RU2448692C2 - Pharmaceutical salts of aminobicyclo[2,2,1]heptane as nf-kb transcription factor inhibitors with antiviral activity (versions) and using them - Google Patents

Abstract

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to organic chemistry and medicine, and concerns new bicycloheptane amino derivatives, namely pharmaceutical salts of 2-(1-aminoethyl)bicyclo[2.2.1]heptane of formula (1)

using them for treating influenza A.

EFFECT: compounds show high activity and low toxicity.

3 cl, 3 dwg, 4 tbl, 12 ex

Description

The invention relates to medicine and, in particular, to the development of treatment for influenza.

Currently, two main classes of drugs are used to treat influenza and acute respiratory viral infections - symptomatic drugs and antiviral etiotropic drugs.

Symptomatic remedies include aspirin, paracetamol, and anti-toxic agents that accompany almost all clinical forms of influenza infection. To date, the entire group of these drugs is outdated and does not correspond to modern ideas about the pathogenesis of influenza infection [Avian influenza: the origin of infectious biocatastrophes. Pokrovsky V.I., Kiselev O.I., ed., Ed. “Rostock", St. Petersburg, 2005, 376 pp.].

Etiotropic drugs used to treat the flu include amantadine, remantadine, algir, Relenza, Tamiflu, and Arbidol [De Clercq E., Strategies in the design of antiviral drugs. Nature review. Drug Discivery. 2002, Vol.1, p.13-25].

The effectiveness of etiotropic therapy significantly depends on the simultaneous use of symptomatic agents, since the relief of flu symptoms during etiotropic therapy is slow and is largely determined only by the suppression of viral reproduction.

The peculiarity of influenza infection is that already at an early stage of the infection process, a strong activation of the pro-inflammatory innate immune response occurs [Seo S.H., Hoffman E., Webster R.G., Lethal H5N1 influenza virus escape host anti-viral cytokine responses. Nat. Med., 2002. Vol.8, p. 950-954].

Further development of this reaction leads to a “cytokine storm”, complicating the course of the infection and leading to complications such as pulmonary edema and systemic organ damage [Zhou J., Law H.K.W., Cheung C.Y. et al. Differential expression of chemokines and their receptors in adult and neonatel macrophages infected with human and avian influenza viruses. J. Infect. Dis., 2006, Vol. 194, p. 61-70]. It is indicated that a high level of production of tumor necrosis factor (TNF-α) is the main cause of systemic organ damage in severe forms of influenza infection.

Means of pathogenetic etiotropic action for the treatment of influenza infection must satisfy three basic requirements:

- act on the reproduction of the virus;

- reduce the cytopathic effect of the virus;

- reduce the pro-inflammatory response of the body

[Avian influenza: the origin of infectious bio-catastrophes. Pokrovsky V.I., Kiselev O.I., ed., Ed. “Rostock", St. Petersburg, 2005, p.376].

In recent years, significant progress has been made in the development and study of the properties of non-steroidal anti-inflammatory drugs [Davies N.M., Action and toxicity of nonsteroidal anti-inflammatory drugs. Curr. Opin. Rheumatology, 1996, Vol.8, p. 169-175]. In particular, the pharmacological properties of the new amino and nitro derivatives of aspirin (acetylsalicylic acid) have been studied.

The goal of obtaining new derivatives of aspirin was to, on the one hand, reduce or eliminate side effects from preparations based on acetylsalicylic acid, and, on the other hand, give them new properties [Glasgow J.F .; Middleton B .; Moore R .; Gray A .; Hill J., The mechanism of inhibition of beta-oxidation by aspirin metabolites in skin fibroblasts from Reye's syndrome patients and controls. Biochim Biophys Acta. 1999; Vol.1454 (1), p.115-25]. In this context, mesalazine, which is 5-aminosalicylic (or 5-amino-2-hydroxybenzoic) acid, should be noted.

An analysis of the mechanisms of the anti-inflammatory action of mesalazine showed that its anti-inflammatory activity is associated with the suppression of the synthesis of the transcription factor NF-kB [Allgayer H., Review article: mechanism of action of mesalazine in preventing colorectal carcinoma in inflammatory bowel diseases. Aliment. Pharmacol Ther., 2003, Vol. 18, Suppl. 2, p.10-14]. Later, a more active analog of Mesalazine - Sulfosalazine [Wahl S., Liptay S., Adler G., Schmidt R.M. Sulfassalazine - a potent and specific inhibitor of nuclear factor Nf-k, Rappa B. J., Clin. Invest., 1998, Vol. 101, p. 1163-1174].

However, the use of salicylic acid derivatives is contraindicated in severe forms of influenza and SARS SARS, as in these cases the incidence of Reye’s syndrome increases [Glasgow JF, Middleton B., Moore R., Gray A., Hill J., The mechanism of inhibition of beta - oxidation by aspirin metabolites in skin fibroblast from Reye's syndrome patients and controls. Biochim Biophys. Acta, 1999, Vol. 1454 (1), p. 115-125. Deeva E.G. Flu. On the verge of a pandemic. A guide for doctors. M .: Publishing. "Geotar". 2008. 198 p.] Therefore, the search for the most effective non-steroidal anti-inflammatory drugs is carried out mainly in the direction of finding transcription factor inhibitors NF-kB [Dieppe P., Dartlett C., Davey P., Doyal L., Ebrahim S., Clinical Review . Balancing benefits and harm: the example of non-steroidal anti-inflamatory drugs. BMJ, 2004, Vol.329, p.31-34].

Changes in the pharmacological properties of aspirin with the introduction of a 5-amino group have led to the strengthening of one of the most important properties of the initial preparation, in particular, the ability to suppress the synthesis of transcription factor NF-kB. The relatively simple modification remains attractive for changing the pharmacological properties of other simplest anti-inflammatory drugs, especially those of natural origin, in particular, such as monoterpenes.

It is known that activation of the transcription factor NF-kB is a key point in the induction of the synthesis of pro-inflammatory cytokines [Tripathi P., Aggarwal A. NF-kB transcriptional factor: a key player in the generation of immune response. Current science, 2006, Vol.90, p.519-531]. Therefore, the creation of antiviral drugs with the properties of NF-kB inhibitors is of significant interest for improving the treatment of viral infections and, in particular, influenza.

Influenza infection begins with the activation of NF-kB and is accompanied in the case of particularly pathogenic viruses by a cytokine storm, in which transcriptional activation of the synthesis of cytokines such as tumor necrosis factor (TNF) -α, interferons-α and -β, interleukins-6.8, 10 and macrophage pro-inflammatory proteins of the MIP family [Nimmerjahn F., Dubziak D., Dirmeier U., Hobom G., et al. Active NF-kB signaling is prerequisite for influenza virus infection. J. Gen. Virol., 2004, Vol. 85, p. 2347-2356]. The transcriptional activity of genes encoding these cytokines is controlled by the key transcription factor NF-kB [Hiscott J., Kwon H., Genin P., Hostile take over: viral appropriation of the NF-kB pathway. Clin. Invest., 2001, Vol. 107 (2), p. 143-151, Seo S.H., Hoffman E., Webster R.G., H5N1 influenza virus escape host antti - viral cytokine responses. Nat. Med., 2002, Vol.8, p. 950-954].

Thus, from the current state of research it follows that:

1. Salicylates are contraindicated in many respiratory viral infections, and especially with moderate flu or its hypertoxic forms. Paracetamol-based drugs are highly toxic (used in extremely high dosage), and so far no means and methods have been found to reduce their toxicity.

2. The need for a combination of antiviral agents and anti-inflammatory therapy in the treatment of influenza forces the production of complex drugs or complex therapy. Complex drugs in most cases do not justify themselves, since the simultaneous administration of individual drugs leads to interference of effects that are not always positive both for the patient and for viral reproduction.

3. In medical practice, there are virtually no antiviral drugs with antioxidant activity or anti-inflammatory effect.

The creation of antiviral drugs with anti-inflammatory properties will help to solve the most important problem - the implementation of drug control over the reproduction of influenza viruses not only through direct antiviral action, but also by reducing the generalized inflammatory response characteristic of modern influenza.

The closest in structure and activity to the claimed compounds are monoterpenes, namely natural borneol.

Monoterpenes are an extensive class of compounds. No less wide is the spectrum of their action (see table 1). The most important for this invention are the anti-inflammatory, antimicrobial and antiviral activity of a number of monoterpenes.

Table 1 The spectrum of biological properties of monoterpenes [getinfo@haworthpressinc.com] Title Molecular structure Concentration% Boiling point, ° С The properties A-terpinol

0.02 217-218 Antibacterial anti-inflammatory Terpineol-4-ol

0.0004 209 Antibacterial anti-inflammatory p-cimen

0.0004 177 Antibacterial anti-inflammatory Borneol

0.008 210 Antibacterial anti-inflammatory Δ-3-Karen

0.004 168 Antibacterial anti-inflammatory

Borneols and isoborneols are the most common bicyclic compounds belonging to the class of monoterpenes. In borneol, the hydroxyl group is in the end position, and in isoborneol - in exo, that is, isoborneol is the exo-isomer of borneol http://en.wikipedia.org/wiki/Borneol

http://allrss.com/wikipedia.php?title=Borneol

Unlike benzene derivatives, such as salicylic acid, acetylsalicylic acid and ibuprufen, natural borneol and isobornoleol belong to bicyclo [2.2.1] heptanes, which is a fundamental difference in chemical structure from the above drugs. The bicyclic structure of borneol and isoborneol is better adapted to the lipophilic components of the cell — the cell membranes, so it can be expected that an increase in their bioavailability can lead to the appearance of new pharmacological properties while maintaining the former.

Borneol and isoborneol have both anti-inflammatory and antioxidant effects. In medicine of many peoples in Asia, natural vegetable oils containing borneol and isobornoleol from 0.01 to 5% are used as a local treatment for inflammatory lesions in the form of rubbing and ointments. In addition, such similar compounds are used as camphor (dehydrogenated borneol), pipene (whose bicyclic framework is similar to that of borneol) and other monoterpenes [Dharmananda S. Borneol, Artemisia and moxa. http. www.itmonline.org/org/art/borneol.ytm. Household Products Database www.hhs.gov. Vail III, Banning W., Vail M.L. Method and apparatus to prevent, treat and cure infections of the respiratory system by pathogens causing sever acute respiratory syndrome (SARS). US Patent 7,048,953].

However, borneol and isobornoleol, having the structure of norbornanes, exhibit high lipophilicity and are therefore toxic to animal and human cells [Avian influenza: the origin of infectious biocatastrophes. Pokrovsky V.I., Kiselev O.I., ed., Ed. “Rostock", St. Petersburg, 2005, 376 pp.].

The anti-inflammatory effect of monoterpenes is their essential property. But the mechanism of action of these agents is unknown.

Due to the similar bicyclic structure of preparations based on natural borneol and antiviral framework synthetic derivatives of norbornanes, it was of interest to study amino derivatives of norbornanes (borneol analogues) as anti-inflammatory and anti-influenza agents. Moreover, the preparation of various pharmaceutical salts also makes it possible to give norbornanes new properties that enhance one or another biological effect on cellular processes.

Anti-inflammatory drugs of natural origin, exhibiting antiviral properties after modification, are unknown in the literature.

The invention is directed to the creation of new compounds having both antiviral and anti-inflammatory activity, non-toxic to animal and human cells, namely amino derivatives of bicycloheptanes having anti-inflammatory effect at the level of inhibition of transcription factor NF-kB and antiviral activity against influenza A viruses.

Pharmaceutical salts of 2- (1-aminoethyl) norbornane (1a-h) and 2-aminonorbornane (2) with antiviral and anti-inflammatory activity are not described in the literature.

Norbornanes (structural analogues of borneol) are disclosed — salts of 2- (1-aminoethyl) [2.2.1] heptane of formula (1a-h), as well as 2-aminobicyclo [2.2.1] heptane hydrochloride of formula (2)

X

(a) Cl

(b) OCOC ₆ H ₅

(c) OCOCH ₂ OC ₆ H ₄ -2-CH ₃

(d) OCOCH ₂ SC ₆ H ₄ -4-Cl

(e) OCO-C ₆ H ₄ -2-OH

(f) OCO-C ₆ H ₄ -2-OCOCH ₃

(g) OSSN ₂ CH ₂ COOH

(h) (HOOC) C (OH) (CH ₂ COOH) ₂

exhibiting antiviral activity against type A influenza viruses and anti-inflammatory properties characteristic of the natural analogue of these compounds - borneol.

Amino derivatives of norbornanes as synthetic analogues of natural borneol, while reducing the overall hydrophobicity of the molecule, have high bioavailability, low toxicity, and a wide spectrum of biological activity.

The use of pharmaceutically acceptable salts of the general formula (1a-h) and 2 for the manufacture of a medicament for the treatment of influenza A is also claimed.

The pharmaceutical salts of 2- (1-aminoethyl) norbornane (2a-h) have a direct antiviral effect on the reproduction of type A influenza virus and at the same time show the ability to suppress the induction of transcription factor NF-kB, a key transcription factor that controls the synthesis of pro-inflammatory cytokines in response to viral an infection.

The claimed pharmaceutical salts with both antiviral and anti-inflammatory properties can be used to solve the most important task: to carry out drug control of the reproduction of influenza viruses not only through direct antiviral action, but also by reducing generalized inflammatory processes.

The invention is illustrated by drawings:

FIGURE 1 - structural formulas of the claimed compounds.

2 shows the effect of aminonorbornanes (compounds 1a and 2) on the induction of transcription of the NF-kB gene. The relative level of NF-kB gene expression is noted on the bars of the diagram.

1. Background transcription

2. Induction of 10 μg / ml recombinant TNF-α

3. The effect of compound 1A and the effect of compound 2

FIG.3 shows the effect of 2 (-1-aminoethyl) norbornane (compound 1a) on the induction of transcription of NF-kB in various concentrations: at the top is the electrophoresis of PCR fragments, at the bottom is a graph of the dependence of the suppression of NF-kB gene expression on the concentration of the compound. Concentrations of compounds are indicated along the abscissa. Columns 1 and 2 (0, 0) represent the background and induction of TNF-α, respectively.

FIGURE 4 is an electrophoregram of PCR fragments of transcripts of the NF-kB gene of HeLa cells under the action of aminonorbornanes (compounds 1a and 2) and dihydroquercetin:

1. Induction of TNF-α

2. Suppression of induction by compound 1a

3. Suppression of induction by compound 2

4. Suppression of dihydroquercetin induction

5. The action of remantadine

6. Control with a duration of stimulation for 18 hours

FIG.5 shows the suppression of the induction of transcription of NF-kB isobornol at various concentrations, where:

1. Control

2. Isoborneol - 0.01%

3. Isoborneol - 0.05%

4. Isoborneol - 0.1%

A method of obtaining compounds of formula 1 is as follows.

Synthesis of 2- (1-aminoethyl) bicyclo [2.2.1] heptane 1a hydrochloride and other pharmaceutical salts 1b-h.

Upon condensation of methyl vinyl ketone with cyclopentadiene, a bicyclic ketone is obtained, and during subsequent treatment with hydroxylamine, 5-acetylbicyclo [2.2.1] hept-2-ene oxime is isolated. By hydrogenation in alkanol at elevated pressure in the presence of a nickel catalyst, the starting 2- (1-aminoethyl) bicyclo [2.2.1] heptane or 2- (1-aminoethyl) norbornane (A) was obtained.

After separation of the catalyst, the resulting amine A is isolated from the reaction mass by extraction with an organic solvent (ether) or by vacuum distillation. Organic salts are obtained from the isolated amine A by reaction with the corresponding acids: hydrochloric (a), benzoic (b), ortho-cresoxyacetic (c), para-cresylthioacetic (d), salicylic (ortho-hydroxybenzoic) (e), acetylsalicylic (aspirin) (f), amber (g) and lemon (h).

The cationic fragment of the other pharmaceutical salts 1a-h is the same and is 2- (1-aminoethyl) bicyclo [2.2.1] heptane.

General structural diagram of the salts obtained:

Hx

(a) HCl

(b) PUMP ₆ N ₅

(c) HOCOCH ₂ OC ₆ H ₄ -2-CH ₃

(d) HOCOCH ₂ SC ₆ H ₄ -4-Cl

(e) HOCO-C ₆ H ₄ -2-OH

(f) HOCO-C ₆ H ₄ -2-OCOCH ₃

(g) NOOSSN ₂ CH ₂ COOH

(h) (HOOC) C (OH) (CH ₂ COOH) ₂

The following are examples of the synthesis of pharmaceutical salts (2- (1-aminoethyl) norbornane) for the subsequent study of their antiviral and anti-inflammatory activity.

1a

Example 1. Through a solution of 1.40 g (0.01 mol) of 2- (1-amino-ethyl) norbornane (A) in 10 ml of dry ether, HCl (a) was passed for 10 minutes, cooled, and evaporated to give 1.76 g (100%) of hydrochloride 1a. The purity of the product is controlled by GLC. Yield 78%. The content of the main substance is 99.0%. Mp 282-283 ° C.

1b

Example 2. To a solution of 1.40 g (0.01 mol) of 2- (1-aminoethyl) norbornane (A) in 10 ml of diethyl ether is added with stirring a solution of 1.22 g (0.01 mol) of benzoic acid HOCOS ₆ H ₅ acid (b ) in 10 ml of diethyl ether. The precipitated fine-crystalline precipitate of 2- (1-aminoethyl) norbornane benzoate (1b) is filtered off, washed with 2 ml of diethyl ether. Yield (1b) 2.17 g (83.1%). Mp 173-174 ° C.

1s

Example 3. To a solution of 1.40 g (0.01 mol) (A) in 5 ml of dry chloroform, with stirring, a solution of 1.66 g (0.01 mol) of cresoxyacetic acid HOCOCH ₂ OC ₆ H ₄ -2- is added dropwise over 10 minutes. CH ₃ (s) in 10 ml of chloroform. The reaction mixture is stirred for 1.5 hours, evaporated by half and cooled to 0-5 ° C. The precipitate (2b) is filtered off, washed twice with 5 ml of light petroleum ether and dried in a vacuum desiccator at 20 mm Hg. within 5 hours. 2.94 g (96.3%) of 2- (1-aminoethyl) norbornane o-cresoxyacetate (1c) were obtained. Mp 221-223 ° C.

1d

Example 4. To a solution of 1.40 g (0.01 mol) of 2- (1-aminoethyl) norbornane (A) in 5 ml of dry (chloroform), a solution of 2.02 g (0.01 mol) of HOCOCH is added dropwise with stirring over 10 minutes. ₂ SC ₆ H ₄ -2-CH ₃ (s). The reaction mixture was stirred for 1.5 hours, evaporated halfway, 10 ml of n-pentane was added to the solution cooled to 20 ° C. The precipitate formed is filtered off, washed twice (2 × 5 ml) with pentane and dried at a residual pressure of 20 mm Hg. within 2 hours. The yield of 2- (2- (1-aminoethyl) norbornane o-cresylthioacetate (1d) was 2.83 g (83.1%), mp 191-192 ° C.

1st

Example 5. Analogously to example 4 of 1.40 g (0.01 mol) (1) and 1.38 g (0.01 mol) of o-hydroxybenzoic 2-acid (HOC ₆ H ₄ COOH) in 20 ml of chloroform after maintaining a solution of these reagents at 25 ° C for 24 hours, evaporation and precipitation with pentane give 2.35 g (84.8%) of salicylate 2- (1-aminoethyl) norbornane (1e). Mp 247-249 ° C.

1f

Example 6. Analogously to example 5 of 1.40 g (0.01 mol) (1) and 1.80 g (0.01 mol) of acetylsalicylic acid (HOC ₆ H ₄ COOH) in 20 ml of chloroform after maintaining a solution of these reagents at 25 ° C in within 24 hours, evaporation and precipitation with pentane, 2.72 g (85%) of 2- (1-aminoethyl) norbornane (1e) acetylsalicylate are obtained. Mp 289-290 ° C.

1g

Example 7. To a solution of 1.40 g (0.01 mol) of 2- (1-aminoethyl) norbornane (A) in 5 ml of dry (chloroform), a solution of 1.18 g (0.01 mol) of amber is added dropwise with stirring over 10 minutes. HOOC acid (CH ₂ ) ₂ COOH (g). The reaction mixture was stirred for 48 hours, evaporated halfway, 10 ml of n-pentane was added to the solution cooled to 20 ° C. The precipitate formed is filtered off, washed twice (2 × 5 ml) with pentane and dried at a residual pressure of 20 mm Hg. Art. within 2 hours. The yield of 2- (2- (1-aminoethyl) norbornane succinate (1g) was 2.35 g (91.1%). T. decomposition 134-136 ° C.

1h

Example 8. Analogously to example 4 of 1.40 g (0.01 mol) (1) and 1.92 g (0.01 mol) of citric acid C ₃ H ₄ (OH) (COOH) ₃ in 20 ml of chloroform after maintaining a solution of these reagents at 25 ° C for 48 hours, evaporation and precipitation with pentane give 3.00 g (90.4%) of 2- (1-aminoethyl) norbornane citrate (1h). T.razl. 142-145 ° C.

2

The method of obtaining compound 2 is as follows.

Example 9. In a three-necked flask with a capacity of 100 ml, to 6.5 g of phosphoric anhydride, 13.5 ml (0.2 mol) of 85% phosphoric acid are added with slow stirring. The mixture is cooled to 25 ° C. and 7.01 g (0.05 mol) of 2-ethoxynorbornane in 30 ml of methylene chloride are added. The reaction mixture is heated to boiling with stirring for 8 hours, then 15 ml of water and 20 ml of diethyl ether are added. The organic layer was washed with a Na ₂ S ₂ O ₃ solution and a saturated NaCl solution, and dried over calcined Na ₂ SO ₄ . After distilling off the mixture of CH ₂ Cl ₂ and Et ₂ O by distillation of the residue in vacuo, 2-iodnorbornane is obtained; yield 8.82 g (79.5% of theory). T.kip. 92-93 ° C (9 mmHg). When the latter interacts with sodium amide in liquid ammonia, 2-aminobicyclo [2.2.1] heptane (2-aminonorbornane) 2 is obtained with a yield of 97.8%.

Norbornanes containing amino, aminomethyl and aminoethyl substituents are synthetic analogues of natural borneol.

The following are examples confirming the properties of the obtained compounds.

Example 10. The structure and antiviral activity of salts of 2- (1-aminoethyl) norbornane.

To study antiviral activity, the most reliable method was used to assess the protective effect of the compounds on a model of lethal influenza infection with the reference virus A / Aichi / 2/68, adapted by multiple passages to mice. Infection with this virus leads to the development of specific influenza pneumonia with a fatal outcome after 8-10 days.

The drugs were administered to animals once 12 and 6 hours before infection at a dose of 10-50 μg / kg of animal weight intraperitoneally. A placebo in the control group of animals served as saline or phosphate buffer in equal volume.

The virus A / Aichi / 2/68 was administered to animals intranasally under light ether anesthesia at a dose of 0.2 and 5 LD ₅₀ . Up to 20 mice were taken in each observation group. Observation of animals was carried out up to 15 days, i.e. the period during which experimental flu has a 100% mortality rate in animals. Animals were kept in sterile boxes, preventing infection with bacterial pathogens. The feed and drinking water were also sterilized.

Based on the obtained mortality indicators, the percentage of mortality in each group was calculated (the ratio of the number of animals killed in 15 days to the total number of infected animals in the group), which was expressed as a protection index. The experimental observations are presented in table 4. The analysis of the results showed that the effect of the studied compounds 1 and 2 against the influenza A virus pathogenic for mice was comparable with the effectiveness of the protective effect of the reference drug remantadine (90-95% at a dose of virus 1 LD ₅₀ ). The high protective effect of compounds 1 and 2 indicates that the amino derivatives of bicycloheptanes (1 and 3) have a pronounced protective effect in relation to the lethal dose of A / Aichi / 2/68 virus in mice.

Thus, modifications of bicycloheptane leading to the introduction of amino or aminoethyl groups into the structure of norbornanes lead to the appearance of pronounced antiviral activity in new compounds corresponding to the reference drug remantadine and protecting animals from a 5-fold lethal dose of A / Aichi / 2 / virus 68.

It is known that such modifications make the studied derivatives of norbornanes similar to remantadine, which suggests their effect on the ion channel of the influenza virus formed by the M2 protein [Avian influenza: the origin of infectious biocatastrophes. 2005. Ed. Pokrovsky V.I. and Kiselev O.I. SPb .: Publ. Rostock, 376 pp.]. At the same time, other effects of the obtained compounds are obvious. So, the anti-apoptotic effect of isoborneol on human neuroblastoma cells is described. Moreover, studies have shown that under stress and elevated levels of 6-hydroxidopamine, isoborneol helps maintain the viability of neuroblasts and other cells [Tian L.-L., Zhou Z., Zhang Q., Sun Y.-N. et al. Protective effect of (±) isoborneol against 6-OHDA - induced apoptosis in SH-SY5Y celles. Cellular Physiology and Biochemistry, 2007, Vol. 20, p. 1019-1032]. The reasons for the increase in cell survival remain incomprehensible, but this property makes the compounds obtained more attractive, since in case of their use, the phenomenon of nonspecific resistance to various influences and, probably, influenza infection can be observed.

It is known that the pharmacological properties of the compounds are largely determined by the counterion, that is, pharmaceutically adequate salt components. In this regard, the antiviral properties of the pharmaceutical salts derived from norbornane were used.

Example 11. Antiviral activity of pharmaceutical salts of 2- (1-aminoethyl) norbornane.

The molecular and structural formulas of the anionic fragment of the pharmaceutical salts 1a-h and 2 and their antiviral activity are presented in table 2.

table 2 Assessment of the effect of the salt anionic fragment of salts 1a-h and compound 2 on antiviral activity Names of the starting acids for the preparation of salts of 2- (1-aminoethyl) norbornane (1), 2-aminonorbornane (2) Anion fragment of salt X ^- Antiviral activity Molecular formula Structural formula In conventional units * 1a Salt Cl ^- +++ 1b Benzoic C ₆ H ₅ COO ^-

+++ 1s Ortho-Cresoxyacetic C ₆ H ₄ (2-CH ₃ ) OCH ₂ COO ^-

++ 1d ortho-cresylthioacetic C ₆ H ₄ (2-CH ₃ ) SCH ₂ COO ^-

++ 1st Salicylic (ortho-hydroxybenzoic) С ₆ Н ₄ (2-ОН) СОО ^-

++++ 1f Acetylsalicylic (aspirin) С ₆ Н ₄ (2-ОСОСН ₃ ) СОО ^-

++++ 1g Amber HOOCCH ₂ CH ₂ COO ^-

++++ 1h Lemon (CH ₂ COOH) ₂ C (OH) COO ^-

++++ 2 Salt Cl ^-

In vitro antiviral activity was determined in a culture of MDCK cells infected with influenza virus type A / PR8 / 34. Antiviral activity was determined by reducing the titer of the virus by 5, 4, 2 and 1lg, which was represented as ++++, +++, ++, +, respectively.

From the data shown in table 2, it is seen that a number of anions increase the antiviral activity of the main pharmacophore - 2- (1-aminoethyl) norbornane.

It is noteworthy that salicylic and acetylsalicylic acids led to an increase in the antiviral effect. Succinic and citric acids had a similar effect. The combination of known anti-inflammatory drugs in salts of antiviral drugs with a clear increase in their activity against influenza viruses should be highly likely to suppress the activity of the pro-inflammatory response of cells and, in particular, to suppress the synthesis of universal transcription factor NF-kB [Kash JC, Basler CF, Garcia -Sastre A., Carter V. et al. Global host response: pathogenesis and transcriptional profiling of type A influenza virus expressing the hemagglutinin and neuraminidase genes from the 1918 pandemic virus. J. of Virology, 2004, Vol. 78, p. 9499-9511. Zheng B.-J., Chan K.-W., Lin Y.-P., Zhao G.-Y. et al. Delayed antiviral plus immunomodulator treatment still reduces mortality in mice infected by high inoculum of influenza A / H5N1 virus. Proc. Natl. Acad. Sci. 2008, Vol.105, p.8091-8096.]

With regard to succinic and citric acids, a metabolic effect is obvious, leading to a decrease in the toxicity of the compound by increasing the redox potential of cells as a factor in increasing nonspecific resistance.

The results of repeated studies of the antiviral activity of salts of 2- (1-aminoethyl) norbornane with salicylic and acetylsalicylic acid and metabolic substrates such as succinic and citric acids are shown in table 3.

Table 3 Analysis of the antiviral activity of compounds 1 and 2 in the composition of salts with anti-inflammatory substances and metabolic activators Anti-inflammatory drugs 1st Salicylic (ortho-hydroxybenzoic) C ₆ H ₄ (2-OH) COO ^-

++++ 1f Acetylsalicylic (aspirin) С ₆ Н ₄ (2-ОСОСН ₃ ) СОО ^-

++++ Metabolic activators 1g Amber HOOCCH ₂ CH ₂ COO ^-

++++ 1h Lemon (CH ₂ COOH) ₂ C (OH) COO ^-

++++ 2 Salt Cl ^-

The data obtained (Table 3) indicate that the metabolic components in the pharmaceutical salts of 2- (1-aminoethyl) norbornane can play a useful role in the manifestation of the pharmacological properties of this compound. However, the indistinct additive effect of such components of the pharmaceutical salts of 2- (1-aminoethyl) norbornane, such as salicylic and aminosalicylic acids, requires further study and exclusion or confirmation of the anti-inflammatory activity of the amino derivatives of norbornane. Moreover, as already indicated, the use of salicylic and acetylsalicylic acids is limited in the treatment of influenza and other respiratory viral infections [WHO, 2007]. Therefore, in the drugs for treatment, it is necessary to exclude this component to reduce the likelihood of side effects.

Example 12. The study of the anti-inflammatory effect of derivatives of 2- (1-aminoethyl) norbornane to suppress the induction of transcription factor NF-kB.

Most antiviral drugs lack anti-inflammatory activity. This applies even to arbidol, the closest analogue of which is indomethacin, which is positioned as an inhibitor of the fusion of the viral membrane with the cell membrane [Anonimous: Arbidol. Drugs R D, 1999, Vol.2, p. 171-172]. At the same time, as already indicated, for norbornane derivatives, it is possible to preserve the anti-inflammatory properties after the introduction of an amino group in the structure of this compound. The introduction of an amino group significantly reduces the toxicity of norbornanes and leads to the appearance of antiviral activity against influenza viruses. It can be hoped that, by analogy with mesalazine, which exhibits anti-inflammatory properties, after administration of the amino group, norbornanes will retain the anti-inflammatory activity characteristic of natural norbornane (borneol). Mesalazine, its derivatives and many other anti-inflammatory drugs show the ability to suppress the induction of the key transcription factor NF-kB, which initiates the transcription of genes encoding pro-inflammatory cytokines [Wahl C., Liptay S., Adler G., Schmidt R.M. Sulfasalazine - a potent and specific inhibitor of nuclear factor kappa B. J. Clin. Invect., 1998, Vol.101, p.1163-1174]. In this regard, to analyze the anti-inflammatory properties of norbornane derivatives, studies were conducted on the effect of these compounds on the expression of a gene encoding the transcription factor NF-kB. Activation of NF-kB gene expression was studied on HeLa cells pretreated with tumor necrosis factor (TNFα). The drug was added at a concentration of 10 μg / ml, which ensured a sufficiently high level of NF-kB gene expression. Test drugs were added 0.5 hours after induction of TNF-α. Total RNA was isolated from the cells, and the analysis of the amount of the corresponding mRNA was carried out by real-time PCR with internal markers. For detection of NF-kB gene expression, primers were used:

direct - GCTCAGTGAGCCCATGGAAT and

reverse - TGATGCTCTTGAAGAAACCTCATTG

(the sequence of the human NF-kB gene, HUMNFKB65A, encoding the subunit of this transcription factor p65, access number in the genebank, L19067, was used to calculate the primers).

For an objective assessment of the results, densitometry of gels was used, followed by computer processing. Figures 1 and 2 show the results of induction of transcription of the NF-kB gene in HeLa cells by tumor necrosis factor (TNF-α) and suppression of induction by amino-substituted norbornane derivatives (compounds 1 and 2). The stimulation of TNF-α was not randomly chosen, since it is hyperproduction of tumor necrosis factor that is associated with the development of severe forms of influenza with systemic organ damage [Kash J.C., Basler C.F., Garcia-Sastre A., Carter V. et al. Global host response: pathogenesis and transcriptional profiling of type A influenza virus expressing the hemagglutinin and neuraminidase genes from the 1918 pandemic virus. J. Virol., 2004, Vol. 78, p. 9499-9511].

Almost all the studied compounds (Fig. 3) showed a rather high level of inhibitory activity according to the test for suppressing NF-kB gene expression. Moreover, it is significant that for the first time it was established that isobornoleol itself is an inhibitor of NF-kB gene transcription, which clarifies its mechanism of action and makes clear the high activity of norbornane amino derivatives (Fig. 4). Thus, amino derivatives of norbornanes exhibit antiviral and anti-inflammatory activity, which makes them promising treatments for influenza infection.

The above examples show that the obtained norbornanes (structural analogues of borneol) - derivatives of 2-aminobicyclo [2.2.1] heptane and 2- (1-aminoethyl) bicyclo [2.2.1] heptane have a pronounced inhibitory effect on the reproduction of influenza viruses as in vivo so in vitro. The antiviral activity of certain salts of 2- (1-aminoethylbicyclo [2.2.1] heptane is superior to the reference drug remantadine.

It was established that the obtained compounds, individually and in salts, show the ability to suppress the expression of the key transcription factor NF-kB gene, which allows them to be classified as anti-inflammatory drugs that suppress the body's pro-inflammatory response to the corresponding stimulus by inhibiting the synthesis of the transcriptional activator NF-kB controlling the expression of proinflammatory cytokine genes.

Therefore, amino-containing norbornanes, like their natural analogues of borneol and isobornoleol, can be used as anti-inflammatory and antiviral drugs for the treatment of influenza infection. The low toxicity of the drugs and their structure, similar to natural borneol, allow us to recommend these drugs for the long-term treatment of systemic inflammatory diseases, the therapy of which is based on the use of inhibitors of transcription factor NF-kB.

Claims (3)

1. Pharmaceutical salts of 2- (1-aminoethyl) bicyclo [2.2.1] heptane of the general formula 1 of the following acids: a - hydrochloric, b - benzoic, c - ortho-cresoxyacetic, d - para-cresylthioacetic, e - salicylic (ortho- hydroxybenzoic), f - acetylsalicylic (aspirin), g - amber and h - lemon

X
(a) Cl
(b) OSE ₆ H ₅
(c) OCOCH ₂ OC ₆ H ₄ -2-CH ₃
(d) OCOCH ₂ SC ₆ H ₄ -4-Cl
(e) OCO-C ₆ H ₄ -2-OH
(f) OCO-C ₆ H ₄ -2-OCOCH ₃
(g) OOCCH ₂ CH ₂ COOH
(h) (NOOS) C (OH) (CH ₂ COOH) ₂ 2. The 2-aminobicyclo [2.2.1] heptane hydrochloride of formula 2

3. The use of pharmaceutically acceptable salts of General formula (1) according to claim 1 or 2-aminobicyclo [2.2.1] heptane hydrochloride of formula 2 according to claim 2 for the preparation of medicines for the treatment of influenza A.

Images