 100 μg ml ^-1 polymyxin B and 3 μg ml ^-1 chloramphenicol. The results obtained indicate that the frequency of conjugation transfer of plasmid pHV33-mob from E. coli S17-1 to the studied F.tularensis strains is the same and is 10 ⁷ CFU. But during the conjugation transfer of the recombinant plasmid pPV / ΔiglC to the deletion strain F.tularensis 15 / 10ΔrecA, no clone was obtained, while the transfer of the plasmid pPV // ΔiglC from E. coli S17-1 to F.tularensis 15/10 resulted in 10 ² CFU. This suggests that homologous recombination in F.tularensis 15 / 10ΔrecA is significantly reduced.

UV resistance of F.tularensis 15/10 ΔrecA strain

For the UV irradiation experiment, a cell suspension was prepared according to the turbidity standard for 10 optical units (which corresponds to the concentration of bacteria F.tularensis 15 / 10-5 · 10 ⁹ cells / ml) from an overnight agar culture. Then the suspension is diluted to a concentration of 1 · 10 ⁶ cells / ml in PBS and 10 ml of the diluted bacterial suspension is transferred to a Petri dish with a diameter of 10 cm. Irradiation is carried out at a wavelength of 365 nm, with constant stirring on a UV transilluminator. After irradiation, the suspension is plated on FT-agar from the initial dilution and the first three ten-fold dilutions and incubated at 37 ° C for 72 hours. The results of inoculation of irradiated F.tularensis 15 / 10ΔrecA cells are shown in Table 4. For comparison, this table shows the survival data for F.tularensis 15/10, F.tularensis 15 / 10ΔrecA (pHV33-mob / recA), F.tularensis 15 strains / 10ΔrecA (pHV33-mob).

To create the pHV33-mob / recA vector, the pHV33-mob vector is used. The pHV33-mob vector is based on the plasmid pHV33, which replicates both in E. coli cells and in F.tularensis cells. A mob fragment from plasmid pPV containing the origin of the oriT transfer from plasmid RP4 is inserted into the BamHI site of the plasmid pHV33, which allows the use of the obtained construct for mobilization transfer of the cloned genetic material from the recipient strain E. coli S17-1 to F.tularensis strains.

Plasmid pHV33-mob / rec4 was obtained by insertion into the vector plasmid pHV33-mob at the restriction site SalI amplicon with a size of 4009 bp with the intact recA gene. This amplicon was obtained on a F.tularensis 15/10 chromosomal DNA matrix with FSA and RSA primers (Table 1).

Table 4 UV exposure on tularemia vaccine strains Exposure time, sec F.tularensis 15/10 F.tularensis 15 / 10ΔrecA F.tularensis 15 / 10ΔrecA: pHV33-mob / recA F.tularensis 15/10 ΔrecA: pHV33-mob The concentration of living cells after UV irradiation (Lg CFU / ml) 0 9.14 9.3 8.91 9.2 10 9.04 7 8.81 7.01 twenty 9.01 6.6 8.47 6.02 40 8.7 6.25 8.37 5.36 80 8.0 5 8.16 4.47 160 6.9 - 7.51 -

Deletion of a F.tularensis 15/10 chromosomal DNA fragment with the recA gene increases the sensitivity of bacterial cells of the modified F.tularensis 15 / 10ΔrecA strain to UV radiation compared to the original F.tularensis 15/10 strain and F.tularensis 15 / 10ΔrecA strain (pHV33-mob / recA) obtained by transferring a plasmid carrying the full-length F.tularensis 15/10 recA gene into the F.tularensis 15 / 10ΔrecA strain.

Determination of the resistance of F.tularensis 15 / 10ΔrecA to normal rabbit serum (NCC)

The bactericidal activity of NKS for the strains of F.tularensis 15 / 10ΔrecA and F.tularensis 15/10 was almost the same and amounted to 30% survival after incubation for 18 hours at a temperature of 37 ° C.

Determination of virulence of F.tularensis 15 / 10ΔrecA for BALB / c mice

BALB / c mice (5 mice per group, age 6-8 weeks) were infected subcutaneously with a bacterial suspension in doses of 1 · 10 ¹ , 1 · 10 ² , 1 · 10 ³ and 1 · 10 ⁴ CFU / mouse. Animals are observed for 30 days. LD _{50 is} determined by the method of Kerber in the modification of I.P. Ashmarin. The results of the determination of LD ₅₀ for strain F.tularensis 15 / 10ΔrecA are presented in table 5. For comparison, this table shows the value of LD ₅₀ for the vaccine strain F.tularensis 15/10.

Table 5 Definition of LD ₅₀ for strains F.tularensis 15/10 and F.tularensis 15 / 10ΔrecA Strains F.tularensis LD ₅₀ , CFU 15/10 5.010 ² 15 / 10ΔrecA 5.0 · 10 ³

The data in the table show that the loss of the ability to produce RecA protein leads to a 10-fold decrease in the virulence of the deletion variant in the recA gene compared to the vaccine strain F.tularensis 15/10.

Assessment of the resistance of the strain F.tularensis 15 / 10ΔrecA

BALB / c mice (5 animals per group) were immunized subcutaneously with a bacterial suspension of the studied F.tularensis strain at doses of 1 · 10 ¹ , 1 · 10 ² , 1 · 10 ³ and 1 · 10 ⁴ CFU / mouse. PBS was administered to mice in the control group. On the 45th day after immunization, subcutaneous infection of animals of all groups with F.tularensis 503 strain was carried out with a dose of 1 · 10 ² CFU / mouse (with subcutaneous infection with F.tularensis 503 DCL equal to 1 cell). Observation of infected animals is carried out for 21 days. The protective properties of the strain are evaluated by the percentage of surviving animals after infection in percent.

Survival data for animals pre-immunized with the vaccine strain F.tularensis 15 / 10ΔrecA are presented in Table 6. For comparison, this table shows the survival rates for animals pre-immunized with the vaccine strain F.tularensis 15/10.

Table 6 The resistance of strains F.tularensis 15/10 and F.tularensis 5 / 10ΔrecA Dose of immunization, CFU / mouse CFU / mouse infection dose The percentage of surviving animals Immunization 15/10 Immunization 15 / 10ΔrecA 1 · 10 ¹ one hundred 60 1 · 10 ² one hundred one hundred 1 · 10 ³ 1 · 10 ² one hundred one hundred 1 · 10 ³ one hundred one hundred 1 · 10 ⁴ Nd one hundred

The protective properties of the strains F.tularensis 15/10 and F.tularensis 15 / 10ΔrecA practically do not differ.

The results allow us to conclude that the inactivation of the recA gene in F.tularensis 15/10:

1. Suppresses homologous recombination in F.tularensis 15 / 10ΔrecA.

2. Does not lead to a change in cultural properties.

3. Does not lead to a change in resistance to the components of normal rabbit serum.

4. Reduces residual virulence in mice.

5. Does not change the protective properties of the vaccine strain.

Thus, the present invention allows to maintain the constancy of the genome and the protective properties of the vaccine strain.

Claims (2)

1. A method for stabilizing a vaccine tularemia strain by introducing a deA gene deletion into F.tularensis 15/10 chromosomal DNA using the suicide plasmid pPVΔrecA carrying the portion of the F.tularensis chromosome with the delegated recA gene as a result of allelic exchange between the modified DNA fragment with the delegated recA gene and the homologous region of the chromosomal DNA of the vaccine strain. 2. The method according to claim 1, where the suicide plasmid pPVΔrecA based on plasmid pUC19 contains DNA fragments with the sacB, cat, mob genes and a fragment of the chromosomal DNA F.tularensis 15/10 with a deletion of the recA gene.

Images