RU2446170C2 - Compounds bound with bir domain of iap - Google Patents

Abstract

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to a compound of formula I

and pharmaceutical compositions containing them and used for IAP-function modulation by inhibiting the binding of BIR-binding protein and BIR domain of IAP and for treating proliferative diseases such as cancer. What is also disclosed is a compound of formula I marked by a detectable tag and an affinity tag which is applicable as a probe for identifying the compounds bound with BIR domain of IAP.

EFFECT: preparing the compounds used for IAP-function modulation.

33 cl, 4 tbl, 1 ex

Description

The present invention relates to bridged compounds that bind to IAP BIR domains and which are useful in the treatment of proliferative disorders and disorders with impaired regulation of apoptosis, such as cancer.

Apoptosis, or programmed cell death, typically occurs with the normal development and maintenance of healthy tissues in multicellular organisms. This is a complex process that leads to the removal of damaged, diseased cells or cells with excessive development in the absence of signs of inflammation or necrosis.

It is known that in the body deregulation of the pathways characteristic of apoptosis occurs, in particular, in cancer and lymphoproliferative syndromes, as well as in autoimmune disorders, such as multiple sclerosis, in neurodegenerative diseases and inflammation. Changes in the apoptotic response of the host during the development or maintenance of viral and bacterial infections have also been described.

Caspases are a family of proteolytic enzymes from the class of cysteine proteases that are known to initiate and carry out apoptosis. In normal cells, caspases are present as inactive zymogens that are catalytically activated after external signals, for example, signals from a ligand-controlled activation of the apoptosis receptor (Death Receptor), such as cytokines or immunological agents, or by the release of mitochondrial factors, such as cytochrome C, after genotoxic chemotoxic or radiation-induced cell damage. Apoptosis protein inhibitors (IAPs) make up a family of proteins that are capable of binding to and inhibiting caspases, thus inhibiting cell apoptosis. Due to their central role in the regulation of caspase activity, IAPs are able to inhibit programmed cell death as a result of various triggering mechanisms, which include the loss of homeostatic or endogenous mechanisms for controlling cell growth, as well as chemotherapeutic drugs and radiation.

IAPs contain from one to three homologous structural domains, known as baculovirus IAP repeat domains (BIRs). They may also contain a RING-type zinc finger domain at the C-terminus with the possibility of inducing the ubiquitination of IAP-binding molecules through its E3 ligase function. Human IAPs, XIAPs, HIAP1s (also referred to as (cIAP2)) and HIAP2s (cIAP1) each contain three BIR domains and a RING-type zinc finger at the carboxy terminus. The other IAP, NAIP, contains three BIR domains (BIR1, BIR2 and BIR3), but there is no RING domain, while Livin, TsIAP and MLIAP contain one BIR domain and a RING domain. The X chromosomal bound apoptosis inhibitor (XIAP) is an example of an IAP that can inhibit caspase initiator known as caspase-9 and effector caspases, Caspase-3 and Caspase-7, by direct binding. XIAP can also induce caspase removal via ubiquitinylation, a mediated proteasome pathway through the E3 ligase activity of the RING-type zinc finger domain. In addition, the BIR3 domain of XIAP binds to and inhibits caspase-9. Linker-BIR2 domain of XIAP inhibits the activity of caspase-3 and caspase-7. BIR domains are also associated with interactions of IAPs with a factor associated with a tumor necrosis factor receptor factor (TRAFs) -1 and -2, and with TAB1, as adapter proteins that transmit a survival signal through NFkB activation. Thus, IAPs act as an immediate inhibitor of the apoptosis cascade, preventing the action or inhibiting active caspases and redirecting the cellular signal transmission to the wake mode. The development of cancer research has led to a new paradigm in cancer biology, where neoplasia can be seen as the inability of cancer cells to implement normal apoptosis pathways. Normal cells take constant feedback from their environment through various intracellular and extracellular factors and "commit suicide" when extracted from this context. This induction of apoptosis is achieved by activation of the caspase cascade. However, cancer cells acquire the ability to overcome or circumvent such regulation of apoptosis and continue abnormal proliferation. Most cancer treatments induce at least a partial apoptotic response in cancer target cells, leading to remission or initiation of tumor regression. However, in many cases, the remaining cells that are resistant to apoptosis are capable of not accepting the therapy with the continuation of the process of oncogenic / genetic change, leading to the emergence of a highly drug-resistant metastatic disease that opposes the possibility of effective treatment of the disease. Moreover, most cancer treatments, including radiation therapy and traditional chemotherapy for the induction of apoptosis in cancer cells, cause additional cell damage due to the lack of specificity of apoptosis induction exclusively in cancer cells. The need to improve the specificity / activity of the pro-apoptotic agents used to treat cancer, as well as other proliferative disorders, is important because it provides the benefits of reducing the side effects associated with the administration of such agents. Therefore, the identification of new agents for the induction of apoptosis in cancer cells is extremely desirable in medicine, and the solution to this problem opens up the possibility of completely new cancer treatment methods.

A growing body of evidence suggests that cancer cells can avoid apoptosis by delaying overexpression of one or more members of the IAP protein family, as documented in many primary tumor biopsy samples, as well as in most established cancer cell lines. Epidemiological studies have demonstrated that overexpression of various IAPs is associated with poor clinical prognosis and survival. For XIAP, this has been shown in many different types of cancer, such as leukemia and ovarian cancer. Overexpression of HIAP1 and HIAP2, resulting from frequent chromosomal amplification of the 11q21-q23 region, which encompasses both proteins, has been observed in various malignant tumors, including medulloblastomas, renal cell carcinomas, glioblastomas, and gastric carcinomas. Negatively regulatory (X) IAP molecules, such as XAF, have been found to be tumor suppressors that are very often lost in clinical cancer. So, thanks to their ability to suppress the activation and action of true mediators of apoptosis, caspases, IAP can directly contribute to the development of tumors and resistance to pharmaceutical intervention. Induction of apoptosis in cancer cells using active small molecules that bind to specific IAP domains is an object of the present invention.

The authors of the present invention and others have demonstrated the critical importance of individual BIR domains for influencing the antiapoptotic function of IAPs. It has been suggested that IAPs antagonists that can bind to individual BIR domains can disrupt the anti-apoptotic function of IAPs. Indeed, individual BIRs serve as critical binding sites for the N-terminal Ser-Gly-Val-Asp, Ser-Gly-Pro-lle and Ala-Thr-Pro-lle Caspase residues 3, 7, and 9, respectively, and such binding is essential for the IAP function of caspase inhibition. The binding of the N-terminal AxPy tetra-peptide residues to XIAP results in the release of active caspases 3, 7 and 9. In the case of other IAPs, such as C-IAP1 and C-IAP2, the BIR functions when bound to the ligand appear to be they consist in directing the activation of the ubiquitin-ligase RING function of IAPs to a linked target, or individual IAPs themselves, causing proteosomal loss. In any case, small IAP antagonist molecules should be excellent pro-apoptotic agents with potential uses for treating cancer, various proliferative disorders, and inflammation.

The mammalian mitochondral protein, namely, the Second Mitochondral Caspase Activator (SMAC), which antagonizes the function of IAP, binds predominantly to BIR 3 or 2 sites in the corresponding IAPs via AxPy amino-terminal tetrapeptide. Four death-inducing Drosophila protein inducers, Reaper, HID, Grim, and Sickle, which agonize the ability of Drosophila IAPs to inhibit caspases, also bind to the BIR domains of Drosophila-like IAPs via the short AxPy amino terminal tetrapeptide, the sequence that is inserted into the BIR-binding pocket and interrupts IAP caspase interactions.

The general topology of individual BIR domains is highly conserved among human IAPs and among individual BIR domains of human IAPs, with each BIR being a zinc finger type polypeptide domain that is locked into a Zn-coordinated atom by three cysteines and a histidine residue. X-ray diffraction analysis of XIAP BIR2 and BIR3 showed a critical binding pocket for the AxPy motif on the surface of each BIR domain. There are changes in the insertion amino acid sequences that form the binding “pocket” and recess in both BIR2 and BIR3. Similarly, the authors of the present invention have described homologous domains in BIRs of other IAPs, cIAP1 and cIAP2. This opens up the possibility of obtaining different classes of natural and synthetic binding compounds, which will have different specificity and binding affinity for each of the BIR domains for each of the IAP. Distinguishing the way in which such compounds will affect the biological function of IAPs in cancer cells compared to normal cells is a major new challenge in discovering new mechanisms and treatments for cancer and other proliferative disorders where there is an upregulation of IAP function. The present inventors have found that certain classes of BIR-binding compounds can bind to IAP BIR domains with unexpected selectivity and activity, resulting in clear therapeutic benefits for some structural classes, potentially resulting either from loss of IAP function or loss of cellular IAP protein , or both.

A series of peptide AxPy-like and heterocyclic modified AxPy peptide compounds have been described that activate cell caspase 3 by reported XIAP BIR3 binding information. For the latest reviews, see Elmore et al., Annual Reports in Medicinal Chemistry, 40 (2006) 245-262; Sun et al., Bioorg. Med. Chem. Let. 15 (2005) 793-797; Oost et al., J. Med. Chem., 2004, 47 (18), 4417-4426; Park et al., Bioorg. Med. Chem. Lett. 15 (2005) 771-775; Franklin et al., Biochemistry, Vol. 42, No. 27, 2003, 8223-8231; Kip et al., Biochemistry 2002, 41, 7344-7349; Wu et al., Chemistry and Biology, Vol., 759-767 (2003); Glover et al., Analytical Biochemistry, 320 (2003) 157-169; US Published Patent Application No. 20020177557; US Published Patent Application No. 20040180828; US Published Patent Application No. US2006 / 0025347A1; US Published Patent Application No. US2005 / 0197403A1; and U.S. Patent Application Publication No. US2006 / 0194741 A1.

It was shown that the above compounds target the XIAP isolated BIR3 domain through substitution of a fluorescently-labeled probe, and it turned out that they induce an apoptotic event in a certain number of cancer cell lines with activity in the low micromolar-nanomolar ranges. These compounds showed low in-vivo activity, probably due to the limited bioavailability, and therefore they may have limited therapeutic use.

Thus, BIR IAP domains are an attractive target for the discovery and development of new therapeutic agents, especially for the treatment of proliferative disorders such as cancer.

SUMMARY OF THE INVENTION

The authors of the present invention previously disclosed a number of compounds that bind to BIR units of IAPs and induce apoptosis in various cancer cell lines (published US patent application No. 20060264379). This application discloses that binding of two BIR-binding units with a site, orientation, and chemical nature preference provides new and clearly advantageous classes of compounds with a 1000-fold increase in activity against various cancer cell lines compared to corresponding BIR-binding compounds that are not bridged. These compounds demonstrate the necessary activity, stability and pharmaceutical properties for the treatment of various types of human cancer. An advantage is that the chemical nature of the bridging group can be chosen to cause translation of high internal cellular activity to a microgram / kg activity level when inhibiting and / or suppressing IAPs in tumor samples. Moreover, the described compounds have pharmaceutically acceptable stability in a variety of mammalian tissues and fluids and have pharmaceutical properties that provide adequate solubility and bioavailability when using various routes of administration suitable for clinical use. Such administration provides a stable in vivo effect in mammals, as measured in normal and tumor tissues.

In one embodiment of the present invention, an isomer, enantiomer, diastereoisomer or tautomer of a compound represented by Formula I is provided:

Where:

n is 0 or 1;

m is 0, 1 or 2;

Y represents NH, O or S;

W represents

или

or

where X is C ₁ -C ₃ alkyl, which forms part of a ring system, wherein said ring system is optionally substituted with one or more R ¹¹ substituents; or X is part of a 5-, 6-, or 7-membered heterocyclic ring system, optionally including one, two, or three heteroatoms selected from O, N, or S, wherein said ring system is optionally substituted with one or more R ¹¹ ; or X represents —C (O) -; and G is a 5-, 6-, or 7-membered ring system, optionally including one or more heteroatoms selected from O, N, or S, wherein said ring system is optionally substituted with one or more R ¹¹ ; and

W ¹ represents

или

or

where R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ , R ^500a , X ¹ , G ¹ have the meanings defined for R ³ , R ⁴ , R ⁵ , X and G, respectively; or

или

,W and W ^{1 are} independently selected from

or

,

where R ³ , R ⁴ have the meanings defined for R ³⁰⁰ , R ^400, respectively;

B is

Q and Q ^{1 are} independently selected from

1) -CH ₂ -,

2) -CH ₂ CH ₂ -,

3) -CH (C ₁ -C ₆ alkyl) -,

4) -CH (C ₃ -C ₇ cycloalkyl) -,

5) -C ₃ -C ₇ cycloalkyl-,

6) -CH (C ₁ -C ₆ alkyl-C ₃ -C ₇ cycloalkyl) -; or

7) —C (O) -;

A and A ^{1 are} independently selected from

1) NR ⁶ or

2) NR ⁶⁰⁰ ;

BG is

1) -Y ¹ -LY ¹⁰⁰ -; or

2) -L-; or

BG is -Y ¹ -L ¹ -ZL ¹⁰⁰ -Y ¹⁰⁰ -, where L ¹ and L ¹⁰⁰ have the same meaning or L ¹ and L ¹⁰⁰ are different from each other;

Y ¹ and Y ^{100 are} independently selected from

1) -C (O) -,

2) -S (O) ₂ - or

3) —C (O) N (R ⁸ ) -;

L, L ¹ and L ¹⁰⁰ are selected from the groups:

1) -C ₁ -C ₁₂ alkyl-,

2) -C ₂ -C ₁₂ alkenyl-,

3) -C ₂ -C ₁₂ alkynyl-,

4) -C ₃ -C ₇ cycloalkyl-,

5) -C ₃ -C ₇ cycloalkenyl-,

5) -aryl-,

6) -biphenyl-,

7) -heteroaryl-,

8) -heterocyclyl-,

9) -C ₁ -C ₆ alkyl- (C ₂ -C ₆ alkenyl) -C ₁ -C ₆ alkyl-,

10) -C ₁ -C ₆ alkyl- (C ₂ -C ₄ alkynyl) -C ₁ -C ₆ alkyl,

11) -C ₁ -C ₆ alkyl- (C ₃ -C ₇ cycloalkyl) -C ₁ -C ₆ alkyl,

12) -C ₁ -C ₆ alkyl-aryl-C ₁ -C ₆ alkyl,

13) -C ₁ -C ₆ alkyl-biphenyl-C ₁ -C ₆ alkyl,

14) -C ₁ -C ₆ alkyl-heteroaryl-C ₁ -C ₆ alkyl,

15) -C ₁ -C ₆ alkyl-heterocyclyl-C ₁ -C ₆ alkyl or

16) -C ₁ -C ₆ alkyl-OC ₁ -C ₆ alkyl; or

L, L ¹ and L ¹⁰⁰ are selected from the groups:

1) - N (R ⁸ ) C (O) N (R ⁸ ) - or

2) -C ₁ -C ₆ alkyl-ZC ₁ -C ₆ alkyl-;

where alkyl, alkenyl, alkynyl, cycloalkenyl and cycloalkyl are optionally substituted with one or more R ⁷ substituents; and aryl, heteroaryl, biphenyl and heterocyclyl are optionally substituted with one or more R ¹¹ substituents;

Z is selected from the groups:

1) -N (R ⁸ ) CON (R ⁸ ) -,

2) -N (R ⁸ ) C (O) -aryl-C (O) N (R ⁸ ) -,

3) -N (R ⁸ ) C (O) -heteroaryl-C (O) N (R ⁸ ) -,

4) -C (O) -,

5) -S (O) ₂ -,

6) -N (R ⁸ ) C (O) -,

7) -C (O) N (R ⁸ ) -,

8) —OC (O) N (R ⁸ ) -,

9) -S (O) ₂ N (R ⁸ ) -,

10) -N (R ⁸ ) -C ₁ -C ₁₂ -alkyl-N (R ⁸ ) -,

11) -N (R ⁸ ) -C (O) C (O) -N (R ⁸ ) -,

12) -N (R ⁸ ) -C (O) -C ₁ -C ₁₂ -alkyl-C (O) -N (R ⁸ ) -,

13) -N (R ⁸ ) -C (O) -aryl-C (O) -N (R ⁸ ) -,

14) -N (R ⁸ ) -C (O) -aryl-O-aryl-C (O) -N (R ⁸ ) -,

15) -N (R ⁸ ) -C (O) -heteroaryl-C (O) -N (R ⁸ ) -,

16) -N (R ⁸ ) -C (O) -biphenyl-C (O) -N (R ⁸ ) -,

17) -N (R ⁸ ) -S (O) ₂ -C ₁ -C ₁₂ -alkyl-S (O) ₂ -N (R ⁸ ) -,

18) -N (R ⁸ ) -S (O) ₂ -aryl-S (O) ₂ -N (R ⁸ ) -,

19) -N (R ⁸ ) -S (O) ₂ -heteroaryl-S (O) ₂ -N (R ⁸ ) -,

20) -N (R ⁸ ) -S (O) ₂ -biphenyl-S (O) ₂ -N (R ⁸ ) -,

21) -N (R ⁸ ) -C ₁ -C ₁₂ -alkyl-N (R ⁸ ) -,

22) -N (R ⁸ ) -aryl-N (R ⁸ ) -,

23) -N (R ⁸ ) -heteroaryl-N (R ⁸ ) - or

24) -N (R ⁸ ) -biphenyl-N (R ⁸ ) -;

where alkyl and cycloalkyl are optionally substituted with one or more R ⁷ substituents, and aryl, heteroaryl and heterocyclyl are optionally substituted with one or more R ¹¹ substituents;

R ¹ and R ^{100 are} independently selected from

1) H or

2) C ₁ -C ₆ alkyl optionally substituted with one or more R ⁷ substituents;

R ² , R ³ , R ⁴ , R ⁵ , R ^5a , R ²⁰⁰ , R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ and R ^500a each independently represent H or C ₁ -C ₆ alkyl optionally substituted with one or more substituents R ⁷ ;

R ⁶ and R ⁶⁰⁰ each independently represent

1) H,

2) halogenated,

3) ← C ₁ -C ₆ alkyl,

4) ← C ₂ -C ₆ alkenyl,

5) ← C ₂ -C ₄ alkynyl,

6) ← C ₃ -C ₇ cycloalkyl,

7) ← C ₃ -C ₇ cycloalkenyl,

8) ← aryl,

9) ← heteroaryl,

10) ← heterocyclyl,

11) ← heterobicyclyl,

12) ← C (O) (O) _n -R ¹² ,

13) ← C (= Y) NR ⁹ R ¹⁰ or

14) ← S (O) ₂ -R ¹² where alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more R ⁷ substituents; and wherein aryl, heteroaryl, heterocyclyl and heterobicyclyl are optionally substituted with one or more R ¹¹ substituents;

R ⁷ represents

1) halogen

2) NO ₂ ,

3) CN,

4) halogenated,

5) C ₁ -C ₆ alkyl,

6) C ₂ -C ₆ alkenyl,

7) C ₂ -C ₄ alkynyl,

8) C ₃ -C ₇ cycloalkyl,

9) C ₃ -C ₇ cycloalkenyl,

10) aryl

11) heteroaryl,

12) heterocyclyl,

13) heterobicyclyl,

14) OR ⁸ ,

15) S (O) _m R ⁸ ,

16) NR ⁹ R ¹⁰ ,

17) NR ⁹ S (O) ₂ R ¹² ,

18) COR ⁸ ,

19) C (O) OR ⁸ ,

20) CONR ⁹ R ¹⁰ ,

21) S (O) ₂ NR ⁹ R ¹⁰ ,

22) OC (O) R ⁸ ,

23) OC (O) YR ¹² ,

24) SC (O) R ⁸ or

25) NC (Y) R ⁹ R ¹⁰ where aryl, heteroaryl, heterocyclyl and heterobicyclyl are optionally substituted with one or more R ¹¹ substituents;

R ⁸ represents

1) H,

2) halogenated,

3) C ₁ -C ₆ alkyl,

4) C ₂ -C ₆ alkenyl,

5) C ₂ -C ₄ alkynyl,

6) C ₃ -C ₇ cycloalkyl,

7) C ₃ -C ₇ cycloalkenyl,

8) aryl,

9) heteroaryl,

10) heterocyclyl,

11) heterobicyclyl,

12) R ⁹ R ¹⁰ NC (= Y) or

13) C ₁ -C ₆ alkyl-C ₂ -C ₄ alkenyl or

14) C ₁ -C ₆ alkyl-C ₂ -C ₄ alkynyl, where alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more R ⁷ substituents; and wherein aryl, heteroaryl, heterocyclyl and heterobicyclyl are optionally substituted with one or more R ¹¹ substituents;

R ⁹ and R ¹⁰ each independently represent

1) H,

2) halogenated,

3) C ₁ -C ₆ alkyl,

4) C ₂ -C ₆ alkenyl,

5) C ₂ -C ₄ alkynyl,

6) C ₃ -C ₇ cycloalkyl,

7) C ₃ -C ₇ cycloalkenyl,

8) aryl,

9) heteroaryl,

10) heterocyclyl,

11) heterobicyclyl,

12) C (O) R ¹² ,

13) C (O) YR ¹² or

14) S (O) ₂ - R ¹² ,

where alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more R ⁷ substituents and where aryl, heteroaryl, heterocyclyl and heterobicyclyl are optionally substituted with one or more R ¹¹ ;

or R ⁹ and R ¹⁰ together with the nitrogen atom to which they are attached form a five-, six- or seven-membered heterocyclic ring, optionally substituted with one or more R ⁷ substituents;

R ¹¹ represents

1) halogen

2) NO ₂ ,

3) CN,

4) B (OR ¹³ ) (OR ¹⁴ ),

5) C ₁ -C ₆ alkyl,

6) C ₂ -C ₆ alkenyl,

7) C ₂ -C ₄ alkynyl,

8) C ₃ -C ₇ cycloalkyl,

9) C ₃ -C ₇ cycloalkenyl,

10) halogenated,

11) OR ⁸ ,

12) NR ⁹ R ¹⁰ ,

13) SR ⁸ ,

14) COR ⁸ ,

15) C (O) OR ⁸ ,

16) S (O) _m R ⁸ ,

17) CONR ⁹ R ¹⁰ ,

18) S (O) ₂ NR ⁹ R ¹⁰ ,

19) aryl

20) heteroaryl,

21) heterocyclyl or

22) heterobicyclyl, where alkyl, alkenyl, alkynyl, cycloalkyl and cycloalkenyl are optionally substituted with one or more R ⁷ substituents;

R ¹² represents

1) halogenated,

2) C ₁ -C ₆ alkyl,

3) C ₂ -C ₆ alkenyl,

4) C ₂ -C ₄ alkynyl,

5) C ₃ -C ₇ cycloalkyl,

6) C ₃ -C ₇ cycloalkenyl,

7) aryl,

8) heteroaryl,

9) heterocyclyl or

10) heterobicyclyl,

where alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more R ⁷ substituents and where aryl, heteroaryl, heterocyclyl and heterobicyclyl are optionally substituted with one or more R ¹¹ ;

R ¹³ and R ¹⁴ each independently represent

1) H or

2) C ₁ -C ₆ alkyl; or

R ¹³ and R ^{14 are} combined to form a ring system;

or a prodrug thereof, or a pharmaceutically acceptable salt, or labeled with a detectable label or its affinity tag.

In another aspect of the present invention, there is provided an intermediate compound represented by Formula 1-v:

where PG ³ , R ¹ , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , X and R ⁶ have the meanings defined in this application.

In another aspect of the present invention, there is provided an intermediate compound represented by Formula 5-i:

where PG ³ , R ¹ , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , X ¹ and R ⁶ have the meanings defined in this application.

In another aspect of the present invention, there is provided an intermediate compound represented by Formula 6-iv:

where R ³ , R ³⁰⁰ , R ⁴ , R ⁴⁰⁰ , R ⁵ , R ^5a , R ⁵⁰⁰ , R ^500a , X, X ¹ and L have the meanings defined in this application.

In another aspect of the present invention, there is provided a process for preparing the compounds represented by Formula 2-i described herein, wherein said method comprises: a) mixing two intermediate compounds represented by Formula 1-v:

and LG-C (O) -L-C (O) -LG in a solvent in the presence of a base; and

b) removing the protective group PG ³ to obtain the compounds of Formula 2-i:

where PG ³ , R ¹ , R ¹⁰⁰ , R ² , R ²⁰⁰ , R ³ , R ³⁰⁰ , R ⁴ , R ⁴⁰⁰ , R ⁵ , R ^5a , R ⁵⁰⁰ , R ^500a , X, X ¹ and L have the meanings defined in this application.

In another aspect of the present invention, there is provided a method for preparing the compounds represented by Formula 3-i described herein, wherein said method comprises: a) mixing two intermediate compounds represented by Formula 1-v:

and LG-S (O) ₂ —LS (O) ₂ —LG in a solvent in the presence of a base; and

b) removing the protective group PG ³ to obtain the compounds of Formula 3-i:

where PG ³ , R ¹ , R ¹⁰⁰ , R ² , R ²⁰⁰ , R ³ , R ³⁰⁰ , R ⁴ , R ⁴⁰⁰ , R ⁵ , R ^5a , R ⁵⁰⁰ , R ^500a , X, X ¹ and L are as defined in this application.

In another aspect of the present invention, there is provided a process for preparing the compounds represented by Formula 4-i described herein, wherein said method comprises: a) mixing two intermediate compounds represented by Formula 1-v:

and LG-L-LG in a solvent in the presence of a base; and

b) removing the protective group PG ³ to obtain the compounds of Formula 4-i:

where PG ³ , R ¹ , R ¹⁰⁰ , R ² , R ²⁰⁰ , R ³ , R ³⁰⁰ , R ⁴ , R ⁴⁰⁰ , R ⁵ , R ^5a , R ⁵⁰⁰ , R ^500a , X, X ¹ and L have the meanings defined in this application.

In another aspect of the present invention, there is provided a process for preparing the compounds represented by Formula 5-ii described herein, wherein said method comprises: a) mixing two intermediate compounds represented by Formula 5-i:

and LG-L-LG in a solvent in the presence of a base; and

b) removing the protective group PG ³ to obtain the compounds of Formula 5-ii:

where PG ³ , R ¹ , R ¹⁰⁰ , R ² , R ²⁰⁰ , R ³ , R ³⁰⁰ , R ⁴ , R ⁴⁰⁰ , R ⁵ , R ^5a , R ⁵⁰⁰ , R ^500a , R ⁶ , R ⁶⁰⁰ , R ⁸ , R ⁸⁰⁰ , X, X ¹ and L have the meanings defined in this application.

In another aspect of the present invention, there is provided a process for preparing the compounds represented by Formula 6-v described herein, wherein said method comprises: a) mixing two intermediate compounds represented by Formula 6-iv:

в растворителе с агентом сочетания; иand

in a solvent with a coupling agent; and

b) removing the protective group PG ³ to obtain the compounds of Formula 6-v:

where PG ³ , R ¹ , R ¹⁰⁰ , R ² , R ²⁰⁰ , R ³ , R ³⁰⁰ , R ⁴ , R ⁴⁰⁰ , R ⁵ , R ^5a , R ⁵⁰⁰ , R ^500a , R ⁶ , R ⁶⁰⁰ , R ⁸ , R ⁸⁰⁰ X, X ¹ and L have the meanings defined in this application.

In another aspect of the present invention, there is provided an intermediate compound represented by Formula I-ia:

where PG ⁴ , R ¹ , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , X, Q and R ⁶ have the meanings defined in this application.

In another aspect of the present invention, there is provided an intermediate compound represented by Formula I-iia:

where PG ⁴ , PG ⁴⁰⁰ , R ¹ , R ¹⁰⁰ , R ² , R ²⁰⁰ , R ³ , R ³⁰⁰ , R ⁴ , R ⁴⁰⁰ , R ⁵ , R ^5a , R ⁵⁰⁰ , R ^500a , A, A ¹ , Q, Q ¹ , X, X ¹ and BG have the meanings defined in this application.

In another aspect of the present invention, there is provided a process for preparing the compounds represented by Formula I as defined above, wherein said process comprises:

a) bridging two intermediate compounds represented by Formula I-ia:

where PG ⁴ , R ¹ , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , X, Q, and R ⁶ are as defined herein in a solvent to give an intermediate compound of Formula I-iia:

where PG ⁴ , PG ⁴⁰⁰ , R ¹ , R ¹⁰⁰ , R ² , R ²⁰⁰ , R ³ , R ³⁰⁰ , R ⁴ , R ⁴⁰⁰ , R ⁵ , R ^5a , R ⁵⁰⁰ , R ^500a , A, A ¹ , Q, Q ¹ , X, X ¹ and BG have the meanings defined in this application, and

b) removing the protective groups PG ⁴ and PG ⁴⁰⁰ to obtain the compounds of Formula 1.

In another aspect of the present invention, there is provided an intermediate compound represented by Formula I-ib:

where PG ⁴ , R ¹ , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , X, Q and R ⁶ have the meanings defined in this application.

In another aspect of the present invention, there is provided an intermediate compound represented by Formula I-iib:

where PG ⁴ , PG ⁴⁰⁰ , R ¹ , R ¹⁰⁰ , R ² , R ²⁰⁰ , R ³ , R ³⁰⁰ , R ⁴ , R ⁴⁰⁰ , R ⁵ , R ^5a , R ⁵⁰⁰ , R ^500a , A, A ¹ , Q, Q ¹ , X, X ¹ and BG have the meanings defined in this application.

In another aspect of the present invention, there is provided a process for preparing compounds represented by Formula I as defined above, wherein said process comprises:

a) bridging two intermediate compounds represented by Formula I-ib:

where PG ⁴ , R ¹ , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , X, Q, and R ⁶ are as defined herein in a solvent to give an intermediate compound represented by Formula I-iib:

where PG ⁴ , PG ⁴⁰⁰ , R ¹ , R ¹⁰⁰ , R ² , R ²⁰⁰ , R ³ , R ³⁰⁰ , R ⁴ , R ⁴⁰⁰ , R ⁵ , R ^5a , R ⁵⁰⁰ , R ^500a , A, A ¹ , Q, Q ¹ , X, X ¹ and BG have the meanings defined in this application, and

b) removing the protective groups PG ⁴ and PG ⁴⁰⁰ to obtain the compounds of Formula 1.

In another aspect of the present invention, there is provided a method for preparing a pharmaceutically acceptable salt of a compound of Formula I by treating a compound of Formula I 1-2 with equivalents of a pharmaceutically acceptable acid as defined herein.

In another aspect of the present invention, there is provided a pharmaceutical composition comprising the compound described above in a mixture with a pharmaceutically acceptable carrier, diluent or excipient.

In another aspect of the present invention, there is provided a pharmaceutical composition adapted for administration as a treatment for a proliferative disorder in a subject, comprising a therapeutically effective amount of a compound described above.

In another aspect of the present invention, there is provided a pharmaceutical composition comprising a compound of Formula I in combination with one or more apoptosis receptor agonists, for example, a TRAIL receptor agonist.

In another aspect of the present invention, there is provided a pharmaceutical composition comprising a compound of Formula I in combination with any therapeutic agent that enhances the response of one or more apoptosis receptor agonists, for example cytotoxic cytokines, such as interferons.

In another aspect of the present invention, there is provided a process for preparing a pharmaceutical composition, which comprises: mixing a compound described above with a pharmaceutically acceptable carrier, diluent or excipient.

In another aspect of the present invention, there is provided a method of alleviating a condition of a disease characterized by insufficient apoptosis, the method comprising: administering to a subject in need thereof a therapeutically effective amount of the pharmaceutical composition described above to treat the condition of the disease.

In another aspect of the present invention, there is provided a method for modulating IAP function, said method comprising: contacting a cell with a compound of the present invention to prevent the BIR binding protein from binding to the IAP BIR domain, thereby modulating IAP function.

In another aspect of the present invention, there is provided a method of treating a proliferative disease, said method comprising: administering to a subject in need thereof a therapeutically effective amount of the pharmaceutical composition described above for treating a proliferative disease.

In another aspect of the present invention, there is provided a method of treating cancer, said method comprising: administering to a subject in need thereof a therapeutically effective amount of the pharmaceutical composition described above for treating cancer.

In another aspect of the present invention, there is provided a method of treating cancer, said method comprising: administering to a subject in need thereof a therapeutically effective amount of the pharmaceutical composition described above in combination with or sequentially with an agent selected from the following:

a) an estrogen receptor modulator,

b) an androgen receptor modulator,

c) a retinoid receptor modulator,

d) a cytotoxic agent

e) an antiproliferative agent,

f) a prenyl protein transferase inhibitor,

g) an inhibitor of HMG-CoA reductase,

h) an HIV protease inhibitor,

i) a reverse transcriptase inhibitor,

k) an angiogenesis inhibitor,

l) a PPAR-.γ agonist,

m) PPAR-.δ. agonist,

n) an inhibitor of characteristic multidrug resistance,

o) an antiemetic,

p) an agent useful in treating anemia,

q) agents useful in the treatment of neutropenia,

r) a means to enhance immunity,

s) proteasome inhibitor,

t) an HDAC inhibitor,

u) an inhibitor of chemotrypsin-like activity in the proteasome or

v) E3 ligase inhibitors,

w) a modulator of the immune system, such as, but not limited to, interferon alfa, Bacillus Calmette-Guerin (BCG) and ionizing radiation (UVB), which can induce the release of cytokines such as interleukins, TNF, or induce the release of apoptosis receptor ligands such as TRAIL;

x) a TRAIL modulator of apoptosis receptors and TRAIL agonists, such as humanized antibodies HGS-ETR1 and HGS-ETR2;

either in combination or sequentially with radiation therapy for the treatment of cancer.

In another aspect of the present invention, there is provided a method of treating or preventing a proliferative disorder in a subject, said method comprising: administering to the subject a therapeutically effective amount of a composition as described above.

In another aspect of the present invention, the method further comprises administering to the subject a therapeutically effective amount of a chemotherapeutic agent before, simultaneously with or after administration of the composition.

In a further aspect, the method further comprises administering to the subject a therapeutically effective amount of an apoptosis receptor agonist before, simultaneously with or after administration of the composition. An apoptotic receptor agonist is TRAIL, or an apoptotic receptor agonist is an anti-TRAIL antibody. An apoptotic receptor agonist is typically administered in an amount that provides a synergistic effect.

In a further aspect, the use of a compound described above for the manufacture of a medicament for the treatment or prophylaxis of a condition of a disease characterized by insufficient apoptosis is provided.

In a further aspect, the use of a compound described above for the manufacture of a medicament for the treatment or prophylaxis of a proliferative disorder is provided.

In a further aspect, the use of a compound described above is provided in combination with an agent for the manufacture of a medicament for the treatment or prevention of a proliferative disorder, wherein said agent is selected from the following:

a) an estrogen receptor modulator,

b) an androgen receptor modulator,

c) a retinoid receptor modulator,

d) a cytotoxic agent

e) an antiproliferative agent,

f) a prenyl protein transferase inhibitor,

g) an inhibitor of HMG-CoA reductase,

h) an HIV protease inhibitor,

i) a reverse transcriptase inhibitor,

k) an angiogenesis inhibitor,

l) a PPAR-.γ agonist,

m) PPAR-.δ. agonist,

n) an inhibitor of characteristic multidrug resistance,

o) an antiemetic,

p) an agent useful in treating anemia,

q) agents useful in the treatment of neutropenia,

r) a means to enhance immunity,

s) proteasome inhibitor,

t) an HDAC inhibitor,

u) an inhibitor of chemotrypsin-like activity in the proteasome or

v) E3 ligase inhibitors,

w) a modulator of the immune system, such as, but not limited to, interferon alfa, Bacillus Calmette-Guerin (BCG) and ionizing radiation (UVB), which can induce the release of cytokines such as interleukins, TNF, or induce the release of apoptosis receptor ligands such as TRAIL;

x) a TRAIL modulator of apoptosis receptors and TRAIL agonists, such as humanized antibodies HGS-ETR1 and HGS-ETR2;

or in combination or sequentially with radiation therapy.

In a further aspect, the use of a compound described above is provided in combination with an apoptosis receptor agonist for the manufacture of a medicament for the treatment or prophylaxis of a proliferative disorder in a subject.

In a further aspect, a pharmaceutical composition is provided comprising a compound as described above, in admixture with a pharmaceutically acceptable carrier, diluent or excipient, for treating or preventing a condition of a disease characterized by insufficient apoptosis.

In a further aspect, a pharmaceutical composition is provided comprising a compound as described above, in combination with any compound that increases the level of one or more apoptosis receptor agonists in the bloodstream to prevent or treat a proliferative disorder.

In a further aspect, a method for preparing a pharmaceutical composition is provided, said method comprising: mixing a compound described above with a pharmaceutically acceptable carrier, diluent or excipient.

In another aspect of the present invention, a probe is provided, wherein said probe is a compound of Formula I above, wherein said compound is a labeled detectable tag or affinity tag.

In another aspect of the present invention, there is provided a method for identifying compounds that bind to the IAP BIR domain, where such an analysis includes:

a) contacting the BIR domain of the IAP with a probe to form a probe: BIR domain complex, wherein said probe is a substitutable test compound;

b) measuring the signal from the probe to establish a reference level;

c) incubation of the probe complex: BIR domain with test compound;

d) measuring the signal from the probe;

e) comparing the signal from step d) with a control level, wherein signal modulation is an indication that the test compound binds to the BIR domain, where the probe is a compound of Formula I labeled with a detectable label or affinity tag.

In another aspect of the present invention, there is provided a method of detecting loss of function or suppression of IAPs in vivo, said method comprising: a) administering to a subject a therapeutically effective amount of a pharmaceutical composition as defined above; b) isolating a tissue sample of a subject; and c) detecting loss of function or suppression of IAPs in the sample.

DETAILED DESCRIPTION OF THE INVENTION

In many types of cancer and other diseases, the activation of IAPs in cells induced by genetic defects or in response to chemotherapeutic agents has been correlated with increased resistance to apoptosis. Interestingly, the results obtained by the inventors of the present invention show that cancer cells in which IAP levels are lowered are more sensitive to chemotherapeutic agents or TRAIL-induced apoptosis. The present invention describes compounds that can directly bind to various IAPs, antagonize their functions and, moreover, cause down-regulation of certain IAP proteins in cells, sensitizing them, thus, to apoptosis. Such molecules, which, by inducing a prolonged loss of IAP from the cells, are involved in the pathogenesis or development of the disease, will be useful as therapeutic agents, either taken separately or in a synergistic combination with other inducers of apoptosis. This combination of effects is expected to provide the clinical benefits of the compounds of the present invention in overcoming resistance to therapy. The use of the compounds disclosed in this application in combination therapy with other agents should also be advantageous.

In one aspect of the present invention, the compounds of the present invention can also be represented by the following Formula II, wherein M1 and M2 are independent BIR binding domains.

In one subgroup of Formula II, M1 has the same meaning as M2, and the dotted line means the line of symmetry. In another subgroup, M1 is different from M2.

In one subgroup, the compounds of Formula II are asymmetric around the dashed line. In another subgroup, the substituents in M1 and M2 are the same. In another subgroup, the substituents in M1 and M2 are different from each other.

Specialists in this field should be clear that when M1 and M2 are the same, the substituents R ¹ , R ^1a , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , R ⁶ , R ⁷ , R ⁸ , R ⁹ , R ¹⁰ , R ¹¹ , R ¹² , R ¹³ , R ¹⁴ , n, m, Y ¹ , Q and X in M1 have the same meaning as R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ³⁰⁰ , R ⁴⁰⁰ , respectively R ⁵⁰⁰ , R ⁶⁰⁰ , R ⁷⁰⁰ , R ⁸⁰⁰ , R ⁹⁰⁰ , R ¹⁰⁰⁰ , R ¹¹⁰⁰ , R ¹³⁰⁰ , R ¹⁴⁰⁰ , n, m, Y ¹⁰⁰ , Q ¹ and X ^{1 are} substituents in M2. When M1 and M2 are different from each other, at least one of the above substituents has a different meaning in any of M1 or M2.

Alternatively, substituents in M1 may be defined as R ¹ , R ^1a , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , R ⁶ , R ⁷ , R ⁸ , R ⁹ , R ¹⁰ , R ¹¹ , R ¹² , R ¹³ , R ¹⁴ , n, m, Y ¹ , Q and X, and substituents in M2 can be defined as R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ , R ⁶⁰⁰ , R ⁷⁰⁰ , R ⁸⁰⁰ , R ⁹⁰⁰ , R ¹⁰⁰⁰ , R ¹¹⁰⁰ , R ¹³⁰⁰ , R ¹⁴⁰⁰ , n, m, Y ¹⁰⁰ , Q ¹ and X ^1, respectively. In the case when M1 and M2 are the same, the substituents R ¹ , R ^1a , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , R ⁶ , R ⁷ , R ⁸ , R ⁹ , R ¹⁰ , R ¹¹ , R ¹² , R ¹³ , R ¹⁴ , n, m, Y ¹ , Q and X in M1 have the same meanings as, respectively, R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ , R ⁶⁰⁰ , R ⁷⁰⁰ , R ⁸⁰⁰ , R ⁹⁰⁰ , R ¹⁰⁰⁰ , R ¹¹⁰⁰ , R ¹³⁰⁰ , R ¹⁴⁰⁰ , n, m, Y ¹⁰⁰ , Q ¹ and X ¹ in M2. In the case where M1 and M2 are different from each other, at least one of the above substituents has a different meaning.

The compounds of the present invention are useful as compounds that bind to the BIR domain in mammalian IAPs and are represented by Formula I.

W and W ¹ :

и W¹ представляет собой

, где R³⁰⁰, R⁴⁰⁰, R⁵⁰⁰, R^500a, X¹ имеют значения, определенные для R³, R⁴, R⁵, R^5a и X соответственно.In one subgroup of compounds of Formula IW represents

and W ¹ represents

where R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ , R ^500a , X ¹ have the meanings defined for R ³ , R ⁴ , R ⁵ , R ^5a and X, respectively.

и W¹ представляет собой

, где R⁵⁰⁰, R^500a, X¹, G¹ имеют значения, определенные для R⁵, R^a, X и G соответственно.In an alternative subgroup of compounds of Formula II, W is

and W ¹ represents

where R ⁵⁰⁰ , R ^500a , X ¹ , G ¹ have the meanings defined for R ⁵ , R ^a , X and G, respectively.

и W¹ представляет собой

, где R⁵⁰⁰, R^500a, G¹ имеют значения, определенные для R⁵, R^5a и G соответственно.In an alternative subgroup of compounds of Formula I, W is

and W ¹ represents

where R ⁵⁰⁰ , R ^500a , G ¹ have the meanings defined for R ⁵ , R ^5a and G, respectively.

и W¹ представляет собой

, где R³, R⁴ имеют значения, определенные для R³⁰⁰, R⁴⁰⁰ соответственно.In another alternative subgroup of compounds of Formula IW represents

and W ¹ represents

where R ³ , R ⁴ have the meanings defined for R ³⁰⁰ , R ^400, respectively.

Any and every individual definition of W and W ¹ disclosed in this application can be combined with any and every individual definition of R ¹ , R ^1a , R ² , R ¹⁰⁰ , R ^100a , R ² , R ²⁰⁰ , B.

AT:

In one example of compounds of Formula I, B is

where A, A ¹ , Q, Q ¹ and BG have the meanings defined in this application.

Any and every individual definition of B disclosed in this application can be combined with any and every individual definition of R ¹ , R ^1a , R ² , R ¹⁰⁰ , R ^100a , R ² , R ²⁰⁰ , W and W ¹ disclosed in this application.

Q and Q ¹ :

In one subgroup of compounds of Formulas IQ and Q ^1, both are —CH ₂ -.

In an alternative subgroup of compounds of Formula II, Q and Q ^{1 are} both —C (O) -.

Any and every individual definition of Q and Q ¹ disclosed in this application can be combined with any and every individual definition of R ¹ , R ^1a , R ² , R ¹⁰⁰ , R ^100a , R ²⁰⁰ , W and W ¹ disclosed in this application.

A and A ¹ :

In one subgroup of compounds of Formula IA and A ^{1 are} independently selected from

1) NR ⁶ or

2) NR ⁶⁰⁰ ;

where R ⁶ and R ⁶⁰⁰ have the meanings defined in this application.

Any and every individual definition of A and A ¹ disclosed in this application can be combined with any and every individual definition of R ¹ , R ^1a , R ² , R ¹⁰⁰ , R ^100a , R ²⁰⁰ , W and W ¹ disclosed in this application.

BG:

In one subgroup of compounds of Formula I, BG is —Y ¹ —LY ¹⁰⁰ -.

In an alternative subgroup of compounds of Formula I, BG is —L—.

In another alternative subgroup, BG is —Y ¹ —L ¹ —ZL ¹⁰⁰ —Y ¹⁰⁰ -, where L ¹ and L ¹⁰⁰ have the same meaning or L ¹ and L ¹⁰⁰ are different from each other.

Any and every individual definition of BG disclosed in this application can be combined with any and every individual definition of R ¹ , R ^1a , R ² , R ¹⁰⁰ , R ^100a , R ²⁰⁰ , W and W ¹ disclosed in this application.

Core:

Therefore, in one subgroup, the compounds of the present invention include compounds of Formula 1A.

where R ¹ , R ^1a , R ² , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , X, X ¹ , A, A ¹ , BG, R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ and R ^500a have the meanings defined in this application.

In one subgroup, the compounds of the present invention include compounds of Formula 1A1:

where R ¹ , R ^1a , R ² , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , Q, Q ¹ , A, A ¹ , BG, X, X ¹ , R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ and R ^500a have the meanings defined in this application.

In another subgroup, the compounds of the present invention include compounds of Formula 1A2:

where R ¹ , R ^1a , R ² , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , Q, Q ¹ , A, A ¹ , BG, X, X ¹ , R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ and R ^500a have the meanings defined in this application.

In another subgroup, the compounds of the present invention include compounds of Formula 1A3:

where R ¹ , R ^1a , R ² , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , Q, Q ¹ , BG, X, X ¹ , R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ , R ^500a , R ⁶ and R ⁶⁰⁰ are as defined herein.

In another subset of the compounds of the present invention include compounds of Formula 1A4:

where R ¹ , R ^1a , R ² , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , Q, Q ¹ , L, X, X ¹ , R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ , R ^500a , R ⁶ and R ⁶⁰⁰ are as defined herein.

In another subgroup, the compounds of the present invention include compounds of Formula 1A5:

where R ¹ , R ^1a , R ² , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , Q, Q ¹ , L, X, X ¹ , R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ , R ^500a , R ⁶ and R ⁶⁰⁰ are as defined herein.

In another subgroup, the compounds of the present invention include compounds of Formula 1A6:

where R ¹ , R ^1a , R ² , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , Q, Q ¹ , X, X ¹ , L, R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ , R ^500a , R ⁶ and R ⁶⁰⁰ are as defined herein.

In an alternative subgroup, the compounds of the present invention include compounds of Formula 1B:

where R ¹ , R ^1a , R ² , R ²⁰⁰ , R ⁵ , R ^5a , G, G ¹ , Q, Q ¹ , X, X ¹ , A, A ¹ , R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ⁵⁰⁰ and R ^500a have the meanings defined in this application.

In another subgroup of compounds of the present invention include compounds of Formula 1B1:

where R ¹ , R ^1a , R ² , R ²⁰⁰ , R ⁵ , R ^5a , G, G ¹ , Q, Q ¹ , BG, X, X ¹ , A, A ¹ , R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ⁵⁰⁰ and R ^500a have the meanings defined in this application.

In another subset of the compounds of the present invention include compounds of Formula 1B2:

where R ¹ , R ^1a , R ² , R ²⁰⁰ , R ⁵ , R ^5a , G, G ¹ , L, Q ¹ Q ¹ , X, X ¹ , A, A ¹ , R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ⁵⁰⁰ and R ^500a have the meanings defined in this application.

In another alternative subgroup, the compounds of the present invention include compounds of Formula 1C:

where R ¹ , R ^1a , R ² , R ²⁰⁰ , R ⁵ , R ^5a , G, G ¹ , BG, Q, Q ¹ , X, X ¹ , A, A ¹ , R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ⁵⁰⁰ and R ^500a have the meanings defined in this application.

In another alternative subgroup, the compounds of the present invention include compounds of Formula 1D:

where R ¹ , R ^1a , R ² , R ² , R ⁵ , R ^5a , BG, G, G ¹ , Q, Q ¹ , A, A ¹ , R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ⁵⁰⁰ , R ^500a , R ⁶ and R ⁶⁰⁰ have the meanings defined in this application.

Y ¹ and Y ¹⁰⁰ :

In one subgroup, Y ¹ and Y ^{100 are} both —C (O) -.

In another subgroup, Y ¹ and Y ^{100 are} both —S (O) ₂ -.

In another subgroup, Y ¹ and Y ^{100 are} both —C (O) N (R ⁸ ) -, where R ⁸ is as defined herein.

Any and every individual definition of Y ¹ and Y ¹⁰⁰ disclosed in this application can be combined with any and every individual definition of Z, R ¹ , R ^1a , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , R ⁶ , R ⁷ , R ⁸ , R ⁹ , R ¹⁰ , R ¹¹ , R ¹² , R ¹³ , R ¹⁴ , n, m, Q, X, R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ , R ⁶⁰⁰ , R ⁷⁰⁰ , R ⁸⁰⁰ , R ⁹⁰⁰ , R ¹⁰⁰⁰ , R ¹¹⁰⁰ , R ¹³⁰⁰ , R ¹⁴⁰⁰ , n, m, Y ¹⁰⁰ , Q ¹ and X ¹ presented in this application.

L, L ¹ and L ¹⁰⁰ :

In one subgroup, L, L ¹ and L ¹⁰⁰ are selected from the following groups:

1) -C ₁ -C ₁₂ alkyl-,

2) -C ₃ -C ₇ cycloalkyl-,

3) -aryl-,

4) biphenyl

5) -heteroaryl-,

6) -heterocyclyl-,

7) -C ₁ -C ₆ alkyl- (C ₃ -C ₇ cycloalkyl) -C ₁ -C ₆ alkyl,

8) -C ₁ -C ₆ alkyl-aryl-C ₁ -C ₆ alkyl,

9) -C ₁ -C ₆ alkyl-biphenyl-C ₁ -C ₆ alkyl,

10) -C ₁ -C ₆ alkyl-heteroaryl-C ₁ -C ₆ alkyl,

11) -C ₁ -C ₆ alkyl heterocyclyl-C ₁ -C ₆ alkyl or

12) -C ₁ -C ₆ alkyl-OC ₁ -C ₆ alkyl,

wherein alkyl and cycloalkyl are optionally substituted with one or more R ⁷ substituents and aryl, heteroaryl, biphenyl and heterocyclyl are optionally substituted with one or more R ¹¹ substituents.

In another subgroup, L, L ¹ and L ¹⁰⁰ are - N (R ⁸ ) C (O) N (R ⁸ ) -, where R ⁸ has the meaning defined in this application.

In another subgroup, L, L ¹ and L ¹⁰⁰ are —C ₁ -C ₆ alkyl-ZC ₁ -C ₆ alkyl—; where alkyl is optionally substituted with one or more substituents R ⁷ and Z has the meaning defined in this application.

Any and every individual definition of L, L ¹ , L ¹⁰⁰ disclosed in this application can be combined with any and every individual definition of Z, R ¹ , R ^1a , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , R ⁶ , R ⁷ , R ⁸ , R ⁹ , R ¹⁰ , R ¹¹ , R ¹² , R ¹³ , R ¹⁴ , n, m, Y, Q, X, R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ , R ⁶⁰⁰ , R ⁷⁰⁰ , R ⁸⁰⁰ , R ⁹⁰⁰ , R ¹⁰⁰⁰ , R ¹¹⁰⁰ , R ¹³⁰⁰ , R ¹⁴⁰⁰ , n, m, Y ¹⁰⁰ , Q ¹ and X ¹ presented in this application.

Z:

In one subgroup, Z is selected from the following groups:

1) -N (R ⁸ ) CON (R ⁸ ) -,

2) -N (R ⁸ ) C (O) -aryl-C (O) N (R ⁸ ) -,

3) -N (R ⁸ ) C (O) -heteroaryl-C (O) N (R ⁸ ) -,

4) -C (O) -,

5) -N (R ⁸ ) -C ₁ -C ₁₂ -alkyl-N (R ⁸ ) -,

6) -N (R ⁸ ) -C (O) C (O) -N (R ⁸ ) -,

7) -N (R ⁸ ) -C (O) -C ₁ -C ₁₂ -alkyl-C (O) -N (R ⁸ ) -,

8) -N (R ⁸ ) -C (O) -aryl-C (O) -N (R ⁸ ) -,

9) -N (R ⁸ ) -C (O) -aryl-O-aryl-C (O) -N (R ⁸ ) -,

10) -N (R ⁸ ) -C (O) -heteroaryl-C (O) -N (R ⁸ ) -,

11) -N (R ⁸ ) -C (O) -biphenyl-C (O) -N (R ⁸ ) -,

12) -N (R ⁸ ) -S (O) ₂ -C ₁ -C ₁₂ -alkyl-S (O) ₂ -N (R ⁸ ) -,

13) -N (R ⁸ ) -S (O) ₂ -aryl-S (O) ₂ -N (R ⁸ ) -,

14) -N (R ⁸ ) -S (O) ₂ -heteroaryl-S (O) ₂ -N (R ⁸ ) - or

15) -N (R ⁸ ) -S (O) ₂ -biphenyl-S (O) ₂ -N (R ⁸ ) -,

where alkyl and cycloalkyl are optionally substituted with one or more substituents R ⁷ and aryl, heteroaryl and heterocyclyl are optionally substituted with one or more substituents R ¹¹ and where R ⁸ has the meaning defined in this application.

Any and every individual definition of Z disclosed in this application can be combined with any and every individual definition of L, L ¹ , L ¹⁰⁰ , R ¹ , R ^1a , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , R ⁶ , R ⁷ , R ⁸ , R ⁹ , R ¹⁰ , R ¹¹ , R ¹² , R ¹³ , R ¹⁴ , n, m, Y, Q, X, R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ , R ⁶⁰⁰ , R ⁷⁰⁰ , R ⁸⁰⁰ , R ⁹⁰⁰ , R ¹⁰⁰⁰ , R ¹¹⁰⁰ , R ¹³⁰⁰ , R ¹⁴⁰⁰ , n, m, Y ¹⁰⁰ , Q ¹ and X ¹ presented in this application.

R ¹ , R ^1a , R ¹⁰⁰ and R ^100a :

In one subgroup of compounds of Formula IR ¹ , R ^1a , R ¹⁰⁰ and R ^{100a are} independently selected from H or CH ₃ .

Any and every individual definition of R ¹ , R ^1a , R ¹⁰⁰ , R ^100a disclosed in this application can be combined with any and every individual definition of L, L ¹ , L ¹⁰⁰ , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , R ⁶ , R ⁷ , R ⁸ , R ⁹ , R ¹⁰ , R ¹¹ , R ¹² , R ¹³ , R ¹⁴ , n, m, Y, Q, X, R ²⁰⁰ , R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ , R ⁶⁰⁰ , R ⁷⁰⁰ , R ⁸⁰⁰ , R ⁹⁰⁰ , R ¹⁰⁰⁰ , R ¹¹⁰⁰ , R ¹³⁰⁰ , R ¹⁴⁰⁰ , n, m, Y ¹⁰⁰ , Q ¹ and X ¹ presented in this application.

R ² and R ²⁰⁰ :

In one subgroup of compounds of Formula I, both R ² and R ²⁰⁰ exhibit (S) stereochemistry.

Any and every individual definition of R ² and R ²⁰⁰ disclosed in this application can be combined with any and every individual definition of L, L ¹ , L ¹⁰⁰ , R ¹ , R ^1a , R ³ , R ⁴ , R ⁵ , R ^5a , R ⁶ , R ⁷ , R ⁸ , R ⁹ , R ¹⁰ , R ¹¹ , R ¹² , R ¹³ , R ¹⁴ , n, m, Y ¹ , Q, X, R ¹⁰⁰ , R ^100a , R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ , R ⁶⁰⁰ , R ⁷⁰⁰ , R ⁸⁰⁰ , R ⁹⁰⁰ , R ¹⁰⁰⁰ , R ¹¹⁰⁰ , R ¹³⁰⁰ , R ¹⁴⁰⁰ , n, m, Y ¹⁰⁰ , Q ¹ and X ¹ presented in this application.

R ³ and R ³⁰⁰ :

In one subgroup of compounds, Formulas IR ³ and R ^{300 are} independently selected from

1) H or

2) C ₁ -C ₆ alkyl optionally substituted with R ⁷ ; and where R ⁷ has the meaning defined in this application.

Typical examples of R ³ and R ³⁰⁰ include H, (S) -methyl, (S) -ethyl, (S) -t-butyl, (S) -cyclohexylmethyl, (S) -2-phenylethyl and benzyl (S) -butylcarbamate .

Any and every individual definition of R ³ and R ³⁰⁰ disclosed in this application can be combined with any and every individual definition of L, L ¹ , L ¹⁰⁰ , R ¹ , R ^1a , R ² , R ⁴ , R ⁵ , R ^5a , R ⁶ , R ⁷ , R ⁸ , R ⁹ , R ¹⁰ , R ¹¹ , R ¹² , R ¹³ , R ¹⁴ , n, m, Y, Q, X, R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ , R ⁶⁰⁰ , R ⁷⁰⁰ , R ⁸⁰⁰ , R ⁹⁰⁰ , R ¹⁰⁰⁰ , R ¹¹⁰⁰ , R ¹³⁰⁰ , R ¹⁴⁰⁰ , n, m, Y ¹⁰⁰ , Q ¹ and X ¹ presented in this application.

R ⁶ and R ⁶⁰⁰ :

In one subgroup of compounds, Formulas IR ⁶ and R ⁶⁰⁰ each independently represent

1) H,

2) ← C ₁ -C ₆ alkyl,

3) ← aryl or

four)

where alkyl is optionally substituted with one or more R ⁷ substituents and where aryl is optionally substituted with one or more R ¹¹ substituents.

Typical examples of R ⁶ and R ⁶⁰⁰ include:

Any and every individual definition of R ⁶ and R ⁶⁰⁰ disclosed in this application can be combined with any and every individual definition of L ¹ L ¹ , L ¹⁰⁰ , R ¹ , R ^1a , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , R ⁷ , R ⁸ , R ⁹ , R ¹⁰ , R ¹¹ , R ¹² , R ¹³ , R ¹⁴ , n, m, Y, Q, X, R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ , R ⁷⁰⁰ , R ⁸⁰⁰ , R ⁹⁰⁰ , R ¹⁰⁰⁰ , R ¹¹⁰⁰ , R ¹³⁰⁰ , R ¹⁴⁰⁰ , n, m, Y ¹⁰⁰ , Q ¹ and X ¹ presented in this application.

R ⁷ :

In one subgroup of compounds of Formulas, IR ⁷ is

1) C ₃ -C ₇ cycloalkyl,

2) aryl,

3) heteroaryl or

4) NHC (O) OCH ₂ phenyl,

where aryl and heteroaryl are optionally substituted with one or more substituents R ¹¹ and where R ⁹ and R ¹⁰ are as defined herein.

Any and every individual definition of R ⁷ disclosed in this application can be combined with any and every individual definition of L, L ¹ , L ¹⁰⁰ , R ¹ , R ^1a , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , R ⁶ , R ⁸ , R ⁹ , R ¹⁰ , R ¹¹ , R ¹² , R ¹³ , R ¹⁴ , n, m, Y, Q, X, R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ , R ⁶⁰⁰ , R ⁷⁰⁰ , R ⁸⁰⁰ , R ⁹⁰⁰ , R ¹⁰⁰⁰ , R ¹¹⁰⁰ , R ¹³⁰⁰ , R ¹⁴⁰⁰ , n, m, Y ¹⁰⁰ , Q ¹ and X ¹ presented in this application.

R ⁸ :

In one subgroup, R ^{8 is} selected from

1) H,

2) halogenated,

3) C ₁ -C ₆ alkyl,

4) C ₃ -C ₇ cycloalkyl,

5) aryl,

6) heteroaryl,

7) heterocyclyl or

8) heterobicyclyl,

where alkyl, cycloalkyl are optionally substituted with one or more R ⁷ substituents and where aryl, heteroaryl, heterocyclyl and heterobicyclyl are optionally substituted with one or more R ¹¹ substituents.

Any and every individual definition of R ⁸ disclosed in this application can be combined with any and every individual definition of L, L ¹ , L ¹⁰⁰ , R ¹ , R ^1a , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , R ⁶ , R ⁷ , R ⁹ , R ¹⁰ , R ¹¹ , R ¹² , R ¹³ , R ¹⁴ , n, m, Y, Q, X, R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ , R ⁶⁰⁰ , R ⁷⁰⁰ , R ⁸⁰⁰ , R ⁹⁰⁰ , R ¹⁰⁰⁰ , R ¹¹⁰⁰ , R ¹³⁰⁰ , R ¹⁴⁰⁰ , n, m, Y ¹⁰⁰ , Q ¹ and X ¹ presented in this application.

R ¹¹ :

In one subgroup of compounds of Formula IR ¹¹ is

1) halogen

2) CF ₃ ,

3) OH,

4) OMe,

5) aryl or

6) heteroaryl.

Examples of R ¹¹ include F, Cl, Br, OH, OMe, CF ₃ , phenyl and tetrazole.

Any and every individual definition of R ¹¹ disclosed in this application can be combined with any and every individual definition of L, L ¹ , L ¹⁰⁰ , R ¹ , R ^1a , R ² , R ³ , R ⁴ , R ⁵ , R ^5a , R ⁶ , R ⁷ , R ⁸ , R ⁹ , R ¹⁰ , R ¹² , R ¹³ , R ¹⁴ , n, m, Y, Q, X, R ¹⁰⁰ , R ^100a , R ²⁰⁰ , R ³⁰⁰ , R ⁴⁰⁰ , R ⁵⁰⁰ , R ⁶⁰⁰ , R ⁷⁰⁰ , R ⁸⁰⁰ , R ⁹⁰⁰ , R ¹⁰⁰⁰ , R ¹¹⁰⁰ , R ¹³⁰⁰ , R ¹⁴⁰⁰ , n, m, Y ¹⁰⁰ , Q ¹ and X ¹ presented in this application.

In accordance with other examples of the present invention, W and W ¹ each can be defined as:

или

or

where R ³ , R ³⁰⁰ , R ⁴ and R ⁴⁰⁰ are as defined above.

One subgroup of compounds of the present invention includes compounds in which W and W ^{1 are} defined as:

In one example of the present invention, W and W ¹ each can be defined as:

или

or

where R ³ , R ³⁰⁰ , R ⁴ and R ⁴⁰⁰ are as defined above.

More specifically, one subgroup of compounds of the present invention includes compounds in which W and W ^{1 are} defined as:

In another aspect of the present invention, W and W ¹ each can be defined as a β-rotational mimetic, such as:

where G, G ¹ , X, X ¹ , R ⁵ , R ^5a , R ⁵⁰⁰ and R ^500a are as defined above.

More specifically, examples of β-rotational mimetics can thus be characterized by the following bicyclic and tricyclic ring systems:

A review of the synthesis of bicyclic and tricyclic ring systems capable of acting as β-rotational mimetics, and synthesis methods for their preparation can be found in the following review article: Cluzeau J .; Lubell W. D. Biopolymers-Peptide Synthesis, 2005, 80, 98, and the references therein, incorporated in their entirety.

If any variable, such as R ³ , R ⁴ , etc., occurs more than once in any component structure, the definition of such a variable in each case is independent of any other cases of the presence of such a variable. If the substituent itself is substituted with one or more substituents, it should be understood that such one or more substituents can be attached to the same carbon atom or to different carbon atoms. Combinations of substituents and variables defined in this application are permissible only if they form chemically stable compounds.

It will be understood by those skilled in the art that substitution patterns and substituents in the compounds of the present invention can be selected to produce compounds that are chemically stable and that can be easily synthesized using the chemistry described in the examples and chemical techniques well known in the art. techniques using readily available starting materials.

It should be understood that many of the substituents or groups described herein contain functional group equivalents, and this means that such a group or substituent can be substituted by another group or substituent that have similar electronic characteristics, hybridization and binding characteristics.

Definitions

Unless otherwise specified, the following definitions apply.

The singular forms referred to by the articles "a", "an" and "the" include the corresponding plural forms, unless the context clearly indicates otherwise.

As used herein, the term “comprising” means that the listed elements following the word “including” are necessary or mandatory, but that other elements are optional and may or may not be present.

As used herein, the term “consisting of” means including and limited to what follows after the phrase “consisting of”. Thus, the phrase “consisting of” indicates that the listed elements are necessary or mandatory and that no other elements may be present.

As used herein, the term “alkyl” is intended to include both branched and linear saturated aliphatic hydrocarbon groups containing the indicated number of carbon atoms, for example C ₁ -C ₆ as defined in C ₁ -C ₆ alkyl, including groups containing 1, 2, 3, 4, 5 or 6 carbon atoms in a linear or branched arrangement, and C ₁ -C ₄ , as in C ₁ -C ₄ alkyl, is defined as including groups containing 1, 2, 3 or 4 carbon atoms in a linear or branched arrangement, and C ₁ -C ₃ , as in C ₁ -C ₃ alkyl, is defined as radical groups containing 1, 2 or 3 carbon atoms in a linear or branched arrangement, and C ₁ -C ₁₂ , as in C ₁ -C ₁₂ alkyl, is defined as including groups containing 1, 2, 3, 4, 5, 6 , 7, 8, 9, 10, 11, and 12 carbon atoms in a linear or branched arrangement. Examples of alkyl as defined above include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl, pentyl and hexyl.

As used herein, the term "alkenyl" means unsaturated linear or branched hydrocarbon groups containing the indicated number of carbon atoms, and in which at least two of these carbon atoms are linked to each other by a double bond, and having either E, or Z stereochemistry, and combinations thereof. For example, C ₂ -C ₆ , as in C ₂ -C ₆ alkenyl, is defined as including groups containing 2, 3, 4, 5, or 6 carbon atoms in a linear or branched arrangement, where at least two of these atoms carbon bonded together by a double bond. Examples of C ₂ -C ₆ alkenyl include ethenyl (vinyl), 1-propenyl, 2-propenyl, 1-butenyl, and the like.

As used herein, the term “alkynyl” means unsaturated, linear hydrocarbon groups containing the indicated number of carbon atoms and in which at least two carbon atoms are linked together by a triple bond. For example, C ₂ -C ₄ , as in C ₂ -C ₄ alkynyl, is defined as including groups containing 2, 3 or 4 carbon atoms in a chain, where at least two of these carbon atoms are linked together by a triple bond.

As used herein, the term “cycloalkyl” means a monocyclic saturated aliphatic hydrocarbon group containing the indicated number of carbon atoms, for example C ₃ -C ₇ , as in C ₃ -C ₇ cycloalkyl, defined as including groups containing 3, 4, 5, 6 or 7 carbon atoms in a monocyclic arrangement. Examples of C ₃ -C ₇ cycloalkyl as defined above include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and cycloheptyl.

As used herein, the term “cycloalkenyl” means a monocyclic saturated aliphatic hydrocarbon group containing the indicated number of carbon atoms, for example C ₃ -C ₇ , as in C ₃ -C ₇ cycloalkenyl, defined as including groups containing 3, 4, 5, 6 or 7 carbon atoms in a monocyclic arrangement. Examples of C ₃ -C ₇ cycloalkenyl as defined above include, but are not limited to, cyclopentenyl and cyclohexenyl.

As used herein, the term “halo” or “halogen” means fluoro, chloro, bromo or iodo.

As used herein, the term “haloalkyl” means alkyl, as defined above, in which each hydrogen atom can be sequentially substituted by a halogen atom. Examples of halogenated include, but are not limited to, CH ₂ F, CHF ₂ and CF ₃ .

As used herein, the term “aryl,” either alone or in combination with another radical, means a carbocyclic aromatic monocyclic group containing 6 carbon atoms, which, in addition, may be fused to a second 5- or 6-membered carbocyclic a group which may be aromatic, saturated or unsaturated. Aryl includes, but is not limited to, phenyl, indanyl, 1-naphthyl, 2-naphthyl and tetrahydronaphthyl. Condensed aryls can be linked to another group either in a suitable position in the cycloalkyl ring or in the aromatic ring. For example:

Arrows deduced from the ring system indicate that the bond can be attached to any of the suitable ring atoms.

или

As used herein, the term “heteroaryl” means a monocyclic or bicyclic ring system containing up to ten atoms, where at least one ring is aromatic, and containing from 1 to 4 heteroatoms selected from the group consisting of O , N and S. A heteroaryl substituent can be attached either via a ring carbon atom or one of the heteroatoms. Examples of heteroaryl groups include, but are not limited to, thienyl, benzimidazolyl, benzo [b] thienyl, furyl, benzofuranyl, pyranyl, isobenzofuranyl, chromenyl, xanthenyl, 2H-pyrrolyl, pyrrolyl, imidazolyl, pyrazolyl, pyridyl, pyrazinyl, pyridinyl, pyrazinyl. indolysinyl, isoindolyl, 3H-indolyl, indolyl, indazolyl, purinyl, 4H-quinolisinyl, isoquinolyl, quinolyl, phthalazinyl, naphthyridinyl, quinoxalinyl, quinazolinyl , cinnolinyl, pteridinyl, isothiazolyl, isochromanil, chromanyl, isoxazolyl, furazanyl, indolinyl, isoindolinyl, thiazolo [4,5-b] pyridine and fluorescein derivatives, such as:

or

As used herein, the term “heterocycle”, “heterocyclic” or “heterocyclyl” means a 5-, 6- or 7-membered non-aromatic ring system containing from 1 to 4 heteroatoms selected from the group consisting of O, N and S. Examples of heterocycles include, but are not limited to, pyrrolidinyl, tetrahydrofuranyl, piperidyl, pyrrolinyl, piperazinyl, imidazolidinyl, morpholinyl, imidazolinyl, pyrazolidinyl, pyrazolinyl and biotinyl derivatives. As used herein, the term “heterocycle”, either alone or in combination with another radical, means a heterocycle, as defined above, fused to another cycle, which may be a heterocycle, aryl, or any other cycle defined in this application. Examples of such heterobicycles include, but are not limited to, coumarin, benzo [d] [1,3] dioxol, 2,3-dihydrobenzo [b] [1,4] dioxin and 3,4-dihydro-2H-benzo [b] [1,4] diazepine.

As used herein, the term “detectable label” means a group that can be linked to a compound of the present invention to produce a probe or to the IAP BIR domain so that when the probe binds to the BIR domain, the label allows either direct or indirect probe recognition, providing its detection, measurement and quantification. As used herein, the term "affinity tag" means a ligand or group that binds either to the compound of the present invention or to the IAP BIR domain, allowing the extraction of another compound to which the ligand or group is bound.

As used herein, the term “probe” means a compound of Formula I that is labeled with either a detectable label or an affinity tag and which is capable of binding either covalently or non-covalently to the IAP BIR domain. When, for example, the probe is bonded non-covalently, it may be replaced by the test compound. When, for example, the probe is covalently bound, it can be used to form cross-linked adducts that can be quantified and inhibited by the test compound.

As used herein, the term “optionally substituted with one or more substituents” or its equivalent term “optionally substituted with at least one substituent” means that the event or circumstances described below may or may not occur and that the description includes cases, when an event or circumstance takes place, and cases of their absence. This definition assumes from zero to five substituents.

If the substituents as such are incompatible with the synthetic methods of the present invention, the substituent can be protected with a suitable protecting group (PG) which is resistant to the reaction conditions used in these methods. The protective group can be removed at an appropriate time in the reaction sequence of the method to obtain the desired intermediate compound or target compound. Suitable protecting groups and methods for protecting various substituents and removing protecting groups using such suitable protecting groups are well known to those skilled in the art; examples thereof can be found in T. Greene and P. Wuts, Protecting Groups in Chemical Synthesis (3rd ed.), John Wiley & Sons, NY (1999), which is incorporated herein by reference in its entirety. Examples of protective groups used in the present invention include, but are not limited to, Alloc, Fmoc, Bn, Boc, CBz and COCF ₃ . In some cases, the substituent may be specifically selected to be reactive under the reaction conditions used in the methods of the present invention. In such circumstances, the reaction conditions convert the selected Deputy to another Deputy, which is either useful in the intermediate in the methods of the present invention, or is the desired Deputy in the target compound.

The abbreviations for α-amino acids used in the present invention are as follows:

Amino acid Abbreviation α-aminobutyric acid Abu Alanine Ala Arginine Arg Aspartic acid Asp Asparagine Asn Cysteine Cys Glutamic acid Glu Glutamine Gln Glycine Gly Isoleucine Ile Histidine His Leucine Leu Lysine Lys Methionine Met Phenylalanine Phe Proline Pro Serine Ser Threonine Thr Tryptophan Trp Tyrosine Tyr Valine Val

As used herein, the term “residue”, when referring to α-amino acids, means a radical derived from the corresponding α-amino acid by removing the hydroxyl of the carboxy group and one hydrogen of the α-amino group. For example, the terms Gln, Ala, Gly, Ile, Arg, Asp, Phe, Ser, Leu, Cys, Asn and Tyr represent the residues L-glutamine, L-alanine, glycine, L-isoleucine, L-arginine, L-aspartic acid , L-phenylalanine, L-serine, L-leucine, L-cysteine, L-asparagine and L-tyrosine, respectively.

As used herein, the term “subject” means humans and mammals other than humans, such as primates, cats, dogs, pigs, cows, sheep, goats, horses, rabbits, rats, mice, and the like.

As used herein, the term “prodrug” means a compound that can be converted under physiological conditions or by solvolysis to a biologically active compound of the present invention. Thus, the term “prodrug” refers to a precursor of a compound of the present invention that is pharmaceutically acceptable. A prodrug may be inactive or exhibit limited activity when administered to a subject in need thereof, but it will be converted in vivo to the active compound of the present invention. Typically, prodrugs are converted in vivo to form a compound of the present invention, for example by hydrolysis in blood or other organs by enzymatic processing. A prodrug compound often demonstrates the benefits of solubility, tissue compatibility, or sustained release in a subject (see Bundgard, H., Design of Prodrugs (1985), p. 7-9, 21-24 (Elsevier, Amsterdam). A prodrug definition includes any covalently bound carriers that release the active compound of the present invention in vivo when such a prodrug is administered to the subject. Prodrugs of the compounds of the present invention can be obtained by modifying the functional groups present in the compound of the present invention ω, so that such modifications are cleaved either by routine manipulation or in vivo to the parent compound of the present invention.

As used herein, the term “pharmaceutically acceptable carrier, diluent or excipient” means, without limitation, any adjuvant, carrier, excipient, glidant, sweetener, diluent, preservative, coloring / coloring agent, flavor and aroma enhancer, surface and flavor active substance, wetting agent, dispersing agent, suspending agent, stabilizer, isotonicity agent, solvent, emulsifier or encapsulating agent, such as liposome, cyclodextrins, encapsules polymer delivery systems or a polyethylene glycol matrix which is acceptable for use by a subject, preferably a human.

As used herein, the term “pharmaceutically acceptable salt” means both acid and base addition salts.

As used herein, the term “pharmaceutically acceptable acid addition salt” means those salts which retain the biological effectiveness and properties of the free bases that are not biologically or otherwise undesirable and which are formed with inorganic acids such as hydrochloric acid , hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like, and organic acids such as acetic acid, trifluoroacetic acid, propiono hydrochloric acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid and the like.

As used herein, the term “pharmaceutically acceptable base addition salt” means those salts that retain the biological effectiveness and properties of free acids that are not biologically or otherwise undesirable. Such salts are prepared by adding an inorganic base or organic base to the free acid. Salts derived from inorganic bases include, but are not limited to, salts of sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum, and the like. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines, including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine , 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, ethylenediamine, glucosamine, methylglucamine, theobromine, purines, piperazine, piperidine, N-ethyl Idin, polyamine resins and the like

As used herein, the term “binding to a BIR domain” means the action of a compound of the present invention on an IAP BIR domain that blocks or reduces the binding of IAPs to BIR binding proteins or is involved in the displacement of BIR binding proteins from IAP. Examples of BIR binding proteins include, but are not limited to, caspases and BIR binding proteins isolated from mitochondria, such as Smac, Omi / WTR2A, and the like.

As used in this application, the term "insufficient apoptosis" means a condition where the disease is caused or proceeds due to the fact that cells harmful to the subject were not susceptible to apoptosis. It includes, but is not limited to, cancer cells that survive in a subject without treatment, cancer cells that survive in a subject during or after anti-cancer treatment, or immune cells that are harmful to the subject and include neutrophils, monocytes, and autoreactive T cells.

As used herein, the term “therapeutically effective amount” means an amount of a compound of Formula I that, when administered to a subject, is sufficient to provide a treatment for a condition of a disease associated with insufficient apoptosis. The amount of the compound of Formula I may vary depending on the compound, the condition and its severity and the age of the subject being treated, but this amount can be determined by a person skilled in the art in a routine manner based on his own knowledge and the present disclosure.

As used herein, the term “treat” or “treatment” means treating a condition of a disease associated with insufficient apoptosis, as disclosed herein, in a subject, and includes: (i) preventing a subject from developing a disease or condition associated with insufficient apoptosis apoptosis, in particular when such a mammal is predisposed to the disease or condition, but it has not yet been diagnosed in this mammal; (ii) inhibiting a disease or condition associated with insufficient apoptosis, i.e. a halt to its development; or (iii) relieving a disease or condition associated with insufficient apoptosis, i.e. providing regression of this condition.

As used herein, the term “cancer treatment” means administering a pharmaceutical composition of the present invention to a subject, preferably a person affected by cancer, to cause cancer relief by killing, inhibiting the growth or inhibition of cancer cell metastases.

As used herein, the term “disease prevention” means, in the case of cancer, the administration after surgery, after chemotherapy or after radiotherapy of a pharmaceutical composition of the present invention to a subject, preferably a person affected by the cancer, to prevent the tumor from resuming growth by killing, inhibiting growth, or inhibition of metastases of the remaining cancer cells. Also included in this definition is the prevention of a prolonged condition that leads to diseases such as asthma, MS, etc.

As used herein, the term “apoptosis” or “programmed cell death” means a regulated cell death process, where a dying cell exhibits a series of clearly defined biochemical parameters that include the formation of vesicles in the cell membrane, wrinkling of the cell soma, chromatin condensation, and structural degradation DNA (stepwise), as well as any caspase-mediated cell death.

As used herein, the terms “BIR domain” or “BIR” are used interchangeably throughout this application and mean a domain that is characterized by several invariant amino acid residues, including conserved cysteines and one conserved histidine residue in the sequence Cys- (Xaa1) ₂ Cys - (Xaa1) ₁₆ His- (Xaa1) _6-8 CyS. A typical amino acid sequence of a consensus sequence is: Xaa1-Xaa1-Xaa1-Arg-Leu-Xaa1-Thr-Phe-Xaa1-Xaa1-Trp-Pro-Xaa2-Xaa1-Xaa1-Xaa2-Xaa2-Xaa1-Xaa1-Xaaa-Xaaa-Xaaa Leu-Ala-Xaa1-Ala-Gly-Phe-Tyr-Tyr-Xaa1-Gly-Xaa1-Xaa1-Asp-Xaa1-Val-Xaa1-Cys-Phe-Xaa1-Cys-Xaa1-Xaa1-Xaa1-Xaal-Xaal- Xaal-Trp-Xaal-Xaal-Xaal-Asp-Xaal-Xaal-Xaal-Xaal-Xaal-His-Xaa-1-Xaa1-Xaa1-Xaa1-Pro-Xaa1-Cys-Xaa1-Phe-Val, where Xaa1 is any amino acid and Xaa2 is any amino acid or is absent. Preferably, the sequence is substantially identical to one of the BIR domain sequences provided herein for XIAP, HIAP1 or HIAP2.

Residues of the BIR domain are listed below (see Genome Biology (2001) 1-10):

As used herein, the term “RING type zinc finger” or “RZF” means a domain having the amino acid sequence of a consensus sequence: Glu-Xaa1-Xaa1-Xaa1-Xaa1-Xaa1-Xaa-1-Xaa2-Xaa1-Xaa1- Xaa1-Cys-Lys-Xaa3-Cys-Met-Xaa1-Xaa1-Xaa1-Xaa1-Xaa1- Xaa3-X-aal-Phe-Xaal-Pro-Cys-Gly-His-Xaal-Xaal-Xaal-Cys-Xaal- Xaal-Cys-Ala-Xaa1-Xaa-1-Xaa1-Xaa1-Xaa1-Cys-Pro-Xaa1-Cys, where Xaa1 is any amino acid, Xaa2 is Glu or Asp, and Xaa3 is Val or Ile.

As used herein, the term “IAP” means a polypeptide or protein or fragment thereof encoded by the IAP gene. Examples of IAPs include, but are not limited to, human or mouse NAIP (Birc 1), HIAP-1 (cIAP2, Birc 3), HIAP-2 (cIAP1, Birc 2), XIAP (Birc 4), survivin (Birc 5), livin (ML-IAP, Birc 7), ILP-2 (Birc 8) and Apollon / BRUCE (Birc 6) (see, for example, U.S. Patent Nos. 6107041; 6133437; 6156535; 6541457; 6656704; 6689562; Deveraux and Reed, Genes Dev. 13, 239-252, 1999; Kasof and Gomes, J. Biol. Chem., 276, 3238-3246, 2001; Vucic et al., Curr. Biol. 10, 1359-1366, 2000; Ashab et al FEBS Lett., 495, 56-60, 2001, the contents of which are incorporated herein by reference).

As used herein, the term “IAP gene” means a gene encoding a polypeptide containing at least one BIR domain, and which is capable of modulating (inhibiting or enhancing) apoptosis in a cell or tissue. The IAP gene is a gene having about 50% or more nucleotide sequence identity with at least one of human or mouse NAIP (Birc 1), HIAP-1 (cIAP2, Birc 3), HIAP-2 (cIAP1, Birc 2 ), XIAP (Birc 4), survivin (Birc 5), livin (ML-IAP, Birc 7), ILP-2 (Birc 8) and Apollon / BRUCE (Birc 6). The region of the sequence by which the identity is determined is a region encoding at least one BIR domain and a RING-type zinc finger domain. Mammalian IAP genes include nucleotide sequences isolated from any mammalian source.

As used herein, the term “IC50” means the amount, concentration, or dose of a particular compound of the present invention at which 50% inhibition of a maximal response is achieved, such as a shift in maximal binding to a fluorescent probe in an assay that measures such a response.

As used herein, the term “EC50” means the amount, concentration or dose of a particular compound of the present invention at which 50% inhibition of cell survival is achieved.

As used herein, the term “modulate” or “modulate” means treating, preventing, suppressing, enhancing or inducing a function or condition using a compound of the present invention. For example, the compounds of the present invention can modulate IAP function in a subject, thereby enhancing apoptosis by substantially reducing or substantially eliminating the interaction of activated apoptotic proteins, such as caspase-3, 7 and 9, with mammalian IAP BIR domains or by inducing loss XIAP proteins in the cell.

As used herein, the term “increased apoptosis” means an increase in the number of cells where apoptosis occurs in a given cell population, either in vitro or in vivo. Examples of cell populations include, but are not limited to, ovarian cancer cells, colon cancer cells, breast cancer cells, lung cancer cells, pancreatic cancer cells or T cells, and the like. It should be understood that the degree of apoptosis enhancement provided by the apoptosis enhancing compound of the present invention in any particular assay will vary, but those skilled in the art can determine a statistically significant change in apoptosis level by identifying the compound that enhances apoptosis, otherwise limited by IAP. Preferably, “enhancing apoptosis” means that the increase in the number of cells undergoing apoptosis is at least 25%, more preferably the increase is 50%, and most preferably an increase of at least two. Preferably, the tracked sample is a sample of a cell that typically undergoes insufficient apoptosis (i.e., cancer cells). Methods for detecting changes in apoptosis level (i.e., enhancement or decrease) are described in the examples and include methods for quantifying DNA fragmentation, methods for quantifying translocation of phosphatoylserine from the cytoplasmic to the extracellular side of the membrane, determining caspase activation, and methods for quantifying cytochrome C excretion and inhibition factor apoptosis in the cytoplasm of mitochondria.

As used herein, the term "proliferative disease" or "proliferative disorder" means a disease that is caused (or leads to) abnormally high levels of cell division, abnormally low levels of apoptosis, or both. For example, cancer such as lymphoma, leukemia, melanoma, ovarian cancer, breast cancer, pancreatic cancer and lung cancer, and autoimmune disorders are all examples of proliferative diseases.

The compounds of the present invention or their pharmaceutically acceptable salts may contain one or more asymmetric centers, chiral axes and chiral planes, and thus the formation of enantiomers, diastereomers and other stereoisomeric forms that can be determined from the point of view of absolute stereochemistry, for example, as (R) - or (S) - or as (D) - or (L) - for amino acids. The present invention provides for the inclusion of all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-), (R) - and (S) - or (D) - and (L) -isomers can be obtained using chiral synthons or chiral reagents or by separation using conventional methods such as reverse phase HPLC. You can get racemic mixtures and then divide them into individual optical isomers, or these optical isomers can be obtained by chiral synthesis. Enantiomers can be resolved by methods known to those skilled in the art, for example, by forming diastereoisomeric salts, which can then be resolved by crystallization, gas-liquid or liquid chromatography, and the selective interaction of one enantiomer with an enantiomer-specific reagent. Specialists in this field should also be clear that when the desired enantiomer is converted to another chemical structural unit by the separation method, in this case an additional step will be required to form the desired enantiomeric form. Alternatively, specific enantiomers can be synthesized by asymmetric synthesis using optically active reagents, substrates, catalysts or solvents, or by converting one enantiomer to another by asymmetric conversion.

Some compounds of the present invention may exist in zwitterionic form, and the present invention includes zwitterionic forms of such compounds and mixtures thereof.

Applications

The compounds of the present invention are useful as compounds that bind to the IAP BIR domain, and as such, the compounds, compositions and method of the present invention include use for cells or subjects affected or predisposed to develop a particular disease state that is characterized by insufficient apoptosis. Thus, the compounds, compositions and methods of the present invention are used to treat cell proliferative diseases / disorders that include, but are not limited to, i) cancer, ii) an autoimmune disease, iii) inflammatory disorders, iv) proliferation induced after medical procedures including, but not limited to, surgery, angioplasty, etc.

The compounds of the present invention may also be useful as antiulcer agents. Down regulation of the TRAIL (TNF-alpha-linked apoptosis-inducing ligand) system in the context of H. pylori infection may limit enhanced apoptosis of gastric epithelial cells and tissue destruction and therefore may allow H. pylori to retain its niche, thus, the compounds of the present invention may be useful in treating a bacterial infection and / or a recurring infection that may develop as a result of down regulation of the TRAIL system (see Nou et al. J. Infectious Diseases (2005) 571-8).

The compounds of the present invention may also be useful for the treatment of primary varicose veins. Evidence suggests (see Ducass et al. Eur. J. Vase. Endovac. Surg (2005) 316-323) that veins affected by primary varicose veins are associated with inhibition of programmed cell death where a defect occurs in the characteristic apoptotic pathway. Thus, the BIR domain-binding compounds of the present invention may be useful for the treatment of this pathology.

The compounds of the present invention may also be useful in the treatment of diseases in which there is a defect in programmed cell death or apoptotic mechanism (TRAIL, FAS, apoptosome), such as multiple sclerosis, asthma, atherosclerosis, inflammation, autoimmune reaction, and the like.

Treatment includes administering to a subject in need thereof a compound of the present invention, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a pharmaceutical carrier and a therapeutically effective amount of a compound of the present invention or a pharmaceutically acceptable salt thereof. In particular, the compounds, compositions and methods of the present invention are useful for treating cancer, including solid tumors, such as carcinomas of the skin, breast, brain, lung, male sex glands, and the like. The types of cancer that can be treated with the compounds, compositions and methods of the present invention include, but are not limited to, the following:

the cloth Example Adrenal glands neuroblastoma Bone osteogenic sarcoma (osteosarcoma), fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma, Evang's sarcoma, malignant lymphoma (reticulo-cell sarcoma), multiple myeloma, malignant giant cell chordoma, osteochronoma fibroma, benignochromic fibroma, benignochromic fibroma, benignochromic fibroids, benign chromophrenic fibroids, benign chromophrenic fibroids, benign fibroids, bone marrow fibroma and giant cell tumors Heart sarcoma (angiosarcoma, fibrosarcoma, rhabdomyosarcoma, liposarcoma), myxoma, rhabdomyoma, fibroma, lipoma and teratoma Gastrointestinal tract esophagus (squamous cell carcinoma, adenocarcinoma, leiomyosarcoma, lymphoma), stomach (carcinoma, lymphoma, leiomyosarcoma), pancreas (ductal adenocarcinoma, insulinoma, glucagonoma, carcinoma, carcinoma, carcinoma) , Kaposi’s sarcoma, leiomyoma, hemangioma, lipoma, neurofibroma, fibroma), large intestine (adenocarcinoma, tubular adenoma, villous adenoma, hamartoma, leiomyoma) Genitourinary tract kidney (adenocarcinoma, Wilms tumor (nephroblastoma), lymphoma, leukemia), bladder and urethra (squamous cell carcinoma, transient cell carcinoma, adenocarcinoma), prostate gland (adenocarcinoma, sarcoma), testicles (carcinoma, embolism, tera teratocarcinoma, choriocarcinoma, sarcoma, interstitial cell carcinoma, fibroma, fibroadenoma, adenomatoid tumors, lipoma) Gynecology uterus (endometrial carcinoma), cervix (cervical carcinoma, precancerous cervical dysplasia), ovaries (ovarian carcinoma (serous cystadenocarcinoma, mucinous cystadenocarcinoma, unclassified carcinoma, cellulose-cell-cell-cell ), vulva (squamous cell carcinoma, intraepithelial carcinoma, adenocarcinoma, fibrosarcoma, melanoma), vagina (parenchymal cell carcinoma, squamous cell carcinoma, botrioid Single sarcoma (embryonal rhabdomyosarcoma). fallopian tubes (carcinoma) Hematology blood (myeloid leukemia (acute and chronic), acute lymphoblastic leukemia, chronic lymphocytic leukemia, myeloproliferative diseases, multiple myeloma, myelodysplastic syndrome), Hodgkin's disease, non-Hodgkin's lymphoma (malignant lymphoma) Liver hepatoma (hepatocellular carcinoma), cholangiocarcinoma, hepatoblastoma, angiosarcoma, hepatocellular adenoma, hemangioma Lungs bronchogenic carcinoma (squamous cell, undifferentiated small cell, undifferentiated large cell, adenocarcinoma), alveolar (bronchiolar) carcinoma, bronchial adenoma, sarcoma, lymphoma, chondromatous hamartoma, mesothelioma Nervous system skull (osteoma, hemangioma, granuloma, xanthoma, deforming osteosis), meninges (meningioma, meningiosarcoma, gliomatosis), brain (astrocytoma, meduloblastoma, glioma, ependymoma, germinoma (pinealoma), glioblastoma multiforme, oligode tumors), spinal cord neurofibroma, meningioma, glioma, sarcoma) Leather malignant melanoma, basal cell carcinoma, squamous cell carcinoma, Kaposi’s sarcoma, nevoid tumors, lipoma, angioma, dermatofibroma, keloids

The compounds of the present invention, or their pharmaceutically acceptable salts, or their prodrugs can be administered in pure form or in a suitable pharmaceutical composition, and this can be done by any method customary in galenic pharmaceutical practice.

The pharmaceutical compositions of the present invention can be obtained by mixing the compounds of the present invention with a suitable pharmaceutically acceptable carrier, diluent or excipient, and they can be formulated in solid, semi-solid, liquid or gaseous forms, such as tablets, capsules, powders, granules, ointments , solutions, suppositories, injectables, inhalants, gels, microspheres and aerosols. Typical routes of administration of such pharmaceutical compositions include, but are not limited to, oral, topical, transdermal, administration by inhalation, parenteral (subcutaneous injection, intravenous, intramuscular, intrastermal or infusion), sublingual, ophthalmic, rectal, vaginal and intranasal. The pharmaceutical compositions of the present invention are formulated in such a way as to provide bioavailability of the active ingredients contained therein when the composition is administered to a subject. Compositions for administration to a subject or patient are in the form of one or more dosage units, where, for example, a tablet may be a single dosage unit, and a container with a compound of the present invention in the form of an aerosol may contain multiple dosage units. Practical methods for preparing such dosage forms are known or should be apparent to those skilled in the art; for example, see Remington's Pharmaceutical Sciences, 18th Ed., (Mack Publishing Company, Easton, Pa., 1990). The composition for administration in any case should contain a therapeutically effective amount of a compound of the present invention or a pharmaceutically acceptable salt thereof for treating a disease condition described above.

The pharmaceutical composition of the present invention may be in solid or liquid form. In one aspect, the carrier (s) are small particles, thus the compositions are in the form of, for example, tablets or powder. The carrier (s) may be liquid, then the compositions are, for example, oral syrup, liquid for injection or aerosol, which is useful, for example, for administration by inhalation.

For oral administration, the pharmaceutical composition is preferably in either solid or liquid form, where semi-solid, semi-liquid forms, suspension and gel are included in the forms considered in this application as either solid or liquid.

As a solid composition for oral administration, the pharmaceutical composition can be formulated to provide a powder, granules, compressed tablets, pills, capsules, chewing gum, cachet, or the like. Such a solid composition typically contains one or more inert diluents or carriers, which are food substances. In addition, one or more of the following substances may be present: binders such as carboxymethyl cellulose, ethyl cellulose, microcrystalline cellulose, tragacanth gum or gelatin; excipients such as starch, lactose or dextrins, disintegrants such as alginic acid, sodium alginate, Primogel, corn starch and the like; lubricants such as magnesium stearate or Sterotex; glidants such as colloidal silicon dioxide; sweeteners such as sucrose or saccharin; a fragrance such as peppermint, methyl salicylate or an orange flavor; and dye.

When the pharmaceutical composition is in the form of a capsule, for example a gelatin capsule, it may contain, in addition to substances of the above type, a liquid carrier, such as polyethylene glycol or oil, such as soybean or vegetable oil.

The pharmaceutical composition may be in the form of a liquid, for example, an elixir, syrup, solution, emulsion or suspension. The liquid may be a liquid for oral administration or for delivery by injection, as two examples. When oral administration is contemplated, the preferred composition contains, in addition to the compounds of the present invention, one or more substances selected from their sweetener, preservatives, colorant / colorant and intensifier of taste and aroma. One or more substances selected from their surfactant, preservative, wetting agent, dispersing agent, suspending agent, buffer, stabilizer and isotonicity agent may be included in a composition intended for administration by injection.

The liquid pharmaceutical compositions of the present invention, whether in the form of solutions, suspensions or other similar form, may include one or more of the following adjuvants: sterile diluents, such as water for injection, saline, preferably physiological saline, Ringer's solution, isotopic sodium chloride solution, fixed oils, such as synthetic mono- or diglycerides, which can serve as a solvent or suspension medium, polyethylene nglycols, glycerin, propylene glycol or other solvents; antibacterial agents such as benzyl alcohol or methyl paraben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates, and isotonicity agents such as sodium chloride or dextrose. Solubilizing agents may include cyclodextrins, such as hydroxypropyl beta-cyclodextrin. The parenteral preparation may be enclosed in ampoules, disposable syringes or multi-dose vials of glass or plastic. The pharmaceutical composition for injection is preferably sterile.

The liquid pharmaceutical composition of the present invention, used either for parenteral or oral administration, should contain such an amount of the compound of the present invention so that a suitable dose can be obtained. Typically, this amount is at least 0.01% of the compound of the present invention in the composition. When the composition is intended for oral administration, this amount can vary from 0.1 to about 70% based on the weight of the composition. For parenteral use, the compositions and preparations of the present invention are prepared in such a way that the parenteral unit dose contains from 0.01 to 1% wt. compounds of the present invention.

The pharmaceutical composition of the present invention can be used for topical administration, in which case it is suitable when the carrier may include a solution, emulsion, ointment or gel base. A base, for example, may include one or more of the following: petrolatum, lanolin, polyethylene glycols, beeswax, mineral oil, diluents such as water and alcohol, and emulsifiers and stabilizers. Thickeners may be present in the pharmaceutical composition for topical administration. If the composition is intended for transdermal administration, it may include a transdermal patch or device for iontophoresis. Compositions for topical administration may have a concentration of a compound of the present invention from about 0.1 to about 10% w / v. (mass per unit volume).

The pharmaceutical composition of the present invention can be used for rectal administration for the treatment of, for example, colon cancer in the form of, for example, a suppository that will melt in the rectum and release the drug. The composition for rectal administration may contain an oil base as a suitable non-irritant excipient. Such bases include, but are not limited to, lanolin, cocoa butter, and polyethylene glycol.

The pharmaceutical composition of the present invention may include various substances that modify the physical form of a solid or liquid dosage form. For example, the composition may include substances that form a coating around the active ingredients. The substances that form the coating shell are typically inert and can be selected, for example, from sugar, shellac and other substances used for enteric coatings. Alternatively, the active ingredients may be enclosed in a gelatin capsule.

The pharmaceutical composition of the present invention in solid or liquid form may include a substance that binds to the compound of the present invention and thus facilitates the delivery of the compound. Suitable substances that can act in this way include, but are not limited to, a monoclonal or polyclonal antibody, protein, or liposome.

The pharmaceutical composition of the present invention may consist of unit doses that can be administered as an aerosol. The term aerosol means a variety of systems from colloidal in nature to systems consisting of pressurized packages. Delivery may be via liquefied or pressurized gas or through a suitable injection system that dispenses the active ingredients. Aerosol delivery of the compounds of the present invention can be carried out in single-phase, biphasic or three-phase systems for delivery of the active ingredient (s). Aerosol delivery includes the necessary container, activators, valves, subcontainers, etc., which together can make up the kit. One of skill in the art can determine the preferred aerosols without undue experimentation.

The pharmaceutical compositions of the present invention can be obtained in accordance with methods well known in the pharmaceutical field. For example, a pharmaceutical composition for administration by injection can be prepared by mixing a compound of the present invention with sterile, distilled water to form a solution. You can add a surfactant that promotes the formation of a homogeneous solution or suspension. Surfactants are compounds that non-covalently interact with a compound of the present invention, facilitating dissolution or homogeneous suspension of the compound in an aqueous delivery system.

The compounds of the present invention or their pharmaceutically acceptable salts are administered in a therapeutically effective amount, which varies depending on various factors, including the activity of the particular compound used; metabolic stability and duration of action of the compound; age, body weight, general health, gender and diet of the patient; method and time of administration; the rate of excretion of the drug from the body; drug combination; the severity of a particular disorder or condition; and the specific subject taking the treatment. Typically, a therapeutically effective daily dose may be from about 0.1 mg to about 40 mg / kg body weight per day or twice daily of a compound of the present invention or a pharmaceutically acceptable salt thereof.

Combination therapy

The compounds of the present invention or their pharmaceutically acceptable salts can also be administered simultaneously with, before or after the administration of one or more of the therapeutic agents described below. Thus, combination therapy may include administering one pharmaceutical dose of a composition that contains a compound of the present invention and one or more additional agents indicated below, as well as administering a compound of the present invention and each of the additional agents in its own separate dosage pharmaceutical composition. For example, the compound of the present invention and another therapeutic agent can be administered to a patient either together in a single oral dosage composition, such as a tablet or capsule, or each agent can be administered in a separate oral dosage composition or via intravenous injection. When using separate dosage compositions, the compounds of the present invention and one or more additional agents can be administered essentially at the same time, i.e. simultaneously, or separately with certain time intervals, i.e. sequentially; it should be understood that combination therapy includes all such regimens.

Thus, the present invention also encompasses the use of the compounds of the present invention in combination with radiation therapy or with one or more additional agents, such as those described in WO 03/099211 (PCT / US03 / 15861), which is incorporated herein by reference.

Examples of such additional therapeutic agents include, but are not limited to, the following:

a) an estrogen receptor modulator,

b) an androgen receptor modulator,

c) a retinoid receptor modulator,

d) a cytotoxic agent

e) an antiproliferative agent,

f) a prenyl protein transferase inhibitor,

g) an inhibitor of HMG-CoA reductase,

h) an HIV protease inhibitor,

i) a reverse transcriptase inhibitor,

k) an angiogenesis inhibitor,

l) a PPAR-.γ agonist,

m) PPAR-.δ. agonist,

n) an inhibitor of characteristic multidrug resistance,

o) an antiemetic,

p) an agent useful in treating anemia,

q) agents useful in the treatment of neutropenia,

r) a means to enhance immunity,

s) a proteasome inhibitor such as Velcade and MG132 (7-Leu-Leu-aldehyde) (see He at al. in Oncogene (2004) 23, 2554-2558);

t) an HDAC inhibitor such as sodium butyrate, phenyl butyrate, hydroamino acids, cyclintetrapeptide and the like. (see Rosato et al. Molecular Cancer Therapeutics 2003, 1273-1284);

u) an inhibitor of chemotrypsin-like activity in the proteasome; and

v) E3 ligase inhibitors.

More specifically, the compounds of the present invention can also be used in combination with one or more chemotherapeutic agents that breaks or stabilizes microtubules, is particularly effective for the treatment of cancer and other neoplasms. Microtubule-disrupting agents (e.g., vinca alkaloids) and microtubule-stabilizing agents (e.g., taxanes) are described in more detail below.

Vinca alkaloids and related compounds

Vinca alkaloids that can be used in combination with the nucleobase oligomers of the present invention for the treatment of cancer and other neoplasms include vincristine, vinblastine, vindesine, vinflunine, vinorelbine and anhydrovinblastine.

Dolastatins are oligopeptides that predominantly interfere with tubulin on the binding domain of vinca alkaloid. These compounds can also be used in combination with the compounds of the present invention for the treatment of cancer and other neoplasms. Dolastatins include dolastatin-10 (NCS 376128), dolastatin-15, ILX651, TZT-1027, simplostatin 1, simplostatin 3 and LU 103793 (cemadotine).

Cryptophycins (e.g., cryptophycin 1 and cryptophycin 52 (LY355703)) bind tubulin in the binding domain of periwinkle alkaloid and induce G2 / M blocking and apoptosis. Each of these compounds can be used in combination with the compounds of the present invention for the treatment of cancer and other neoplasms.

Other microtubule-breaking compounds that can be used in combination with the compounds of the present invention for the treatment of cancer and other neoplasms are described in US Pat. Nos. 6,458,765; 6,433,187; 6323315; 6,258,841; 6143721; 6,127,377; 6103698; 6,023,626; 5,985,837; 5,965,537; 5,955,423; 5952298; 5,939,527; 5,886,025; 5,831,002; 5,741,892; 5,665,860; 5,653,399; 5,635,483; 5,599,902; 5530097; 5,521,284; 5,504,191; 4,879,278 and 4,816,444 and published US patent applications No. 2003/0153505 A1; 2003/0083263 A1 and 2003/0055002 A1, each of which is incorporated into this application by reference.

Taxanes and other microtubule stabilizing compounds

Taxanes, such as paclitaxel, docetaxel, RPR 109881 A, SB-T-1213, SB-T-1250, SB-T-101187, BMS-275183, BRT 216, DJ-927, MAC-321, IDN5109 and IDN5390, can use in combination with the compounds of the present invention for the treatment of cancer and other neoplasms. Taxane analogues (e.g., BMS-184476, BMS-188797) and functionally related non-taxanes (e.g., epothilones (e.g., epothilone A, epothilone B (EPO906), deoxyepotilone B and epothilone B lactam (BMS-247550)), eleutherobin, discodermolide, 2-epi-discodermolid, 2-desmethyl discodermolide, 5-hydroxymethyl discodermolide, 19-des-aminocarbonyl discodermolide, 9 (13) cyclo-discodermolide and laulimalide) can also be used in the methods and compositions of the present invention.

Other microtubule stabilizing compounds that can be used in combination with the compounds of the present invention for the treatment of cancer and other neoplasms are described in US Pat. Nos. 6,624,317; 6,610,736; 6605599; 6,589,968; 6,583,290; 6,576,658; 6,515,017; 6,531,497; 6,500,858; 6,498,257; 6,495,594; 6,489,314; 6,458,976; 6,441,186; 6,410,025; 6,414,015; 6387927; 6,380,395; 6,380,394; 6,362,217; 6359140; 6306893; 6302838; 6,300,355; 6291690; 6291684; 6,268,381; 6,262,107; 6,262,094; 6,147,234; 6,136,808; 6,127,406; 6,100,411; 6,096,909; 6025385; 6011056; 5,965,718; 5,955,489; 5,919,815; 5,912,263; 5,840,750; 5,821,263; 5,767,297; 5,728,725; 5,721,268; 5,719,177; 5,714,513; 5,587,489; 5,473,057; 5,407,674; 5,250,722; 5010099 and 4939168 and published US patent applications No. 2003/0186965 A1; 2003/0176710 A1; 2003/0176473 A1; 2003/0144523 A1; 2003/0134883 A1; 2003/0087888 A1; 2003/0060623 A1; 2003/0045711 A1; 2003/0023082 A1; 2002/0198256 A1; 2002/0193361 A1; 2002/0188014 A1; 2002/0165257 A1; 2002/0156110 A1; 2002/0128471 A1; 2002/0045609 A1; 2002/0022651 A1; 2002/0016356 A1; 2002/0002292 A1, each of which is incorporated into this application by reference.

Other chemotherapeutic agents that can be administered with the compound of the present invention are listed in the Table below:

Other means SR-27897 (CCK A inhibitor, Sanofi-Synthelabo) BCX-1777 (PNP inhibitor, BioCryst) tocladesin (cyclic AMP agonist, Ribapharm) ranprimase (ribonuclease stimulator, Alfacell) alvocib (CDK inhibitor, Aventis) galarubicin (RNA synthesis inhibitor, D -A) CV-247 (COX-2 inhibitor, Ivy Medical) tirapazamine (reducing agent, SRI International) P54 (COX-2 inhibitor, Phytopharm) N-acetylcysteine (reducing agent, Zambon) CapCell ™ (CYP450 stimulator, Bavarian Nordic) R- flurbiprofen (NF-kappaB inhibitor, Encore) GCS-100 (gal3 antagonist, GlycoGenesys) 3CPA (NF-kappaB inhibitor, Active Biotech) G17DT immunogen (gastrin inhibitor, Aphton) seocalcitol (vitamin D receptor agonist, Leo) e faproxiral (oxidizing agent, Allos Therapeutics) 131-I-TM-601 (DNA antagonist, TransMolecular) PI-88 (heparanase inhibitor, Progen) Eflornithine (ODC inhibitor, ILEX Oncology) tesmilifen (histamine antagonist, YM BioSciences) minodronic acid inhibitor ( , Yamanouchi) histamine (H2 receptor agonist, Maxim) indisulam (p53 stimulator, Eisai) thiazofurin (IMPDH inhibitor, Ribapharm) aplidine (PPT inhibitor, PharmaMar) cilengitide (integrin antagonist, Merck KGaA) rituximab (CD47 antibody), antibody 4720, (antagonist of IL-1, Sanofi-Synthelabo) gemtuzumab (CD33 antibody, Wyeth Ayerst) CCI-779 (mTOR kinase inhibitor, Wyeth) PG2 (hematopoiesis enhancer, Pharmagenesis) exisulind (PDE V inhibitor, Cell Pathways) Immunol ^TM (triclosan-based mouthwash, Endo) CP-461 (PDE V inhibitor, Cell Pathways) triacetyluridine (uridine prodrug, Wellstat) AG-2037 (GART inhibitor, Pfizer) SN-4071 (anti-sarcoma, Signature BioScience) WX-UK1 (plasminogen activation inhibitor, Wilex) TransMID-107.TM . (immunotoxin, KS Biomedix) PBI-1402 (PMN stimulator, ProMetic LifeSciences) PCK-3145 (apoptosis promoter, Procyon) bortezomib (proteasome inhibitor, Millennium) doranidazole (apoptosis promoter, Pola) SRL-172 (T-cell stimulator, SR Pharma ) CHS-828 (cytotoxic agent, Leo) TLK-286 (glutathione S transferase inhibitor, Telik) trans-retinoic acid (differentiator, NIH) PT-100 (growth factor agonist, Point Therapeutics) MX6 (apoptosis promoter, MAXIA) midostaurine ( PKC inhibitor, Novartis) apomin (apoptosis promoter, ILEX Oncology) bryostatin-1 (PKC stimulator, GPC Biotech) urocidine (apoptosis promoter, Bioniche) CDA-II (apoptosis promoter, Everlife) Ro-31 -7453 (apoptosis promoter, LaRoche) SDX-101 (apoptosis promoter, Salmedix) brostallicin (apoptosis promoter, Pharmacia) ceflatonin (apoptosis promoter, ChemGenex)

Additional combinations may also include agents that reduce the toxicity of the above agents, such as hepatotoxicity, neuronal toxicity, nephrotoxicity, and the like.

Moreover, based on the in vitro results obtained by the present inventors, it can be assumed that the compounds of the present invention may work well with TRAIL. In one example, co-administration of one of the compounds of Formula I of the present invention with an apoptosis receptor agonist such as TRAIL, such as a small molecule or an antibody that mimics TRAIL, can be advantageous by providing a synergistic effect with a 2-3-fold increase in activity. Moreover, the compounds of the present invention can be used in combination with any compounds that cause increased levels of TRAIL circulation.

Screening tests

The compounds of the present invention can also be used in the selection method of other compounds that bind to the IAP BIR domain. In general, to use a compound of the present invention in a method for identifying compounds that bind to the IAP BIR domain, IAP binds to a carrier and the compound of the present invention is added to the sample to be analyzed. Alternatively, the compound of the present invention can be coupled to a carrier and IAP is added.

There are many methods for determining the binding of a compound of the present invention to a BIR domain. In one method, the compound of the present invention, for example, can be fluorescently or radioactively labeled, and binding is determined directly. For example, this can be accomplished by attaching the IAP to a solid support, adding a detectably labeled compound of the present invention, washing out the excess reagent, and determining if the amount of detectable label is that which is present on the solid support. You can use various stages of blocking and washing, which are known to specialists in this field.

In some cases, only one of the components is labeled. For example, specific residues in the BIR domain may be labeled. Alternatively, more than one component may be labeled with different labels; for example, using I ¹²⁵ for the BIR domain and the fluorescent label for the probe.

The compounds of the present invention can also be used as competitors for screening for additional candidate drugs or test compounds. As used herein, the terms “candidate drug” or “test compounds” are used interchangeably and mean any molecule, such as a protein, oligopeptide, small organic molecule, polysaccharide, polynucleotide, etc., for a bioactivity test. Compounds may have the ability to directly or indirectly alter the biological activity of IAP.

Candidate drugs may include various chemical classes, although typically they are small organic molecules having a molecular weight of more than 100 and less than about 2500 daltons. Candidate agents typically include functional groups necessary for sutural interaction with proteins, such as hydrogen bonding and lipophilic bonding, and typically include at least an amine, carbonyl, hydroxyl, ether or carboxyl group. Candidate drugs often include cyclic carbon or heterocyclic structures and / or aromatic or polyaromatic structures substituted with one or more functional groups.

Candidate medicines can be obtained from any number of sources, including libraries of synthetic or natural compounds. For example, various agents are available for the arbitrary and direct synthesis of a wide range of organic compounds and biomolecules, including the expression of randomized oligonucleotides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or can be easily obtained. In addition, natural or synthetically obtained libraries and compounds can be easily modified with traditional chemical, physical and biochemical means.

Competitive screening assays can be performed by combining the IAP BIR domain and the probe to form a probe: BIR domain complex in the first sample, followed by the addition of the test compound from the second sample. In this assay, binding of a test compound is determined, and a change or difference in binding between the two samples indicates the presence of a test compound capable of binding to the BIR domain and the potential modulation of IAP activity.

In one case, the binding of a test compound is determined using competitive binding assays. In this embodiment, the probe is labeled with an affinity tag, such as biotin. In some circumstances, there may be competitive binding between the test compound and the probe, where the probe displaces the candidate agent.

In one case, the test compound may be labeled. Either the test compound or the compound of the present invention, or both are added first to the IAP BIR domain for a time sufficient to allow binding to form a complex.

For the formation of the probe: BIR domain complex, typically incubation is required at temperatures ranging from 4ºC and 40ºC for a period of time from 10 minutes to about 1 hour, which makes it possible to carry out high-throughput screening. Any excess reagents are usually removed or washed. The test compound is then added and the presence or absence of the labeled component is monitored, which is indicative of binding to the BIR domain.

In one case, the probe is added first and then the test compound. Probe displacement is an indication that the test compound binds to the BIR domain and is thus capable of binding and potentially modulating IAP activity. Any component can be labeled. For example, the presence of the probe in the wash solution indicates the displacement of the probe by the test compound. Alternatively, if the test compound is labeled, the presence of the probe on the carrier indicates displacement.

In one case, you can first add the test compound, with incubation and washing, followed by the addition of a probe. The lack of binding to the probe may indicate that the test compound binds to the BIR domain with high affinity. So, if the probe is detected on a carrier, in combination with the lack of binding of the test compound, this may indicate that the test compound is capable of binding to the BIR domain.

Modulation is tested by screening for the ability of the test compound to modulate IAP activity, and this method involves combining the test compound with the IAP BIR domain as described above and determining the change in the biological activity of the IAP. Therefore, in this case, the test compound should bind to the BIR domain (although this may not be necessary), as well as change its biological activity described in this application.

In analyzes, positive controls and negative controls can be used. All control and test samples are analyzed several times to obtain statistically significant results. After incubation, all samples are washed to remove non-specifically bound substances from them and the amount of bound probe is determined. For example, when using a RFID tag, samples are read in a scintillation counter to determine the amount of bound compound.

Typically, the signals that are detected in this analysis may include fluorescence, transmission of resonance energy, time-divided fluorescence, radioactivity, fluorescence polarization, plasma resonance or chemiluminescence, and the like. depending on the nature of the label. Detectable labels useful for screening assays of the present invention include a fluorescent label such as fluorescein, Oregon green, dansil, rhodamine, tetramethylrodamine, Texas red, Eu ³⁺ ; a chemiluminescent label such as luciferase; colorimetric labels; enzymatic markers; or radioisotopes such as tritium, I ¹²⁵ and the like.

This application discloses the use of two fluorescently labeled BIR-binding compounds, which can serve as probes in the analysis of fluorescence polarization described below.

Affinity tags that may be useful for screening assays of the present invention include biotin, polyhistidine, and the like.

Synthesis and Methods

General methods for the synthesis of compounds of the present invention are presented below and are disclosed for illustrative purposes only and should not be construed as limiting the methods for preparing compounds by any other methods. Those skilled in the art will appreciate that a large number of methods are available for preparing the compounds of the present invention.

General procedures

Schemes 1, 2, 3, 4, 5, and 6 illustrate general synthesis procedures for preparing the compounds of the present invention.

Scheme 1 illustrates the general procedures for the preparation of intermediates of the general Formula 1-v. Intermediate 1-ii was obtained by a sequence of reductive amination procedures. Thus, the compound of general Formula 1-i was treated with amine R ⁶ NH ₂ , followed by reduction with a suitable hydride to give intermediate 1-ii. Protection of compound 1-ii with a protecting group PG ⁵ followed by removal of the protecting group PG ¹ gives intermediate 1-iii. PG ² (H) N (R ³ ) CHCO ₂ H is coupled to 1-iii using amino acid binders, followed by deprotection of PG ² to give intermediate 1-iv. Similarly, PG ³ (R ¹ ) N (R ² ) CHCO ₂ H is coupled to 1-iv using amino acid binders, followed by deprotection of PG ⁵ to give intermediate 1-v.

Scheme 2 illustrates general procedures for preparing bis-amide bridged compounds of the present invention. Treatment of intermediate 1-v with 0.5 equivalents of LG-C (O) -LC (O) -LG and deprotection of PG ³ affords compound 2-i.

Scheme 3 illustrates general procedures for preparing bis-sulfonyl bridged compounds of the present invention. Treatment of intermediate 1-v with 0.5 equivalents of LG-S (O) ₂ -LS (O) ₂ -LG and deprotection of PG ³ gives compound 3-i.

Scheme 4 illustrates general procedures for preparing alkyl bridged compounds of the present invention. Treatment of intermediate 1-v with 0.5 equivalents of LG-L-LG and deprotection of PG ³ gives compound 4-i.

Scheme 5 illustrates the use of functionalized amino acids as bridging groups.

PG ⁴ (H) N (R ⁸ ) CHCO ₂ H is coupled to 1-v using amino acid binders, followed by deprotection of PG ⁴ , which provides intermediate 4-i. Treatment of 4-i with LG-Z-LG followed by deprotection of PG ³ gives compound 5-ii.

Similar bridging strategies can be used to prepare Formula I compounds from intermediates I-ia and I-ib.

Scheme 6 illustrates the general procedures for preparing bridged compounds of the general Formula 6-v. Intermediate 6-i is prepared using a sequence of reductive amination procedures. Bis-aldehyde is treated with amine R ⁶ NH ₂ , followed by reduction using a suitable hydride to give intermediate 6-i. The compound of general Formula 6-ii is coupled to compound 6-i using amino acid binders, followed by deprotection of PG ¹ to give intermediate 6-iii. PG ² (H) N (R ³ ) CHCO ₂ H is coupled to compound 6-iii using amino acid binders, followed by removal of the protecting group PG ² to give intermediate 6-iv. Similarly, PG ³ (R ¹ ) N (R ² ) CHCO ₂ H is coupled to compound 6-iv using amino acid binders, followed by deprotection of PG ⁵ to give compound 6-v.

The above schemes are also applicable in cases where R ³ and R ^{4 are} combined to form a heterocyclic ring system and R ¹ , R ² , W, R ⁵ , R ^5a , X, L, and the like. have the meanings defined in this application. LG is a leaving group, such as, for example, Cl, Br, I, OTs or OMs.

EXAMPLES

The following abbreviations are used in the present description:

Boc: tert-butoxycarbonyl;

CBz: benzyloxycarbonyl;

DCM: dichloromethane, CH ₂ Cl ₂ ;

DIPEA: diisopropylethylamine;

DMAP: 4- (dimethylamino) pyridine;

DMF: N, N-dimethylformamide;

DTT: dithiothreitol;

EDC: 3- (dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride;

EDTA: ethylenediaminetetraacetic acid;

Fmoc: N- (9-fluorenylmethoxycarbonyl);

HBTU: O- (benzotriazol-1-yl) -N, N, N ', N'-tetramethyluronium hexafluorophosphate;

HCl: hydrochloric acid;

HOAc: acetic acid;

HOBt: 1-hydroxybenzotriazole;

HPLC: high performance liquid chromatography;

LCMS: liquid chromatography - mass spectrometry;

MeOH: methanol;

MgSO ₄ : magnesium sulfate;

MS: mass spectrum;

Ms: methanesulfonyl;

NaHCO ₃ : sodium bicarbonate;

Pd / C: palladium on carbon;

TEA: triethylamine;

TFA: trifluoroacetic acid;

THF: tetrahydrofuran;

TMEDA: N, N, N, N-tetramethylethylenediamine;

Ts: para-toluenesulfonyl.

Synthesis Methods

Obtaining representative examples:

The preparation of intermediate 7-7 is illustrated in Scheme 7. The conversion of intermediate 7-7 to compounds 1, 13, 20, and 23 is summarized in schemes 8, 9, 10, and 11.

Compound 7-7 was obtained by a method similar to that described in co-owned US patent application No. 11/434166. The reductive amination of the Boc proline using phenethylamine and Na (AcO) ₃ BH afforded intermediate 7-1, which was then acylated using benzyl chloroformate and the Boc protecting group was removed using 4 N a solution of HCl in 1,4-dioxane to give intermediate 7-3 · HCl. Activation of the carboxyl group of Boc-L-Tle-Gly-OH by treatment with HBTU, HOBt and DIPEA amide binders in a DMF solvent followed by the addition of 7-3 · Cl gave intermediate 7-4. Removal of the Boc protecting group using 4 n. a solution of HCl in 1,4-dioxane gave 7-5 · ΗCl. Activation of the carboxyl group of Boc-NMe-Ala-OH by treatment with HBTU, HOBt and DIPEA amide binders in a DMF solvent followed by the addition of 7-5 · HCl gave intermediate 7-6. Removal of the Cbz protecting group using Pd / C under a hydrogen atmosphere in MeOH afforded compound 7-7.

Treatment of a solution of compound 7-7 with terephthaloyl chloride and TEA in THF afforded intermediate 8-1. Removal of the Boc protecting group of intermediate 8-1 using 4 N a solution of HCl in 1,4-dioxane gave compound 1 in the form of its bis-hydrochloride salt.

Treatment of a solution of compound 7-7 with 4,4'-biphenyldisulfonyl chloride and TEA in THF afforded intermediate 9-1. Deprotection of Boc in Intermediate 9-1 Using 4 N a solution of HCl in 1,4-dioxane gave compound 13 in the form of its bis-hydrochloride salt.

Treatment of a solution of compound 7-7 with 1,4-phenylenediisocyanate in CH ₂ Cl ₂ gave intermediate 10-1. Removal of the Boc protecting group of intermediate 9-1 using 50% TFA in DCM afforded compound 20 in the form of its bis-TFA salt.

Treatment of a solution of compound 7-7 with α, α'-dibromo-p-xylene and TEA in DMF gave intermediate 11-1. Deprotection of Boc in Intermediate 11-1 Using 4 N a solution of HCl in 1,4-dioxane gave compound 23 in the form of its bis-hydrochloride salt.

The preparation of intermediate 12-2 is illustrated in Scheme 12. The conversion of intermediate 12-2 to compounds 35, 87 and 104 is summarized in schemes 13, 14 and 15.

Activation of the carboxyl group of Cbz-Gly-OH by treatment with HBTU and DIPEA with amide binders in a DMF solvent followed by the addition of compound 7-7 gave intermediate 12-1. Removal of the Cbz protecting group using Pd / C under a hydrogen atmosphere in MeOH afforded intermediate 12-2.

Treatment of a solution of compound 12-2 with terephthaloyl chloride and TEA in CH ₂ Cl ₂ gave intermediate 13-1. Deprotection of Boc in Intermediate 13-1 Using 4 N a solution of HCl in 1,4-dioxane gave compound 91 in the form of its bis-hydrochloride salt.

Treatment of a solution of compound 12-2 with 2,6-naphthalenedisulfonyl chloride and TEA in CH ₂ Cl ₂ gave intermediate compound 14-1. Deprotection of Boc in Intermediate 14-1 Using 4 N a solution of HCl in 1,4-dioxane gave compound 87 in the form of its bis-hydrochloride salt.

Treatment of a solution of compound 12-2 with 1,4-phenylenediisocyanate in DMF gave intermediate 15-1. Removal of the Boc protecting group of intermediate 15-1 using 50% TFA in CH ₂ Cl ₂ gave compound 104 in the form of its bis-TFA salt.

The preparation of compound 94 is illustrated in Scheme 16. The reductive amination of 4,4'-biphenyldicarboxaldehyde using phenethylamine and Na (AcO) ₃ BH afforded intermediate 16-2. Activation of the proline carboxyl group by treatment with HBTU, HOBt and DIPEA amide binders in a DMF solvent followed by the addition of compound 16-2 gave intermediate 16-3. Removal of the Boc protecting group of compound 16-3 using 4 N. a solution of HCl in 1,4-dioxane gave compounds 16-4 · 2HCl. Activation of the carboxyl group of Boc-L-Tle-OH by treatment with HBTU, HOBt and DIPEA amide binders in a DMF solvent followed by the addition of 16-4 · HCl gave intermediate 16-5. Removal of the Boc protecting group using 4 n. a solution of HCl in 1,4-dioxane gave compound 16-6 · 2HCl. Activation of the carboxyl group of Boc-N-Me-Ala-OH by treatment with the amide binders EDC, HOBt and DIPEA in a CH ₂ Cl ₂ solvent followed by the addition of 16-6 · 2HCl gave intermediate 16-7. Removal of the Boc protecting group using 4 n. a solution of HCl in 1,4-dioxane gave a compound of 94 · 2HCl.

Production methods

Intermediate 7-1

To a solution of N- (tert-butoxycarbonyl) -L-proline (10.0 g, 50.2 mmol) in methylene chloride (150 ml) was added phenethylamine (6.52 ml, 50.2 mmol). After stirring for 1 hour at room temperature, sodium triacetoxyborohydride (21.0 g, 100.3 mmol) and methanol (50 ml) were added and the reaction mixture was stirred at room temperature overnight. Saturated aqueous NaHCO ₃ and ethyl acetate were added, the organic layer was separated, washed with brine, dried over anhydrous MgSO ₄ , filtered and concentrated in vacuo. Purification by silica gel chromatography, eluting with a 95: 5 to 50:50 hexane / EtOAc mixture, gave intermediate 7-1 as a colorless oil. MS (m / z) M + 1 = 305.4

Intermediate 7-2

To a solution of compound 7-1 (8.10 g, 26.6 mmol) in methylene chloride (80 ml), cooled to 0 ° C, TEA (7.4 ml, 53.3 mmol), benzyl chloroformate (4.10 ml, 29) were successively added. , 3 mmol) and the reaction mixture was stirred for 3 hours at room temperature. An aqueous solution of NaHCO ₃ and ethyl acetate were added, the organic layer was separated, washed with brine, dried over MgSO ₄ and concentrated in vacuo. Purification by silica gel chromatography, eluting with a 95: 5 → 50:50 hexane / EtOAc gradient, gave intermediate 7-2 as a colorless oil.

Intermediate 7-3 · HCl

4 n. a solution of HCl in 1.4 dioxane (20 ml) was added to intermediate 7-2 (11.5 g, 26.2 mmol) and the solution was stirred for 2 hours at room temperature. Volatiles were removed under reduced pressure and the residue was triturated with diethyl ether to give intermediate 7-3 · HCl as a white solid. MS (m / z) M + 1 = 339.2

Intermediate 7-4

To a solution of Boc-L-Tle-OH (5.70 g, 24.5 mmol) in DMF, cooled to 0 ° C, DIPEA (16.9 ml, 94.3 mmol), HOBt (3.3 g, 24, 5 mmol) and HBTU (9.30 g, 24.5 mmol). After stirring for 10 minutes, intermediate 7-3 · HCl (7.04 g, 18.8 mmol) was added and the reaction mixture was stirred overnight at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid solution, aqueous NaHCO ₃ solution and brine, dried over anhydrous MgSO ₄ , filtered and concentrated in vacuo. Purification by silica gel chromatography with gradient elution of 95: 5 → 50:50 with hexane / EtOAc gave intermediate 7-4 as a colorless oil.

The intermediate compound 7-5 · HCl

4 n. a solution of HCl in 1,4-dioxane (20 ml) was added to intermediate 7-4 (8.30 g, 15.0 mmol) and the solution was stirred for 2 hours at room temperature. Volatiles were removed under reduced pressure and the residue was triturated with diethyl ether to give intermediate 7-5 · HCl as a white solid. MS (m / z) M + 1 = 452.2.

Intermediate 7-6

To a solution of Boc-N-Me-Ala-OH (4.20 g, 20.7 mmol) in DMF, cooled to 0 ° C, DIPEA (14.3 ml, 79.8 mmol), HOBt (2.8 g) were successively added. 20.7 mmol) and HBTU (7.90 g, 20.7 mmol). After stirring for 10 minutes, intermediate 7-5 · ΗCl (7.76 g, 15.9 mmol) was added and the reaction mixture was stirred overnight at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid solution, aqueous NaHCO ₃ solution and brine, dried over anhydrous MgSO ₄ , filtered and concentrated in vacuo. Purification by silica gel chromatography with gradient elution of 95: 5 → 50:50 with hexane / THF gave intermediate 7-6 as a colorless oil.

Intermediate 7-7

To a solution of intermediate 7-6 (3.00 g, 4.7 mmol) in anhydrous MeOH (100 ml) with stirring in an atmosphere of N _{2 was} added 10% Pd / C (200 mg). The reaction mixture was purged with H ₂ and stirred for 1 hour. The reaction mixture was then filtered through celite and the filtrate was concentrated in vacuo. Purification by silica gel chromatography with a gradient elution of 95: 5 → 50:50 with hexane / THF gave intermediate 7-7 as a colorless oil. MS (m / z) M + 1 = 503.4.

Intermediate 8-1

To a solution of intermediate 7-7 (250 mg, 0.49 mmol) in THF, cooled to 0 ° C, TEA (134 μl, 0.96 mmol) and terephthaloyl chloride (49.7 mg, 0.24 mmol) and the reaction were successively added. the mixture was stirred for 2 hours at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid solution, aqueous NaHCO ₃ solution and brine, dried over anhydrous MgSO ₄ , filtered and concentrated in vacuo. Purification by silica gel chromatography with a gradient elution of 95: 5 → 50:50 with hexane / THF gave intermediate 8-1 as a white solid.

Compound 1 · 2ΗCl

4 n. a solution of HCl in 1,4-dioxane (3 ml) was added to intermediate 8-1 (120 mg, 0.10 mmol) and the solution was stirred for 2 hours at room temperature. Volatiles were removed under reduced pressure and the residue was triturated with diethyl ether to give 1 · 2ΗCl as a white solid.

Intermediate 9-1

To a solution of intermediate 7-7 (1.22 g, 2.42 mmol) in THF, cooled to 0 ° C, TEA (1.35 ml, 9.70 mmol) and 4.4'-biphenyl disulfonyl chloride (425 mg, 1) were successively added. , 21 mmol) and the reaction mixture was stirred for 2 hours at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid solution, aqueous NaHCO ₃ solution and brine, dried over anhydrous MgSO ₄ , filtered and concentrated in vacuo. Purification by silica gel chromatography with gradient elution of 95: 5 → 50:50 with hexane / THF gave intermediate 9-1 as a white solid.

Compound 13 · 2ΗCl

4 n. a solution of HCl in 1,4-dioxane (5 ml) was added to intermediate 9-1 (450 mg, 0.35 mmol) and the solution was stirred for 2 hours at room temperature. Volatiles were removed under reduced pressure and the residue was triturated with diethyl ether to give 13 · 2ΗCl as a white solid.

Intermediate 10-1

To a solution of intermediate 7-7 (180 mg, 0.36 mmol) in CH ₂ Cl _{2 was} added 1,4-phenylenediisocyanate (25 mg, 0.16 mmol) and the reaction mixture was stirred overnight at room temperature. Volatiles were removed under reduced pressure and the residue was purified by silica gel chromatography with a gradient of 95: 5 → 50:50 hexane / THF to give intermediate 10-1 as a white solid.

Compound 20 · 2TFA

Intermediate 10-1 (175 mg, 0.15 mmol) was dissolved in a mixture of CH ₂ Cl ₂ (3.0 ml) and TFA (3.0 ml). The solution was stirred for 3 hours at room temperature. Volatiles were removed under reduced pressure and the residue was triturated with diethyl ether to give 20 · 2TFA as a white solid.

Intermediate 11-1

To a solution of intermediate 7-7 (210 mg, 0.42 mmol) in DMF, DIPEA (435 μl, 2.50 mmol) and α, α'-dibromo-p-xylene (49 mg, 0.18 mmol) were successively added. and the reaction mixture was stirred for 2 hours at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid solution, aqueous NaHCO ₃ solution and brine, dried over anhydrous MgSO ₄ , filtered and concentrated in vacuo. Purification by silica gel chromatography with a gradient elution of 95: 5 → 30:70 with hexane / THF gave intermediate 11-1 as a white solid.

Compound 23 · 2ΗCl

4 n. a solution of HCl in 1,4-dioxane (2 ml) was added to intermediate 11-1 (33 mg, 0.03 mmol) and the solution was stirred for 2 hours at room temperature. Volatiles were removed under reduced pressure and the residue was triturated with diethyl ether to give compound 23 · 2ΗCl as a white solid.

Intermediate 12-1

To a solution of Cbz-Gly-OH (4.16 g, 19.9 mmol) in DMF, cooled to 0 ° C, DIPEA (14.0 ml, 80.4 mmol) and HBTU (7.01 g, 18.5) were successively added. mmol). After stirring for 5 minutes, intermediate 7-7 (8.11 g, 16.1 mmol) was added and the reaction mixture was stirred overnight at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid solution, aqueous NaHCO ₃ solution and brine, dried over anhydrous MgSO ₄ , filtered and concentrated in vacuo. Purification by silica gel chromatography with gradient elution of 95: 5 → 50:50 with hexane / THF gave intermediate 12-1 as a white solid.

Intermediate 12-2

To a solution of intermediate 12-1 (4.21 g, 6.07 mmol) in anhydrous MeOH (120 ml), 10% Pd / C (500 mg) was added with stirring under N ₂ . The reaction mixture was purged with H ₂ and stirred for 6 hours. The reaction mixture was then filtered through celite and the filtrates were concentrated in vacuo to give intermediate 12-2 as a white solid. MS (m / z) M + 1 = 560.4

Intermediate 13-1

To a solution of intermediate 12-2 (200 mg, 0.36 mmol) in DCM cooled to 0 ° C, TEA (100 μl, 0.71 mmol) and terephthaloyl chloride (36 mg, 0.18 mmol) were successively added and the reaction mixture was stirred for 6 hours at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid solution, aqueous NaHCO ₃ solution and brine, dried over anhydrous MgSO ₄ , filtered and concentrated in vacuo. Purification by silica gel chromatography with gradient elution of 95: 5 → 50:50 with hexane / THF gave intermediate 13-1 as a white solid.

Compound 35 · 2ΗCl

4 n. a solution of HCl in 1,4-dioxane (3.0 ml) was added to intermediate 13-1 (195 mg, 0.18 mmol) and the solution was stirred for 2 hours at room temperature. Volatiles were removed under reduced pressure and the residue was triturated with diethyl ether to give compound 35 · 2ΗCl as a white solid.

Intermediate 14-1

To a solution of intermediate 12-2 (245 mg, 0.44 mmol) in DCM, cooled to 0 ° C, TEA (130 μl, 0.93 mmol), 2,6-naphthalenedisulfonyl chloride (66 mg, 0.20 mmol) were successively added. and the reaction mixture was stirred overnight at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid solution, aqueous NaHCO ₃ solution and brine, dried over anhydrous MgSO ₄ , filtered and concentrated in vacuo. Purification by silica gel chromatography with gradient elution of 95: 5 → 50:50 with hexane / THF gave intermediate 14-1 as a white solid.

Compound 87 · 2ΗCl

4 n. a solution of HCl in 1,4-dioxane (5.0 ml) was added to intermediate 14-1 (160 mg, 0.11 mmol) and the solution was stirred for 2 hours at room temperature. Volatiles were removed under reduced pressure and the residue was triturated with diethyl ether to give compound 87 · 2ΗCl as a white solid.

Intermediate 15-1

To a solution of intermediate 12-2 (142 mg, 0.25 mmol) in THF was added 1,4-phenylenediisocyanate (41 mg, 0.25 mmol) and the reaction mixture was stirred at room temperature for 3 hours. Volatiles were removed under reduced pressure and the residue was purified by silica gel chromatography with a gradient of 95: 5 → 50:50 hexane / THF to give intermediate 15-1 as a white solid.

Compound 104 · 2TFA

Intermediate 15-1 (96 mg, 0.07 mmol) was dissolved in a mixture of CH ₂ Cl ₂ (1.0 ml) and TFA (1.0 ml). The solution was stirred for 1 hour at room temperature. Volatiles were removed under reduced pressure and the residue was triturated with diethyl ether to give 104 · 2TFA as a white solid.

The intermediate connection 16-2

Phenethylamine (1.72 g, 14.3 mmol) was added to a solution of 4,4'-biphenyldicarboxaldehyde (1.50 g, 7.13 mmol) in methylene chloride (25 ml). After stirring for 1 hour at room temperature, sodium triacetoxyborohydride (4.53 g, 21.4 mmol) and methanol (25 ml) were added and the reaction mixture was stirred at room temperature overnight. Saturated aqueous NaHCO ₃ and ethyl acetate were added, the organic layer was separated, washed with brine, dried over anhydrous MgSO ₄ , filtered and concentrated in vacuo. Purification by chromatography on silica gel, eluting with 95: 5 → 50:50 hexane / EtOAc, afforded intermediate 16-2 as a yellow solid.

The intermediate connection 16-3

To a solution of Boc-Pro-OH (3.64 g, 16.1 mmol) in DMF, cooled to 0 ° C, DIPEA (11.06 ml, 61.8 mmol), HOBt (2.50 g, 18.5) were successively added. mmol) and HBTU (7.03 g, 18.5 mmol). After stirring for 10 minutes, intermediate 16-2 (2.60 g, 6.18 mmol) was added and the reaction mixture was stirred for 3 days at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid solution, aqueous NaHCO ₃ solution and brine, dried over anhydrous MgSO ₄ , filtered and concentrated in vacuo. Purification by silica gel chromatography with a gradient elution of 95: 5 → 50:50 with hexane / EtOAc gave intermediate 16-3 as a white solid.

The intermediate compound 16-4 · 2ΗCl

4 n. a solution of HCl in 1.4 dioxane (10 ml) was added to intermediate 16-3 (3.10 g, 3.80 mmol) and the solution was stirred for 2 hours at room temperature. Volatiles were removed under reduced pressure and the residue was triturated with diethyl ether to give intermediate 16-4 · 2ΗCl as a white solid.

The intermediate connection 16-5

To a solution of Boc-L-Tle-OH (2.18 g, 9.45 mmol) in DMF, cooled to 0 ° C, DIPEA (6.50 ml, 36.3 mmol), HOBt (1.47 g, 10 89 mmol) and HBTU (4.12 g, 10.89 mmol). After stirring for 10 minutes, intermediate 16-4 · 2ΗCl (2.50 g, 3.63 mmol) was added and the reaction mixture was stirred overnight at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid solution, aqueous NaHCO ₃ solution and brine, dried over anhydrous MgSO ₄ , filtered and concentrated in vacuo. Purification by silica gel chromatography with a gradient of 95: 5 → 50:50 hexane / EtOAc gradient gave intermediate 16-5 as a white solid.

The intermediate compound 16-6 · 2ΗCl

4 n. a solution of HCl in 1.4 dioxane (5 ml) was added to intermediate 16-5 (1.60 g, 1.54 mmol) and the solution was stirred for 2 hours at room temperature. Volatiles were removed under reduced pressure and the residue was triturated with diethyl ether to give intermediate 16-6 · 2ΗCl as a white solid.

Intermediate 16-7

To a solution of Boc-N-Me-Ala-OH (404 mg, 1.99 mmol) in CH ₂ Cl ₂ , cooled to 0 ° C, DIPEA (1.36 ml, 7.60 mmol), HOBt (308 mg, 2.28 mmol) and EDC (437 mg, 2.28 mmol). After stirring for 10 minutes, intermediate 16-6 · 2ΗCl (700 mg, 0.76 mmol) was added and the reaction mixture was stirred overnight at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid solution, aqueous NaHCO ₃ solution and brine, dried over anhydrous MgSO ₄ , filtered and concentrated in vacuo. Purification by silica gel chromatography with gradient elution of 95: 5 → 50:50 with hexane / THF gave intermediate 16-7 as a white solid.

Compound 94 · 2ΗCl

4 n. a solution of HCl in 1,4-dioxane (3 ml) was added to intermediate 16-7 (243 g, 0.20 mmol) and the solution was stirred for 2 hours at room temperature. Volatiles were removed under reduced pressure and the residue was triturated with diethyl ether to give compound 94 · 2ΗCl as a white solid.

Compound 94 · 2ΗCl

4 n. a solution of HCl in 1,4-dioxane (3 ml) was added to intermediate 16-7 (243 g, 0.20 mmol) and the solution was stirred for 2 hours at room temperature. Volatiles were removed under reduced pressure and the residue was triturated with diethyl ether to give compound 94 · 2ΗCl as a white solid.

Compound 49

Compounds 49-1 and 49-2 were coupled using HOBt, HBTU and DIPEA in a DMF solvent using a method similar to that described for converting compound 7-5- to 7-6, to give intermediate 49-3. Carried out the removal of protection in the intermediate compound 9-3 using 4 N. a solution of HCl in 1,4-dioxane to obtain compound 49 · 2ΗCl. MS (m / z) (M + 2) / 2 = 519.0.

Connection 106 - Probe P2:

Stage a)

Intermediate 49-3 and 5% Pd / C (10 wt%) were suspended in MeOH and placed in a hydrogen atmosphere (1 atm). After stirring for 16 hours, the solution was filtered through celite and concentrated under reduced pressure to give intermediate 106-1.

Stage b)

To a solution of compound 106-1 (100 mg, 0.09 mmol) in anhydrous dichloromethane (5 ml), fluoresceinisothiocyanate (35 mg, 0.09 mmol) and triethylamine (20 μl) were added with stirring under N ₂ atmosphere. The reaction mixture was then stirred for 2 hours at room temperature. Ethyl acetate was added and washed twice with a 10% citric acid solution, the organic layer was separated, washed with saturated brine, dried over anhydrous MgSO ₄ , filtered and concentrated in vacuo to give intermediate 106-2 as a yellow solid. MS (m / z) (M + 2) / 2 = 746.6.

Stage c)

Dichloromethane (3 ml) and TFA (3 ml) were added to compound 106-2 (60 mg, 0.04 mmol) and the solution was stirred for 40 minutes at room temperature. Volatiles were removed under reduced pressure and the residue was triturated with diethyl ether. Purification by reverse phase chromatography with gradient elution with a water / acetonitrile mixture gave the expected 106 · 2TFA as a yellow solid. MS (m / z) M + 1 = 1291.6.

Representative compounds of the present invention were obtained in accordance with the above procedures and are illustrated in Table 1.

Representative compounds of the present invention, which can be obtained using simple modifications of the above procedures, are illustrated in Table 2:

X may be selected from CH ₂ , CF ₂ , O, or S;

and n may be 1, 2 or 3;

and BG can be selected from the groups including:

and R ^3/300 have the meanings defined in this application

and R ^{6/600 is} independently selected from H, alkyl, or:

Representative compounds of the present invention, which can be obtained using simple modifications of the above procedures, are illustrated below:

Where R ⁴ , R ⁵ , R ^5a , R ⁶ , R ⁴⁰⁰ , R ⁵⁰⁰ , R ^500a , R ⁶⁰⁰ , X, X ¹⁰⁰ and BG have the meanings defined in this application;

and R ³ and R ^{300 are} independently selected from the following: —CHOR ⁷ , —C (CH ₃ ) OR ^7, or —CH ₂ CH ₂ OR ⁷ ; where R ^{7 is} defined as —C (O) R ⁸ and R ⁸ is alkyl, aryl or heteroaryl, where alkyl may be further substituted with R ⁷ and aryl and heteroaryl may be further substituted with R ¹¹ .

Analyzes

Molecular expression constructs

GST-XIAP BIR3RING: The XIAP coding sequence of amino acids 246-497 was cloned into PGEX2T1 via BamH1 and AVA I. The plasmid was transformed into E. coli DH5α for use in protein expression and purification.

GST-HIAP2 (cIAP-1) BIR 3: HIAP2 coding sequence of amino acids 251-363 was cloned into PGex4T3 via BamH1 and Xhol. The plasmid was transformed into E. coli DH5α for use in protein expression and purification.

GST-H IAP1 (cIAP-2) BIR 3: HIAP1 coding sequence of amino acids 236-349 was cloned into PGex4T3 via BamH1 and Xhol. The plasmid was transformed into E. coli DH5α for use in protein expression and purification.

GST linker BIR 2 BIR3Ring: XIAP coding sequence of amino acids 93-497 was cloned into PGex4T1 via BamH1 and Xhol. Amino acids 93-497 were amplified from full-length XIAP in pGex4t3 using primers: TTAATAGGATCCATCAACGGCTTTTATC and GCTGCATGTGTGTCAGAGG using standard PCR conditions. The PCR fragment of TA was cloned into pCR-2.1 (Invitrogen). Linker BIR 2 BIR 3Ring was subcloned into pGex4T1 by digestion with BamHI / Xhol. The plasmid was transformed into E. coli DH5α for use in protein expression and purification.

Human full length XIAP, AEG plasmid number 23. The XIAP coding sequence of amino acids 1-497 was cloned into the GST hybridization vector, PGEX4T1, through the restriction sites BamH1 and Xho I. The plasmid was transformed into E. coli DH5α for use in protein expression and purification.

GST-XIAP linker BIR 2: XIAP linker BIR 2 coding sequence of amino acids 93-497 was cloned into pGex4T3 via BamHI and Xhol. The plasmid was transformed into E. coli DH5α for use in protein expression and purification.

Synthesis of a fluorescent probe for FP analysis

The fluorescence peptide probe Fmoc-Ala-Val-Pro-Phe-Tyr (t-Bu) -Leu-Pro-Gly (t-Bu) -Gly-OH was obtained using standard Fmoc chemistry on a 2-chlorotrityl chloride resin (Int. J. Pept. Prot. Res. 38: 555-561, 1991). Cleavage from the resin was carried out using 20% acetic acid in dichloromethane (DCM), while the side chain still remained blocked. The C-terminal protected carboxylic acid was coupled to 4 ′ - (aminomethyl) fluorescein (Molecular Probes, A-1351; Eugene, Oreg.) Using excess diisopropylcarbodiimide (DIC) in dimethylformamide (DMF) at room temperature and purified by silica gel chromatography ( 10% methanol in DCM). The N-terminal Fmoc protecting group was removed using piperidine (20%) in DMF and purified by silica gel chromatography (20% methanol in DCM, 0.5% HOAc). At the end, the side chain tert-butyl protecting groups were removed using a 95% trifluoroacetic acid solution containing 2.5% water and 2.5% triisopropylsilane. The resulting peptide showed a single peak according to HPLC (purity> 95%).

Fluorescent probes can be prepared using monomeric BIR binding units or bridged BIR binding compounds of the present invention using the chemical techniques described herein to produce probes comprising compound 106.

Probe P2:

Expression and purification of recombinant proteins

A. Expression of recombinant proteins

Glutathione S-transferase (GST) -labeled proteins were expressed in Escherichia coli strains of DH5 alpha. To express full-length XIAP, single or combinations of XIAP-BIR domains, cIAP-1, cIAP-2 and Livin transformed bacteria were cultured overnight at 37 ° C in Luria Broth (LB) medium supplemented with 50 μg / ml ampicillin. The culture after culturing overnight was then diluted 25 times in fresh LB supplemented with ampicillin and the bacteria were grown to A ₆₀₀ = 0.6, then induced with 1 mM isopropyl-D-1-thiogalactopyranoside for 3 hours. After induction, the cells were centrifuged at 5000 rpm for 10 minutes and the medium was removed. Each centrifuge pellet obtained from 1 liter of culture to which 10 ml of lysis buffer was added (50 mM Tris-HCl, 200 mM NaCl, 1 mM DTT, 1 mM PMSF, 2 mg / ml lysozyme, 100 μg / ml) ), incubated at 4ºC with gentle shaking. After 20 minutes of incubation, the cell suspension was kept at -80 ° C overnight or until needed.

B. Purification of Recombinant Proteins

To purify recombinant proteins, the IPTG-induced cell lysate was thawed in a vortex funnel and then torn apart by instant freezing in liquid nitrogen twice, subject to vortex mixing after each thawing. Cells were further rupture by passing the extract four times through the apparatus to break Bio-Neb cells (Glas-col) set with the pressure of nitrogen gas 100 lb / ⁱⁿ² (7.0 kg / cm ^2). Suspended impurities were removed from the extract by centrifugation at 4ºC at 15,000 rpm in a Beckman SS-34 rotary device for 30 minutes. The resulting supernatant was then mixed with 2 ml of glutathione-sepharose beads (Pharmacia) per 500 ml of cell culture (per 1000 ml of culture for full-length XIAP) for 1 hour at 4 ° C. Then the balls were washed 3 times with 1 × Tris-buffered saline (TBS) to remove unbound proteins. The remaining proteins were eluted with 2 washes of 2 ml of 50 mM Tris pH 8.0 containing 10 mM reduced glutathione. Eluted proteins were collected and precipitated with 604 g / liter of ammonium sulfate and the resulting pellet was again suspended after centrifugation in a suitable buffer. SDS-PAGE analysis showed that the purified proteins had a purity> 90%. To determine the protein concentration in purified proteins, the Bradford method was used.

Proteins with His-tag (histidine tag) were expressed in E. coli cells strain AD494 using the construct pet28ACPP32. Soluble protein fractions were obtained as described above. For protein purification, the supernatant was purified by affinity chromatography using a Sepharose chelating agent (Pharmacia) loaded with NiSO ₄ in accordance with the manufacturer's instructions. The purity of the eluted protein was> 90%, as determined by SDS-PAGE analysis. To determine the protein concentration in purified proteins, the Bradford method was used.

Binding analysis

Competitive analysis based on fluorescence polarization

For all analyzes, fluorescence and fluorescence polarization was determined using a Tecan Polarion device with an excitation filter set to 485 nm and an emission filter set to 535 nm. For each analysis, the concentration of the target protein was first established by titration of the selected protein to obtain a linear dose response signal and incubated separately in the presence of a fluorescent probe. After the establishment of such conditions, the activity of the compounds (IC ₅₀ ) and selectivity were determined in the presence of a fixed certain amount of the target protein and fluorescent probe and a 10-point serial dilution of the selected compounds. For each IR ₅₀ curve, the analyzes were performed as follows: 25 μl / well of diluted compound in 50 mM MES pH 6.5 buffer was added to a black 96 well plate, then 25 μl / well of bovine serum albumin (BSA) was added at 0.5 mg / ml in 50 mM MES pH 6.5. Autofluorescence for each compound was first determined by reading only the compound / BSA solution. Then, 25 μl of a fluorescein probe diluted in 50 mM MES containing 0.05 mg / ml BSA was added, and reading was performed to determine the damping of the fluorescein signal. Finally, 25 μl / well of the target or control protein (GST-BIRs) diluted in a suitable concentration in 50 mM MES containing 0.05 mg / ml BSA was added, and the fluorescence polarization was determined.

IR definition _fifty  and inhibition constants

For each analysis, the relative fluorescence polarization units were plotted against final concentrations of the compound and the IC _{50 was} calculated using the Grad pad prism and / or Cambridge soft program. The k _i value was derived from the calculated IC ₅₀ value, as described above, and in accordance with the equation described in Nikolovska-Coleska, Z. (2004) Anal Biochem 332, 261-273.

It was shown that the selected compound of the present invention binds to the cir-IAP1, c-IAP2 and XIAP BIR3 domain and to the XIAP linker-BIR2-BIR3-RING at k _i <1 μM.

Caspase-3 de-repression analysis using full-sized XIAP, BIR2 linker or BIR2-BIR3-RING linker

In vitro analysis was performed to determine the relative activity of the selected compound against XIAP-Bir2, where caspase-3 was inhibited using GI fusion proteins XIAP linker-Bir2, XIAP linker Bir2-Bir3-RING or full-length XIAP. Caspase 3 (0.125 μl) and 12.25-34.25 nM (final concentration) of the GST-XIAP fusion protein (GST-Bir2, GST-Bir2Bir3RING or full-length XIAP) were coincubated with serial dilutions of the compound (200 μM - 5 pM). Caspase 3 activity was measured by overlaying 25 μl of a 0.4 mM DEVD-AMC solution. The final reaction volume was 100 μl. All dilutions were carried out in caspase buffer (50 mM Hepes pH 7.4, 100 mM NaCl, 10% sucrose, 1 mM EDTA, 10 mM DTT, 0.1% CHAPS (Stennicke, HR and Salvesen, GS (1997). Biochemical characteristics of caspase-3, -6, -7 and -8. J. Biol. Chem. 272, 25719-25723).

Fluorescent AMC released by hydrolysis of the substrate by caspase-3 was measured in a TECAN spectrophotometer with excitation at 360 nm and emission at 444 nm after 15 minutes of incubation at room temperature. IR ₅₀ values were calculated on a one- or two-site competitive model using GraphPad v4.0 using a graph of fluorescence values after 15 minutes of incubation against log10 concentration of the compound.

Cell-free analysis

Caspase-3 de-repression analysis using cell extracts (apoptosome)

100 μg S100 of cell extract 293 and from 0.25 μM to 20 μM GST-XIAP fusion protein (XIAP-Bir3RING, XIAP-Bir2Bir3RING or full-length XIAP) were co-incubated with serial dilutions of the compound (40 μM - 50 pM). Caspases present in the extracts were activated by adding 1 mM dATP, 0.1 mM ALLN, 133 μg Cytochrome C (final concentrations) and incubation at 37 ° C for 25 minutes. For all reactions and dilutions, S100 buffer (50 mM Pipes pH 7.0, 50 mM KCl, 0.5 mM EGTA pH 8.0, 2 mM MgCl ₂ , supplemented with 1/1000 dilutions of 2 mg / ml Cytogalysin B, 2 mg was used / ml Himostatin, Leipeptin, Pepstatin, Antipain, 0.1 M PMSF, 1M DTT). The final reaction volume was 30 μl. Caspase 3 activity was measured by overlaying 30 μl of a 0.4 mM DEVD-AMC solution. The cleavage AMC released was measured in a TECAN spectrophotometer with excitation at 360 nm and emission at 444 nm using a kinetic cycle of 1 hour with readings every 5 minutes. Caspase activity was calculated as V ₀ AMC fluorescence / sec. Caspase depression using the compounds of the present invention was compared with a fully activated extract repressed by the presence of the XIAP fusion protein.

Cell culture and cell death assays

A. Cell culture

The cancer cells MDA-MD-231 (mammary gland), SKOV-3 (ovary) and H460 (lung) were cultured in RPMI 1640 medium supplemented with 10% FBS and 100 units / ml Penicillin and Streptomycin.

B. Assays

Survival analyzes were performed on the following transformed human cancer cell lines: MDA-MB-231, SKOV-3, H460, PC3, HCT-116, and SW480 cells. Cells were seeded in 96-well plates at respective densities of 5,000 and 2,000 cells per well and incubated at 37 ° C in the presence of 5% CO ₂ for 24 hours. The selected compounds were diluted in medium at various concentrations ranging from 0.00001 μM to 100 μM. Diluted compounds were added to the culture medium. For MDA-MB-231 SKOV3, H460, PC3, HCT-116 and SW480 cells, compounds were added either individually or in the presence of 1-3 ng / ml TRAIL. After 48-72 hours, cell survival was assessed using MTS assays. Solution of [3- (4,5-dimethylthiazol-2-yl) -5- (3-carboxymethoxyphenyl) -2- (4-sulfophenyl) -2H-tetrazolium, internal salt; MTS] was added to the cells for 1 to 4 hours. After incubation, the amount of converted MTS was determined using a Tecan spectrophotometer set at 570 nm.

Cells MDA-MB-231 and SKOV-3 were treated with selected compounds of the present invention, and it was found that the values of the EC ₅₀ below 200 nm.

MTT Viability Analysis

One day prior to treatment with the compound, from 2000 to 4000 cells per well were seeded into culture-treated tissue culture plates in 96-well format with 100 μl of medium and incubated at 37 ° C, 5% CO ₂ . On the day of treatment with the compound, the compounds were diluted in cell culture medium to a working initial concentration of 2 ×. Then, 100 μl of the diluted compound was added to each well. The treated plate was incubated for 72 hours at 37 ° C, 5% CO ₂ . After incubation, cell viability was evaluated as follows: 20 μl of MTT reagent (5 mg / ml) was added to each well on the cell plate. The plate was incubated for 2 hours at 37 ° C in the presence of 5% CO ₂ . The supernatant was then removed from the plate and 100 μl of isopropanol was added. The optical density was measured in a TECAN spectrophotometer at 570 nm. Percent viability was expressed as a percentage of the signal obtained with untreated cells.

Table 7 presents some of the SAR compounds shown in Table 1 above. As such, the compounds showed EC ₅₀ values against MDA-MB-231 and SKOV-3 cells <1 μM, with many compounds showing EC ₅₀ values <50 nM.

A - EC50 <10 nM

B - EC50 10-25 nm

C - EC50> 25 nM

In addition, cell treatment with 10 nM Compounds 31 and 35 enhanced the effectiveness of TRAIL on colorectal HCT116 cells and A2780S ovary cells by about 2 times, respectively.

Apoptosis analysis: determination of caspase-3 activity from cultured cells.

The day before treatment, 10,000 cells per well were seeded in a white tissue-treated 96-well plate with 100 μl of medium. On the day of treatment with the compound, the compounds were diluted in the cell culture medium to a working initial concentration of 2 × and 100 μl of the diluted compound was added to each well, the plate was incubated for 5 hours at 37 ° C in the presence of 5% CO ₂ . After incubation, the plate was washed twice with cold buffer, Tris-buffered saline (200 μl, TBS). Cells were lysed with 50 μl caspase assay buffer (20 mM), Tris-HCl pH 7.4, 0.1% NP-40, 0.1% Chaps, 1 mM DTT, 0.1 mM EDTA, 0.1 mM PMSF, 2 mg / ml Himostatin, Leipeptin, Pepstatin, Antipain), then incubated at 4ºC with shaking for 30 minutes. Caspase assay buffer (45 μl) and Ac-DEVD-AMC (5 μl, 1 mg / ml) were added to each well and the plate was shaken and incubated for 16 hours at 37 ° C. The amount of AMC released was measured in a TECAN spectrophotometer with an excitation filter and an emission filter set at 360 nm and 444 nm. The percentage of activity of Caspase-3 was expressed in comparison with the signal obtained with untreated cells.

Cell Biochemistry:

A. Definition of XIAP, C-IAP1, C-IAP2, PARP, Caspase-3 and Caspase-9

The determination of XIAP and PARP expressed by cells was carried out using Western blotting. Cells were seeded at a density of 300,000 cells / well in 60 mm wells (6-well plate). The next day, the cells were treated with the selected compound at the indicated concentration. After 24 hours, the cells, trypsinized cells, were besieged by centrifugation at 1800 rpm at 4ºC. The obtained precipitate after centrifugation was washed twice with cold TBS. The final washed cell pellet was lysed using 250 μl of lysis buffer (NP-40, glycerin, 1% cocktail of protease inhibitor (Sigma)), placed at 4 ° C for 25 min with gentle shaking. The cell extract was centrifuged at 4ºC for 10 minutes at 10,000 rpm. Both the supernatant and pellet after centrifugation were stored for analysis by Western blotting, as described below. The amount of protein in the supernatant was determined and about 50 μg of protein was fractionated into 10% SDS-PAGE. The pellets after centrifugation were washed with lysis buffer and resuspended in 50 μl of Lamelli 1 × buffer, boiled and fractionated on SDS-PAGE. After electrophoresis, each gel was electrically transferred onto a nitrocellulose membrane at 0.6A for 2 hours. Non-specific membrane regions were blocked for 1 hour with 5% separated milk in TBST (TBS containing 0.1% (v / v) Tween-20) at room temperature. For protein immunodetection, membranes were incubated overnight with primary antibodies against various IAPs or caspase-3 or caspase-9 primary antibodies were incubated at 4 ° C with shaking at the following dilutions:

after overnight incubation, the membranes were washed three times for 15 min in TBST, then incubated for 1 hour at room temperature in the presence of a secondary antibody bound to an HRP enzyme (Chemicon) and diluted at 1/5000. After incubation, each membrane was washed three times with TBST and the immunoreactive bands were determined by adding a luminescent substrate (ECL kit, Amersham) and the signal was picked up on an X-RAY film for different exposure times. The active compounds have been shown to induce PARP cleavage and induce the loss of C-IAP1 and C-IAP2 from cells.

More specifically, C-IAP1 levels decreased in HCT116 cells after treatment overnight with compounds 45, 100, 31, 59, 44, 40, 67, 91.

Hollow fiber model

An in vivo hollow fiber model was used to demonstrate the in vivo efficacy of selected compounds against selected cell lines as therapy using a single agent or in combination with selected cytotoxic agents. On day 1, selected cell lines were cultured and the fiber was filled at a cell density of about 40,000 cells / fiber. On the day of surgery (day 4), three fibers were implanted subcutaneously in 28-35 male Nu / Nu CD-1 mice. On day 5, mice were started daily with subcutaneous injections of a control vehicle or vehicle containing the selected compound at a suitable concentration and / or an intraperitoneal injection of the cytotoxic agent. After 4 consecutive days of treatment, the animals were sacrificed, each fiber was removed and the metabolic viability of the remaining cells was determined by MTT analysis. Compound efficacy was defined as the difference between an animal that was treated with a vehicle and an animal that was treated only with a compound or compound administered in combination with a cytotoxic agent.

Compound 31 and compound 56 caused a 70% decrease in MTT signal in fibers from treated mice compared to fibers from vehicle treated control mice.

In vivo combination therapy with taxotere

Female nude CD-1 mice with a nude mutation (approximately 20-25 g) were injected subcutaneously with 5 × 10 ⁶ H460 cells in the right flank. The animals were divided into equal groups depending on the size of the tumor and drug therapy was started when the tumors reached a size of ~ 30-50 mm ³ . Animals that did not have a tumor or which were considered to be outside the scope of the study due to the tumor being too large were removed from the test at this point. The remaining animals were administered Taxotere (or equivalent vehicle volume) at 30 mg / kg, intraperitoneally, 2 times at intervals of a week. The compound was administered twice daily (at 10 mg / kg, subcutaneously, at intervals of about 6 hours), starting during the administration of Taxotere and continuing daily for the duration of the experiment. Tumor size was measured three times a week. Health assessment was performed at the time of delivery of the compound.

Human ovarian cancer cell line xenograft SKOV-3 study

Female nude CD-1 mice with a nude mutation (approximately 20-25 g) were subcutaneously injected with 1 × 10 ⁶ human SKOV-3 cells of a human ovarian tumor in 50% matrigel, in the right flank. On day 55, when the tumors reached a size of about 100 mm ³ , treatment with the compound was started according to treatment scheme 5/2 during the experiment period. Tumor size was measured using digital compasses and calculated as V = (a × b ² ) / 2, where a is the length and b is the width.

X-ray study of human breast cancer cell line MDA-MB-231

Female nude mice CD-1 with a nude mutation (approximately 20-25 g) were subcutaneously injected with 1 × 10 ⁶ human breast tumor MDA-MB-231 cells in the right flank. On day 71, when the tumors reached a size of approximately 90 mm ³ , treatment with the compound was started according to treatment scheme 5/2 during the experiment period. Tumor size was measured using digital compasses and calculated as V = (a × b ² ) / 2, where a is the length and b is the width.

Pharmacokinetic studies

The selected compounds are dissolved in an aqueous medium and can be administered at different doses using different routes of administration, including intravenous bolus injection, intravenous infusion, oral administration and subcutaneous injection.

The compounds of the present invention exhibit acceptable pharmacokinetic profiles when administered through various clinically relevant routes.

Discussion

Not wishing to be bound by theory, the inventors of the present invention believe that the compounds of the present invention bind to the XIAP BIR domains and prevent the interaction of activated caspases with XIAP and cause the loss of XIAP protein in cells. In particular, the presented data confirms that the compounds of the present invention can significantly reduce or substantially eliminate the interaction of XIAP with active caspase-9 and with active caspase-3. Since caspase-7 can also bind to the BIR2 site of XIAP, it is possible that the compounds also interfere with the binding of activated caspase-7 to XIAP. Other data also show that the compounds of the present invention induce the loss of cIAP-1 and -2 in cells within 1-5 hours after addition of the compound. Thus, a possible mechanism in many cancer cells is that the compounds of the present invention bind to cIAPs and, through ubiquitin-mediated degradation, induce a loss of their function and promote or stimulate apoptosis of the target cells. Summarizing the above, the compounds of the present invention through direct contact in IAPs inhibit the function of IAP in cells, promote or stimulate cell apoptosis, and in some cells provide synergistic activity of apoptosis inducers.

All references to literature, patents, published patent applications cited in this application are incorporated into this application by reference in their entirety.

Although specific embodiments have been described, those skilled in the art will appreciate that changes are possible without violating the gist of the present invention, which is determined solely in accordance with the following claims.

Claims (33)

1. The compound of formula I

where n is 0 or 1;
m is 0, 1 or 2;
Y represents O;
W represents

or

where X is C ₁ -C ₃ alkyl, which forms part of the ring system, and G is a 5-, 6- or 7-membered ring system; and
W ¹ represents

or

where X ¹ and G ¹ have the meanings defined for X and G, respectively; or
Is a

Q and Q ¹ independently represent
1) -CH ₂ - or
2) -C (O) -;
A and A ¹ independently represent
1) NR ⁶ or
2) NR ⁶⁰⁰ ;
BG is
1) -Y ¹ -LY ¹⁰⁰ -;
2) -L- or
3) -Y ¹ -L ¹ -ZL ¹⁰⁰ -Y ¹⁰⁰ -, where L ¹ and L ¹⁰⁰ have the same meaning or
four)

Y ¹ and Y ¹⁰⁰ independently represent
1) -C (O) -,
2) -S (O) ₂ - or
3) —C (O) N (R ⁸ ) -;
L, L ¹ and L ¹⁰⁰ are
1) -C ₁ -C ₁₂ alkyl-
2) -aryl-,
3) -biphenyl-,
4) thienyl
5) -C ₁ -C ₆ alkyl-aryl-C ₁ -C ₆ alkyl or
6) -C ₁ -C ₆ alkyl-O-C ₁ -C ₆ alkyl;
Z represents
1) -N (R ⁸ ) CON (R ⁸ ) -,
2) -N (R ⁸ ) C (O) -aryl-C (O) N (R ⁸ ) -,
3) -C (O) -,
4) -N (R ⁸ ) -C (O) C (O) -N (R ⁸ ) -,
5) -N (R ⁸ ) -C (O) -C ₁ -C ₁₂ -alkyl-C (O) -N (R ⁸ ) -,
6) -N (R ⁸ ) -C (O) -heteroaryl-C (O) -N (R ⁸ ) -,
7) -N (R ⁸ ) -C (O) -biphenyl-C (O) -N (R ⁸ ) -,
8) -N (R ⁸ ) -S (O) ₂ -aryl-S (O) ₂ N (R ⁸ ) - or
9) -N (R ⁸ ) -S (O) ₂ -biphenyl-S (O) ₂ -N (R ⁸ ) -,
R ¹ and R ¹⁰⁰ independently represent
1) N or
2) C ₁ -C ₆ alkyl;
R ^la and R ^100a are H;
R ² , R ³ , R ²⁰⁰ and R ³⁰⁰ each independently represents H or C ₁ -C ₆ alkyl optionally substituted with one or more R ⁷ substituents;
R ⁴ R ⁵ R ^5a R ⁴⁰⁰ R ⁵⁰⁰ and R ^500a are H;
R ⁶ and R ⁶⁰⁰ each independently represents
1) H,
2) C ₁ -C ₆ alkyl,
3) aryl or
4) C (O) (O) _n -R ¹² ,
where alkyl is optionally substituted with one or more substituents R ⁷ ;
R ⁷ represents
1) C ₁ -C ₆ alkyl,
2) C ₃ -C ₇ cycloalkyl,
3) aryl,
4) heteroaryl,
5) thienyl,
6) tetrazolyl or
7) NR ⁹ R ¹⁰ ,
wherein aryl or tetrazolyl is optionally substituted with one or more R ¹¹ substituents;
R ⁸ represents
1) N or
2) C ₁ -C ₆ alkyl,
R ⁹ and R ¹⁰ each independently represents
1) N or
2) C (O) YR ¹² ,
R ¹¹ represents
1) halogen
2) halogenated,
3) OR ⁸ ,
4) aryl or
6) tetrazolyl,
R ¹² represents
1) C ₁ -C ₆ alkyl optionally substituted with one or more R ⁷ substituents;
where aryl is a carbocyclic aromatic monocyclic group containing 6 carbon atoms, which may be fused to a second 5- or 6-membered carbocyclic group, which may be aromatic, saturated or unsaturated, and aryl is attached at the position on the carbocyclic aromatic monocyclic group containing 6 carbon atoms, or optionally on a second 5- or 6-membered carbocyclic group, which may be aromatic, saturated or unsaturated, or its pharmaceutically riemlemaya salt. 2. The compound according to claim 1, in which W represents

and W ¹ represents

3. The compound according to claim 1, in which W represents

and W ¹ represents

4. The compound according to claim 1, in which Q and Q ¹ both represent —CH ₂ -. 5. The compound according to claim 1, in which BG is —Y ¹ —LY ¹⁰⁰ -. 6. The compound according to claim 1, in which L represents naphthyl or biphenyl. 7. The compound according to claim 1, which is a compound
formulas 1A1

formulas 1A2

formulas 1A4

formulas 1A5

or
formulas 1A6

8. The compound according to claim 1, in which Y ¹ and Y ¹⁰⁰ both are —C (O) -. 9. The compound according to claim 1, in which R ¹ and R ¹⁰⁰ represent CH ₃ . 10. The compound according to claim 1, in which the compound exhibits (S) stereochemistry at R ² and R ²⁰⁰ . 11. The compound according to claim 1, in which R ³ and R ³⁰⁰ represent H, (S) - methyl, (S) -ethyl, (S) -t-butyl, (S) -cyclohexylmethyl, (S) -2 phenylethyl or benzyl (S) butyl carbamate. 12. The compound according to claim 1, in which R ⁶ and R ⁶⁰⁰ each independently represents
1) H,
2) C ₁ -C ₆ alkyl optionally substituted with aryl, or
3) aryl. 13. The compound according to claim 1, in which R ⁶ and R ⁶⁰⁰ are
H, -CH (CH ₃ ) ₂ , -CH ₂ CH ₂ C (CH ₃ ) ₃ ,

and

14. The compound according to claim 1, in which R ¹¹ represents F, Cl, Br, OH, OMe, CF ₃ , phenyl or tetrazole. 15. The compound according to claim 1, represented by the formula

where BG is

and

and R ⁶ and R ^{600 are} independently selected from H, alkyl, or

16. The compound according to claim 1, selected from the group consisting of
Comp. No. Structure one

2

3

four

5

6

7

8

9

10

eleven

12

13

fourteen

fifteen

16

17

eighteen

twenty

21

22

23

24

25

26

27

28

29th

thirty

31

32

33

34

35

36

37

38

39

40

41

42

44

45

46

47

48

49

fifty

52

53

54

55

56

57

58

59

60

61

62

63

64

65

66

67

68

69

71

72

73

74

75

76

77

78

79

82

83

84

85

86

87

88

89

90

91

92

93

94

95

96

97

98

99

one hundred

101

102

103

105

and its pharmaceutically acceptable salts. 17. The intermediate compound represented by formula 1-v:

formula 5-i:

formula 6-iv:

I-ia formula:

formula I-iia:

or its salt, where
PG ³ , PG ⁴ and PG ⁴⁰⁰ mean protecting groups independently selected from Alloc, Fmoc, Bn, Boc, CBz and COCF ₃ ;
X, X ¹ each means C ₁ -C ₃ alkyl, which forms part of the ring system;
G is a 5-, 6- or 7-membered ring system;
Q and Q ¹ independently represent
1) -CH- or
2) -C (O) -;
A and A ¹ independently represent
1) NR ⁶ or
2) NR ⁶⁰⁰ ;
BG is
1) -Y ¹ -LY ¹⁰⁰ -;
2) -L-;
3) -Y ¹ -L ¹ -ZL ¹⁰⁰ -Y ¹⁰⁰ -, where L ¹ and L ¹⁰⁰ are equal, or
four)

Y ¹ and Y ¹⁰⁰ independently represent
l) -c (O) -,
2) -S (O) ₂ - or
3) —C (O) N (R ⁸ ) -;
L, L ¹ and L ¹⁰⁰ are
1) -C ₁ -C ₁₂ alkyl-
2) -aryl-,
3) -biphenyl-,
4) thienyl
5) -C ₁ -C ₆ alkyl-aryl-C ₁ -C ₆ alkyl or
6) -C ₁ -C ₆ alkyl-O-C ₁ -C ₆ alkyl;
Z represents
1) -N (R ⁸ ) CON (R ⁸ ) -,
2) -N (R ⁸ ) C (O) -aryl-C (O) N (R ⁸ ) -,
3) -C (O),
4) -N (R ⁸ ) -C (O) C (O) -N (R ⁸ ) -,
5) -N (R ⁸ ) -C (O) -C ₁ -C ₁₂ -alkyl-C (O) -N (R ⁸ ) -,
6) -N (R ⁸ ) -C (O) -heteroaryl-C (O) -N (R ⁸ ) -,
7) -N (R ⁸ ) -C (O) -biphenyl-C (O) -N (R ⁸ ) -,
8) -N (R ⁸ ) -S (O) ₂ -aryl-S (O) ₂ -N (R ⁸ ) - or
9) -N (R ⁸ ) -S (O) ₂ -biphenyl-S (O) ₂ -N (R ⁸ ) -;
R ¹ and R ¹⁰⁰ independently represent
1) N or
2) C ₁ -C ₆ alkyl;
R ² , R ³ , R ²⁰⁰ and R ³⁰⁰ each independently represents H or C ₁ -C ₆ alkyl optionally substituted with one or more R ⁷ substituents;
R ⁴ , R ⁵ , R ^5a , R ⁴⁰⁰ , R ⁵⁰⁰ and R ^5OOa are H;
R ⁶ and R ⁶⁰⁰ each independently represents
1) H,
2) C ₁ -C ₆ alkyl,
3) aryl or
4) C (O) (O) _n -R ¹² ,
where alkyl is optionally substituted with one or more substituents R ⁷ ;
R ⁷ represents
1) C ₁ -C ₆ alkyl,
2) C ₃ -C ₇ cycloalkyl,
3) aryl,
4) heteroaryl,
5) thienyl,
6) tetrazolyl or
7) NR ⁹ R ¹⁰ ,
wherein aryl or tetrazolyl is optionally substituted with one or more R ¹¹ substituents;
R ⁸ represents
1) N or
2) C ₁ -C ₆ alkyl,
R ⁹ and R ¹⁰ each independently represents
1) N or
2) C (O) YR ¹² ,
R ¹¹ represents
1) halogen
2) halogenated,
3) OR ⁸ ,
4) aryl or
5) tetrazolyl,
R ¹² is C ₁ -C ₆ alkyl optionally substituted with one or more R ⁷ substituents;
where aryl is a carbocyclic aromatic monocyclic group containing 6 carbon atoms, which may be fused to a second 5- or 6-membered carbocyclic group, which may be aromatic, saturated or unsaturated, and aryl is attached at the position on the carbocyclic aromatic monocyclic group containing 6 carbon atoms, or optionally on a second 5- or 6-membered carbocyclic group, which may be aromatic, saturated or unsaturated. 18. The method of obtaining the compounds of formula 2i, where the specified method includes:
a) mixing two intermediate compounds represented by formula 1-v

and LG-C (O) -LC (O) -LG in a solvent in the presence of a base and
b) removing the protective group PG ³ to obtain the compounds of formula 2-i

or its salt,
where PG ³ represents a protective group selected from Alloc, Fmoc, Bn, Boc, CBz and COCF ₃ ,
LG is a leaving group selected from Cl, Br, I, OTs or OMs;
each of X and X ¹ is C ₁ -C ₃ alkyl, which forms part of a ring system;
L represents
1) -C ₁ -C ₁₂ alkyl-;
2) aryl;
3) biphenyl;
4) thienyl;
5) -C ₁ -C ₆ alkyl-aryl-C ₁ -C ₆ alkyl or
6) -C ₁ -C ₆ alkyl-O-C ₁ -C ₆ alkyl;
R ¹ and R ¹⁰⁰ independently represent
1) N or
2) C ₁ -C ₆ alkyl;
R ² , R ³ , R ²⁰⁰ and R ³⁰⁰ each independently represents H or C ₁ -C ₆ alkyl optionally substituted with one or more R ⁷ substituents;
R ⁴ , R ⁵ , R ^5a , R ⁴⁰⁰ , R ⁵⁰⁰ and R ^500a are H;
R ⁶ and R ⁶⁰⁰ each independently represents
1) H,
2) C ₁ -C ₆ alkyl,
3) aryl or
4) C (O) (O) _n -R ¹² ,
where alkyl is optionally substituted with one or more substituents R ⁷ ;
R ⁷ represents
1) C ₁ -C ₆ alkyl,
2) C ₃ -C ₇ cycloalkyl,
3) aryl,
4) heteroaryl,
5) thienyl,
6) tetrazolyl or
7) NR ⁹ R ¹⁰ ,
wherein aryl or tetrazolyl is optionally substituted with one or more R ¹¹ substituents;
R ⁸ represents
1) N or
2) C ₁ -C ₆ alkyl,
R ⁹ and R ¹⁰ each independently represents
1) N or
2) C (O) YR ¹² ,
R ¹¹ represents
1) halogen
2) halogenated,
3) OR ⁸ ,
4) aryl or
5) tetrazolyl,
R ¹² is C ₁ -C ₆ alkyl optionally substituted with one or more R ⁷ substituents;
where aryl is a carbocyclic aromatic monocyclic group containing 6 carbon atoms, which may be fused to a second 5- or 6-membered carbocyclic group, which may be aromatic, saturated or unsaturated, and aryl is attached at the position on the carbocyclic aromatic monocyclic group containing 6 carbon atoms, or optionally on a second 5- or 6-membered carbocyclic group, which may be aromatic, saturated or unsaturated. 19. A method for preparing a pharmaceutically acceptable salt of a compound of formula (I) according to any one of claims 1-16, by treating a compound of formula I 1-2 with equivalents of a pharmaceutically acceptable acid. 20. A pharmaceutical composition for treating or preventing a proliferative disorder or disease state characterized by insufficient apoptosis, comprising a therapeutically effective amount of a compound according to any one of claims 1-16, and a pharmaceutically acceptable carrier, diluent or excipient. 21. The pharmaceutical composition according to claim 20, further comprising one or more compounds of formula I in combination with one or more death receptor agonists. 22. The pharmaceutical composition according to item 21, where the death receptor agonist is a TRAIL receptor. 23. The pharmaceutical composition according to claim 20, further comprising a therapeutic agent that enhances the response of one or more death receptor agonists. 24. The compound according to any one of claims 1 to 16 for the treatment or prevention of a proliferative disorder or disease state characterized by insufficient apoptosis. 25. The use of a compound according to any one of claims 1 to 16 for the manufacture of a medicament for the treatment or prevention of a proliferative disorder or disease state characterized by insufficient apoptosis. 26. The use of a compound according to any one of claims 1 to 16 in combination with a death receptor agonist for treating or preventing a proliferative disorder or disease state characterized by insufficient apoptosis. 27. The use of claim 26, wherein the death receptor agonist is a TRAL or TRAIL antibody receptor. 28. The probe, which is a compound according to any one of claims 1 to 16, and labeled with a detectable label or affinity tag selected from the group consisting of fluorescein, oregon green, dansil, rhodamine, tetramethylrodamine, texas red, Eu ³⁺ ; luciferase, tritium, I ¹²⁵ , biotin and polyhistidine. 29. The probe according to p. 28, having the following formula:

30. A method for identifying compounds that bind to the IAP BIR domain, where such an analysis includes:
a) contacting the IAP BIR domain with the probe of claim 28 to form a probe-BIR domain complex, wherein said probe is a replaceable test compound;
b) measuring the signal from the probe to establish a reference level;
c) incubation of the probe complex: BIR domain with test compound;
d) measuring the signal from the probe;
e) comparing the signal from step d) with a control level, while signal modulation is an indication that the test compound binds to the BIR domain. 31. A compound selected from the group consisting of

or its pharmaceutically acceptable salts. 32. The method of obtaining the compounds of formula 5ii, where the method includes
a) mixing two intermediate compounds represented by formula 5-i:

and LG-L-LG in a solvent in the presence of a base and
b) removing the protective group PG ³ to obtain a compound of formula I represented by formula 5-ii:

or its salt,
where PG ³ represents a protective group selected from Alloc, Fmoc, Bn, Boc, CBz and COCF ₃ ,
LG is a leaving group selected from Cl, Br, I, OTs or OMs;
X and X ¹ each represents C ₁ -C ₃ alkyl, which forms part of the ring system;
Z represents
1) -N (R ⁸ ) CON (R ⁸ ) -,
2) -N (R ⁸ ) C (O) -aryl-C (O) N (R ⁸ ) -,
3) -C (O) -,
4) -N (R ⁸ ) -C (O) C (O) -N (R ⁸ ) -,
5) -N (R ⁸ ) -C (O) -C ₁ -C ₁₂ -alkyl-C (O) -N (R ⁸ ) -,
6) -N (R ⁸ ) -C (O) -heteroaryl-C (O) -N (R ⁸ ) -,
7) -N (R ⁸ ) -C (O) -biphenyl-C (O) -N (R ⁸ ) -,
8) -N (R ⁸ ) -S (O) ₂ -aryl-S (O) ₂ -N (R ⁸ ) - or
9) -N (R ⁸ ) -S (O) ₂ -biphenyl-S (O) ₂ -N (R ⁸ ) -,
R ¹ and R ¹⁰⁰ independently represent
1) N or
2) C ₁ -C ₆ alkyl;
R ² , R ³ , R ²⁰⁰ and R ³⁰⁰ each independently represents H or C ₁ -C ₆ alkyl optionally substituted with one or more R ⁷ substituents;
R ⁴ , R ⁵ , R ^5a , R ⁴⁰⁰ , R ⁵⁰⁰ and R ^500a are H;
R ⁶ and R ⁶⁰⁰ each independently represents
1) H,
2) C ₁ -C ₆ alkyl,
3) aryl or
4) C (O) (O) _n -R ¹² ,
where alkyl is optionally substituted with one or more substituents R ⁷ ;
R ⁷ represents
1) C ₁ -C ₆ alkyl,
2) C ₃ -C ₇ cycloalkyl,
3) aryl,
4) heteroaryl,
5) thienyl,
6) tetrazolyl or
7) NR ⁹ R ¹⁰ ,
wherein aryl or tetrazolyl is optionally substituted with one or more R ¹¹ substituents;
R ⁸ represents
1) N or
2) C ₁ -C ₆ alkyl,
R ⁹ and R ¹⁰ each independently represents
1) N or
2) C (O) YR ¹² ,
R ¹¹ represents
1) halogen
2) halogenated,
3) OR ⁸ ,
4) aryl or
5) tetrazolyl,
R ¹² is C ₁ -C ₆ alkyl optionally substituted with one or more R ⁷ substituents;
where aryl is a carbocyclic aromatic monocyclic group containing 6 carbon atoms, which may be fused to a second 5- or 6-membered carbocyclic group, which may be aromatic, saturated or unsaturated, and aryl is attached at the position on the carbocyclic aromatic monocyclic group containing 6 carbon atoms, or optionally on a second 5- or 6-membered carbocyclic group, which may be aromatic, saturated or unsaturated. 33. The method of obtaining the compounds of formula 6v, where the method includes:
a) mixing two intermediate compounds represented by formula 6-iv:

and

in a solvent with a coupling agent, and b) removing the PG ³ protecting group to give a compound of formula 6-v:

where PG ³ represents a protective group selected from Alloc, Fmoc, Bn, Boc, CBz and COCF ₃ ,
each of X and X ¹ is C ₁ -C ₃ alkyl, which forms part of a ring system;
L represents
1) -C ₁ -C ₁₂ alkyl-;
2) aryl;
3) biphenyl;
4) thienyl;
5) -C ₁ -C ₆ alkyl-aryl-C ₁ -C ₆ alkyl or
6) -C ₁ -C ₆ alkyl-O-C ₁ -C ₆ alkyl;
R ¹ and R ¹⁰⁰ independently represent
1) N or
2) C ₁ -C ₆ alkyl;
R ² , R ³ , R ²⁰⁰ and R ³⁰⁰ each independently represents H or C ₁ -C ₆ alkyl optionally substituted with one or more R ⁷ substituents;
R ⁴ , R ⁵ , R ^5a , R ⁴⁰⁰ , R ⁵⁰⁰ and R ^500a are H;
R ⁶ and R ⁶⁰⁰ each independently represents
1) H,
2) C ₁ -C ₆ alkyl,
3) aryl or
4) C (O) (O) _n -R ¹² ,
where alkyl is optionally substituted with one or more substituents R ⁷ ;
R ⁷ represents
1) C ₁ -C ₆ alkyl,
2) C ₃ -C ₇ cycloalkyl,
3) aryl,
4) heteroaryl,
5) thienyl,
6) tetrazolyl or
7) NR ⁹ R ¹⁰ ,
wherein aryl or tetrazolyl is optionally substituted with one or more R ¹¹ substituents;
R ⁸ represents
1) N or
2) C ₁ -C ₆ alkyl,
R ⁹ and R ¹⁰ each independently represents
1) N or
2) C (O) YR ¹² ,
R ¹¹ represents
1) halogen
2) halogenated,
3) OR ⁸ ,
4) aryl or
5) tetrazolyl,
R ¹² is C ₁ -C ₆ alkyl optionally substituted with one or more R ⁷ substituents;
where aryl is a carbocyclic aromatic monocyclic group containing 6 carbon atoms, which may be fused to a second 5- or 6-membered carbocyclic group, which may be aromatic, saturated or unsaturated, and aryl is attached at the position on the carbocyclic aromatic monocyclic group containing 6 carbon atoms, or optionally on a second 5- or 6-membered carbocyclic group, which may be aromatic, saturated or unsaturated.