MX2008005477A - Iap bir domain binding compounds - Google Patents

Abstract

The present disclosure relates to compounds that bind to IAP BIR domains, more particularly the BIR2 and BIR3 domains. The compounds are represented by Formula 1:(I) These compounds have been found to be useful in altering apoptotic responses in cells which can lead to the treatment of proliferative disorders. Apoptotic pathways are known to play a critical role in the development of cancer, autoimmune disorders and neurodegenerative diseases. A process to make the compounds of Formula 1 is also disclosed.

Description

IAP BIR DOMAIN COMPOSITION FIELD OF THE INVENTION The present invention has to do with compounds that bind to the BIR domains of IAP, and more particularly the BIR2 and BIR3 domains, and are useful for treating proliferative disorders.

BACKGROUND OF THE INVENTION Apoptosis, or programmed cell death, normally occurs in the development and maintenance of healthy tissues in multicellular organisms. It is known that apoptotic trajectories play a critical role in embryonic development, viral pathogenesis, cancer, autoimmune disorders and neurodegenerative diseases, as well as other cases. Alterations in an apoptotic response have been implicated in the development of cancer, autoimmune diseases, such as systemic lupus erythematosus and multiple sclerosis, and in viral infections, including those associated with herpes viruses, poxviruses and adenoviruses. Caspases, a class of cysteine proteases, are known to initiate apoptosis after they have been activated. Inhibitors of apoptosis proteins (IAPs) are a family of proteins, which contain one three repeating Baculovirus IAP domains (BIR), particularly BIR1, BIR2 and BIR3, and may also contain a RING zinc finger domain in the C term. Examples of human IAPs include, XIAP, HIAP1 (also referred to as cIAP2) and HIAP2 (cIAPl) each has three BIR domains, and one carboxy terminal RING zinc finger. The NAIP has three BIR domains (BIR1, BIR2 and BIR3), but not the RING domain, while Livin and ILP2 have a single BIR domain and a RING domain. X-linked inhibitor prototype apoptosis (XIAP) can not only inhibit caspases activated by direct binding to caspases, but XIAP can also remove caspases and the second mitochondrial caspase activator (Smac) through the proteasome pathway mediated by ubiquitylation via the E3 ligase activity of a zinc finger domain RING. The BIR3 domain binds to XIAP and inhibits caspase-9 which can activate caspase-3. The BIA2 linker domain of XIAP inhibits the activity of caspases-3 and 7 effectors. The BIR domains have also been associated with the interactions of the IAPs, with the associated factor of tumor necrosis factor (TRAFs) -l and 2, and with TAB1. Taken together, IAPs function as a restriction to apoptosis and can directly contribute to the progress and resistance of the tumor in the intervention pharmaceutical Interestingly, the results demonstrate that resistance to apoptosis can be decreased by siRNA and antisense directed against specific IAPs in cells. Therefore, it is suggested that the interference with the activity of the IAPs could be advantageous in the sensitization of diseased cells to apoptosis. A series of endogenous ligands are capable of interfering with IAP-caspase interactions. The crystallographic X-ray structure of BIR2 and BIR3 from XIAP reveals a gap and a critical junction groove on the surface of each BIR domain. Two mammalian mitochondrial proteins have been identified, particularly the second activator derived from mitochondria of caspases (Smac) and Omi / Htra2 and four proteins of Drosophila (Reaper, HID, Grim and Sickle) which interfere with the function of IAP binding to these sites in your respective BIR domain. Each of these IAP inhibitors possess a short amino terminal tetrapeptide, similar to AXPY or AVPI, the sequence which fits into this gap and disrupts protein / protein interactions such as IAP-caspase interactions. Even if the total folding of individual BIR domains is generally conserved, there are alterations in the amino acid sequences that form the gap and the binding groove. As such, the union affinities vary between each of the BIR domains. A number of compounds have been described, which supposedly bind XIAP including Wu et al., Chemistry and Biology, Vol. 10, 759-767 (2003); US published patent application number US2006 / 0025347A1; US published patent application number US2005 / 0197403A1; US published patent application number US2006 / 0194741A1. Some of the aforementioned compounds, while appearing to orient the BIR3 domain of XIAP, may have limited bioavailability and thus limited therapeutic application. In addition, the compounds may not be selective against other IAPs, and of course other BIR domains, such as BIR2; This lack of specificity can lead to unexpected side effects. In this way, the BIR domains of IAP represent an attractive target for the discovery and development of novel therapeutic agents, especially for the treatment of proliferative disorders such as cancer.

SUMMARY OF THE INVENTION A novel series of compounds that bind IAPs and improve cellular apoptosis by modulation of IAP have been described, and which have pharmaceutically acceptable stability and bioavailability. The compounds cause a reduction and / or loss of IAP proteins in cells before mitochondrial depolarization occurs and avoids the interaction of caspase 3, caspase 7, and caspase 9. Therefore, the results suggest that a molecule from Pegagne it is able to de-regulate IAP proteins before cell death, thus indicating that clinically the use of the compounds may offer advantages when administered in combination with other inducers of apoptosis. Specifically, it has been shown that the compounds bind to the BIR2 and BIR3 domain of mammalian XIAP and promote apoptosis of cancer cells as a single agent or in combination with a gutemotherapeutic agent or a death receptor agonist, such as TRAIL or with receptor antibodies TRAIL agonists. In addition, it was shown that the compounds cause reduction of cellular IAPs from cells which can be blogged by a proteasome inhibitor. Advantageously, the compounds described herein have pro-apoptotic activity in several cancer cell lines such as bladder, breast, pancreatic, colon, leukemic, lung, lymphoma, multiple myeloma and ovarian, and can also find application in other cancer cell lines and in diseases where the cells are resistant to apoptosis. It was found that the compounds eliminate cancer cells in a synergistic manner with TRAIL or with TRAIL agonist receptor antibodies. These results suggest that the compounds of the present invention will demonstrate anti-cancer activity against solid tumors and tumors that originate from hematological malignancies. In addition, the compounds of the present invention can also find application in preventing cancer cell metastasis, invasion, inflammation, and in other diseases characterized by cells that are resistant to apoptosis. The compounds may also be useful in the treatment of autoimmune diseases. According to an aspect or embodiment of the present invention, there is provided an isomer, an enantiomer, a diastereomer or a tautomer of a compound represented by Formula I: I or a salt thereof, where: n is O or l; m is 0, 1 or 2; p is 1 or 2; And it is NH, O or S; A and A1 are independently selected from 1) -CH2-, 2) -CH2CH2-, 3) -C (CH3) 2-, 4) -CH (C? -C6 alkyl) -, 5) -CH (cycloalkyl) C3-C7) -, 6) -C3-C7-cycloalkyl-, 7) -CH (C6-C6-cycloalkyl) alkyl C3-C7) -. or 8) -C (O) -; B and B1 are independently Ci-Cg alkyl; BG is 1) X-L-X1-; or BG is X and X1 are independently selected from 1) 0, NR ", S, O 2)?". O 3) ^ u 4) H, 7) H; L is selected from: 1) -C, -C, -C-, 2-) alkyl-C2-C6-alkenyl, 3) -C2-C4-alkynyl, 4) -C3-C7-cycloalkyl, 5) -phenyl-, 6) -biphenyl-, 7) -heteroaryl-, 8) -heterocyclyl-, -alkyl of C? -C6- (C2-Ce alkenyl) Ci-C- alkyl-, 10) -Cl alkyl -Cβ- (C2-C4 alkynyl) -C6 alkyl, -6) -C6 alkyl- (C3-C7 cycloalkyl) -C6 alkyl-C6, 12) -alkyl of C? -C6-phenyl-alkyl of 13) -alkyl of C? -C6-biphenyl-alkyl of 14 -. 14-C6-C6-heteroaryl-alkyl alkyl of 15) -Ci-C3-heterocyclyl-alkyl alkyl 16) -alkyl of C? -C6-0-Ci-C? Alkyl; R1, R100, R2 and R200 are independently selected from: 1) H, or 2) C? -C6 alkyl optionally substituted with one or more substituents R6; Q and Q1 are each independently 1) NR4R5, 2) OR11, or 3) S (0) mRn; o and Q1 are each independently wherein G is a ring of 5, 6 or 7 members which optionally incorporates one or more heteroatoms chosen from S, N or O, the ring replacing optionally with one or more substituents R12; R4 and R5 are each independently 1) H, 2) haloalkyl, 3) < -alkyl of C? -C6, 4) < -C2-C6 alkenyl, 5) < -C2-C4 alkynyl, 6) < -C3-C7 cycloalkyl, 7) < C3-C7-C7-cycloalkenyl, 8) -aryl, 9) < -heteroaryl, 10) < -heterocyclyl, 11) < -heterobicyclyl, 12) -C (0) -Rn, 13) < -C (0) 0-Rn, 14) < -C (= Y) NR8R9, or 15) < r-S (O) 2-11, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; R6 is 1) halogen, 2) N02, 3) CN, 4) haloalkyl, 5) C6-6 alkyl, 6) C2-C6 alkenyl, 7) C2-C4 alkynyl, 8) C3-C7 cycloalkyl, 9) C3-C7 cycloalkenyl, ) aryl, 11) heteroaryl, 12) heterocyclyl, 13) heterobicyclyl, 14) OR7, 15) S (0) mR7 16) NR8R9, 18) COR '19) C (0) OR7, 20) CONR8R9, 21) S (0) 2NR8R9 22) OC (0) R7, 23) OC (0) Y-Ru, 24) SC (0) R7, or 25) NC (Y) NR8R9, wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; R7 is 1) H, 2) haloalkyl, 3) C6-6 alkyl, 4) C2-Cd alkenyl, 5) C2-C4 alkynyl, 6) C3-C7 cycloalkyl, 7) C3-C7 cycloalkenyl , 8) aryl, 9) heteroaryl, 10) heterocyclyl, 11) heterobicyclyl, 12) R8R9NC (= Y), or 13) C6-C6 alkyl-C2-C4 alkenyl, or 14) C6-C6 alkyl -C2-C4alkynyl, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; R8 and R9 are each independently 1) H, 2) haloalkyl, 3) C? -C6 alkyl, 4) C2-C6 alkenyl, 5) C2-C4 alkynyl, 6) C3-C7 cycloalkyl, 7) C3-C7 cycloalkenyl, 8) aryl, 9) heteroaryl, 10) heterocyclyl, 11) heterobicyclyl, 12) C (0) Rn, 13) C (0) Y-Rn, or 14) S (0) 2-Rn, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R8; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; or R8 and R9 together with the nitrogen atom to which they are attached form a five, six, or seven membered heterocyclic ring optionally substituted with one or more R6 substituents; R10 is 1) halogen, 2) N02, 3) CN, 4) B (OR13) (OR14), ) C 1 -C 6 alkyl, 6) C 2 -C 6 alkenyl, 7) C 2 -C 4 alkynyl, 8) C 3 -C 7 cycloalkyl, 9) C 3 -C 7 cycloalkenyl, 10) haloalkyl, 11) OR 7, 12 ) NR8R9, 13) SR7, 14) COR7, 15) C (0) OR7, 16) S (0) mR7, 17) CONR8R9, 18) S (0) 2NR8R9, 19) aryl, 20) heteroaryl, 21) heterocyclyl , or 22) heterobicyclyl, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, and cycloalkenyl are optionally substituted with one or more substituents R6; R11 is 1) haloalkyl, 2) C6-C6 alkyl, 3) C2-Ce alkenyl, 4) C2-C4 alkynyl, 5) C3-C7 cycloalkyl, 6) C3-C7 cycloalkenyl, 7) aryl, 8) heteroaryl, 9) heterocyclyl, or 10) heterobicyclyl, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; R12 is 1) haloalkyl, 2) C6-C6 alkyl, 3) C2-C6 alkenyl, 4) C2-C4 alkynyl, 5) C3-C7 cycloalkyl, 6) C3-C7 cycloalkenyl, 7) aryl , 8) heteroaryl, 9) heterocyclyl, 10) heterobicyclyl, 11) C (0) -R, 12) C (0) 0-R, 13) C (0) NR8R9, 14) S (0) mRn, or 15) C (= Y) NR8R9, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; R 13 and R 14 are each independently 1) H, or 2) Ci-Cß alkyl, or R 13 and R 14 combine to form a heterocyclic ring or a heterobicyclyl ring, or a prodrug, or the compound of Formula I is labeled with a detectable label or affinity tag According to an alternative aspect of the present invention, a compound is provided, according to Formula 2: 2 where n, R1, R2, R100, R200, A, A1, Q, Q1, B, B1, and BG as defined in the above; where the dotted line represents a hypothetical dividing line to compare the substituents associated with Ml and M2. In another aspect of the present invention, M1 is the same as M2. In another aspect of the present invention, M1 is different from M2. In one aspect of the present invention, there is provided an intermediate compound represented by Formula 2 (iii): 2 (¡ü) where PG2 is a protective group, and R1, R2, B, A, and Q are as defined herein. In another aspect of the present invention, an intermediate compound represented by Formula 3 (iii) is provided: where B, B1, A, A1, Q and Q1 are as defined at the moment. In another aspect of the present invention, there is provided an intermediate compound represented by Formula 4 (iii): R2 H O A ~ .Q 4 (iii) wherein PG3 is a protecting group, and B, R1, R2, A, and Q are as defined herein. In another aspect of the present invention, an intermediate compound represented by Formula 5 (i) is provided: where PG3 are protective groups, and B, B1, R1, R100, R2, R200, A, A1, Q and Q1 are as defined herein. In another aspect of the present invention, there is provided an intermediate compound represented by Formula 6 (iii): 6 (iii) wherein PG3 is a protecting group, and R1, R2, B, A, and Q are as defined herein. In another aspect of the present invention, there is provided an intermediate compound represented by Formula 7 (iii): 7 (iti) wherein PG3 is a protecting group, and R1, R2, B, A, and Q are as defined herein. In another aspect of the present invention, there is provided an intermediate compound represented by Formula 8 (iii): where B, B1, A, A1, Q and Q1 are as defined herein. In another aspect of the present invention, provides a process for producing compounds represented by Formula I, described above, the process comprising: a) coupling two intermediates represented by Formula 2 (iii): 2 (iii) in a solvent; and b) removing the protecting groups so as to form compounds of Formula 1. In another aspect of the present invention, there is provided a process for producing compounds represented by Formula I, described above, the process comprising: a) coupling an intermediate represented by Formula 3 (iii): Y in a solvent; Y b) removing the protecting groups so that they form compounds of Formula 1. In another aspect of the present invention, there is provided a process for producing compounds represented by Formula I, described herein, the process comprising: a) coupling an intermediary represented by Formula 4 (iii): 4 (iii) and a diacid activity, such as a diacid chloride or a diacid activity using 2 eguivalents of peptide coupling agents, in a solvent; and b) removing the protecting groups so as to form compounds of Formula 1. In another aspect of the present invention, there is provided a process for producing compounds represented by Formula I, described herein, the process comprising: a) coupling two intermediaries represented by Formula 4 (iii): 4 (Üi) and with triphosgene, or an equivivalent triphosgene, in a solvent; and b) removing the protecting groups so as to form compounds of Formula 1. In another aspect of the present invention, there is provided a process for producing compounds represented by Formula I, described herein, the process comprising: a) coupling two intermediaries represented by Formula 4 (iii): 4 (iii) with oxalyl chloride in a solvent; and b) removing the protecting groups so that they form compounds of Formula 1. In another aspect of the present invention, there is provided a process for producing compounds represented by Formula I, described herein, the process comprising: a) coupling an intermediary represented by Formula 6 (iii): 6 (iii) and either a bis-acid chloride or a bis-acid, using a coupling agent, in a solvent; and b) removing the protecting groups so as to form compounds of Formula 1. In another aspect of the present invention, there is provided a process for producing compounds represented by Formula I, described herein, the process comprising: a) coupling an intermediary represented by Formula 7 (iii): 7 (iii) and to diamine using a coupling agent in a solvent; and b) removing the protecting groups so that they form compounds of Formula 1. In another aspect of the present invention, a process for producing compounds is provided. represented by Formula I, described above, the process comprises: a) coupling an intermediate represented by Formula 8 (iii): R PG2N ^ CO2H and R2 in a solvent; and b) removing the protecting groups so as to form compounds of Formula 1. In another aspect of the present invention, there is provided a process for producing compounds represented by Formula I, described above, the process comprising: a) hydrogenation of a compound represented by in a solvent, b) filtration and concentration of the solvent to provide a compound of the formula lq. In another aspect of the present invention, there is provided a pharmaceutical composition comprising a compound, as described above, in admixture with a pharmaceutically acceptable carrier, diluent or excipient. In another aspect of the present invention, there is provided a pharmaceutical composition adapted for administration as an agent for treating a proliferative disorder in a subject, comprising a therapeutically effective amount of a compound, as described above. In another aspect of the present invention, there is provided a pharmaceutical composition comprising a compound of Formula I in combination with one or more death receptor agonists, for example, a TRAIL receptor agonist. In another aspect of the present invention, there is provided a pharmaceutical composition comprising a compound of the formula I in combination with any therapeutic agent that increases the response of one or more death receptor agonists, for example cytotoxic cytokines such as interferons.

In another aspect of the present invention, there is provided a method for preparing a pharmaceutical composition, the method comprising: mixing a compound, as described above, with a pharmaceutically acceptable carrier, diluent or excipient. In another aspect of the present invention, there is provided a method for treating a disease state characterized by insufficient apoptosis, the method comprising: administering to a subject in need thereof, a therapeutically effective amount of a pharmaceutical composition, as described herein. above, so that it addresses the disease state. In another aspect of the present invention, a method of modulating IAP function is provided, the method comprising: contacting a cell with a compound of the present invention in a manner that prevents binding of a BIR binding protein to a BIR domain of IAP, therefore modulates the IAP function. In another aspect of the present invention, there is provided a method of treating a proliferative disease, the method comprising: administering to a subject in need thereof, a therapeutically effective amount of the pharmaceutical composition, as described above, so that treat proliferative disease.

In another aspect of the present invention, there is provided a method for treating cancer, the method comprising: administering to a subject in need thereof, a therapeutically effective amount of the pharmaceutical composition, as described above, so as to treat the Cancer. In another aspect of the present invention, there is provided a method of treating cancer, the method comprising: administering to the subject in need thereof, a therapeutically effective amount of a pharmaceutical composition, as described above, in combination or sequentially with a agent selected from: a) an estrogen receptor modulator, b) an androgen receptor modulator, c) a retinoid receptor modulator, d) a cytotoxic agent, e) an antiproliferative agent, f) a prenyl transferase inhibitor -protein, g) a HMG-CoA reductase inhibitor, h) an HIV protease inhibitor, i) an inverse transcriptase inhibitor, k) an angiogenesis inhibitor, 1) a PPAR-? agonist, m) a PPAR-d agonist, n) an inhibitor of resistance inherent to multiple drugs, or) an anti-emetic agent, p) an agent useful in the treatment of anemia, q) agents useful in the treatment of neutropenia, r) an improved immunological drug. s) a proteasome inhibitor; t) an HDAC inhibitor; u) an inhibitor of the guimiotripsin-like activity in the proteasome; or v) E3 ligase inhibitors; w) a modulator of the immune system such as, but not limited to, interferon-alpha, Bacillus Calmette-Guerin (BCG), and ionizing radiation (UVB) which can induce the release of cytokines, such as interieucins, TNF, or induce release of death receptor ligands such as TRAIL; x) a TRAIL death receptor modulator and TRAIL agonists such as the humanized antibodies HGS-ETR1 and HGS-ETR2; or in combination or sequentially with radiation therapy, so treat the cancer. In another aspect of the present invention, there is provided a method for the treatment or prevention of a proliferative disorder in a subject, the method comprising: administering to the subject a therapeutically effective amount of the composition, described above. In another aspect of the present invention, the method further comprises administering to the subject a therapeutically effective amount of a prior chemotherapeutic agent at, simultaneously with or after administration of the composition. In yet another aspect, the method further comprises administering to the subject a therapeutically effective amount of a death agonist receptor prior to, simultaneously with or after administration of the composition. The death agonist receptor is TRAIL or the death agonist receptor is a TRAIL antibody. The death agonist receptor is typically administered in an amount that produces a synergistic effect. The use of the compound as described above for the manufacture of a medicament for treating or preventing a disease state characterized by insufficient apoptosis. The use of the compound as described above for the manufacture of a medicament for treating or preventing a proliferative disorder. The use of the compound as described in above in combination with an agent for the manufacture of a medicament for treating or preventing a proliferative disorder, wherein the agent is selected from: a) an estrogen receptor modulator, b) an androgen receptor modulator, c) a modulator of the retinoid receptor, d) a cytotoxic agent, e) an antiproliferative agent, f) a prenyl protein transferase inhibitor, g) a HMG-CoA reductase inhibitor, h) an HIV protease inhibitor, i) a transcriptase inhibitor inverse, k) an angiogenesis inhibitor, 1) a PPAR-? agonist, m) a PPAR-d agonist, n) an inhibitor of inherent resistance to multiple drugs, or) an anti-emetic agent, p) a useful agent in the treatment of anemia, g) agents useful in the treatment of neutropenia, r) an improved immunological drug. s) a proteasome inhibitor; t) an HDAC inhibitor; u) an inhibitor of activity similar to Chymotrypsin in the proteasome; or v) E3 ligase inhibitors; w) a modulator of the immune system such as, but not limited to, interferon-alpha, Bacillus Calmette-Guerin (BCG), and ionizing radiation (UVB) which can induce the release of cytokines, such as interieucins, TNF, or induce release of death receptor ligands such as TRAIL; x) a TRAIL death receptor modulator and TRAIL agonists such as the humanized antibodies HGS-ETR1 and HGS-ETR2; or in combination or sequentially with radiation therapy. The use of the compound as described above in combination with a death agonist receptor for the manufacture of a medicament for the treatment or prevention of a proliferative disorder in a subject. The death agonist receptor is TRAIL. The death agonist receptor is a TRAIL antibody. The death agonist receptor is in an amount that produces a synergistic effect. The proliferative disorder is cancer. A pharmaceutical composition comprising the compound as described above, mixed with a pharmaceutically carrier, diluent or excipient acceptable, to treat or prevent a disease state characterized by insufficient apoptosis. A pharmaceutical composition comprising the compound of any one of claims 1 to 63 in combination with any compound that increases the level of circulation of one or more death receptor agonists to prevent or treat a proliferative disorder. A method for preparing a pharmaceutical composition, the method comprises: mixing the compound of any one of claims 1 to 63, with a pharmaceutically acceptable carrier, diluent or excipient. In another aspect of the present invention, a probe is provided, the probe is a compound of Formula I above, the compound is etched with a detectable ethylene or an affinity ethylene. In another aspect of the present invention, there is provided a method for identifying compounds that bind to an IAP BIR domain, the assay comprises: a) contacting an IAP BIR domain with a probe to form a probe: domain complex BIR, the probe is displaced by a test compound; b) measuring a signal from the probe to establish a reference level; c) incubating the probe: BIR domain complex with the test compound; d) measuring the signal of the probe; e) comparing the signal of step d) with the reference level, a modulation of the signal is an indication that the test compound binds to the BIR domain, where the probe is a compound of Formula I labeled with a label detectable or an affinity tag.

BRIEF DESCRIPTION OF THE FIGURES Additional aspects and advantages of the present invention could be better understood with reference to the description in relation to the following Figure, wherein: Figure 1 is a graph illustrating a combination of anti-cancer therapy in vivo in the which compound 23 showed an increased anti-tumor effect in combination with mitomycin C with dose increase, with superior anti-tumor effects showing 5mg / kg compared to the dose of 1 mg / kg.

DETAILED DESCRIPTION OF THE INVENTION In many cancers and other diseases, an up-regulation of IAP induced by gene defect or by chemotherapeutic agents have been correlated with increased resistance to apoptosis. Interestingly, Results show that cells reduced in IAP levels are more sensitive for TRAIL-induced apoptosis. It is believed that a small molecule, which could induce the loss of IAP from diseased cells, could be useful as a therapeutic agent. The present compounds were reported to be able to bind directly to IAPs, causing a down regulation of the IAP proteins in the cell before cell death, inducing apoptosis in cancer cells, and having a synergistic effect in combination with inducers of apoptosis. This may provide clinical advantages in terms of the selectivity of therapy based on the phenotype of the cancer cells. The use of the compounds of the present invention in combination with therapy with other agents in terms of the dose of administration and the timing of dose programming could also be advantageous. The compounds of the present invention are useful as a BIR domain that binds compounds in mammalian IAPs and are represented by Formula I. The following are modalities, groups and substituents of the compounds according to Formula I, which are described in more detail ahead. n: In a subset of the compounds of the Formula 1, n is 1. Each and every one of the individual definition of n as explained herein can be combined with each and every one of the individual definition of the Nucleus, R1, R2, R100, R200, A, A1, Q, OB, B1, and BG as explained herein.

A and A1: In a subset of the compounds of Formula 1, A and A1 are both CH2. In an alternative subset of the compounds of Formula 1, A and A1 are both C = 0. In another alternative subset of the compounds of Formula 1, A is CH2 and A1 is C = 0. Each and every one of the individual definition of A and A1 as explained herein may be combined with each and every one of the individual definition of the Nucleus, n, R1, R2, R100, R200 Q, Q1, B, B1, and BG as explained in this.

Nucleus: Therefore, the present invention comprises compounds of the Formula a: 1a 1b 1c wherein BG, B, B1, Q, Q1, R1, R100, R2 and R200 are as defined above and hereafter. In one example, the present invention comprises compounds of Formula la. In an alternative example, the present invention comprises compounds of Formula Ib. Each and every one of the individual definition of the Nucleus as explained herein may be combined with each and every one of the individual definition of A, A1, n, R1, R2, R100, R200, Q, Q1, B, B1, and BG as explained herein.

B and B1: In a subset of the aforementioned compounds, B and B1 are both C?-C4 alkyl. Each and every one of the individual definition of B and B1 as explained herein may be combined with each and every one of the individual definition of the Nucleus, A, A1, n, R1, R2, R100, R200, Q, Q1, and BG as explained herein.

BG: In a subset of the aforementioned compounds, BG is -X-L-X1-. Therefore the invention comprises compounds of the Formula Id and it: 1d 1? wherein L, B, B1, X, X1, Q, Q1, R1, R100, R2 and R200 are as defined herein. In an alternative subset of the aforementioned compounds, BG is Therefore, the invention alternatively comprises compounds of Formula lf or lg: 1f 1g wherein A, A1, B, B1, Q, Q1, R1, R100, R2 and R200 are as defined herein. Each and every one of the individual definition of BG as explained herein may be combined with each and every one of the individual definition of the Nucleus, A, A1, n, R1, R2, R100, R200, Q, Q1, B, and B1 as explained herein.

X and X1: In a subset of the aforementioned compounds, X and X1 are independently selected from 1) 0, NH, OR ^, Jé '6) V, or In another subset of the aforementioned compounds, X and X1 are independently selected from: 1) 0, Typical examples of X and X1 include both X and X1 Each and every one of the individual definition of X and X1 as explained herein may be combined with each and every one of the individual definition of the Nucleus, A, A1, n, R1, R2, R100, R200, Q, Q1, B, B1, and BG as explained in this.

L: In a subset of the aforementioned compounds, L is selected from: 1) -alkyl Ci-Cio-, 2) -alkyl group of C2-C4-, 3) -phenyl-, 4) -biphenyl-, 5) -alkyl of C? -C6- (alginyl of C2-C4) -alkyl of C? -C6,6) -alkyl of C? -C6-phenyl-alkyl of Ci-Ce, 7) -alkyl of C? -C6-biphenyl-C? -C6 alkyl, or 8) -alkyl of C? -C6-0-alkyl of C? -C6. In another subset of the aforementioned compounds, L is selected from 1) -alkyl of C? ~ C? 0-, 2) -phenyl-, 3) -biphenyl-, 4) -CH2- (C2-C4 alkynyl) -CH2-, 5) -CH2-phenyl-CH2-, 6) -CH2-biphenyl-CH2-, or 7) -Ci-C-O-alkyl-Ci-Cd alkyl- Typical examples of L include Each and every one of the individual definition of L as explained herein can be combined with all and each of the individual definition of the Nucleus, A, A1, n, R1, R2, R100, R200, Q, Q1, B, and B1 as explained herein.

A: In the above-mentioned aspect, r is an integer of 1, 2, 3, 4, 5, 6, 7, or 8. Each and every one of the individual definition of r as explained herein may be combined with each and every one of the individual definition of the Nucleus, A, A1, n, R1, R2, R100, R200, Q, Q1, B, and B1 as explained herein. More explicitly, the invention comprises compounds of the Formula lh, li, lj, lk, 11, and lm: twenty 1m wherein B, B1, X, X1, Q, Q1, R100, R2 and R200 are as defined herein.

R1 and R100: In a subset of the aforementioned compounds R1 and R100 are both C?-C6 alkyl. In one example, R1 and R100 are both CH3. Each and every one of the individual definition of R1 and R100 as explained herein may be combined with each and every one of the individual definition of the Nucleus, A, A1, n, R2, R200, Q, Q1, B, B1, and BG as explained herein.

R2 and R200: In a subset of the aforementioned compounds R2 and R200 are both Ci-Cß alkyl. In one example, R2 and R200 are both CH3. Each and every one of the individual definition of R2 and R200 as explained herein may be combined with each and every one of the individual definition of the Core, A, A1, n, R1, R100, Q, Q1, B, B1, and BG as explained herein.

Q and Q1: In a subset of the compounds before mentioned, Q and Q1 are both NR4R5, wherein R4 and R5 are as defined herein. Each and every one of the individual definition of Q and Q1 as explained herein can be combined with each and every one of the individual definition of the Nucleus, A, A1, n, R1, R100, R2, R200, B, B1, and BG as explained herein.

R4 and R5: In a subset of the aforementioned compounds in which A and A1 are both C = 0, R4 is H and R5 is selected from 1) -haloalkyl, 2) "-alkyl of C? -C6, 3) < C2-C6 alkenyl, 4) -C2-C4 alkynyl, 5) < -C3-C-cycloalkyl, 6) < -C3-C7 cycloalkenyl, 7) < -aryl, 8) "-heteroaryl, 9) -heterocyclyl, or 10)" -heterobicyclyl, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and where the aril, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R 10 substituents, wherein R6 and R10 are as defined herein In another subset of the above compounds, R 4 is H and R 5 is selected from: 1) -C3-C7-cycloalkyl, 2) -C3-C7-cycloalkenyl, 3) -aryl, 4) -heteroaryl, 5) -heterocyclyl, or 6) «-heterobicyclyl. In yet another subset of the above compounds, R 4 is H and R 5 is aryl.

In an example, R4 is H and R5 is Therefore, when A and A are both C = 0, then Q and Q1 are both In an alternative subset of the aforementioned compounds in which A and A1 are both CH2, then R4 and R5 are each independently 1) H, 2) haloalkyl, 3) "-alkyl of C? -C6, 4)" -alkenyl of C2-C6, 5) «-alkynyl of C2-C4, 6)« -cycloalkyl of C3-C7, 7) «-cycloalkenyl of C3-C7 , 8) «-aryl, 9)« -heteroaryl, 10) «-heterocyclyl, 11)« -heterobicyclyl, 13) "-C (0) 0-R, 14) ^ C (= Y) NR8R9, or 15)" -S (0) 2 -Rn, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; wherein Y, R6, R8, R9, R10 and R11 are as defined herein. In another subset of the above compounds, R4 and R5 are independently selected from 1) H, 2) C? -C6 alkyl, 3) < -C (0) -Rn, 4) «-C (0) 0 -Rn, or 5)« -S (0) 2 -Rn, wherein the alkyl is substituted with a substituent R6; wherein R6, and R11 are as defined herein. In a subset of the aforementioned compounds, R4 is 1) H, 2) «-C (0) -R, 3)« -C (0) 0 -Rn, or 4) «-S (0) 2 -Rn; and R5 is Ci-Cß alkyl substituted with a phenyl; wherein R11 is as defined herein. In another subset of the aforementioned compounds, R 4 is 1) H, 2) 11 -C (0) -R 3) «-CÍOJO-R 111 where R .11 is as defined in this Each and every one of the individual definition of R4 and R5 as explained herein may be combined with each and every one of the individual definition of the Core, A, A1, n, R1, R100, R2, R200, B, B1, and BG as explained herein.

R11: In a subset of the aforementioned compounds, R 11 is 1) haloalkyl, 2) C 1 -C 6 alkyl, 3) C 2 -Ce alkenyl, 4) C 2 -C 4 alkynyl, 5) aryl, 6) heteroaryl, 7) heterocyclyl, or 8) heterobicyclyl, wherein the alkyl, alkenyl, alkynyl are optionally substituted with one or more substituents R6; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; wherein R6 and R10 are as defined herein. In another subset of the compounds before mentioned, R 11 is 1) haloalkyl, 2) C 1 -C 6 alkyl, 3) aryl, 4) heteroaryl, or 5) heterocyclyl, wherein the alkyl is optionally substituted with one or two R 6 substituents; and wherein the aryl, heteroaryl and heterocyclyl are substituted with a R10 substituent; wherein R6 and R10 are as defined herein. In a subset of the aforementioned compounds, R 11 is 1) haloalkyl, 2) C 1 -C 6 alkyl optionally substituted with one or two R 6 substituents, or 3) phenyl optionally substituted with a R 10 substituent; wherein the substituents R6 and R10 are as defined herein. Each and every one of the individual definition of R11 as explained herein may be combined with each and every one of the individual definition of the Nucleus, A, A1, n, R1, R100, R2, R200, R4, R5, B, B1, and BG as explained at the moment.

R6: In a subset of the aforementioned compounds, R6 is 1) halogen, 2) N02, 3) CN, 4) aryl, 5) heteroaryl, 6) heterocyclyl, 7) heterobicyclyl, 8) OR7, 9) SR7, or 10) NR8R9, wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more substituents R10; wherein R7, R8, R9 and R10 are as defined herein. In another subset of the aforementioned compounds, R6 is 1) halogen, 2) aryl, or 3) NR8R9, wherein the aryl is optionally substituted with a substituent R10; wherein R8, R9 and R10 are as defined herein. In a subset of the aforementioned compounds, R6 is 1) halogen, 2) phenyl, or 3) NR8R9, wherein the phenyl is optionally substituted with a substituent R10; wherein R8 and R9 are as defined herein. Each and every one of the individual definition of R6 as explained herein may be combined with each and every one of the individual definition of the Nucleus, A, A1, n, R1, R100, R2, R200, R4, R5, B, B1, and BG as explained in I presented.

R8 and R9: In a subset of the aforementioned compounds, R8 and R9 are each independently 1) H, 2) haloalguilo, 3) Ci-Cd alkyl, 4) C2-C6 alkenyl, 5) C2- alkynyl C4, 6) C3-C7 cycloalkyl, or 7) C3-C cycloalkenyl, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; wherein the substituents R6 are as defined herein. In another subset of the aforementioned compounds, R8 and R9 are each independently 1) H, or 2) C6-C6 alkyl, wherein the alkyl is optionally substituted with an aryl. Each and every one of the individual definition of R8 and R9 as explained herein may be combined with each and every one of the individual definition of the Core, A, A1, n, R1, R100, R2, R200, R4, R5, B, B1, and BG as explained herein.

R10: In one aspect of the aforementioned compounds, R 10 is 1) halogen, 2) N 0 2, 3) CN, 4) haloalguil, 5) OR7, 6) NR8R9, or 7) SR7; wherein R7, R8, and R9 are as defined herein. In another aspect of the aforementioned compounds, R10 is 1) halogen, or 2) Oalguilo of C? -C6. Each and every one of the individual definition of R10 as explained herein may be combined with each and every one of the individual definition of the Nucleus, A, AM n, R 1, R 100, R 2, R 200, R 4, R 5, B, B 1, and BG as explained herein. . Thus, when A and A1 are both CH2, then Q and Q1 are independently selected from: N The present invention also comprises an isomer, enantiomer, diastereomer or tautomer of a compound represented by Formula I: or a salt thereof, where: n is 1; m is 0, 1 or 2; And it is NH, O or S; A and A1 are independently selected from 1) -CH2-, or 2) -C (O) -; B and B1 are independently C alquilo-Ce alkyl; BG is 1) -X-L-X1-; or BG is 2) H H, X and X1 are independently selected from 1) 0, NH, S, «MA 7) H; L is selected from: I) -alkyl of C? -C? 0-, 2) -alkenyl of C2-Cß-, 3) -alkynyl of C4-, 4) -cycloalkyl of C3-C7-, 5) -phenyl -, 6) -biphenyl-, 7) -heteroaryl-, 8) -heterocyclyl-, 9) -alkyl of d-C6- (C2-C6 alkenyl) -alkyl of Ci-Cß, 10) -alkyl of C? -C6- (C2-C4 alkynyl) -Ci-Cβ alkyl, II) -C6 alkyl- (C3-C7 cycloalkyl) -Ci-Cß alkyl, 12) -C6 alkyl-C6 -phenyl-C de-C6 alkyl, 13) -alkyl of C?-C6-biphenyl-C alquilo-C6 alkyl, 14) -alkyl of C?-C6-heteroaryl-alkyl ) -Ci-Cß-heterocyclyl-C de-C6 alkyl alkyl, or 16) -C--C6-0alkyl-C?-C6 alkyl; R1, R100, R2 and R200 are selected independently of: 1) H, or 2) Ci-Cß alkyl optionally substituted with one or more substituents R6; Q and Q1 are each independently NR4R5; R4 and R5 are each independently 1) H, 2) haloalkyl, 3) "-alkyl of C? -C6, 4)" -alkenyl of C2-C6, 5) "-alkynyl of C2-C4, 6" «- C3-C7 cycloalkyl, 7) -C3-C-8-cycloalkenyl, 8) -aryl, 9) "-heteroaryl, 10)" -heterocyclyl, 11) "-hetero-cyclicyl, 12)" -CtO-R11, 13) "-CtOJO-R11, 14)" -C (= Y) NR8R9, or 15) «-S (0) 2 -Rn, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are substituted optionally with one or more substituents R Rb is 1) halogen, 2) N02, 3) CN, 4) haloalguilo, 5) C6-6 alkyl, 6) C2-C6 alkenyl, 7) C2-C4 alkynyl, 8) C3-C7 cycloalkyl , 9) C3-C7 cycloalkenyl, 10) aryl, 11) heteroaryl, 12) heterocyclyl, 13) heterobicyclyl, 14) OR7, 15) S (0) raR7, 16) NR8R9, 17) NR8S (0) 2Rn, 18 ) COR7, 19) C (0) OR7, 20) CONR8R9, 21) S (0) 2NR8R9 22) OC (0) R '23) OC (0) YR, 24) SC (0) R7, or 25) NC (Y) NR8R9, wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more substituents R10; R7 is 1) H, 2) haloalkyl, 3) Ci-Cß alkyl, 4) C2-C6 alkenyl, 5) C2-C4 alkynyl, 6) C3-C7 cycloalkyl, 7) C3-C7 cycloalkenyl, 8) aryl, 9) heteroaryl, 10) heterocyclyl, 11) heterobicyclyl, 12) R8R9NC (= Y), or 13) C6-C6 alkyl-C2-C4 alkenyl, or 14) C6-C6 alkyl C2-C4 alkynyl, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; R8 and R9 are each independently 1) H, 2) haloalkyl, 3) C6-6 alkyl, 4) C2-C6 alkenyl, 5) C2-C4 alkynyl, 6) C3-C7 cycloalkyl, 7) C3-C7 cycloalkenyl, 8) aryl, 9) heteroaryl, 10) heterocyclyl, 11) heterobicyclyl, 12) C (0) R, 13) C (0) Y-Ru, or 14) S (0) 2-R , wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more R substituents; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; or R8 and R9 together with the nitrogen atom to which they are attached form a five, six or seven membered heterocyclic ring optionally substituted with one or more substituents R6; R10 is 1) halogen, 2) N02, 3) CN, 4) B (OR13) (OR14), 5) C6-C6 algayl, 6) C2-C6 alkenyl, 7) C2-C4 alginyl, 8) cycloalguyl of C3-C7, 9) C3-C7 cycloalguenyl, 10) haloalguyl, 11) OR7, 12) NR8R9, 13) SR7, 14) COR7, 15) C (0) OR7, 16) S (0) mR7, 17 ) CONR8R9, 18) S (0) 2NR8R9, 19) aryl, 20) heteroaryl, 21) heterocyclyl, or 22) heterobicyclyl, wherein the alkenyl, alkenyl, alkynyl, cycloalkyl, and cycloalkenyl are optionally substituted with one or more substituents R6; and Ru is 1) haloalkyl, 2) C alquilo-C6 alkyl, 3) C2-C6 alkenyl, 4) C2-C4 alkynyl, 5) C3-C7 cycloalkyl, 6) C3-C7 cycloalkenyl, 7) aryl, heteroaryl, 9) heterocyclyl, or 10) heterobicyclyl, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; or a prodrug; or the compound of Formula I is labeled with a detectable label or an affinity tag. In a subset of the compounds of Formula 1, especially compounds of Formula Ib, wherein n = 1; A and A1 are both C = 0, B and B1 are independently C? -C4 alkyl; BG is -X-L-X1; or X and X1 are independently selected from 1) 0. ° _ > v. OR 4) H < *.

L is selected from 1) -Ci-Cio alkyl, 2) -phenyl-, 3) -biphenyl-, 4) -CH2- (C2-C4 alkynyl) -CH2-, 5) -CH2-phenyl-CH2- , 6) -CH2-biphenyl-CH2-, or 7) -alkyl of C? -C6-0-C? -C6 alkyl; R1, R100, R2 and R200 are each independently Q and Q1 are both NR4R5; R4 is H; and R5 is selected from: 1) -C3-C7-cycloalkyl, 2) -C3-C7-cycloalkenyl, 3) -aryl, 4) "-heteroaryl, 5)" -heterocyclyl, or 6) "-heterobicyclyl. In another subset of the compounds described above, A and A1 are both C = 0, B and B1 are independently C?-C4 alkyl; BG is X-L X1; or L is R1, R100, R2 and R200 are each independently CH3; Q and Q1 are both NR R5; R4 is H; Y RD is In an alternative subset of the compounds of Formula 1, especially compounds of Formula la, wherein n = 1; A and A1 are both CH2; B and B1 are independently C? -C alkyl; BG is -X-L-X1; or X and X1 are independently selected from 1) 0, O 2) ^ O 3) ^ ° .o L is selected from 1) -alkyl of C? -C? 0-, 2) -phenyl-, 3) -biphenyl-, 4) -CH2- (C2-C4 alkynyl) -CH2-, 5) -CH2- phenyl-CH2-, 6) -CH2-biphenyl-CH2-, or 7) -alkyl of C? -C6-0-Ci-C? alkyl; R1, R100, R2 and R200 are each independently CH3 'Q and Q1 are both NR4R5; R4 is 1) H, 2) «-C (0) -Rn, 3)« -C (0) 0 -Rn, or 4) «-S (0) 2 -Rn; and R5 is C6-C6 alkyl substituted with a phenyl; wherein R11 is as defined herein; R 11 is 1) haloalkyl, 2) C 1 -C 6 alkyl, 3) aryl, 4) heteroaryl, or 5) heterocyclyl, wherein the alkyl is optionally substituted with one or two R 6 substituents; and wherein the aryl, heteroaryl and heterocyclyl is substituted with a R10 substituent; wherein R6 and R10 are as defined herein; R6 is 1) halogen, 2) aryl, or 3) NR8R9, wherein the aryl is optionally substituted with a substituent R10; wherein R8, R9 and R10 are as defined herein; R8 and R9 are each independently 1) H, 2) haloalkyl, 3) C6-6 alkyl, 4) C2-C6 alkenyl, 5) C2-C4 alkynyl, 6) C3-C7 cycloalkyl, or C3-C-cycloalkenyl, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; wherein the substituents R6 are as defined herein; and R10 is 1) halogen, 2) N02, 3) CN, 4) haloalguil, 5) OR7, 6) NR8R9, or 7) SR7; wherein R7, R8, and R9 are as defined herein. In another subset of the aforementioned compounds, n = 1; A and A1 are both CH2; B and B1 are independently C?-C4 alkyl; BG is -X-L-X1; or X and X1 are independently selected from 1) 0, L is selected from 1) -alkyl of C? -C? O-, 2) -phenyl-, 3) -biphenyl-, 4) -CH2- (C2-C4 alkynyl) -CH2-, 5) -CH2- phenyl-CH2-, 6) -CH2-biphenyl-CH2-, or 7) -alkyl of C? -C6-0-alkyl of C? -C6; R1, R100, R2 and R200 are each independently CH 3 'Q and Q1 are both NR4R5 Rq is 1) H, 2) «-C (O) -R 111 3) -C (0) 0-R 1'1 4) -S (0) 2-R 1i1 wherein R > ?? it is as defined in the present; Ru is 1) haloalkyl, 2) C 1 -C 6 alkyl optionally substituted with one or two R 6 substituents, or 3) phenyl optionally substituted with a R 10 substituent; wherein the substituents R6 and R10 are as defined herein; R6 is 1) halogen, 2) phenyl, or 3) NR8R9, wherein the phenyl is optionally substituted with a substituent R10; wherein R8 and R9 are as defined herein; R8 and R9 are each independently 1) H, or 2) C6-C6 alkeyl, wherein the alkenyl is optionally substituted with an aryl; and R10 is 1) halogen, or 2) Oalguilo of C? -C6. In yet another subset of the aforementioned compounds, n = 1; A and A1 are both CH; B and B1 are independently C6-C4 aligyl; BG is -X-L-X1; or X and X1 are selected independently of no, 4) H *; L is selected from 1) -alguilo of C? -C? 0-, 2) -phenyl-, 3) -biphenyl-, 4) -CH2- (C2-C alkynyl) -CH2-, 5) -CH2-phenyl-CH2-, 6) -CH2-biphenyl-CH2-, or ) -alkyl of C? -C6-0-alkyl of C? -C6; R1, R100, R2 and R200 are each independently CH3; and Q and Q1 are both independently selected from In one aspect of the present invention, the compounds of the present invention may also be represented by Formula 2 in which M1 and M2 represent independent BIR-binding domains. 2 wherein n, R1, R2, R100, R200, A, A1, Q, Q1, B, B1, and BG as defined herein, and the dotted line represents a hypothetical dividing line for comparing the associated substituents with Ml and M2. In a subset of the compounds of the Formula 2, Ml is the same as M2. In an alternative subset of the compounds of Formula 2, M1 is different from M2. In yet another subset, B is the same as B1. In yet another subset B is different from B1. One skilled in the art will recognize that when M1 and M2 are the same, the substituents R1, R2, R4, R5, R6, R7, R8, R9, R10, R11, R13, R14, m, p, Y, A, Q, and B in Ml have the same meaning as the substituents R100, R200, R4, R5, R6, R7, R8, R9, R10, Ru, R13, R14, m, p, Y, A1, Q1, and B1 respectively in M2. When M1 and M2 are different, in at least one substituent R1, R2, R100, R200, R4, R5, R6, R7, R8, R9, R10, R11, R13, R14, m, p, Y, A, A1, Q, Q1, B, and B1 is different in any of Ml or M2. Alternatively substituents on Ml can be defined as R1, R2, R4, R5, R6, R7, R8, R9, R10, R11, R13, R14, m, p, Y, A, Q, and B, and those on M2 can defined as R100, R200, R400, R500, R600, R700, R800, R900, R1000, R1100, R1300, R1400, M1, P1, Y1, A1, Q1 and B1 respectively in M2. In the case where M1 and M2 are the same, the substituents R1, R2, R4, R5, R6, R7, R8, R9, R10, R11, R13, R14, m, p, Y, A, Q, and B, in Ml they have the same meaning as R100, R200, R400, D 500 1400 1 1 vl? 1 , , in, p, i,? , Q1 and B1 respectively in M2. In the case where M1 and M2 are different, at least one of the aforementioned substituents is different. If any variable, such as R6, R600, R10, R1000 and the like, occurs more than once in any constituent structure, the definition of the variable in each case is independent in each different case. If a substituent is substituted in itself with one or more substituents, it will be understood that one or more substituents can be attached to the same carbon atom or different carbon atoms. The combinations of substituents and variables defined herein are allowed only if they produce chemically stable compounds. One skilled in the art will understand that the substitution patterns and substituents in the compounds of the present invention can be selected to provide compounds that are chemically stable and can be easily synthesized using the chemistry set forth in the examples and the chemical techniques well known in the art using Start materials readily available. It will be understood that many substituents or groups described herein have eguivalents of functional groups, which means that the group or substituent can be replaced by another group or substituent which has similar electronic, hybridizing or binding properties.

Definitions Unless specified otherwise, the following definitions apply: The singular forms "a" and "an" include plural references unless the context clearly states otherwise. As used herein, the term "comprising" is intended to imply that the list of Elements that follow the word "comprising" are required or mandatory, but other elements are optional and may or may not be presented. As used herein, the term "consis of" is intended to imply that it includes and is limited to anything that follows the phrase "consis of". Thus, the phrase "consis of" indicates that the elements listed are required or are mandatory and that other elements can not be presented. As used herein, the term "alguilo" is intended to include saturated aliphatic hydrocarbon groups of both straight and branched chain having the specified number of carbon atoms, for example Ci-Cio, as in Ci-Cio algayl, is defined including groups having 1, 2 , 3, 4, 5, 6, 7, 8, 9 or 10 carbon atoms in a linear or branched arrangement, and Ci-Cβ, as in C al-C6 algayl, is defined to include groups that have 1, 2, 3, 4, 5 or 6 carbons in a linear or branched arrangement, and C? -C4, as in C? ~ C4 algayl, is defined to include groups having 1, 2, 3 or 4 carbons in a linear or branched arrangement . Examples of Ci-Ce alkyl and C?-C4 alkyl, as defined above, include, but are not limited to, methyl, ethyl, n-propyl, i-propyl, n-butyl, t-butyl, i -butyl, pentyl and hexyl. As used herein, the term "alkenyl" is intended to mean groups of unsaturated straight or branched chain hydrocarbons having the specified number of carbon atoms therein, and in which at least two of the carbon atoms are linked together by a double bond, and that they have regioguimica either E or Z and combinations thereof. For example, C2-Cd, as in C2-Ce algenyl, is defined to include groups having 1, 2, 3, 4, 5 or 6 carbons in a linear or branched arrangement, at least two of the carbon atoms bonding by a double link Examples of C2-C6 alkenyl include ethenyl (vinyl), 1-propenyl, 2-propenyl, 1-butenyl and the like. As used herein, the term "alkynyl" is intended to imply groups of straight chain, unsaturated hydrocarbons, which have the specified number of carbon atoms therein and in which at least two carbon atoms are linked by a triple link. For example, C2-C4, as in C2-C4 alkynyl, is defined to include groups that have 2, 3 or 4 carbon atoms in a chain, at least two of the carbon atoms bonding through a triple bond. Examples of such alynyl include ethynyl, 1-propynyl, 2-propynyl and the like. As used herein, the term "cycloalguyl" is intended to imply a group of monocyclic saturated aliphatic hydrocarbons having the specified number of carbon atoms therein, eg, C3-C7, as in C3-C7 cycloalkyl, is defined to include groups which have 3, 4, 5, 6, 6, 7, 7 carbon atoms in a monocyclic disposition. Examples of C3-C cycloalkyl, as defined above, include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and cycloheptyl. As used herein, the term "cycloalgenyl" is intended to mean a group of monocyclic saturated aliphatic hydrocarbons having the specified number of carbon atoms therein, eg, C3-C7, as in C3-C7 cycloalkenyl. , is defined by including groups that have 3, 4, 5, 6 or 7 carbons in a monocyclic arrangement. Examples of C3-C7 cycloalgenyl, as defined above, include, but are not limited to, cyclopentenyl and cyclohexenyl. As used herein, the term "halo" or "halogen" is intended to mean fluorine, chlorine, bromine and iodine. As used herein, the term "haloalguyl" is intended to mean an alger as defined above, in which each hydrogen atom can be successively replaced by a halogen atom. Examples of haloalkyls include, but are not limited to CH2F, CHF2 and CF3. As used herein, the term "aryl", either alone or in combination with another radical, means a carbocyclic aromatic monocyclic group containing 6 carbon atoms which may also be fused to a second 5 or 6 membered carbocyclic group. , which can be aromatic, saturated or unsaturated. Aryl includes, but is not limited to, phenyl, indanyl, 1-naphthyl, 2-naphthyl and tetrahydronaphthyl. The fused aryls can be connected to another group in a suitable position in either the cycloalkyl ring or the aromatic ring. For example: The lines with arrows, drawn from the ring system, indicate that the bond can be attached to any of the ring's appropriate atoms. As used herein, the term "biphenyl" is intended to mean two phenyl groups linked at any one of the available sites on the phenyl ring. The biphenyl may be covalently linked to other groups from any available position on the phenyl rings. For example: As used herein, the term "heteroaryl" is intended to mean a monocyclic or bicyclic ring system of up to ten atoms, wherein at least one ring is aromatic, and contains from 1 to 4 heteroatoms selected from the group consisting of O, N and S. The heteroaryl substituent can be attached either through a ring carbon atom or one of the heteroatoms. Examples of heteroaryl groups include, but are not limited to, thienyl, benzimidazolyl, benzo [b] thienyl, furyl, benzofuranyl, pyranyl, isobenzofuranyl, chromenyl, xanthenyl, 2H-? Aryl, pyrrolyl, imidazolyl, pyrazolyl, pyridyl, pyrazinyl, pyrimidinyl. , pyridazinyl, indolizinyl, isoindolyl, 3H-indolyl, indolyl, indazolyl, purinyl, 4H-quinolizinyl, isoquinolyl, quinolyl, phthalazinyl, naphthyridinyl, quinoxalinyl, quinazolinyl, cinolinyl, pteridinyl, isothiazolyl, isochromanyl, chromanyl, isoxazolyl, furazanyl, indolinyl, isoindolinyl , thiazolo [4,5-b] -pyridine, and fluoroscene derivatives such as: As used herein, the term "heterocycle", "heterocyclic" or "heterocyclyl" is intended to mean a 5, 6 or 7 membered non-aromatic ring system containing 1 to 4 heteroatoms Examples of heterocycles include, but are not limited to, pyrrolidinyl, tetrahydrofuranyl, piperidyl, pyrrolinyl, piperazinyl, imidazolidinyl, morpholinyl, imidazolinyl, pyrazolidinyl, pyrazolinyl, and As used herein, the term "heterobicyclo", either alone or in combination with another radical, is intended to mean a heterocycle as defined above, fused to another cycle, be it a heterocycle, an aryl or any other another cycle defined in the present. Examples of such heterobicycles include, but are not limited to, coumarin, benzo [d] [l, 3] dioxol, 2,3-dihydrobenzo [b] [1,] dioxin and 3,4-dihydro-2H-benzo [b] ] [1, 4] dioepine.

Examples of wherein G is a 5, 6 or 7 membered ring, which optionally incorporates one or more heteroatoms selected from S, N or 0, and p is 1 or 2, and is optionally substituted with one or more substituents R12, include, but are not limited to: As used herein, the term "heteroatom" is intended to mean 0, S or N. As used herein, the term "detectable label" is intended to mean a group that can be linked to a compound of the present invention. invention to produce a probe, or to a BIR domain of IAP, so that when the probe is associated with the BIR domain, the etigueta allows the recognition either directly or indirectly of the probe, so that it can be detected, measure and quantify As used herein, the term "affinity ethylene" is intended to mean a ligand or group, which binds either to a compound of the present invention or to a BIR domain of IAP to allow another compound to be extracted from a solution to which the ligand or group binds. As used herein, the term "probe" is intended to mean a compound of Formula I which is labeled with either a detectable label or affinity tag, and which is capable of binding, either covalently or non-covalent, to an IAP BIR domain. When, for example, the probe binds non-covalently, it can be displaced by a test compound. When, for example, the probe is covalently linked, it can be used to form cross-linked adducts, which can be quantified and inhibited by a test compound. As used herein, the term "optionally substituted with one or more substituents" or its equivalent term, "optionally substituted with at least one substituent" is intended to imply that the event of circumstances, described subsequently, may or may not occur, and that the description includes cases where the event or circumstance is presented and cases in the which not. The definition is intended to imply from zero to five substituents. If the substituents themselves are incompatible with the synthetic methods of the present invention, the substituent can be protected with a suitable protecting group (PG) which is stable for the reaction conditions used in these methods. The protection group can be removed at a suitable point in the reaction sequence of the method, to provide a desired intermediate or target compound. Suitable protecting groups, and methods for protecting and deprotecting different substituents using such suitable protection groups, are well known to those skilled in the art; examples of which can be found in T. Greene and P. Wuts, Protecting Groups in Chemical Synthesis (3rd edition), John Wiley & Sons, NY (1999), which is incorporated herein by reference in its entirety. Examples of fully used protection groups include, but are not limited to, Fmoc, Bn, Boc, CBz and COCF3. In some cases, a substituent may be specifically selected to be reactive under the reaction conditions used in the methods of this invention. Under these circumstances, the reaction conditions convert the selected substituent into another substituent which is either useful in a intermediary compound in the methods of this invention or is a desired substituent in a target compound. The abbreviations for the a-amino acids used in full are as follows: As used herein, the term "residue", when referring to α-amino acids, is intended to mean a radical derived from the corresponding α-amino acid by removing the hydroxyl from the carboxy group and a hydrogen from the α-amino group. For example, the terms Gln, Ala, Gly, He, Arg, Asp, Phe, Ser, Leu, Cys, Asn and Tyr represent the residues of L-glutamine, L-alanine, glycine, L-isoleucine, L-arginine, Acid L- aspartic acid, L-phenylalanine, L-serine, L-leucine, L-cysteine, L-asparagine and L-tyrosine, respectively. As used herein, the term "subject" is intended to mean humans and non-human mammals such as primates, cats, dogs, pigs, cattle, sheep, goats, horses, rabbits, rats, mice and the like. As used herein, the term "prodrug" is intended to mean a compound that can be converted, under physiological conditions or by solvolysis, to a biologically active compound of the present invention. Thus, the term "prodrug" refers to a precursor of a compound of the invention which is pharmaceutically acceptable. A prodrug may be inactive or show limited activity when administered to a subject in need thereof, but is converted in vivo to an active compound of the present invention. Typically, the prodrugs are transformed in vivo to produce the compound of the invention, for example, by hydrolysis in the blood or other organs by enzymatic processing. The prodrug compound often offers advantages of solubility, tissue compatibility or delayed release in the subject (see, Bungard, H., Design of Produgs (1985), pp. 7-9, 21-24 (Elsevier, Amsterdam). definition of prodrug includes any covalently linked carriers, which release the active compound of the invention in vivo when such a prodrug is administered to a subject. Prodrugs of a compound of the present invention can be prepared by modifying the functional groups present in the compound of the invention, such that the modifications are cleaved, either by routine manipulation or in vivo, to a parent compound of the invention. As used herein, the term "Pharmaceutically acceptable carrier, diluent or excipient" is intended to mean, without limitation, any adjuvant, carrier, excipient, glidant, sweetening agent, diluent, preservative, dye / dye, flavor improver, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, emulsifier or encapsulating agent, such as a liposome, cyclodextrins, polymeric encapsulation delivery systems or polyethylene glycol matrix, which are acceptable for use in the subject, preferably humans. As used herein, the term "pharmaceutically acceptable salt" is intended to mean addition salts of both acid and base.

As used herein, the term "pharmaceutically acceptable acid addition salt" is intended to mean those salts which retain the biological effectiveness and properties of the free bases, which are not biologically or otherwise undesirable, and which are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like, and organic acids such as acetic acid, trifluoroacetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid and the like. As used herein, the term "pharmaceutically acceptable base addition salt" is intended to mean those salts which retain the biological effectiveness and properties of the free acids, which are not biologically or otherwise undesirable. These salts are prepared from the addition of an inorganic base or an organic base to the free acid. Salts derived from inorganic bases include, but are not limited to, the salts of sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum and similar. Salts derived from organic bases include, but are not limited to, salts of primary, secondary and tertiary amines, substituted amines including substituted amines, cyclic amines and ion exchange basic resins which occur naturally, such as isopropylamine resins, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, ethylenediamine, glucosamine, methylglucamine, theobromine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine and the like. As used herein, the term "binding to BIR domain" is intended to mean the action of a compound of the present invention on a BIR domain of IAP, which blocks or decreases the binding of IAPs to binding proteins to BIR or is involved in displacing BIR binding proteins from an IAP. Examples of BIR binding proteins include, but are not limited to, mitochondrially derived BIR binding caspases and proteins such as Smac, Omi / WTR2A and the like. As used herein, the term "insufficient apoptosis" is intended to mean a state in which a disease is provoked or continues since the cells detrimental to the subject have not been subjected to apoptosis. This includes, but is not limited to, cancer cells that survive in an untreated subject, cancer cells that survive in a subject during or after cancer treatment or cells of the immune system whose action is detrimental to the subject, and include neutrophils. , monocytes and self-reactive T cells. As used herein, the term "therapeutically effective amount" is intended to mean an amount of a compound of Formula I which, when administered to a subject, is sufficient to effect the treatment for a disease state associated with insufficient apoptosis. The amount of the compound of Formula I will vary depending on the compound, the condition and its severity, and the age of the subject to be treated, but can be determined routinely by someone with ordinary skill in the art taking into account their own knowledge and description. As used herein, the term "treating" or "treatment" is intended to mean the treatment of a disease state associated with insufficient apoptosis, as described herein, in a subject, and includes: (i) avoiding a disease or condition associated with insufficient apoptosis occurs in a subject, in particular, when such a mammal is predisposed to the illness . or condition, but has not yet been diagnosed as having it; (ii) inhibiting a disease or condition associated with insufficient apoptosis, that is, stopping its development; or (iii) alleviating a disease or condition associated with insufficient apoptosis, that is, causing the regression of the condition. As used herein, the term "treating cancer" is intended to mean the administration of a pharmaceutical composition of the present invention to a subject, preferably a human, which is affected with cancer, to cause cancer relief to the patient. eliminate, inhibit the growth or inhibit the metastasis of cancer cells. As used herein, the term "preventing disease" is intended to mean, in the case of cancer, the post-surgical, post-chemotherapy or post-radiotherapy administration of a pharmaceutical composition of the present invention to a subject, preferably a human, which was affected with cancer, to prevent renewed cancer growth by eliminating, inhibiting growth or inhibiting the metastasis of any remaining cancer cells. Also included in this definition is the prevention of prosurvival conditions that lead to diseases such as asthma, MS and the like.

As used herein, the term "synergistic effect" is intended to imply that the effect achieved with the combination of the compounds of the present invention, and either the chemotherapeutic agents or death receptor agonists of the invention, is greater. The effect obtained with only one of the compounds, agents or agonists or, favorably, the effect obtained with the combination of the compounds, agents or agonists in the foregoing is greater than the addition of the effects obtained with each one. of the compounds, agents or agonists used separately. Such synergy allows smaller doses to be given. As used herein, the term "apoptosis" or "programmed cell death" is intended to imply the regulated process of cell death, wherein a dead cell shows a set of well characterized biochemical features that include blistering on the membrane cellular, contraction of the cellular body, condensation of the chromatin and the stepped rupture of the DNA, as well as cell death mediated by any caspase. As used herein, the term "BIR domain" or "BIR" is used interchangeably completely and is intended to imply a domain which is characterized by a series of invariant amino acid residues including conserved cysteines and a residue conserved histidine within the sequence Cys- (Xaal) 2Cys- (Xaal)? 6His- (Xaal) 6-β and s. Typically, the amino acid sequence of the consensus sequence is: Xaal-Xaal-Xaal-Arg-Leu-Xaal-Thr-Phe-Xaal-Xaal-Trp-Pro-Xaa2-Xaal-Xaal-Xaa2-Xaa2-Xaal-Xaal- Xaal-Xaal-Leu-Ala-Xaal-Ala-Gly-Phe-Tyr-Tyr-Xaal-Gly-Xaal-Xaal-Asp-Xaal-Val-Xaal-Cys-Phe-Xaal-Cys-Xaal-Xaal-Xaal- Xaal-Xaal-Xaal-Trp-Xaal-Xaal-Xaal-Asp-Xaal-Xaal-Xaal-Xaal-Xaal-His-Xaa-1-Xaal-Xaal-Xaal-Pro-Xaal-Cys-Xaal-Phe-Val, wherein Xaal is any amino acid and Xaa2 is any amino acid or is absent. Preferably, the sequence is substantially identical to one of the BIR domain sequences provided for XIAP, HIAP1 or HIAP2 herein. The residues of the BIR domain are listed in the following (see Genome Biology (2001) 1-10): As used herein, the term "ring zinc finger" or "RZF" is intended to mean a domain having the amino acid sequence of the consensus sequence: Glu-Xaal-Xaal-Xaal-Xaal-Xaa -1- Xaa2-Xaal-Xaal-Xaal-Cys-Lys-Xaa3-Cys-Met-Xaal-Xaal-Xaal-Xaal-Xaal-Xaa3-X-aal-Phe-Xaal-Pro-Cys-Gly-His-Xaal-Xaal- Xaal-Cys-Xaal-Xaal-Cys-Ala-Xaal-Xaa-1-Xaal-Xaal-Xaal-Cys-Pro-Xaal-Cys, where Xaal is any amino acid, Xaa2 is Glu or Asp and Xaa3 is Val or He . As used herein, the term "IAP" is intended to mean a polypeptide or a protein, or fragment thereof, encoded by an IAP gene. Examples of IAPs include, but are not limited to, NAIP (Birc 1), HIAP-1 (cIAP2, Birc 3), HIAP-2 (cIAPl, Birc 2), XIAP (Birc 4), survivin (Birc 5), livin (ML-IAP, Birc 7), ILP-2 (Birc 8) and Apollon / BRUCE (Birc 6) human or mouse (see, for example, the American Patents Numbers 6,107,041; 6,133,437; 6,156,535; 6,541,457; 6,656,704; 6,689,562; Deveraux and Reed, Genes Dev. 13, 239-252, 1999; Kasof and Gomes, J. Biol. Chem., 276, 3238-3246, 2001; Vucic et al., Curr. Biol. 10, 1359-1366, 2000; Ashab et al. FEBS Lett., 495, 56-60, 2001, the contents of which are incorporated herein by reference). As used herein, the term "gene IAP "purports to imply a gene encoding a polypeptide that has at least one BIR domain and which is capable of modulating (inhibiting or enhancing) apoptosis in a cell or tissue.The IAP gene is a gene that is approximately 50% or more than sequence identity nucleotides with at least one of NAIP (Birc 1), HIAP-1 (cIAP2, Birc 3), HIAP-2 (cIAPl, Birc 2), XIAP (Birc 4), survivin (Birc 5), livin (ML-IAP, Birc 7), ILP-2 (Birc 8) and Apollon / BRUCE (Birc 6) human or mouse. The region of the sequence on which the identity is measured is a region encoding at least one BIR domain and one zinc finger domain of the ring. The mammalian IAP genes include nucleotide sequences isolated from any mammalian source. As used herein, the term "IC50" is intended to mean an amount, concentration or dosage of a particular compound of the present invention that achieves a 50% inhibition of a maximal response, such as displacement of the probe junction. maximum fluorescent in a test that measures such response. As used herein, the term "EC50" is intended to mean an amount, concentration or dosage of a particular compound of the present invention that achieves a 50% inhibition of cell survival. As used herein, the term "modular" or "gue modulates" is intended to imply the treatment, prevention, suppression, amelioration or induction of a function or condition using the compounds of the present invention. For example, The compounds of the present invention can modulate IAP function in a subject, thereby improving apoptosis by significantly reducing, or essentially eliminating, the interaction of activated apoptotic proteins, such as caspase 3, 7 and 9, with BIR domains. mammalian IAPs, or by inducing the loss of the IAP protein in a cell. As used herein, the term "which improves apoptosis" is intended to imply an increase in the number of cells that undergo apoptosis in a given cell population, either in vitro or in vivo. Examples of cell populations include, but are not limited to, ovarian cancer cells, colon cancer cells, breast cancer cells, lung cancer cells, pancreatic cancer cells or T cells and the like. It will be appreciated that the degree of apoptosis improvement provided by a compound that improves apoptosis of the present invention will vary in a given assay, but one skilled in the art can determine the statistically significant change in the level of apoptosis which identifies a compound that improves apoptosis otherwise limited by an IAP. Preferably, "which improves apoptosis" means that the increase in the number of cells undergoing apoptosis is at least 25%, more preferably the increase is 50% and more. preference the increase is at least once. Preferably, the monitored sample is a sample of cells that normally undergo insufficient apoptosis (ie, cancer cells). Methods for detecting changes in the level of apoptosis (i.e., enhancement or reduction) are described in the Examples and include methods that quantify DNA fragmentation, methods that quantify phosphatoyl serine from the cytoplasmic side to the extracellular side of the membrane, determination of caspase activation and methods that quantify the release of cytochrome C and the apoptosis inhibiting factor into the cytoplasm by the mitochondria. As used herein, the term "proliferative disease" or "proliferative disorder" is intended to mean a disease that is caused by, or results in, inadequately elevated levels of cell division, inadequately low levels of apoptosis, or both. For example, cancers such as lymphoma, leukemia, melanoma, ovarian cancer, breast cancer, pancreatic cancer and lung cancer, and autoimmune disorders are all examples of proliferative diseases. As used herein, the term "death receptor agonist" is intended to imply an agent capable of stimulating, by direct or indirect contact, the pro-apoptotic response mediated by death receptors. For example, an TRAIL Receptor Agonist Antibody can bind to the TRAIL receptor (s) and activate an apoptotic response. On the other hand, another agent such as interferon-a can activate the release of endogenous TRAIL and / or over-regulate the TRAIL receptors in such a way that the cellular pro-apoptotic response is amplified. The compounds of the present invention, or their pharmaceutically acceptable salts, can contain one or more asymmetric centers, chiral axes and chiral planes and can thus give rise to enantiomers, diastereomers and other stereoisomeric forms, and can be defined in terms of absolute stereochemistry , such as (R) or (S), or as (D) or (L) for amino acids. The present invention is intended to include all possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-), (R) and (S) or (D) and (D) and (L) isomers can be prepared using either guiral synths or guiral reagents, or resolved using conventional techniques, such as reverse phase HPLC. The racemic mixtures can be prepared and separated in the following into individual optical isomers, or these optical isomers can be prepared by guiral synthesis. The enantiomers they can be solved by methods known to those skilled in the art, for example, by formation of diastereomeric salts which can then be separated by crystallization, gas-liquid or liguid chromatography, selective reaction of an enantiomer with a specific enantiomer reagent. It will also be appreciated by those skilled in the art that where the desired enantiomer is converted to another guiding entity by a separation technique, an additional step is then regimented to form the desired enantiomeric form. Alternatively, the specific enantiomers can be synthesized by asymmetric synthesis using reagents, substrates, catalysts or optically active solvents, or by converting one enantiomer to another by asymmetric transformation. Certain compounds of the present invention can exist in Zwitterionic form and the present invention includes zwitterionic forms of these compounds and mixtures thereof.

Utilities The compounds of the present invention are useful as binding compounds to the BIR domain of IAP and, as such, the compounds, compositions and method of the present invention include their application to the cells of subjects affected with or who have a predisposition towards the development of a particular disease state, which is characterized by insufficient apoptosis. Thus, the compounds, compositions and methods of the present invention are used to treat cell proliferative diseases / disorders, which include, but are not limited to, i) cancer, ii) autoimmune disease, iii) inflammatory disorders, iv) induced proliferation after medical procedures, including, but not limited to surgery, angioplasty and the like. The compounds of the present invention can also be useful in the treatment of diseases in which there is a defect in programmed cell death or the apoptotic maguinaria (TRAIL, FAS, apoptosoma), such as multiple sclerosis, asthma, atherosclerosis, inflammation, autoimmunity and similar. The treatment involves the administration, to a subject in need thereof, of a compound of the present invention or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a pharmaceutical carrier and a therapeutically effective amount of a compound of the present invention. , or a pharmaceutically acceptable salt thereof. In particular, the compounds, compositions and methods of the present invention are useful for the treatment of cancer, including solid tumors such as carcinomas of the skin, breast, brain, lung, testicular and the like. Cancers that can be treated by the compounds, compositions and methods of the invention include, but are not limited to, the following: Tissue Example Adrenal gland neuroblastoma Bone osteogenic sarcoma (osteosarcoma), fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma, Ewing's sarcoma, malignant lymphoma (reticulocellular sarcoma), multiple myeloma, malignant giant cell tumor chordoma (osteochondroma (osteocartilaginous exostosis), benign chondroma, chondroblastoma, chondromyxofibroma, osteoid osteoma and giant cell tumors Cardiac sarcoma (angiosarcoma, fibrosarcoma, rhabdomyosarcoma, liposarcoma), myxoma , rhabdomyoma, fibroma, lipoma and teratoma Gastrointestinal esophagus (carcinoma of cells aaddeennooccaarcinoma, l 'eiJo-m - i! osarcoiimnaa, lymphoma), estóm.a_g_, or , L1i-innfommaa lleeiioommiioossaarrccoommaa ,,)), pancreas ((dduuccttal aaddeennooccaarrcciinnoommaa, insulinoma, glucaggoonnoommaa ggaassttrinoma ,,, ,, ttuummoorreess ccaarrcciinnooiiddeess vviippoommaa)) ,, iinntteessttiinnoo ddeellggaaddoo ((aaddeennooccaarrcciinnoommaa ,, lymphoma, carcinoid tumors, Kaposi's sarcoma, leiomyoma, hemangioma, lipoma, neurofibroma, fibroma), large intestine (adenocarcinoma, tubular adenoma, villous adenoma, hamartoma, leiomyoma) The compounds of the present invention or their pharmaceutically acceptable salts or prodrugs thereof, may be administered in form or in an appropriate pharmaceutical composition, and may be carried out by any of the accepted modes of Galenic pharmaceutical practice. The pharmaceutical compositions of the present invention can be prepared by mixing a compound of the present invention with an appropriate pharmaceutically acceptable carrier, diluent or excipient, and can be formulated into solid, semi-solid, liquid or gaseous forms, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants, gels, microspheres and aerosols. Typical routes for administering such pharmaceutical compositions include, without limitation, oral, topical, transdermal, inhalation, parenteral (subcutaneous injections, intravenous, intramuscular, intramuscular, intramuscular injection or infusion techniques), sublingual, ocular, rectal, vaginal and intranasal. The pharmaceutical compositions of the present invention are formulated so as to allow the active ingredients contained therein to be bioavailable upon administration of the composition to a subject. The compositions that will be administered to a subject or patient take the form of one or more dosage units where, for example, a tablet can be a single dosage unit, and a container of a compound of the present invention in the form of an aerosol can contain a plurality of dosage units. Current methods for preparing such dosage forms are known or will be apparent to those skilled in the art; for example, see Remington's Pharmaceutical Sciences, 18th Edition (Mack Publishing Company, Easton, Pa., 1990). The composition to be administered, in any case, will contain a therapeutically effective amount of a compound of the present invention, or a pharmaceutically acceptable salt thereof, for the treatment of a disease state as described in the above. A pharmaceutical composition of the present invention may be in the form of a solid or liquid. In one aspect, the carrier (s) are particles, so that the compositions, for example, are in the form of a tablet or powder. The carrier (s) can be liquids, with the compositions being, for example, an oral syrup, injectable liquid or an aerosol, which is useful, for example, in administration by inhalation. For oral administration, the pharmaceutical composition is preferably either in solid or liquid form, where the semi-solid, semi-liquid, suspension and gel forms are included within the forms considered herein as either solid or liguidas. As a solid composition for oral administration, the pharmaceutical composition can be formulated into a powder, granule, compressed tablet, pill, capsule, chewing gum, wafer or the like. Such a solid composition will typically contain one or more inert diluents or edible carriers. In addition, one or more of the following may be present: binders such as carboxymethylcellulose, ethylcellulose, microcrystalline cellulose, gum tragacanth or gelatin; excipients such as starch, lactose or dextrins, disintegrating agents such as alginic acid, alginate Sodium, Primogel, corn starch and the like; lubricants such as magnesium stearate or Sterotex; glidants such as colloidal silicon dioxide; sweetening agents such as sucrose or saccharin; a flavoring agent such as peppermint, methyl salicylate or orange flavoring; and a coloring agent. When the pharmaceutical composition is in the form of a capsule, for example, a gelatin capsule, it may contain, in addition to materials of the above type, a liquid carrier such as polyethylene glycol, or oil such as soy or vegetable oil. The pharmaceutical composition may be in the form of a liquid, for example, an elixir, syrup, solution, emulsion or suspension. The liquid can be for oral administration or for injection delivery, as two examples. When intended for oral administration, the preferred composition contains, in addition to the present compounds, one or more of a sweetening agent, preservatives, dye / dye and flavor improver. In a composition intended to be administered by injection, one or more of a surfactant, preservative, wetting agent, dispersing agent, suspending agent, buffer, stabilizer and isotonic agent may be included. The liguid pharmaceutical compositions of the present invention, whether solutions, suspensions or other similarly, they may include one or more of the following adjuvants: sterile diluents such as water for injection, saline, preferably physiological saline, Ringer's solution, isotonic sodium chloride, fixed oils such as mono or synthetic diglycerides which may serve as the solvent or suspension medium, polyethylene glycols, glycerin, propylene glycol or other solvents; antibacterial agents such as benzyl alcohol or methylparaben; antioxidants such as ascorbic acid or sodium bisulfite; guelantes agents such as etilendiamintetracetic acid; buffers such as acetates, citrates or phosphates and tonicity adjusting agents such as sodium chloride or dextrose. The parenteral preparation can be contained in ampoules, disposable syringes or multiple dose vials made of glass or plastic. An injectable pharmaceutical composition is preferably sterile. A liquid pharmaceutical composition of the present invention, used for parenteral or oral administration, must contain an amount of a compound of the present invention, so that a suitable dose will be obtained. Typically, this amount is at least 0.01% of a compound of the present invention in the composition. When intended for oral administration, this amount can be varied to be between 0.1 and about 70% of the weight of the composition. For parenteral use, the compositions and preparations according to the present invention are prepared such that a parenteral dosage unit contains between 0.1 to 1% by weight of the compound of the present invention. The pharmaceutical composition of the present invention can be used for topical administration, in which case the carrier can suitably comprise a solution, emulsion, ointment or gel base. The base, for example, may comprise one or more of the following: petrolatum, lanolin, polyethylene glycols, beeswax, mineral oil, diluents such as water and alcohol and emulsifiers and stabilizers. Thickening agents may be present in a pharmaceutical composition for topical administration. If intended for transdermal administration, the composition may include a transdermal patch or device for iontophoresis. Topical formulations may contain a concentration of the compound of the present invention from about 0.1 to about 10% w / v (weight per unit volume). The pharmaceutical composition of the present invention can be used for rectal administration to treat, for example, colon cancer, in the form of, for example, a suppository, which will melt in the rectum and will release the drug. The composition for rectal administration may contain an oleaginous base as a suitable non-irritating excipient. Such bases include, without limitation, lanolin, cocoa butter and polyethylene glycol. The pharmaceutical composition of the present invention may include various materials, which modify the physical form of a solid or bound dosage unit. For example, the composition may include materials that form a coating layer around the active ingredients. The materials that form the coating layer are typically inert, and may be selected from, for example, sugar, shellac and other enteric coating agents. Alternatively, the active ingredients can be embedded in a gelatin capsule. The pharmaceutical composition of the present invention, in solid or liguid form, may include an agent that binds to the compound of the present invention and, consequently, aid in the delivery of the compound. Suitable agents that can act in this capacity include, but are not limited to, a monoclonal or polyclonal antibody, a protein or a liposome. The pharmaceutical composition of the present invention can consist of dosage units which can be administered as an aerosol. The term aerosol is It uses to denote a variety of systems that vary from colloidal in nature to systems consisting of pressurized packaging. The supply can be by a liquefied or compressed gas or by an appropriate pump system that distributes the active ingredients. The aerosols of the compounds of the present invention can be delivered in single phase, bi-phasic or tri-phasic systems, in order to supply the active ingredient (s). The supply of the aerosol includes the necessary container, activators, valves, subrecipients and the like, which can together form an eguip. One skilled in the art, without unfounded experimentation, can determine the preferred aerosols. The pharmaceutical compositions of the present invention can be prepared by the methodology well known in the pharmaceutical art. For example, a pharmaceutical composition intended to be administered by injection can be prepared by mixing a compound of the present invention with sterile distilled water, so that a solution is formed. A surfactant may be added to facilitate the formation of a homogeneous solution or suspension. Surfactants are compounds that interact non-covalently with the compound of the present invention so as to facilitate the homogeneous dissolution or suspension of the compound in the aqueous delivery system.

The compounds of the present invention, or their pharmaceutically acceptable salts, are administered in a therapeutically effective amount, which will vary depending on a variety of factors including the activity of the specific compound employed; the metabolic stability and the duration of action of the compound; the age, body weight, general health, sex and diet of the patient; the mode and time of administration; the rate of excretion; the combination of drugs; the severity of the particular disorder or condition; and the subject who undergoes the therapy. Generally, a therapeutically effective daily dose may be from about 0.1 mg to about 40 mg / kg of body weight per day, or twice per day, of a compound of the present invention or a pharmaceutically acceptable salt thereof.

Combination Therapy The compounds of the present invention, or pharmaceutically acceptable salts thereof, may also be administered simultaneously with, before or after administration of one or more of the therapeutic agents described in the following. Such combination therapy can include the administration of a simple pharmaceutical dosage formulation, which contains a compound of the present invention and one or more additional agents given in the following, as well as the administration of the compound of the present invention and each additional agent in its own separate pharmaceutical dosage formulation. For example, a compound of the present invention and a chemotherapeutic agent, such as taxol (paclitaxel), taxotere, etoposide, cisplatin, vincristine, vinblastine and the like, can be administered to the patient either together in a single dosage composition, or administered each agent in separate oral dosage formulations or by intravenous injection. Where separate dosage formulations are used, the compounds of the present invention and one or more additional agents can be administered essentially at the same time, i.e., concurrently, or at staggered times separately, i.e., sequentially; It is understood that combination therapy includes all these regimens. In addition, these compounds can exhibit synergy with molecules that can stimulate the apoptotic pathway of the death receptor by a direct or indirect manner since, for example, the compounds of the present invention can be used in combination with soluble TRAIL or any agent that can cause an increase in the circulating level of TRAIL, such as interferon-alpha, BCG or through radiation. Thus, the present invention also encompasses the use of the compounds of the present invention, in combination with radiation therapy, or one or more additional agents such as those described in WO 03/099211 (PCT / US03 / 15861), which is incorporated by this for reference. Examples of such additional agents include, but are not limited to, the following: an estrogen receptor modulator, b) an androgen receptor modulator, retinoid receptor modulator, a cytotoxic agent, an antiproliferative agent, a transferase inhibitor. of prenylated proteins, a HMG-CoA reductase inhibitor, an HIV protease inhibitor, a reverse transcriptase inhibitor, an angiogenesis inhibitor, a PPAR-? agonist, a PPAR-d agonist. , n an inhibitor of resistance inherent to multiple drugs, or) an anti-emetic agent, p) an agent useful in the treatment of anemia, q) agents useful in the treatment of neutropenia, r) an immune booster drug, s) a proteasome inhibitor such as Velcade and MG132 (7-Leu-Leu-aldehyde) (see He et al., In Oncogene (2004) 23, 2554-2558); t) an HDAC inhibitor, such as sodium butyrate, phenyl butyrate, hydroamic acids, cyclin tetrapeptide and the like (see Rosato et al., Molecular Cancer Therapeutics 2003, 1273-1284); u) an inhibitor of the guimiotripsin-like activity in the proteasome; v) E3 ligase inhibitors; w) a modulator of the immune system such as, but not limited to, interferon-alpha or BCG which can induce the release of cytokines, such as interieucins, TNF or induce the release of ligands from the death receptor such as TRAIL; x) a TRAIL death receptor modulator and TRAIL agonists such as the humanized antibodies HGS-ETR1 and HGS-ETR2; and either in combination or sequentially with radiation therapy, so cancer is treated. Additional combinations can also include agents which reduce the toxicity of the aforementioned agents, such as liver toxicity, neuronal toxicity, nephrotoxicity and the like. In one example, the co-administration of one of the compounds of Formula I of the present invention with a death receptor agonist such as TRAIL, such as a peptide molecule or an antibody that mimics TRAIL can cause a favorable synergistic effect . Moreover, the compounds of the present invention can be used in combination with any compounds that cause an increase in the circulating levels of TRAIL.

Alkaloids Vinca and Related Compounds Vinca alkaloids which can be used in combination with the nucleobase oligomers of the invention, to treat cancer and other neoplasms, include vincristine, vinblastine, vindesine, vinflunine, vinorelbine and anhydrovinblastine. Dolastatins are oligopeptides that interfere mainly with tubulin in the vinca alkaloid binding domain. These compounds can also be used in combination with the compounds of the invention to treat cancer and other neoplasms. Dolastatins include dolastatin-10 (NCS 376128), dolastatin-15, ILX651, TZT-1027, simplostatin 1, simplostatin 3 and LU103793 (cemadotine). Cryptophycins (e.g. cryptophycin 1 and cryptophycin 52 (LY355703) bind tubulin within the vinca alkaloid binding domain and induce arrest in G2 / M and apoptosis, either of which may be used in combination with the compounds of the invention to treat Cancer and Other Neoplasms Other microtubule-disrupting compounds, which may be used in conjunction with the compounds of the invention to treat cancer and other neoplasms, are described in US Pat.

Nos. 6,458,765; 6,433,187; 6,323,315; 6,258,841; 6,143,721; 6,127,377; 6,103,698; 6,023,626; 5,985,837; 5,965,537; ,955,423; 5,952,298; 5,939,527; 5,886,025; 5,831,002; 5,741,892; 5,665,860; 5,654,399; 5,635,483; 5,599,902; ,530,097; 5,521,284; 5,504,191; 4,879,278; and 4,816,444, and Publications of North American patent application Nos. 2003/0153505 Al; 2003/0083263 Al; and 2003/0055002 Al, each of which is hereby incorporated by reference.

Taxans and Other Stabilization Compounds Microtubules Taxanes, such as paclitaxel, doxetaxel, RPR 109881A, SB-T-1213, SB-T-1250, SB-T-101187, BMS-275183, BRT 216, DJ-927, MAC-321, IDN5109 and IDN5390 can used in combination with the compounds of the invention to treat cancer and other neoplasms. Taxane analogues (eg, BMS-184476, BMS-188797) and non-functionally related taxanes (e.g., epothilones (e.g., epothilone A, epothilone B (EPO906), deoxiepotilone B, and epothilone B lactam (BMS-247550)) , eleuterobine, discodermolide, 2-epi-discodermolide, 2-des-metildiscodermolide, 5-hydroxymethyldiscoder-milled, 19-de-aminocarbonyl biscopolide, 9 (13) -cyclodiscodermolide and laulimalide) can also be used in the methods and compositions of the invention. Other microtubule stabilization compounds which can be used in combination with the compounds of the invention to treat cancer and other neoplasms are described in US Pat. Nos. 6,624,317; 6,610,736; 6,605,599; 6,589,968; 6,583,290; 6,576,658; 6,515,017; 6,531,497 6,500,858; 6,498,257; 6,495,594; 6,489,314; 6,458, 976 6,441,186; 6,441,025; 6,414,015; 6,387,927; 6,380,395 6,380,394; 6,362,217; 6,359,140; 6,306,893; 6,302,838 6,300,355; 6,291,690; 6,291,684; 6,268,381; 6,262,107 6,262,094; 6,147,234; 6,136,808; 6, 127,406; 6,100,411 6,096,909; 6,025,385; 6,011,056; 5, 965,718; 5,955,489 5,919,815; 5,912,263; 5,840,750; 5,821,263; 5,767,297 5,728,725; 5,721,268; 5,719, 177; 5,714,513; 5,587,489 5,473,057; 5,407,674; ,250,722; 5,010,099; and 4,939,168; and US Patent Application Publications Nos. 2003/0186965 Al; 2003/0176710 Al; 2003/0176473 Al; 2003/0144523 Al; 200310134883 Al; 200310087888 Al; 2003/0060623 Al; 200310045711 Al; 200310023082 Al; 200210198256 Al; 200210193361 Al; 200210188014 Al; 200210165257 Al; 200210156110 Al; 200210128471 Al; 200210045609 Al; 200210022651 Al; 200210016356 Al; 200210002292 Al, each of which is incorporated by this for reference. Other chemotherapeutic agents that can be administered with a compound of the present invention are listed in the following Table: Additional combinations may also include agents which reduce the toxicity of the aforementioned agents, such as liver toxicity, neuronal toxicity, nephrotoxicity and the like.

Selection assays The compounds of the present invention can also be used in a method for screening other compounds that bind to a BIR domain of IAP. Generally speaking, the use of the compounds of the invention in a method for identifying compounds that bind to an IAP BIR domain, the IAP is linked to a support, and a compound of the invention is added to the assay. Alternatively, the compound of the invention can be attached to the support and the IAP added. There are a number of ways in which the binding of a compound of the present invention to the BIR domain is determined. In one form, the compound of the invention, for example, can be labeled fluorescently or radioactively and the binding determined directly. For example, this can be done by attaching the IAP to a solid support, adding a compound of the invention detectably, removing the excess reagent by washing and determining whether the amount of the detectable ethigueta is agüella present in the solid support. They can be used numerous stages of blogging and washing, which are known to those skilled in the art. In some cases, only one of the components is etched. For example, specific residues can be labeled in the BIR domain. Alternatively, more than one component can be etched with different bands; for example, using I125 for the BIR domain, and a fluorescent probe for the probe. The compounds of the invention can also be used as competitors to select additional candidates for drugs or test compounds. As used herein, the terms "drug candidate" or "test compounds" are used interchangeably and describe any molecule, for example, a protein, oligopeptide, organic molecule, polysaccharide, polynucleotide, and the like, which must be be tested for bioactivity. The compounds may be capable of directly or indirectly altering the biological activity of the IAP. Drug candidates can include various guimical classes, typically they are organic molecules that have a molecular weight of more than 100 and less than about 2,500 Daltons. Candidate agents typically include functional groups necessary for structural interaction with proteins, for example, hydrogen bonds and lipophilic binding, and typically include at least one amine, carbonyl, hydroxyl, ether or carboxyl group. Drug candidates often include a cyclic carbon or heterocyclic structures and / or aromatic or polyaromatic structures substituted with one or more functional groups. Drug candidates can be obtained from any number of sources including libraries of synthetic or natural compounds. For example, numerous means are available for the random and targeted synthesis of a wide variety of organic compounds and biomolecules, including the expression of randomized oligonucleotides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are readily available or produced. Additionally, libraries and compounds produced naturally or synthetically are easily modified through conventional chemical, physical and biochemical means. Competitive screening assays can be done by combining an IAP BIR domain and a probe to form a probe: BIR domain complex in a first sample followed by adding a test compound from a second sample. The union of the test is determined, and a change or difference in the union between the two samples indicates the presence of a test compound capable of binding to the BIR domain and potentially modulating the activity of the IAPs. In one case, the binding of the test compound is determined through the use of competitive binding assays. In this mode, the probe is etched with an affinity etiket such as biotin. Under certain circumstances, there may be a competitive binding between the test compound and the probe, with the probe displacing the candidate agent. In one case, the test compound can be labeled. Either the test compound or a compound of the present invention, or both, are first added to the BIR domain of IAP for a sufficient time to allow the binding to form a complex. The formation of the probe complex: BIR domain typically reguates incubations of between 4 ° C and 40 ° C for between 10 minutes to about 1 hour to allow high-throughput screening. Any excess reagents are usually removed or cleaned with water. The test compound is then added, and the presence or absence of the ethylated component is followed, to indicate binding to the BIR domain. In one case, the probe is added first, followed by the test compound. The displacement of the probe it is an indication that the test compound is binding to the BIR domain and thus is able to bind to, and potentially modulate, the activity of the IAP. Each component can be linked. For example, the presence of the probe in the wash solution indicates the displacement by the test compound. Alternatively, if the test compound is etched, the presence of the probe in the support indicates displacement. In one case, the test compound can be added first, with incubation and washing, followed by the probe. The absence of binding by the probe may indicate that the test compound binds to the BIR domain with a higher affinity. Thus, if the probe is detected in the support, coupled with a lack of binding of the test compound, it may indicate that the test compound is capable of binding to the BIR domain. Modulation is tested by selecting the ability of a test compound to modulate the activity of the IAP and includes combining a test compound with an IAP BIR domain, as described above, and determining an alteration in the biological activity of the IAP. the IAP. Therefore, in this case, the test compound must either bind to the BIR domain (although this may not be necessary) or alter its biological activity as defined herein.

Positive controls and negative controls can be used in the trials. All control and test samples are performed multiple times to obtain statistically significant results. After the incubation, all samples are washed free of nonspecifically bound material and the amount of the bound probe is determined. For example, where a radioetiguette is employed, the samples can be counted in a scintillation counter to determine the amount of bound compound. Typically, signals that are detected in the assay may include fluorescence, resonance energy transfer, time resolved fluorescence, radioactivity, fluorescence polarization, plasma resonance or guimioluminescence, and the like, depending on the nature of the ethylet. The detectable labels, useful for screening assays in this invention, include a fluorescent etchant such as Fluorescein, Oregon green, dansyl, rhodamine, tetramethylrhodamine, texas red, Eu3 +; a guimioluminescent ethiguete such as luciferase; colorimetric etchings; enzyme labels; or radioisotopes such as tritium, I25 and the like. The affinity tags, which may be useful for performing screening assays of the present invention, include biotin, polyhistidine and Similar .

SYNTHESIS AND METHODOLOGY The general methods for the synthesis of the compounds of the present invention are shown in the following and are described solely for the purpose of illustration and are not intended to be construed as limiting the processes for making the compounds by any other methods. Those skilled in the art will readily appreciate that a number of methods are available for the preparation of the compounds of the present invention. A series of intermediary compounds described herein can be synthesized, using the synthetic methods described in the previously filed US patent application serial number 11 / 434,166, filed May 17, 2006, the entire contents of which are hereby incorporated by reference. . Esguema 1 illustrates the synthesis of a typical synthetic intermediary represented by l (i). The examples of l (i) represent proline derivatives such as l (ii) and derivatives of 2- (aminomethyl) pyrrolidine represented by the intermediates I (iii-viii). The proline derivatives of 1 (i) can be prepared by the treatment of Boc-Pro-OH with typical peptide coupling agents and an amine, to provide the intermediary l (ii). The intermediate l (iii) of 2- (aminomethyl) pyrrolidine is prepared by the condensation of an amide with N-Bo-prolinal. The resulting amine may be admixed with a suitably activated acid chloride, anhydride or carboxylic acid, such as succinamidyl esters, HOBt esters and the like, to provide intermediates such as l (iv-vi). The intermediaries l (iv) and 1 (v) present protection groups, which can also be removed and acquire functionality later in the synthesis. Sulfonylation with a sulfonyl chloride provides l (vii). Properly activated side chain protected amino acids can be coupled to the intermediate l (iii) using standard peptide coupling agents to provide the intermediate l (viii), the PG can then be removed in the synthesis.

H 9N can be exemplified by the following: Scheme 1 General procedure for the preparation of bis-alkynyl derivatives of the Formula Ig. Esguema 2 illustrates a general procedure to prepare connected bis-alginyl compounds of the formula Ig. PG1-Thr-0H is deprotonated with NaH and treated with propargyl bromide to provide intermediate 2 (i) of Thr. Activation of the carboxylic acid of 2 (i) with standard peptide coupling agents and treatment with the intermediate l (i) provides the amide intermediate 2 (ii). The peptide coupling of PG2 (R1) N (R2) (H) CC02H with 2 (ii) is carried out by the activation of the carboxylic acid of PG2 (R1) N (R2) (H) CC02H with standard peptide coupling agents, followed by the addition of 2 (ii), to provide completely protected amide 2 (iii). The bis-alginyl connecting portion is prepared by homo-coupling if the aliquino portions of 2 (iii) use an appropriate Cu catalyst, and the subsequent deprotection of PG2, to provide compounds of the formula Ig.

R1 1) coupling agents Q R2 3) deprotection R1 N] f i R R22 HH A -, PG2 (R1) N Scheme 2 General procedure for the preparation of compounds of Formula Ih. Esquema 3 illustrates a general procedure for the preparation of di (bromomethyl) benzene derivative compounds of Formula I. PG1-Ser-OH is deprotonated with NaH and treated with 1, -di (bromomethyl) benzene to provide intermediate 3. (i) Ser. Activation of the carboxylic acid of 3 (i) with standard peptide coupling agents and treatment with intermediate l (i) provides intermediate 3 (ii), which is deprotected in PG1 to provide the intermediate 3 (iii) of amide. Peptide coupling of PG2 (RX) N (R2) (H) CC02H with 3 (iii) is effected by activation of the carboxylic acid of PG2 (R1) N (R2) (H) CC02H with standard peptide coupling agents , followed by the addition of 3 (iii) to provide the fully protected amide, which can also be deprotected in PG2 to provide compounds of the formula Ih. 1,4-di (bromomethyl) bepcene Scheme 3 General procedure for the preparation of symmetric amides of the formula I-j and I-k The Esguema 4 represents a general procedure for the preparation of symmetric amides of the formula I-f and I-g. Activation of the carboxylic acid of PG1-Orn (PG2) -OH with standard peptide coupling agents and treatment with the intermediate l (i), followed by deprotection of PG1, provides the amide intermediate 4 (i). The coupling of PG ^ R ^ NIR2) (H) CC02H peptides with 4 (i) is effected by the activation of the carboxylic acid of PG3 (R1) N (R2) (H) CC02H with agents peptide coupling standard, followed by the addition of 4 (i) to provide fully protected amide 4 (ii). The selective removal of PG2 provides the intermediate 4 (iii) of amide. Treatment of 4 (iii) with 0.5 eguivalents of an activated alguil or aromatic diacid, followed by deprotection of PG3, provides compounds of formula I-j and I-k, respectively. 3) deprotection. . N.H ^ PG2 deprotection of R1 1) coupling agents p (33 ^ __ / -b G3 pβ «?« * * 5 (d H.- YN "R2 R2 H O A-Q 4 (ii) deprotection Scheme 4 General procedure for the preparation of compounds of the formula 1-1 The Esguema 5 illustrates a general procedure for the preparation of symmetrical ureas of the general formula 1-1. Intermediate 4 (iii) is treated with 0.5 triphosgene equivivalents, or a triphosgene equivivalent, to provide a 5 (i) protected urea intermediate. The removal of PG3 provides compounds of the general Formula 1-1.

Scheme 5 General procedure for the preparation of symmetric esters The Esguema 6 illustrates the preparation of symmetric esters of the formula 1-m and general I-n. An amino acid derivative which shows a hydroxy portion in its side chain, such as PG1-Ser (PG2) -OH, is activated with standard peptide coupling reagents and is treated with l (i), and the resulting amide is deprotected in PG1 to provide the amine intermediate 6 (i). Activation of the carboxylic acid of PG3 (R3) N (H) (R2) CC02H using standard peptide coupling agents and treatment of the resulting activated amino acid with 6 (i) provides 6 (ii).

Selective deprotection of PG2 provides the alcohol 6 (iii) intermediate. Treatment of 6 (iii) with 0.5 eguivalents of an activated dicarboxylic acid, and deprotection of PG3, provides compounds of formula I-m and general I-n. ß (l) Scheme 6 General procedure for the preparation of symmetric amides of the formula I-o The Esguema 7 illustrates the preparation of symmetric amides of the general formula l-o. An amino acid derivative which shows a carboxylic acid in its side chain, such as PG1-Glu (PG2) -OH, is activated with standard peptide coupling reagents and is treated with l (i) and the resulting amide is deprotected in PG1 to provide the amine intermediate 7 (ii). Activation of the carboxylic acid of PG3 (R3) N (R2) (H) CC02H using standard peptide coupling agents, followed by treatment with 7 (i) provides 7 (ii). Selective deprotection of PG2 provides the carboxylic acid 7 (iii) intermediate. Activation of the carboxylic acid with standard peptide coupling agents and treatment with 0.5 eguivalents of a diamine provides the intermediate 7 (iv). The deprotection of PG3 provides compounds of the general formula I-o.

CO G ^ R '1) coupling p P < (?? 3 09 B? 'Rd deesspPrrootteecccci, óonn -G3 - oe -P ° 2 VH PG3 - ^ CO, H 2) 7 (¡) R2 R2 HO A- "R -2, H' O" A l - , Scheme 7 General procedure for the preparation of compounds of Formula Ii. The Esquema 8 illustrates a general procedure for the preparation of compounds of the Formula Ii. PG1-Ser-OH is deprotonated with NaH and treated with 2,2'-bis (bromomethyl) -1,1 '-biphenyl to provide intermediate 8 (i) of Ser. Activation of the carboxylic acid of 8 (i) with standard peptide coupling agents and the treatment with the intermediate l (i) provides the intermediate 8 (ii), which is deprotected in PG1 to provide the intermediate 8 (iii) of amide. Peptide coupling of PG2 (R1) N (R2) (H) CC02H with 3 (iii) is effected by the activation of the carboxylic acid of PG2 (R1) N (R2) CHC02H with standard peptide coupling agents, followed by adding 3 (ii) to provide the fully protected amide, which can also be deprotected in PG2 to provide compounds of the formula Ii.

Scheme 8 General procedure for the preparation of compounds of the formula Ip The Esguema 9 illustrates a general procedure for the preparation of glyoxaxalamines of the general formula Ip. Intermediate 4 (iii) is treated with 0.5 ealivalents of oxalyl chloride, or an equivalent of oxalyl chloride, to provide a 9 (i) protected urea intermediate. Removal of PG3 provides compounds of the general formula Ip.

Scheme 9 General Procedure for the preparation of the compounds of the formula lq Reduction of the triple bonds of the Compounds of the general formula lg provide the compounds of the general formula lg. For example, hydrogenation of compounds of the general formula lg with H2 gas in the presence of a catalyst system such as Pd / C provides the compounds of the general formula lp.

The foregoing Esguemas apply to both symmetrical compounds and non-symmetrical compounds of the present invention. Substituents B, B1, A1, A, Q, Q1, R1, R100, R2, R200, R4, R5, Ru, r and the like are as defined herein.

EXAMPLES The following abbreviations are used throughout the process: Boc: t-butoxycarbonyl; CBz benzyloxycarbonyl; DCM: dichloromethane; DIPEA: diisopropylethylamine; DMAP 4- (dimethylamino) pyridine; DMF: N, N-dimethylformamide; DTT: dithiothreitol; EDC: 3-dimethylaminopropyl hydrochloride) -3- ethylcarbodiimide; EDTA: ethylenediaminetetraacetic acid; Fmoc: N- (9-fluorenylmethoxycarbonyl); HBTU: 0- (benzotriazol-1-yl) -N, N, N ', N'-tetramethyluronium hexafluorophosphate; HCl: hydrochloric acid; HOAc: acetic acid; HOBt: 1-hydroxybenzotriazole; HPLC: high resolution liguid chromatography; LCMS: liguid chromatography-mass spectrometer; MeOH: methanol; MgSO4: magnesium sulfate; MS: mass spectrum; ? aHC03: sodium hydrogen carbonate; Pd / C: palladium on carbon; TEA: triethylamine; and THF: tetrahydrofuran. 1. Synthesis of intermediary l-4b Stage One: ) i 1-2a: R * = H, R = Boc ^ T 1-2b: R ** = COCFj, R = EK c). 1-2c R4 = COCF3, R = H Step a) To a solution of N- (tert-butoxycarbonyl) -L-prolinal 1-1 (6.0 g, 30.1 mmol) in methylene chloride was added phenethylamine (3.8 mL, 30.1 mmol). After stirring for 1 h at RT, sodium cyanoborohydrate (12.8 g, 60.2 mmol) was added and the reaction mixture was stirred at room temperature overnight. Aqueous NaHCO 3 and ethyl acetate were added, the organic layer was separated, washed with brine, dried over MgSO 4 and concentrated in vacuo. Purification by flash chromatography gives I-2a as a colorless oil. MS (m / z) M + l = 305.

Step b) To a solution of I-2a (6.0 g, 19.7 mmol) in methylene chloride sequentially added triethylamine (5.5 mL, 39.5 mmol), 4-dimethylamino pyridine (catalytic) and trifluoroacetic anhydride (4.2 mL, 29.6 mmol) and the reaction mixture was stirred for 3 h at room temperature. Aqueous NaHCO 3 and ethyl acetate were added, the organic layer was separated, washed with brine, dried over MgSO 4 and concentrated in vacuo. Purification by flash chromatography gives I-2b as a colorless oil.

Step c) A solution of 4 N HCl in 1,4-dioxane (20 mL) was added to I-2b (7.4 g, 18.5 mmol) at room temperature and the solution was stirred for 2 h and then concentrated in vacuo. The crystallization from ether gives I-2c as a white solid. MS (m / z) M + l = 301.

Stage Two Step a) To a solution of I-2d (7.2 g, 21.3 mmol) in DMF was sequentially added DIPEA (19.0 mL, 106 mmoles), HOBt (4.24 g, 27.7 mmoles) and HBTU (10.5 g, 27.7 mmoles). After stirring for 5 minutes, l-2c (7.1 g, 27.7 mmol) was added and the reaction mixture was stirred overnight at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid, aqueous NaHC03 and brine, dried over MgSO4 and concentrated in vacuo. Purification by flash chromatography affords compound I-3a as a white solid.

Step b) A solution of 4 N HCl in 1,4-dioxane (15 mL) was added to I-3a (10.7 g, 18.0 mmol) at room temperature and the solution was stirred for 2 h and then concentrated in vacuo. Ether crystallization provides I-3b as a white solid. MS (m / z) M + l = 440.

Stage Three Step a) To a solution of I-3b (8.9 g, 18.7 mmol) in DMF was added sequentially DIPEA (16.7 mL, 93.6 mmol), HOBt (3.7 g, 24.3 mmol), HBTU (9.2 g, 24.3 mmol). After stirring for 5 minutes BOC-NMeAlaOH (4.9 g, 24.3 mmol) was added and the reaction mixture was stirred overnight at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid, aqueous NaHC03 and brine, dried over MgSO4 and concentrated in vacuo. Purification by flash chromatography provides I-4a as a solid White .

Step b) To a solution of I-4a (8.7 g, 13.4 mmol) in 5 THF was cooled to 0 ° C, 2 N LiOH (20 mL) was added and the reaction was stirred overnight at room temperature. The pH was adjusted to 6 with 10% citric acid and ethyl acetate was added, the organic layer was separated, washed with brine, dried over MgSO4 and concentrated in vacuo. Purification by flash chromatography provides I-4b as a white solid. MS (m / z) M + l = 625.

Synthesis of I-2d To a suspension of NaH (4.56 g, 114.04 mmol) in dry DMF (100 mL) was cooled to 0 ° C was added in portions N-Boc-L-threonine (10,000 g, 45.62 mmol). After stirring for 10 minutes, propargyl bromide (10 mL) was slowly added and the reaction was stirred for 1 h at 0 ° C. Water (500 mL) and ethyl acetate (100 mL) were added, the organic layer was separated, the aqueous layer was acidified to pH = 5 with 10% citric acid and extracted two times with ethyl acetate. The combined organic extracts were washed with brine, dried over MgSO4 and concentrated in vacuo. Purification by flash chromatography provides l-2d as a colorless oil. 2. Synthesis of compound 4 Stage One Step a) To a solution of I-4b (600 mg, 1.1 mmol) in THF was sequentially added DIPEA (240 uL, 2.3 mmol) and benzenesulfonyl chloride (160 uL, 2.2 mmol). The reaction was stirred for 1 h at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid and brine, dried over MgSO4 and concentrated in vacuo. Purification by flash chromatography provides 2-1 as a white solid.

Stage Two Step a) To a solution of 2-1 (400 mg, 0.6 mmol) in dry acetone sequentially tetramethylethylenediamine (180 uL, 1.2 mmol) and copper (I) chloride (118 mg, 1.2 mmol) were added sequentially. The reaction was stirred overnight at room temperature the solvent was removed m vacuo. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid, aqueous NaHC03 and brine, dried over MgSO4 and concentrated in vacuo. Purification by flash chromatography affords 2-la as a white solid.

Step b) A solution of 4 N HCl in dioxane (3 mL) was added to 2-la (542 mg, 0.47 mmol) at 0 ° C. The solution was stirred for 2 h and then concentrated in vacuo. Ether crystallization provides compound 4 2HC1 as a white solid. MS (m / z) M + l = 1136. 3. Synthesis of compound 2 Step One To a solution of I-4b (900 mg, 1.7 mmol) in DMF was added sequentially DIPEA (1.5 mL, 8.5 mmol), HBTU (841 mg, 2.2 mmol) and HOBt (340 mg, 2.2 mmol).

After stirring for 5 minutes Boc-D-Tyr (Me) -OH (655 mg, 2.2 mmol) was added and the reaction mixture was stirred overnight at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid, aqueous NaHC03 and brine, dried over MgSO4 and concentrated in vacuo. Purification by flash chromatography provides 3-1 as a white solid. Stage Two Step a) To a solution of 3-1 (225 mg, 0.3 mmol) in dry acetone sequentially tetramethylethylenediamine (85 uL, 0.5 mmol) and copper (I) chloride (54 mg, 0.5 mmol) were added and the reaction was added it was stirred overnight at room temperature the solvent was removed in vacuo. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid, aqueous NaHC03 and brine, dried over MgSO4 and concentrated in vacuo. Purification by flash chromatography affords 3-la as a white solid.

Step b) A solution of 4 N HCl in 1,4-dioxane (2 mL) was add 3-la (150 mg, 0.1 mmol) at 0 ° C and the solution was stirred for 2 h and then concentrated in vacuo. The crystallization of the diethyl ether yielded the compound 2'2HC1 as a white solid. MS (m / z) M + l = 1210. 4. Synthesis of compound 11 Stage One 4-1 4-1a To a suspension of NaH (1.46 g, 36.5 mmol) in DMF was cooled to 0 ° C, BOC-Ser-OH 4-1 (3.0 g, 14.6 mmol) was added and after stirring for 15 minutes it was added to, a ' -Dibromo-p-xylene (2.3 g, 8.7 mmol). The reaction was then stirred for 1 h at 0 ° C and 15 minutes at RT. Water was added and the pH acidified to pH 5 with IN HCl. Ethyl acetate was added, the organic layer was separated, washed with brine, dried over MgSO4 and concentrated in vacuo. Purification by flash chromatography affords 4-la as a white solid.

Stage Two Step a) To a solution of 4-la (1.6 g, 3.1 mmol) in DMF was added sequentially DIPEA (1.3 mL, 7.5 mmol), HOBt (1.2 g, 7.8 mmol) and HBTU (2.9 g, 7.8 mmol). After stirring for 5 minutes, l-2c (1.7 g, 5.7 mmol) was added and the reaction mixture was stirred overnight at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid, aqueous NaHC03 and brine, dried over MgSO4 and concentrated in vacuo. Purification by flash chromatography provides 4-lb as a white solid.

Step b) A solution of 4 N HCl in 1,4-dioxane (5 mL) was added to 4-lb (1.4 g, 1.3 mmol) at room temperature and the solution was stirred for 2 h and then concentrated in vacuo. Ether crystallization provides 4-lc as a white solid. MS (m / z) M + l = 877.

Stage Three 4-1d: X, -βOC b) _ ^ Compound 11: X ^ H Step a) To a solution of 4-lc (550 mg, 0.6 mmol) in DMF was added sequentially DIPEA (550 uL, 3.1 mmol), HBTU (611 mg, 1.6 mmol) and HOBt (246 mg, 1.6 mmol). After stirring for 5 minutes BOC-NMe-AlaOH (327 mg, 1.6 mmol) was added and the reaction mixture was stirred overnight at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid, aqueous NaHC03 and brine, dried over MgSO4 and concentrated in vacuo. Purification by flash chromatography provides 4-ld as a white solid.

Step b) A solution of 4 N HCl in 1,4-dioxane (5 mL) was added to 4-ld (520 mg, 0.4 mmol) at room temperature and the solution was stirred for 2 h and then concentrated in vacuo. Ether crystallization provides compound 11-2HC1 as a white solid. MS (m / z) M + l = 1048.

. Synthesis of compound 18 Stage One Step a) To a solution of Boc-Glu (OBn) -OH (5.55 g, 16.4 mmol) in DMF was added sequentially DIPEA (12.5 mL, 71.8 mmol), HOBt (3.86 g, 28.6 mmol) and HBTU (5.43 g, 14.3 mmol). After stirring for 5 minutes I-2c (3.04 g, 9.0 mmol) was added and the reaction mixture was stirred overnight at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid, aqueous NaHC03 and brine, dried over MgSO4 and concentrated in vacuo. Purification by flash chromatography affords 5-la as a white solid.

Step b) A solution of 4 N HCl in 1,4-dioxane (20 mL) was added to 5-la (5.2 g, 8.4 mmol) at room temperature and the solution was stirred for 2 h and then concentrated in vacuo. The crystallization of ether gives 5-lb as a white solid. -1c; R = ßp b) 5-1d; R = H Step a) To a solution of Boc-NMe-Ala-OH (2.1 g, 10.4 mmol) in DMF was added sequentially DIPEA (10.5 mL, 60.3 mmol), HBTU (3.0 g, 9.3 mmol) and HOBt (2.0 g, 15.3 mmol). After stirring for 5 minutes, 5-lb (4.7 g, 8.4 mmol) was added and the reaction mixture was stirred overnight at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid, aqueous NaHC03 and brine, dried over MgSO4 and concentrated in vacuo. Purification by flash chromatography provides 5-lc as a white solid.

Step b) A suspension of 5-lc (1.9 g, 2.8 mmol) and 10% Pd / C (196 mg) was stirred for 3 hours under hydrogen atmosphere. The reaction was filtered through celite and the filtrate was concentrated in vacuo. Purification by flash chromatography provides 5-Id as a solid White , Stage Three b) 18.2HCI; R = H Step a) To a solution of 5-ld (101 mg, 0.16 mmol) in DMF was added sequentially DIPEA (200 uL, 1.1 mmol), HBTU (56 mg, 0.14 mmol) and HOBt (24 mg, 0.18 mmol ). After stirring for 5 minutes, ethylenediamine (3.7 mg, 0.06 mmol) was added and the reaction mixture was stirred overnight at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid, aqueous NaHC03 and brine, dried over MgSO4 and concentrated in vacuo. Purification by flash chromatography gives 5-le as a white solid.

Step b) A solution of 4 N HCl in 1,4-dioxane (5 mL) was added to 5-le (75 mg, 0.06 mmol) at room temperature and the solution was stirred for 2 h and then concentrated in vacuo. Ether crystallization afforded compound 18-HC1 as a white solid. MS (m / z) (M + 2) / 2 = 527.3. 6. Synthesis of compound 15 Stage One i 6-1a: R = Boc b) I-6-1b: R = H.TFA Step a) Boc-L-proline (9.36 g, 43.5 mmol), HOBt (8.0 g, 52.2 mmol), EDC ( 10 g, 52.2 mmol) and DIPEA (30 mL, 174 mmol) in dry dichloromethane (200 mL) under N2 and stirred for 10 minutes at room temperature. Then 1, 2, 3, -R-Tetrahydronaphthylamine (6.72 g, 45.6 mmol) was added and the solution was allowed to stir for 24 h at RT. The contents were added in a separator funnel together with EtOAc and washed with 10% citric acid (2x), saturated NaHCO 3 (2x) and brine. The organic layer was collected, dried and concentrated under reduced pressure to provide 6-the Step b) The product from step a) was treated with 50% CH2C12 / TFA (50 mL) for 1 h at room temperature. The volatiles were removed in vacuo to give 6-lb as the TFA salt. MS (m / z) M + l = 245.

Stage Two Step a) Z-Orn (Boc) OH (2.63 g, 7.2 mmol) was dissolved, HOBt (1.19 g, 7.8 mmol), HBTU (2.96 g, 7.8 mmol) and DIPEA (4.6 mL, 26 mmol) in dry DMF (12 mL) under N2 and stirred for 10 minutes at room temperature. The intermediary 6-lb (3.0 g, 6.5 mmol) was then added and the solution allowed to stir for 24 h at room temperature. The contents were added in a separatory funnel together with EtOAc and washed with 10% citric acid (2x), saturated NaHCO 3 (2x) and brine. The organic layer was collected, dried and concentrated under reduced pressure to provide 6-lc.

Step b) The product from step a) was treated with 10 ml of 50% CH2C12 / TFA for 1 h at room temperature to give 6-ld as its TFA salt. MS (m / z) M + l = 493.

Stage Three Step a) Intermediate 6-ld (200 mg, 0.33 mmol), DMAP (5 mg, catalytic) and DIPEA (230 μL, 1.32 mmol) were dissolved in dry dichloromethane (5 mL) under N2 and terephthaloyl chloride (30 mg , 0.15 mmol) was then added and the solution was stirred for 24 h at RT. The contents were added in a separatory funnel together with EtOAc and washed with 10% citric acid (2x), saturated NaHCO 3 (2x) and brine. The organic layer was collected, dried and concentrated under reduced pressure to give the 6 -le product as a yellow oil.

Step b) 6. Le (160 mg, 0.19 mmol) and 10% Pd / C (50% H20, 100 mg) in MeOH (10 ml) under N2 were mixed together, N2 then rinsed with H2 and the The mixture was stirred for 24 h at RT. The mixture was filtered on celite, washed with MeOH. The filtrate was collected, dried and concentrated or reduced pressure to give the product 6-lf. MS (m / z) M + l = 847.

Stage Four Step a) Boc-N-Me-Ala-OH (74 mg, 0.37 mmol), HOBt (59 mg, 0.38 mmol), HBTU (144 mg, 0.38 mmol) and DIPEA (140 μL, 0.8 mmol) were dissolved in DMF. dry (5 ml) under N2 and they agitated for 10 minutes at RT. Then 6-lf (135 mg, 0.16 mmol) was added and the solution was allowed to stir for 24 h at RT. The contents were added in a separatory funnel together with ETOAc and washed with 10% citric acid (2x), saturated NaHCO 3 (2x) and brine. The organic layer was collected, dried and concentrated under reduced pressure to provide 6-lg.

Stage b) The 6-lg intermediate was subsequently treated with 4N HCl in 1,4-dioxane for 1 h at room temperature. Trituration with diethyl ether gave the bis-HCl salt of compound 15. MS (m / z) M + l = 1017. 7. Synthesis of compound 14 Step a) To a solution of 7-la (206 mg, 0.35 mmol) in dichloromethane (5 mL) was added sequentially DIPEA (100 uL, 0.57 mmol) and terephthaloyl chloride (31.3 mg, 0.15 mmol) and the reaction was stirred for 12 hours at room temperature. Water and ethyl acetate were added, the organic layer was separated, washed with 10% citric acid, aqueous NaHC03 and brine, dried over MgSO4 and concentrated under reduced pressure. Purification by flash chromatography afforded 7-lb as a white solid.

Step b) A solution of 4 N HCl in 1,4-dioxane (1 mL) was added to 7-lb (16 mg, 0.01 mmol) at room temperature and the solution was stirred for 2 h and then concentrated in vacuo. Trituration with diethyl ether gave compound 14-2HC1 as a white solid, MS (m / z) (M + 2) /2=546.5.

Intermediate l-2d (250 mg, 0.78 mmol), HOBt (120 mg, 0.78 mmol), HBTU (300 mg, 0.78 mmol) and DIPEA (525 μL, 3 mmol) were dissolved in dry DMF (5 mL) under N2 and they stirred for 10 minutes at room temperature. The 6-lb intermediate (215 mg, 0.6 mmol) was added and the solution allowed to stir for 24 h at room temperature. The contents were added in a separatory funnel together with EtOAc and washed with 10% citric acid (2x), brine (2x) and saturated NaHCO 3 (2x). The organic layer was collected, dried and concentrated under reduced pressure. The product was purified by flash chromatography (hexanes / EtOAc) and subsequently treated with 4N HCl in 1,4-dioxane, the volatiles were removed and triturated with diethyl ether to give 8-la as the HCl salt. MS (m / z) M + l = 384.3.

Stage b) Boc-Me-Ala-OH (130 mg, 0.63 mmol), HOBt (100 mg, 0.63 mmol), HBTU (240 mg, 0.63 mmol) and DIPEA (420 μL, 2.4 mmol) in dry DMF (5 mL) were dissolved. N2 and it stirred for 10 minutes at RT. Then 8-lb (200 mg, 0.48 mmol) was added and the solution was allowed to stir for 24 h at RT. The contents were added in a separatory funnel together with EtOAc and washed with 10% citric acid (2x), brine (2x) and saturated NaHCO 3 (2x). The organic layer was collected, dried and concentrated under reduced pressure. The 8-lb product was purified by flash chromatography (hexanes / EtOAc). MS (m / z) M + l = 569.4 Stage c) Compound 23'2HC1 The 8-lb intermediate (70 mg, 0.123 mmol), CuCl (20 mg, 0.185 mmol) and tetramethylethylenediamine (27 μL, 0.185 mmol) were dissolved in dry acetone (3 mL) and stirred at RT under an atmosphere of 02 for 72 hours. h. EtOAc was added and the mixture transferred to a separatory funnel. The mixture was washed with 10% citric acid (2x), brine (2x) and saturated NaHCO 3 (2x). The organic layer is collected, dried and concentrated under reduced pressure. The product was purified by flash chromatography (hexanes / THF). The resulting product was stirred with 4N HCl in 1,4-dioxane for 2 hours. The volatiles were removed under reduced pressure and the residue triturated with diethylether to provide compound 23 as its bis-HCl salt. MS (m / z) M + l = 935.1. 9. Synthesis of compound 25 To a solution of 23.2HC1 (100 mg, 0.1 mmol) in anhydrous MeOH (10 mL) and stirred under N2 was added 10% Pd / C (500 mg). The reaction mixture was purged with hydrogen and stirred for 16 h under atmospheric pressure of hydrogen. The mixture was then filtered through celite and the filtrate was concentrated in vacuo to provide compound 25'2HC1 as a white solid. MS (m / z) M + l = 943.6, . Synthesis of compound 41 a) - 10-a? i = Boc,? 2 = Cbz - 10-cX = Boc - 10-bX1 = Boc,? 2 = H c) - «- Compound 41-2HO Step a) To a solution of 10-a (4.90 g, 6.15 mmol) in anhydrous MeOH (120 mL) and stirred under N2 was added 10% of Pd / C (500 mg). The reaction mixture was purged with H2 and stirred for 3 h, then filtered through celite. The filtrate was concentrated in vacuo to provide intermediate 10-b as a white solid. MS (m / z) M + l = 662.4.

Step b) A solution of 10-b (200 mg, 0.30 mmol) in dichloromethane, cooled to 0 ° C, Et3N (84 μL, 0.60 mmol) and oxalyl chloride (13 μL, 0.15 mmol) were added sequentially. The reaction was then stirred for 4 hours at room temperature. Aqueous NaHC0 and ethyl acetate were added, the organic layer was separated, washed with brine, dried over anhydrous MgSO4, filtered and concentrated in vacuo. Purification by elution of silica gel chromatography with a hexane / tetrahydrofuran gradient provided the expected compound 10-c as a white solid.

Step c) 4N HCl in 1,4-dioxane (3 ml) was added at 10-c. (95 mg, 0.07 mmol) and the solution was stirred for 2 hours at room temperature. The volatiles were removed under reduced pressure and the residue was triturated with diethylether to provide compound 41 as its bis-HCl salt. MS (m / z) (M + 2) /2=589.4. Representative compounds of the present invention were prepared by simple modification of the above procedures and are illustrated in Table 1: TABLE 1 The representative compounds of the present invention which can be prepared by simple modification of the above procedures and are illustrated in Tables 2 to 11.

TABLE 2 M1-BG-M2 Formula IA TABLE 3 B and B are C6-C6 alkyl Note: In M1 and M2, the stereochemistry in the connecting carbon is (S) Table 4 M 1 - B - BG - B1 - 2 Formula 1B Note: In M1 and M2, the stereochemistry at the connecting carbon is (S) TABLE 5 M1-BG-M2 Formula 1A Note: In the following Table R4 is H or any substituent without acyl TABLE 6 1 - B BG B1 - M2 Formula 1B Note: In M1 and M2, the stereochemistry at the connecting carbon is (S) Note: In the following Table R4 is H or any substituent without acyl Table 7 M 1 - B - BG - B1 - M2 Formula 1 B B and B1 are Ci-C6 alkyl Note: In M1 and M2, the stereochemistry in the connecting carbon is (S) Note: In the following Table R4 is H or any substituent without acyl 20 25 TABLE 9 wherein R1, R100, R2, R20D, B, B1, n, BG, A, A1, are as defined herein; Q and Q1 are independently defined as NR4R5, wherein R5 is defined as herein and R4 is selected the following: TABLE 10 wherein R1, R00, R2, R200, B, B1, n, BG, A, A1, are as defined herein; Q and Q1 are independently defined as OR11, and R11 is selected from the following: TABLE 11 wherein R1, R100, R2, R2M, B, B1, n, m, BG, A, A1, are as defined herein; Q and Qi are independently defined as S (0) m R11, and R11 is selected as follows: Assays 11. Molecular constructors for GST-XIAP BIR3RING expression: XIAP encoded sequence of amino acids 246-497 cloned in PGEX2T1 through BamHI and AVAI. The plasmid was transformed into E. coli DH5a for use in the expression and purification of probeins. GST-HIAP2 (cIAP-1) BIR3: Coding sequence HIAP2 of the amino acids 251-363 cloned in PGex4T3 through BamHI and XhoI. The plasmid was transformed into E. coli DH5a for use in the expression and purification of probeins. GST-HIAP1 (cIAP-2) BIR 3: Codified sequence HIAP1 of amino acids 236-349, cloned in PGex4T3 through BamHI and XhoI. The plasmid was transformed into E. Coli DH5a for use in the expression and purification of probeins. GST - BIR 2 linker BIR3Ring: XIAP encoded sequence of amino acids 93-497 cloned in PGex4Tl through BamHl and Xhol. Amino acids 93-497 were amplified by parib of XIAP of longibud compleba in pGex4t3, using the sebadores TTAATAGGATCCATCAACGGCTTTTATC and GCTGCATGTGTGTCAGAGG, using standardized PCR conditions. The fragmenbo of PCR was cloned TA in pCR-2.1 (Invibrogen). The BIR 2 BIR3Ring linker was subcloned into pGex4Tl by BamHI / XhoI digestion.

The plasmid was transformed into E. coli DH5a for use in the expression and purification of probeins. Human XIAP of bobal longibud, number 23 of plasmid Aegera. Sequence codifies XIAP of amino acids 1-497 cloned in the fusion vecbor GST, PGEX4T1 through the sibios of resuscitation BamHl and Xho I. (a donation of Bob Korneluk and Peber Lisbon). The plasmid was transformed into E. coli DH5a for use in the expression and purification of probeins. GST-XIAP linker BIR 2: codified sequence Linker BIR XIAP of amino acids 93-497 cloned in pGex4T3 through BamHI and Soy. The plasmid was transformed into E. coli DH5a for use in the expression and purification of probeins. 12. Fluorescent probe synthesis for FP assay A fluorescent beaker probe, Fmoc-Ala-Val-Pro-Phe-Tyr (b-Bu) -Leu-Pro-Gly (b-Bu) -Gly-OH was prepared using standard Fmoc chemistry in 2-chlorotryl chloride resin (Int. J. Pept. Prot. Res. 38: 555-561, 1991). The splitting from the resin was done using 20% acetic acid in dichloromethane (DCM), which left the side chain still blocked. The C-terminal protected carboxylic acid was coupled to '- (aminomethyl) fluorescein (Molecular Probes, A-1351; Eugene, Oregon) using excess diisopropylcarbodiimide (DIC) in dimethylformamide (DMF) at room temperature and purified by silica gel chromatography (10% methanol in DCM). The N-terminal Fmoc protection group was removed using piperidine (20%) in DMF, and purified by silica gel chromatography (20% methanol in DCM, 0.5% HOAc). Finally, the t-butyl side chain protecting groups were removed using 95% trifluoroacetic acid containing 2.5% water and 2.5% triisopropyl silane. The obtained peptide displayed a single peak by HPLC (> 95% pure). 13. Expression and purification of recombinant proteins A. Expression of Recombinant Proteins Labeled proteins were expressed with Glutathione S-transferase (GST) in strains of Escherichia coli DH5-alpha. For full length, single-length XIAP expression or combinations of CIAP BIR domains, cultured cIAP-1, cIAP-2 and Livin transformed in the middle of Luria Broth (LB) supplemented with 50 μg / ml were grown overnight at 37 ° C. of ampicillin. The overnight culture was diluted 25-fold in medium supplemented with ampicillin LB and the bacteria were cultured to A6oo = 0.6, then induced with 1 mM isopropyl-D-1-thiogalactopyranoside for 3 hours. In the induction, the cells were centrifuged at 5000 RPM for 10 minutes and the medium was removed. Each granule obtained from a 1 liter culture received 10 ml of lysis buffer (50 mM Tris-HCl, 200 mM NaCl, 1 mM DTT, 1 mM PMSF, 2 mg / ml lysosim, 100 μg / m)), incubated at 4 ° C with gentle agitation. After 20 minutes of incubation, the cell suspension was placed at -80 ° C overnight or until needed. B. Purification of recombinant proteins For purification of recombinant proteins, the cell lysate induced by IPTG was thawed by vortexing and then altered by flash freezing in liquid nitrogen twice with a vortex after each thawing. The cells were further altered by passing the extract four times through a Bio-Neb cell disrupting device (Glas-cab) set at 100 psi with Nitrogen gas. The extract was clarified by centrifugation in 4C at 15,000 RPM in a Beckman SS-34 rotor for 30 minutes. The resulting supernatant was then mixed with 2 ml of glutathione-Sepharose beads (Pharmacia) per 500 ml of cell culture (per 1000 ml of culture for full length XIAP) for 1 hour at 4C. Subsequently, the beads were washed 3 times with IX of Tris-buffered Saline Solution (TBS) to remove unbound proteins. The retained proteins were eluted with 2 washes of 2 ml of 50 mM TRIS pH 8.0 containing 10 M of reduced glutathione. The eluted proteins were pooled and precipitated with 604 g / liter of ammonium sulfate and the resulting granule was resuspended in an appropriate buffer. As judged by SDS-PAGE the purified proteins were > 90% pure. The concentration of protein or purified proteins was determined from the Bradford method. His-tag proteins were expressed in the E. coli strain in AD494 cells of E. coli using a pet28ACPP32 construct. The fraction of soluble proteins was prepared as described above. For protein purification, the supernatant was purified by affinity chromatography using chelating Sepharose (Pharmacia) loaded with NiS04, according to the manufacturer's instructions. The purity of the eluted protein was > 90% pure as determined by SDS-PAGE. The protein concentration of purified proteins was determined from the Bradford assay.

Binding Assay 14. Competition Test Based on Fluorescence Polarization For all assays, fluorescence and fluorescence polarization were evaluated using a Polarion Tecan instrument with the excitation filter set at 485 nm and the emission filter set at 535 nm. For each assay, the concentration of the target protein was first established by titration of the selected protein in order to produce a linear dose response signal when incubated alone in the presence of the florescent probe. When establishing these conditions, the potency and selectivity of the compounds (IC50), was evaluated in the presence of a fixed defined amount of target protein and fluorescent probe and a serial dilution of 10 points of the selected compounds. For each IC 50 curve, the assays were activated as follows: 25 μl / well of the compound diluted in 50 mM buffer MES pH 6.5 was added to a black 95-well plate, then 25 μl / well of bovine serum albumin ( BSA) at 0.5 mg / ml in 50 M of MES pH 6.5. The auto-fluorescence for each compound was evaluated by first reading the compound / BSA solution alone. Then 25 μl of the fluorescein probe diluted in 50 mM MES containing 0.05 mg / ml of BSA were added and a reading to detect fluorescein signal extinction was made. Finally 25 μl / well of the target protein or control (GST-BIRs) diluted at the appropriate concentration in 50 mM of MES containing 0.05 mg / ml of BSA were added and the fluorescence polarization was evaluated.

. Determination of IC50 and inhibitory constants For each test, fluorescent polarization units were plotted against the final concentrations of the compound and the IC50 was calculated using the software Grad pad prism and / or Cambridge soft. The ki value was derived from the IC 50 value calculated as described above and according to the equation described in Nikolovska-Coleska, Z. (2004) Anal Biochem 332, 261-273. 16. De-repression assay of BIR2 linker or BIR2-BIR3-RING linker, of Caspase-3 total length XIAP In order to determine the relative activity of the selected compound against XIAP-Bir2, an in vitro assay was prepared where caspase-3 was inhibited by GST fusion proteins from the bIA2 linker, XIAP Bir2-Bir3-RING Linker or full-length XIAP. Caspase-3 (0.125 μl) and 12.25-34.25 nM (final concentration) of the GST-XIAP fusion protein (GST-Bir2, GST-Bir2Bir3RING or full length XIAP) were co-incubated with serial dilutions of the compound ( 200 μM-5 pM). The activity of caspase 3 was measured by overlapping 25 μl of a 0.4 mM DEVD-AMC solution. The final reaction volume was 100 μl. All dilutions were made in caspase buffer (50 mM Hepes pH 7.4, 100 mM NaCl, 10% sucrose, 1 mM EDTA, 10 mM DTT, 0.1% CHAPS (Stennicke, H.R., and Salvesen, G.S. (1997). The biochemical characteristics of caspase-3, 6, 7 and 8. J. Biol. Chem. 272, 25719-25723). The fluorescent AMC released from caspase-3 hydrolysis of the substrate was measured in a TECAN spectrophotometer at 360 nm excitation and 444 nm emission, after 15 minutes of incubation at room temperature. The IC 50 values were calculated in a competition model of one or two sites using GraphPad v4.0, using the fluorescence values after 15 minutes of incubation plotted against the loglO concentration of the compound. The compounds which were tested in the apoptosome assay and the BIR2 binding inhibition assay. -Bir3 / caspase-3 was found to have IC50s as illustrated in Table 12.

TABLE 12 In Vitro Activity of Selected Compounds Against IAPs Nd = Not determined; Caption: FP test: A < 5nM; B < 100 nM; C > 100 Nm; Caption: Apoptosome assay: A < 0.1μM; B < 0.5 μM; C > 1 μM. The results showed that the selected compounds can inhibit the caspase blockade activity of XIAP in an apoptosome assay (expressed at an effective concentration to achieve 50% activation and report that Ki binds to several IAPs.) This Ki was calculated to from the displacement of a fluorescent probe capable of binding to the bir3 domain of several IAPs using a fluorescence polarization assay.

Cell-free assay 17. Caspase de-repression assay using cell extracts (apoptosome) 100 μg of 293 cells of S100 extract and 0.25 μM-2 μM of GST-XIAP fusion protein (XIAP-Bir3RING, XIAP-Linker Bir2Bir3RING or Full-length XIAP) were co-incubated with serial dilutions of the compound (40 μM-5 pM). The caspases present in the extracts were activated and added 1 mM of dATP, 0.1 mM of ALLN, 133 μg of Cytochrome C (final concentrations) and incubated at 37 ° C for 25 minutes. All reactions and dilutions used S100 buffer (50 mM Pipes pH 7.0, 50 mM KCl, 0.5 mM EGTA pH 8.0, 2 mM MgC12 supplemented with 1/1000 dilutions of 2 mg / ml of Cytocalysin B, 2 mg / ml Chymostatin, leupeptin, Pepstatin, Antipain, 0.1 M PMSF, 1 M DTT). The final reaction volume was 30 μl. The activity of caspase-3 was measured by overlapping 30 μl of a DEVD-AMC solution in 0.4 mM, the splitting of AMC released in a TECAN spectrophotometer was measured in an excitation of 360 nm and 444 nm emission, in a kinetic cycle of 1 hour with readings taken every 5 minutes. Caspase activity was calculated as fluorescence V0 / sec AMC. The de-repression of caspase by our compounds was compared for the fully activated extract and the activated extract represented by the presence of the XIAP fusion protein. 18. Cell Culture and Cell Death Assays A. Cell Culture MDA-MD-231 (breast) and SKOV-3 (ovarian) cancer cells were cultured in RPMI1640 medium supplemented with 10% FBS and 100 units / ml Penicillin. and Streptomycin. B. Assays Viability tests were done on a number of cells including MDA-MB-231, KSVO-3 cells, H460, PC3, HCT-116 and S 480. The cells were seeded in 96 well plates at a respective density of 5000 and 2000 cells per well and incubated at 37 ° C in the presence of 5% C02 for 24 hours. The selected compounds were diluted in the medium in various concentrations ranging from 0.01 μM to 100 μM. The diluted compounds were added in the MDA-MB-231 cells. For MDA-MB-231 cells SKOV3, H460, PC3, HCT-116 and S 480, the compounds were added either alone or in the presence of 1-3 ng / ml of TRAIL. After 72 hours, cell viability was evaluated by MTT-based assays. The IC50 of the compounds selected against the MDA and SKOV3 cell lines are presented in Table 13: Table 13: IC50s of selected compounds against MDA and SKOV3 cell lines The compounds exemplified in Table 1 were tested and found to have IC50s in the following ranges: A < 100 nM; B < 1000 nM; Or 1000 nM. 19. Apoptosis assay: Measurement of caspase-3 activity from cultured cells. One day before the treatment, 10 000 cells were plated per well in a 96-well plate treated with white tissue culture with 100 μl of medium. On the day of compound treatment, the compounds were diluted by cell culture to a concentration of the usable 2X material and 100 μl of the diluted compound, were added to each well and the plate was incubated for 5 hours at 37 ° C in presence of 5% C02. In the incubation, the plate was washed twice with 200 μl cold TRIS (TBS) TRIS buffer. Cells were used with 50 μl Caspase assay buffer (20 mM Tris-HCl pH 7.4, 0.1% NP-40, 0.1% Chaps, 1 mM DTT, 0.1 mM EDTA, 0.1 mM PMSF, 2 mg / ml of Chymostatin, Leupeptin, Pepstatin, Antipain) was then incubated at 4 ° C with shaking for 30 minutes. 45 μl of Caspase assay buffer and 5 μl of Ac-DEVD-AMc at 1 mg / ml were added to each well, the plate was shaken and incubated for 16 hours at 37 ° C. The amount of AMC release was measured on a TECAN spectrophotometer with the excitation and emission filter set at 360 nm and 444 nm. The percentage of Caspase-3 activity was expressed in comparison to the signal obtained with the untreated cells.

. Cellular Biochemistry: A. Detection of XIAP and PARP / Caspase-3 / Caspasa-9 The detection of cells expressing XIAP and PARP was done by western blotting. The cells were plated at 300,000 cells / well in 60 mm wells (6-well plate disc). The next day, the cells were treated with a selected compound in the indicated concentration. 24 hours later, the cells with trypsin were granulated by centrifugation at 1800 rpm at 4 ° C. The resulting granule was rinsed twice with cold TBS. The final washed cell pellet was smooth with 250 μl of lysis buffer (NP-40, glycerol, 1% of a protease inhibitor cocktail (Sigma)), placed at 4 ° C for 25 minutes with gentle agitation. The cell extract was centrifuged at 4 ° C for 10 minutes at 10,000 rpm. Both the supernatant and the granule were maintained for western blot analysis as described below. From the supernatant, the protein content was evaluated and approximately 50 μg of the protein was fractionated in 10% SDS-PAGE. The granules were washed with the lysis buffer and resuspended in 50 μl of Lamelli IX buffer, boiled and fractionated on SDS-PAGE. In the electrophoresis each gel was electro-transferred on a nitrocellulose membrane at 0.6A for 2 hours. Non-specific sites were blocked membrane for 1 hour with 5% skim milk in TBST (TBS containing 0.1% (v / v) Tween-20) at RT. For immunodetection of proteins, membranes were incubated overnight with primary antibodies raised against clone 48 XIAP obtained from Becton-Dickison) or PARP: obtained from Cell signal or primary antibodies were incubated caspase-3 or caspase-9 at 4 ° C with agitation in dilutions as follows: Clone 80 XIAP (Becton-Dickinson) ... 1/2500 PARP (Cell Signal) ... 1/2500 Caspasa 3 (Sigma) ... 1/1500 Caspasa 9 (Upstate) .. 1/1000 In the overnight incubation, the membranes received three 15 minute washes in TBST then incubated for 1 hour at room temperature in the presence of a secondary antibody coupled with HRP enzyme (Chemicon) and diluted in 1/5 000. In the incubation, each membrane was washed three times with TBST and the immunoreactive bands were detected by the addition of a luminescent substrate (ECL kit Amersham) and the signal was captured on an X-ray film for various exposure times. The active compounds demonstrated that they induce the cleavage of PARP and XIAP as well as to transfer XIAP in an insoluble compartment. 21. Hollow fiber model The hollow fiber in the in vivo model was used to demonstrate the in vivo efficacy of the selected compounds against selected cell lines as single agent therapy or in combination with selected cytotoxic agents. On day 1, the selected cell lines were cultured and the fiber filled at a cell density of approximately 40,000 cells / fiber. On the day of the operation (day 4), three fibers were implanted subcutaneously in male Nu / Un CD-1 mice of 28-35 g. On day 5, mice began to receive a daily injection by intravenous or subcutaneous route of the control vehicle or vehicle containing the selected compound at the appropriate concentration and / or injection of the cytotoxic agent intra-peritoneally. On days 7 of the non-consecutive treatments, the animals were sacrificed, each fiber was removed and the metabolic viability of the remaining cells was determined by MTT assay. The effectiveness of the compound is defined as the difference between the MTT values obtained from the cell containing the fiber taken from the animal treated with vehicle and from the animal treated with the compound alone or the given compound in combination with the cytotoxic agent. 22. Combination of anti-cancer therapy in vivo Female nude mice received 2X10 of HCT-116 subdermally on the right side. On day 26, when tumors had -90 mm, animals were assigned to groups using a balanced design based on tumor size. At this time, treatment of mitomycin C and Compound 23 was initiated. Mitomycin C ip was administered at 1 mg / kg, Monday through Friday for two weeks. Compound 23 iv was given in 1 or 5 mg / kg five times per week of the duration of the experiment. The tumor measurements were taken twice a week. As illustrated in Figure 1, compound 23 sd an increased anti-tumor effect in combination with mitomycin C with increased doses, with 5 mg / kg sng superior anti-tumor effects compared to the dose of 1 mg / kg. 23. Pharmacokinetic studies Selected compounds were dissolved in normal saline or appropriate vehicle and were given in several doses using a different route of administration, including intravenous bolus, intravenous infusion, oral and subcutaneous injection. All literature, patents, published patent applications cited herein and incorporated therefore for reference. From the foregoing, it will be appreciated that while the specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without departing from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.

Claims (79)

1. NOVELTY OF THE INVENTION Having described the present invention, it is considered as a novelty and therefore the property described in the following claims is claimed as property.
2. CLAIMS 1. An isomer, enantiomer, diastereomer or tautomer of a compound represented by Formula I:
3. I or a salt thereof, wherein: n is 0 or 1; m is 0, 1 or 2; p is 1 or 2; And it is NH, O or S; A and A1 are independently selected from 1) -CH2-, 2) -CH2CH2-, 3) -C (CH3) 2-,
4. 4) -CH (C? -C6 alkyl) -,
5. 5) -CH (C3-C7 cycloalkyl) -, 6) -C3-C7 cycloalkyl-, 7) -CH (C?-C6 alkyl-C3-C7 cycloalkyl) -, or 8) -C (O) -; B and B1 are independently C? -C6 alkyl; BG is 1) X-L-X1-; or BG is X and X1 are independently selected from 1) O.NR13, S, O 2) Fy. L is selected from: 1) -C--C? 0 ?-, 2-alkyl) -C2-Cß-, 3-alkenyl) -C2-C4-alkynyl, 4) -C3-C7-cycloalkyl-, 5) phenyl-, 6) -biphenyl-, 7) -heteroaryl-, 8) -heterocyclyl-, 9) -alkyl of d-C6- (C2-C6 alkenyl) -alkyl of C? -C6-, 10) - C?-C6- (C2-C4 alkynyl) alkyl-Ci-Ce alkyl, 11) -Ci-Cß- (C3-C7 cycloalkyl) alkyl- Ci-Cß alkyl, 12) -Ci-alkyl -Cβ-phenyl-Ci-Cß alkyl, 13) -C--C6-biphenyl-C de-C6 alkyl, 14 alkyl) -C--C6-heteroaryl-Ci-Cß alkyl, 15) -alkyl of C? -C6-heterocyclyl-C? -C6 alkyl, or 16) -alkyl of C? -C6-0-Ci-C? Alkyl; R1, R100, R2 and R200 are independently selected from: 1) H, or 2) optionally substituted C6-C6 alkyl with one or more substituents R; Q and Q1 are each independently 1) NR4R5, 2) OR11, or Q and Q1 are each independently wherein G is a 5, 6 or 7 membered ring which optionally incorporates one or more heteroatoms chosen from S, N or O, the ring optionally substituted with one or more R12 substituents; R4 and R5 are each independently 1) H, 2) haloalkyl, 3) < -Ci-Ce alkyl, 4) -C2-C6 alkenyl, 5) < -C 2 -C 4 -alkynyl) -C3-C7-cycloalkyl) 7-C3-C7-cycloalkenyl, 8) < -arilo, 9) < -heteroaryl, 10) < -heterocyclyl, 11) < -heterobicyclyl, 12) < -C (0) -R, 13) < -C (0) 0-R, 14) < -C (= Y) NR8R9, or 15) -S (0) 2-RU. wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; R6 is 1) halogen, 2) N02, 3) CN, 4) haloalkyl, 5) C6-C6 alkyl, 6) C2-C6 alkenyl, 7) C2-C4 alkynyl, 8) C3-C7 cycloalkyl , 9) C3-C7 cycloalkenyl, 10) aryl, 11) heteroaryl, 12) heterocyclyl, 13) heterobicyclyl, 14) OR7, 15) S (0) mR7 16) NR8R9, 17) NR8S (0) 2Rn, 18) COR7, 19) C (0) OR7, 20) CONR8R9, 21) S (0) 2NR8R9 22) OC (0) R7, 23) OC (0) YR , 24) SC (0) R7, or 25) NC (Y) NR8R9, wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more substituents R10; R7 is 1) H, 2) haloalkyl, 3) Ci-Cß alkyl, 4) C2-C6 alkenyl, 5) C2-C4 alkynyl, 6) C3-C7 cycloalkyl, 7) C3-C7 cycloalkenyl, 8) aryl, 9) heteroaryl, 10) heterocyclyl, 11) heterobicyclyl, 12) R8R9NC (= Y), or 13) C2-C6 alkyl-C2-C4 alkenyl, or 14) C2-C4-C6-alkynyl alkyl of C2-C4, wherein the alkyl, alkenyl, alkynyl, cycloalkyl , cycloalkenyl cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; R8 and R9 are each independently 1) H, 2) haloalkyl, 3) C6-6 alkyl, 4) C2-C6 alkenyl, 5) C2-C4 alkynyl, 6) C3-C7 cycloalkyl, 7) C3-C7 cycloalkenyl, 8) aryl, 9) heteroaryl, 10) heterocyclyl, 11) heterobicyclyl, 12) C (0) R11, 13) C (0) Y-Rn, or 14) S (0) 2-Ru , wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R8; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; or R8 and R9 together with the nitrogen atom to which they are attached form a five, six, or seven membered heterocyclic ring optionally substituted with one or more R6 substituents; R10 is 1) halogen, 2) N02, 3) CN, 4) B (OR13) (OR14), 5) Ci-Cß alkyl, 6) C2-C6 alkenyl, 7) C2-C4 alkynyl, 8) C3-C7 cycloalkyl, 9) C3-C7 cycloalkenyl, 10) haloalkyl, 11) OR7, 12) NR8R9, 13) SR7, 14) COR7, 15) C (0) OR7, 16) S (0) mR7, 17) CONR8R9, 18) S (0) 2NR8R9, 19) aryl, 20) heteroaryl, 21) heterocyclyl, or 22) heterobicyclyl, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, and cycloalkenyl are optionally substituted with one or more substituents R6; R 12 is 1) haloalkyl, 2) C 1 -C 6 alkyl, 3) C 2 -C 6 alkenyl, 4) C 2 -C 4 alkynyl, 5) C 3 -C 7 cycloalkyl, 6) C 3 -C 7 cycloalkenyl, 7) aryl , 8) heteroaryl, 9) heterocyclyl, or 10) heterobicyclyl, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; R12 is 1) haloalkyl, 2) C alquilo-C6 alkyl, 3) C2-Ce alkenyl, 4) C-C4 alkynyl, 5) C3-C7 cycloalkyl, 6) C3-C7 cycloalkenyl, 7) aryl , 8) heteroaryl, 9) heterocyclyl, 10) heterobicyclyl, 11) C (0) -Rn, 12) C (0) 0-R, 13) C (0) NR8R9, 14) S (0) mR, or ) C (= Y) NR8R9, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more substituents R1; R 13 and R 14 are each independently 1) H, or 2) C 1 -C 6 alkyl; or R13 and R14 combine to form a ring heterocyclic or a heterobicyclyl ring; or a prodrug; or the compound of Formula I is labeled with a detectable label or an affinity tag. 2. The compound according to claim 1, characterized in that it is a salt. 3. The compound, according to claim 1, characterized in that it is a pharmaceutically acceptable salt. 4. The compound according to claim 1, characterized in that n is 1. 5. The compound according to claim 1, characterized in that A and A1 are both CH2. 6. The compound according to claim 1, characterized in that A and A1 are both C = 0. 7. A compound, according to claim 1, of the Formula la: 1a characterized in that BG B, B1, Q, Q1, R1, R100, R2 and R200 are as defined in claim 1. 8. A compound, according to claim 1, of Formula Ib: '1b characterized in that BG, B, B1, Q, Q1, R1, R100, R and R200 are as defined in claim 1. 9. The compound, according to claim 1, characterized in that B and B1 are both alkyl of C? -C. 10. The compound according to claim 1, characterized in that BG is -X-L-X1-. 11. The compound, in accordance with claim 1, characterized in that BG is fH and H. 12. The compound, in accordance with claim 1, characterized in that BG is 13. A compound, according to claim 1, of Formula lf: 1f characterized in that A, A1, B, B1 Q, Q1 R1 R100, R2 and R200 are as defined in claim 1. 14. A compound, according to claim 1, of the Formula lg: ig characterized in that A, A1, B, B1, Q, Q1, R1, R100, R2 and R200 are as defined in claim 1. 15. The compound, according to claim 1, characterized in that X and X1 are selected independently of 1) O, NH, O 2) A ^ X y, O M 3) \ s' 6), or 16. The compound, according to claim 15, characterized in that X and X1 are independently selected from: 1) 0, O 2) Fy. 3) . OR! O N 4) H 17. The compound, according to claim 16, characterized in that both X and X1 are 0, 18. The compound, according to claim 1, is selected from: 1) -alkyl, C, -C? 0 2) -C2-C4-alkynyl, 3) -phenyl-, 4) -biphenyl-, 5) -alkyl of Ci-C- (C2-C4 alkynyl) - C.sub.6 -C.sub.6 alkyl) -C.sub.6 -C.sub.phenyl- C.sub.1 -C.sub.d.sub.7 alkyl- C.sub.1 -C.sub.6 -biphenyl- C.sub.1 -C.sub.alkyl ester, or 8) -alkyl of C? -C6-0-alkyl of C? -C6. 19. The compound according to claim 18, characterized in that L is selected from 1) -alkyl of C? -C? O-, 2) -phenyl-, 3) -biphenyl-, 4) -CH2- (C2-C4 alkynyl) -CH2-, 5) -CH2-phenyl-CH2- , 6) -CH2-biphenyl-CH2-, or 7) -alkyl of C? -C6-0-alkyl of C? -C6. 20. The compound, according to claim 19, characterized in that L is: 21. The compound according to claim 20, characterized in that r is an integer of 1, 2, 3, 4, 5, 6, 7, or 8. 22. A compound, according to claim 1, of the Formula lh: characterized in that B, B1, X, X1, Q, Q1, R1, R100, R2 and R200 are as defined in claim 1. 23. A compound, according to claim 1, of the formula li: characterized in that B, B1, X, X1, Q, R1, R100, R2 and R200 are as defined in claim 1. 24. A compound, according to claim 1, of Formula lj: characterized in that B, B1, X, X1, Q, Q1, R100, R2 and R200 are as defined in claim 1. 25. A compound, according to claim 1, of the Formula lk: characterized in that B, B1, X, X1, Q, Q1, R1, R100, R2 and R200 are as defined in claim 1. 26. A compound, according to claim 1, of Formula 11: characterized in that B, B1, X, X1, Q, Q1, R1, R100, R2 and R200 are as defined in claim 1. 27. A compound, according to claim 1, of Formula lm: characterized in that B, X, X1, Q, Q1, R1, R100, R2 and R200 are as defined in claim 1. 28. The compound, according to claim 1, characterized in that R1 and R100 are both C-alkyl. ? -C6. 29. The compound, in accordance with claim 28, characterized in that R1 and R100 are both CH3. 30. The compound according to claim 1, characterized in that R2 and R200 are both Ci-Cß alkyl. 31. The compound according to claim 30, characterized in that R2 and R200 are both CH3. 32. The compound, according to claim 1, characterized in that Q and Q1 are both NRR5, wherein R4 and R5 are as defined in claim 1. 33. The compound, according to claim 32, characterized in that A and A1 are both C = 0, R4 is H and R5 is selected from 1) < -haloalkyl, 2) "-alkyl of C? -C6, 3) < -C2-C6 alkenyl, 4) - (-C2-C4 alkynyl) 5'-C3-C7 cycloalkyl, 6) < -C3-C7 cycloalkenyl, 7) < -aryl, 8) -heteroaryl, 9) < -heterocyclyl, or 10) "-heterobicyclyl, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and characterized in that the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; wherein R6 and R10 are as defined in claim 1 34. The compound according to claim 33, characterized in that R4 is H and R5 is selected from: 1) "-C3-C-cycloalkyl, 2)" -C3-C7-cycloalkenyl, 3) "-aryl, 4)" -heteroaryl, 5) "-heterocyclyl, or 6)" -heterobicyclyl. 35. The compound according to claim 34, characterized in that R4 is H and R5 is aryl. 36. The compound according to claim 35, characterized in that R4 is H and R5 is 37. The compound, according to claim 1, characterized in that A and A1 are both C = 0, and Q and Q are both 38. The compound according to claim 32, characterized in that A and A1 are both CH2, then R4 and R6 are each independently DH, 2) haloalkyl, 3) "-alkyl of -C? ~ C6 4)" -alkenyl of C2-C8, 5) «-C2-C6-Alkynyl)« -C3-C7-cycloalkyl, 7) «-3C7-C7-C8-cycloalkenyl)« -aryl, 9) «-heteroaryl, 10)« - heterocyclyl, 11) «-heterobicyclyl, 12)« - C (0) -Rn, 13) «- C (0) 0 -Rn, 14)« - C (= Y) NR8R9, or 15) «- S (0 ) 2-Rn, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and where the aril, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; wherein Y, R6, R8, R9, R10 and R11 are as defined in claim 1. 39. The compound, according to claim 38, characterized in that R4 and R5 are independently selected from DH, 2) C alkyl. ? -C6, 3) «-C (0) -Rn, 4)« -C (0) 0 -Rn, or 5) «-S (0) 2 -Rn, wherein the alkyl is substituted with a substituent R6; wherein R6, and R11 are as defined in claim 1. 40. The compound, according to claim 39, characterized in that R4 is DH, 2) «- C (0) -Rn, 3)« -C ( 0) 0-Rn, or 4) «-S (0) 2 -R11; and R5 is Ci-Cß alkyl substituted with a phenyl; wherein R11 is as defined in claim 1. 41. The compound according to claim 40, characterized in that R4 is D H, 2) «-C (0) -Ru, 3)« -C (0) 0 -Rn, or wherein R .11 is as defined in claim 1. 42. The compound, according to claim 38, characterized in that R11 is 1) haloalkyl, 2) C6-C6 alkyl, 3) "-alkenyl of C2. -Cd, 4) "- C2-C4 alkynyl 5)" -aryl, 6) "-heteroaryl, 7)" -heterocyclyl, or 8) "-heterobicyclyl, wherein the alkyl, alkenyl, alkynyl are optionally substituted with one or more substituents R6; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; wherein R6 and R10 are as defined in claim 1. 43. The compound, according to claim 42, characterized in that R11 is 1) haloalkyl, 2) C6-C6 alkyl, 3) aryl, 4) heteroaryl. , or 5) heterocyclyl, wherein the alkyl is optionally substituted with one or two substituents R6; and wherein the aryl, heteroaryl and heterocyclyl are substituted with a R10 substituent; wherein R6 and R10 are as defined in claim 1. 44. The compound, according to claim 43, characterized in that R11 is 1) haloalkyl, 2) Ci-Cg alkyl optionally substituted with one or two substituents R6, or 3) phenyl optionally substituted with a substituent R10; wherein the substituents R6 and R10 are as defined in claim 1. 45. The compound, according to claim 38, characterized in that R6 is 1) halogen, 2) N02, 3) CN, 4) aryl, 5) heteroaryl, 6) heterocyclyl, 7) heterobicyclyl, 8) OR7, 9) SR7, or 10) NR8R9, wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more substituents R10; wherein R7, R8, R9 and R10 are as defined in claim 1. 46. The compound, according to claim 45, characterized in that R6 is 1) halogen, 2) aryl, or 3) NR8R9, wherein the aryl is optionally substituted with a substituent R10; wherein R8, R9 and R10 are as defined in claim 1. 47. The compound, in accordance with claim 46, characterized in that R6 is 1) halogen, 2) phenyl, or 3) NR8R9, wherein the phenyl is optionally substituted with a substituent R10; wherein R8 and R9 are as defined in claim 1. 48. The compound, according to claim 38, characterized in that R8 and R9 are each independently DH, 2) haloalkyl, 3) C6-C6 alkyl, 4) C2-C6 alkenyl, 5) C2-C alkynyl, 6) C3-C7 cycloalkyl, or 7) C3-C7 cycloalkenyl, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more R6 substituents; wherein the substituents R6 are as defined in claim 1. 49. The compound, according to claim 48, characterized in that each is independently R8 and R9. D H, or 2) C 1 -C 6 alkyl, wherein the alkyl is optionally substituted with an aryl. 50. The compound according to claim 38, characterized in that R10 is D halogen, 2) N02, 3) CN, 4) haloalkyl, 5) OR7, 6) NR8R9, or 7) SR7; wherein R7, R8, and R3 are as defined in claim 1. 51. The compound, according to claim 50, characterized in that R10 is 1) halogen, or 2) C6-C6alkyl. 52. The compound, according to claim 1, A and A1 are both CH, then Q and Q1 are independently selected from: 53. An isomer, enantiomer, diastereomer or tautomer of a compound represented by Formula 1: I or a salt thereof, where: n is 1; m is 0, 1 or 2; And it is NH, 0 or S; A and A1 are independently selected from 1) -CH2-, or 2) -C (0) -; B and B1 are independently C? -C6 alkyl; BG is 1) -X-L-X1-; or X and X1 are independently selected from 1) O, NH, S. O 2) Y 7) H L is selected from: 1) -C--C? 02 alkyl) -C 2 -C 6 alkenyl-, 3) -C 2 -C 4 -alkynyl, 4) -C 7 -cycloalkyl-, 5) -C phenyl-, 6) -biphenyl-, 7) -heteroaryl-, 8) -heterocyclyl-, 9) -alkyl of C? -C6- (C2-Ce alkenyl) -alkyl of C? -C6-, 10) - Ci-Cd- (C2-C4 alkynyl) alkyl-C6-6 alkyl, 11) -Ci-C3- (C3-C7 cycloalkyl) alkyl- C6-C6 alkyl, -3-alkyl) C? -C6-phenyl-Ci-C? Alkyl, 13)-C6-C6-biphenyl-C6-C6 alkyl, 14 alkyl) C6-C6-heteroaryl-C6-C6 alkyl , 15) -alkyl Ci-Cd-heterocyclyl-C-C6 alkyl, or 16) -alkyl of C? -C6-0 -alkyl of C? -C6; R1, R100, R2 and R200 are independently selected from: D H, or 2) Ci-Cd alkyl optionally substituted with one or more substituents R6; Q and Q1 are each independently NR4R5; R4 and R5 are each independently DH, 2) haloalkyl, 3) "- Ci-Ce alkyl, 4)" -C2-Cd alkenyl, 5) "-C2-C4-alkynyl, 6)" -C3 cycloalkyl -C, 7) «-C3-C7-C8-cycloalkenyl, 8)« -aryl, 9) «-heteroaryl, 10)« -heterocyclyl, 11) «-heterobicyclyl, 12)« -C (0) -R, 13) "-C (0) 0-Rn, 14)" -C (= Y) NR6R9, or 15) "-S (0) 2-RU, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more substituents R 10 R c is D halogen, 2) N 0 2, 3) CN, 4) haloalkyl, 5) C 1 -C 6 alkyl, alkenyl of C2-C6, 7) C2-C4 alkynyl, C3-C7 cycloalkyl, 9) C3-C7 cycloalkenyl, 10 aryl, 11 heteroaryl, 12 heterocyclyl, 13 heterobicyclyl, 14 OR7, 15 S (0) mR7, 17 .11 NR ° S (0) 2R, 18 COR7, 19 C (0) OR7, 20 CONR8R9, 21 S (0) 2NRaR- 22) OC (0) R7, 23) OC (0) YR, 24) SC (0) R7, or 25) NC (Y) NR8R9, wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; R7 is DH, 2) haloalkyl, 3) C6-C6 alkyl, 4) C2-C6 alkenyl, 5) C2-C4 alkynyl, 6) C3-C7 cycloalkyl, 7) C3-C7 cycloalkenyl, ) aryl, 9) heteroaryl, 10) heterocyclyl, 11) heterobicyclyl; 12) R8R9NC (= Y), or 13) C2-C4 Ci-C3-alkenyl alkyl, or 14) C2-C4-C6-alkynyl C2-C4 alkyl, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and where the aril, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; R8 and R9 are each independently DH, 2) haloalkyl, 3) C6-6 alkyl, 4) C2-C6 alkenyl, 5) C2-C4 alkynyl, 6) C3-C7 cycloalkyl, 7) cycloalkenyl C3-C, 8) aryl, 9) heteroaryl, 10) heterocyclyl, 11) heterobicyclyl, 12) C (0) Rn, 13) C (0) Y-Rn, or 14) SfO.z-R11, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; or R8 and R9 together with the nitrogen atom to which they are attached form a five, six or seven membered heterocyclic ring optionally substituted with one or more R substituents; R10 is 1) halogen, 2) N02, 3) CN, 4) B (OR13) (OR14), 5) Ci-Ce alkyl, 6) C2-Cd alkenyl, 7) C2-C4 alkynyl, 8) C3-C7 cycloalkyl, 9) C3-C7 cycloalkenyl, 10) haloalkyl, 11) OR7, 12) NR8R9, 13) SR7, 14) COR7, 15) C (0) 0 R1, 16) S (0) mR7 , 17) C0NR8R9, 18) S (0) 2NR8R9, 19) aryl, 20) heteroaryl, 21) heterocyclyl, or 22) heterobicyclyl, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, and cycloalkenyl are optionally substituted with one or more substituents R6; and R11 is 1) haloalkyl, 2) C6-6 alkyl, 3) C2-C6 alkenyl, 4) C2-C4 alkynyl, 5) C3-C7 cycloalkyl, 6) C3-C7 cycloalkenyl, 7) aryl, 8) heteroaryl, 9) heterocyclyl; or 10) heterobicyclyl, wherein the alkyl, alkenyl, alkynyl; cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; or a prodrug; or the compound of Formula I is labeled with a detectable label or an affinity tag. 54. The compound, according to claim 53, characterized in that: n = 1; A and A1 are both C = 0, B and B1 are independently C? -C4 alkyl; BG is -X-L-X1; or X and X1 are independently selected from DO, O 2) f, 3) X ^ L is selected from 1) -Ci-Cio-, 2-phenyl-, 3-biphenyl-, 4) -CH2- (C2-C4 alkynyl) -CH2-, 5) -CH2-phenyl-CH2 alkyl -, 6) -CH2-biphenyl-CH2-, or 7) -alkyl of C? -C6-0-alkyl of C? -C6; R1, R100, R2 and R200 are each independently CH3; Q and Q1 are both NR4R5; R4 is H; and R5 is selected from: 1) -C3-C7-cycloalkyl, 2) -C3-C-3-cycloalkenyl, -3-aryl, 4) -heteroaryl, 5) -heterocyclyl, or 6) -hetero-cyclicyl. 55. The compound according to claim 54, characterized in that: A and A1 are both C = 0, B and B1 are independently C? -C alkyl; BG is -X-L-X1; or L is R1, R100, R2 and R200 are each independently CH3; Q and Q1 are both NR4R5; R4 is H; Y 56. The compound, according to claim 53, characterized in that: n = 1; A and A1 are both CH2; B and B1 are independently C?-C4 alkyl; BG is -X-L-X1; or X and X are independently selected from DO, O 3) N- u, 0 L is selected from 1) -alkyl of C? -C? Oe 2) -phenyl-, 3) -biphenyl-, 4) -CH2- (C2-C4 alkynyl) -CH2-, 5) -CH2-phenyl- CH2-, 6) -CH2-biphenyl-CH2-, or 7) -Ci-Ce-O-alkyl of C? -C6 alkyl; R1, R100, R2 and R200 are each independently CH3; Q and Q1 are both NR R5; R4 is D H, 2) «-C (0) -R11, 3)« -C (0) 0 -R, or 4) «-S (0) 2 -Rn; and R5 is Ci-Cß alkyl substituted with a phenyl; wherein R11 is as defined herein; R11 is 1) haloalkyl, 2) Ci-Ce alkyl, 3) aryl, 4) heteroaryl, or 5) heterocyclyl, wherein the alkyl is optionally substituted with one or two R6 substituents; and wherein the aryl, heteroaryl and heterocyclyl is substituted with a R10 substituent; wherein R6 and R10 are as defined herein; RD is 1) halogen, 2) aryl, wherein the aryl is optionally substituted with a substituent R 10; wherein R8, R9 and R10 are as defined herein; R8 and R9 are each independently DH, 2) haloalkyl, 3) C6-6 alkyl, 4) C2-C6 alkenyl, 5) C2-C4 alkynyl, 6) C3-C7 cycloalkyl, or 7) cycloalkenyl of C3-C7, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; wherein the substituents R6 are as defined herein; and R10 is 1) halogen. 2) N02, 3) CN, 4) haloalkyl, 5) OR7,
6. 6) NR8R9, or 7) SR7; wherein R ', RJ, and R3 are as defined herein. 57. The compound, according to claim 56, characterized in that: n = l; A and A1 are both CH2; B and B1 are independently C? -C4 alkyl; BG is -X-L-X1; or X and X1 are independently selected from 1) 0, L is selected from 1) -alkyl of C? -C? 0-, 2) -phenyl-, 3) -biphenyl-, 4) -CH2- (C2-C4 alkynyl) -CH2-, 5) -CH2- phenyl-CH2-, 6) -CH2-biphenyl-CH2-, or
7. 7) -alkyl of C? -C6-0-C? -C6 alkyl; R1, R100, R2 and R200 are each independently CH 3 'Q and Q1 are both NR4R5; R4 is DH, 2) «- C (0) -R 111 3) (0) 0-R 1'1 4) «- S (0) 2 -R 11, * y wherein R > n is as defined herein; R11 is 1) haloalkyl, 2) Ci-Cß alkyl optionally substituted with one or two R6 substituents, or 3) phenyl optionally substituted with a R10 substituent; wherein the substituents R6 and R10 are as defined herein; R6 is 1) halogen, 2) phenyl, or wherein the phenyl is optionally substituted with a substituent of R? o; wherein R8 and R9 are as defined herein; R8 and R9 are each independently D H, or 2) Ci-Cß alkyl, wherein the alkyl is optionally substituted with an aryl; and R10 is 1) halogen, or 2) C6-C6alkyl. 58. The compound, according to claim 57, characterized in that: n = 1; A and A1 are both CH2; B and B1 are independently C? -C alkyl; BG is X L-X1; or X and X1 are independently selected from 1) O, XFc L is selected from 1) -alkyl of C? -C? 0-, 2) -phenyl-, 3) -biphenyl-, 4) -CH2- (C2-C4 alkynyl) -CH2-, 5) -CH2- phenyl-CH2-, 6) -CH2-biphenyl-CH2-, or 7) -alkyl of C? -C6-0-alkyl of C? -C6; R1, R100, R2 and R200 are each independently CH3; and Q and Q1 are both selected independently of: 59. A compound represented by Formula 2 characterized in that n, R1, R2, R100, R200, A, A1, Q, Q1, B, B1, and BG as defined in claim 1; and where the dotted line represents a hypothetical dividing line to compare the substituents associated with Ml and M2. 60. The compound, according to claim 59, characterized in that Ml is the same as M2. 61. The compound, according to claim 59, characterized in that Ml is different from M2. 62. A compound, according to claim 1, selected from the group consisting of: 63. An uncompromising composer represented by Formula 2 (iii): characterized because PG2 is a probecbor group, and R1, R2, B, A, and Q are as defined in the claim 64. An uncompromising composer represented by Formula 3 (iii): characterized in that B, B1, A, A1, Q and Q1 are as defined in claim 1. 65. An ineberiate compound represented by Formula 4 (iii): R2 H or A-Q 4 (iil) characterized in that PG3 is a probecbor group, and B, R1, R2, A, and Q are as defined in claim 1. 66. An ineberiate compound represented by Formula 5 (i): characterized because PG3 are probecbores groups, and B, B1, R1, R100, R2, R200, A, A1, Q and Q1 are as defined in claim 1. 67. An uncompromising composer represented by Formula 6 (iii): R2 H O A * Q 6 (III) characterized because PG3 is a probecbor group, and R1, R2, B. A, and Q are as defined in the claim 1. 68. An uncompromising composer represented by Formula 7 (iii): 7 (iii) characterized because PG3 is a probecbor group, and R1, R2, B, A, and Q are as defined in claim 1. 69. An ineberiate compound represented by Formula 8 (iii): characterized in that B, B1, A, A1, Q and Q1 are as defined in claim 1. 70. A process for producing compounds represented by Formula I, according to claim 1, the process characterized in that it comprises: a) coupling two inbermediaries represented by Formula 2 (iii): 2 (iii) in a solvenbe; and b) removing the test groups so that they form compounds of Formula 1. 71. A process for producing compounds represented by Formula I, according to claim 1, the process characterized in that it comprises: a) attach an inbermediary represented by the Formula 3 (iii): pG2.N .C02H and ^ 2 in a solvent; and b) removing the protecting groups so as to form compounds of Formula 1. 72. A process for producing compounds represented by Formula I, according to claim 1, the process characterized in that it comprises: a) coupling an intermediate represented by Formula 4 (iii): 3 - . 3 - _-NH, PG - Rr? R N 'R2 H O A-Q 4 (üi) and an activated diacid, such as a diacid chloride or an activated diacid using 2 equivalents of peptide coupling agents, in a solvent; Y b) remove the protection groups so that they form compounds of Formula 1. 73. A process for producing compounds represented by Formula 1, according to claim 1, the process characterized in that it comprises: a) coupling two intermediates represented by Formula 4 (iii): 4 (III) with triphosgene, or one triphosgene equivalent, in a solvent; and b) removing the protecting groups so as to form compounds of Formula 1. 74. A process for producing compounds represented by Formula I, according to claim 1, the process characterized in that it comprises: a) coupling two intermediates represented by Formula 4 (iii): * W with oxalyl chloride in a solvent; and b) removing the protecting groups so as to form compounds of Formula 1. 75. A process for producing compounds represented by Formula I, according to claim 1, the process characterized in that it comprises: a) coupling an intermediate represented by Formula 6 (iii): 6 (iii) and either a bis-acid chloride or a bis-acid, using a coupling agent, in a solvent; and b) removing the protecting groups so as to form compounds of Formula 1. 76. A process for producing compounds represented by Formula I, according to claim 1, the process characterized in that it comprises: a) coupling an intermediate represented by the Formula 7 (iii): 7 (iii) and a diamine using a coupling agent in a solvent; and, b) removing the protection groups so that they form compounds of Formula 1. 77. A process for producing compounds represented by Formula I, according to claim 1, the process characterized in that it comprises: a) coupling an intermediate represented by Formula 8 (iii): Y in a solvent; and b) removing the protecting groups so as to form compounds of Formula 1. 78. A process for producing compounds represented by Formula I, according to claim 1, the process characterized in that it comprises: a) hydrogenation of a compound represented by ig in a solvent, b) filtration and concentration of the solvent to provide a compound of the formula lq. 79. A method for modulating the IAP function, the method characterized in that it comprises: contacting a cell with a compound, according to claim 1, so as to prevent binding of a BIR binding protein to an IAP BIR domain therefore, it modulates the IAP function. Use of a compound represented by Formula I: l or a salt thereof, for the manufacture of a medicament for treating or preventing a disease state characterized by insufficient apoptosis, wherein: n is 0 or 1; m is 0, 1 or 2; p is 1 or 2; And it is NH, 0 or S; A and A1 are independently selected from 1) -CH2-, 2) -CH2CH2-, 3) -C (CH3) 2-, 4) -CH (C6-C6 alkyl) -, 5) -CH (cycloalkyl) C3-C7) -, 6) -C3-C7-cycloalkyl-, 7) -CH (C3-C6 alkyl-C3-C7 cycloalkyl) -, or
8. 8) -C (O) -; B and B1 are independently Ci-Ce alkyl; BG is 1) -X-L-X1-; or BG is X and X1 are independently selected from 1) 0. NR13, S, O 2) Y. or 3) X U, 4) H ^, 6) AND F, or L is selected from: 1) -alkyl of C? -C? 0-, 2) -alkenyl of C2-C6-, 3) -alkynyl of C2-C4-, 4) -cycloalkyl of C3-C7-, 5) -phenyl-, 6) -biphenyl-, 7) -heteroaryl-, 8) -heterocyclyl-,
9. 9) -alkyl of C? -C6- (C2-C6 alkenyl) -alkyl of C? -C6-, 10) -alkyl of Ci-C- (C2-C4 alkynyl) -alkyl of C? -C6, 11) -Ci-Cß alkyl- (C3-C7 cycloalkyl) -C6 alkyl, -6-6) -C6 alkyl-phenyl-C- C6 alkyl, 13) -C alkyl; -C6-biphenyl-C-C6 alkyl, 14) -Ci-Cd-heteroaryl-Ci-Ce alkyl, 15 alkyl) -Ci-Cd-heterocyclyl-alkyl C? -C6, or 16) -alkyl of C? -C6-0-alkyl of C? -C6; R1, R100, R2 and R200 are independently selected from: 1) H, or 2) C? -C6 alkyl optionally substituted with one or more substituents R6; Q and Q1 are each independently 1) NRR5, 2) OR11, or Q and Q1 are each independently wherein G is a 5, 6 or 7 membered ring which optionally incorporates one or more heteroatoms chosen from S, N or 0, the ring optionally substituted with one or more R12 substituents; R4 and R5 are each independently 1) H, 2) haloalkyl, 3) < -Ci-Cβ alkyl, 4) -C2-Cd alkenyl, 5) -C2-C4 alkynyl, 6) < -C3-C7 cycloalkyl, 7) < C3-C7-cycloalkenyl, 8) "-aryl, 9)" -heteroaryl, 10) < -heterocyclyl, 11) < -heterobicyclyl, 12) -C (0) -R, 13) < -C (0) 0-Rn, 14) < -C (= Y) NR8R9, or 15) < -S (0) 2-Rn, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; R ° is 1) halogen, 2) N02, 3) CN, 4) haloalkyl, 5) Ci-Ce alkyl, 6) C2-C6 alkenyl, 7) C2-C4 alkynyl, 8) C3-C7 cycloalkyl, 9) C3-C7 cycloalkenyl, 10) aryl, 11) heteroaryl, 12) heterocyclyl, 13) heterobicyclyl, 14) OR7, 15) S (0) mR7 16) NR8R9, 17) NR8S (0) 2R11, 18) COR7, 19) C (0) OR7 , 20) C0NR8R9, 22) OC (0) R7, 23) OC (0) Y-R, 24) SC (0) R7, or 25) NC (Y) NR8R9, wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more substituents R10; R 7 is 1) H, 2) haloalkyl, 3) C 1 -C 6 alkyl, 4) C 2 -C 6 alkenyl, 5) C 2 -C 4 alkynyl, 6) C 3 -C 7 cycloalkyl, 7) C 3 -C 7 cycloalkenyl , 8) aryl, 9) heteroaryl, 10) heterocyclyl, 11) heterobicyclyl, 12) R8R9NC (= Y), or 13) C2-C4 Ci-Ce-alkenyl alkyl, or 14) C6-C6 alkyl- C2-C4 alkynyl, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more R6 substituents; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; R8 and R9 are each independently 1) H, 2) haloalkyl, 3) Ci-Cß alkyl, 4) C2-Cß alkenyl, 5) C2-C alkynyl, 6) C3-C7 cycloalkyl, 7) C3-C7 cycloalkenyl, 8) aryl, 9) heteroaryl, 10) heterocyclyl, 11) heterobicyclyl, 12) C (O) 11, 13) C (0) Y-Rn, or 14) S (0) 2-Rn, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; or R8 and R9 together with the nitrogen atom to which they are attached form a five, six, or seven membered heterocyclic ring optionally substituted with one or more substituents R6; R10 is 1) halogen, 2) N02, 3) CN, 4) B (OR13) (OR14), 5) Ci-Cß alkyl, 6) C2-C6 alkenyl, 7) C2-C4 alkynyl, 8) C3-C7 cycloalkyl, 9) C3-C7 cycloalkenyl, 10) haloalkyl, 11) OR7, 12) NR8R9, 13) SR7, 14) COR7, 15) C (0) OR7, 16) S (0) mR7, 17) CONR8R9, 18) S (0) 2NR8R9, 19) aryl, 20) heteroaryl, 21) heterocyclyl, or 22) heterobicyclyl, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, and cycloalkenyl are optionally substituted with one or more substituents R6; R11 is 1) haloalkyl, 2) C 1 -C 6 alkyl, 3) C 2 -C 6 alkenyl, 4) C 2 -C 4 alkynyl, 5) C 3 -C 7 cycloalkyl, 6) C 3 -C 7 cycloalkenyl, 7) aryl, 8) heteroaryl, 9) heterocyclyl, or 10) heterobicyclyl, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; R12 is 1) haloalkyl, 2) C6-C6 alkyl, 3) C2-Cd alkenyl, 4) C2-C5 alkynyl, 5) C3-C7 cycloalkyl, 6) C3-C7 cycloalkenyl, 7) aryl , 8) heteroaryl, 9) heterocyclyl,
10. 10) heterobicyclyl,
11. 11) C (0) -Rn,
12. 12) C (0) 0-R,
13. 13) C (0) NR8R9,
14. 14) S (0) mRn, or
15. 15) C (= Y) NR8R9, in where the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl are optionally substituted with one or more substituents R6; and wherein the aryl, heteroaryl, heterocyclyl, and heterobicyclyl are optionally substituted with one or more R10 substituents; R 13 and R 14 are each independently 1) H, or 2) C 1 -C 6 alkyl; or R13 and R14 combine to form a heterocyclic ring or a heterobicyclyl ring; 81. The use of the compound of any of claims 1 to 62 for the manufacture of a medicament for treating or preventing a disease state characterized by insufficient apoptosis. 82. The use, according to claim 80 or 81, characterized in that the disease state is cancer. 83. The use of the compound of any one of claims 1 to 62 for the manufacture of a medication to treat or prevent a proliferative disorder. 84. The use of the compound of any one of claims 1 to 62 in combination with an agent for the manufacture of a medicament for treating or preventing a proliferative disorder, characterized in that the agent is selected from: a) an estrogen receptor modulator, b) an androgen receptor modulator, c) a retinoid receptor modulator, d) a cytotoxic agent, e) an antiproliferative agent, f) a prenyl protein transferase inhibitor, g) a HMG-CoA reductase inhibitor, h) an HIV protease inhibitor, i) a reverse transcriptase inhibitor, k) an angiogenesis inhibitor, 1) a PPAR-? agonist, m) a PPAR-d agonist, n) an inhibitor of inherent resistance to multiple drugs, or an anti-emetic agent, p) an agent useful in the treatment of anemia, q) agents useful in the treatment of neutropenia, r) an improved immunological drug. s) a proteasome inhibitor; t) an HDAC inhibitor; u) an inhibitor of chymotrypsin-like activity in the proteasome; or v) E3 ligase inhibitors; w) a modulator of the immune system such as, but not limited to, interferon-alpha, Bacillus Calmette-Guerin (BCG), and ionizing radiation (UVB) that can induce the release of cytokines, such as interieucins, TNF, or induce release of death receptor ligands such as TRAIL; x) a TRAIL death receptor modulator and TRAIL agonists such as the humanized antibodies HGS-ETR1 and HGS-ETR2; or in combination or sequentially with radiation therapy. 85. The use of the compound of any one of claims 1 to 62 in combination with a death agonist receptor for the manufacture of a medicament, the treatment or prevention of a proliferative disorder in a subject. 86. The use according to claim 85, characterized in that the death agonist receptor is TRAIL 87. The use according to claim 85, characterized in that the death agonist receptor is a TRAIL antibody. 88. Use in accordance with the claim 85, characterized in that the death agonist receptor is in an amount that produces a synergistic effect. 89. The use according to claim 84 or 85, characterized in that the proliferative disorder is cancer. 90. A pharmaceutical composition comprising the compound of any of claims 1 to 62, mixed with a pharmaceutically acceptable carrier, diluent or excipient, to treat or prevent a disease state characterized by insufficient apoptosis. 91. A pharmaceutical composition comprising the compound of any one of claims 1 to 62 in combination with any compound that increases the level of circulation of one or more death receptor agonists to prevent or treat a proliferative disorder. 92. A method for preparing a pharmaceutical composition, the method comprising: mixing the compound of any of claims 1 to 62, with a pharmaceutically acceptable carrier, diluent or excipient.