RU2429294C2 - EXPRESSION GENETIC MAKER pOptivec/F8BDD CODING HUMAN RECOMBINANT BLOOD COAGULABILITY FACTOR VIII WITH DELETION OF B-DOMAIN AND CELL LINE DG-OV-F8BDD-18 PRODUCING HUMAN RECOMBINANT BLOOD COAGULABILITY FACTOR VIII WITH DELETION OF B-DOMAIN - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: expression plasmid DNA pOptivec/FSBDD coding the human recombinant blood coagulability factor VIII with deletion of B-domain which is used to transform cells of DG-OV-F8BDD-18 line for producing.

EFFECT: invention provides high secretion level of the human recombinant blood coagulability factor VIII with deletion of B-domain in a serum-free culture medium.

2 cl, 1 dwg, 2 ex

Description

The invention relates to the field of biotechnology, and in particular to a technology for the production of biologically active substances (BAS) by genetic engineering methods, more precisely, to methods for producing blood coagulation factor VIII with a B-domain deletion (BDD-rfVIII).

The structure of the factor VIII (fVIII) gene and its relationship with hemophilia genetics were established in 1984-85 (Vehar GA and RM Lawn (1986). "The cloning of factor VIII and the genetics of hemophilia A." Hosp Pract (Off Ed) 21 (5): 111-116). The factor VIII gene is located on the large arm of the X chromosome, on a site about 186 Kb in length, consists of 26 exons ranging in size from 69 bp up to 3106 bp and introns reaching up to 32.4 Kb. The region encoding factor VIII occupies up to 1% of the length of the X chromosome.

Expression of the factor VIII gene mainly occurs in hepatocytes (Zelechowska MG, JA van Mourik, et al. (1985). "Ultrastructural localization of factor VIII procoagulant antigen in human liver hepatocytes." Nature, 317 (6039): 729-730), where its mRNA is detected, as well as a polypeptide in the endoplasmic reticulum. In addition, it was shown that the promoter region of factor VIII contains regulatory sequences specific for hepatocytes.

The initial factor VIII polypeptide translocates to the lumen of the endoplasmic reticulum (ER), where N-glycosylation occurs. In ER, fVIII interacts with a number of chaperones, including calreticulin, calnexin, BiP. Transport to the Golgi apparatus (AG) is still not fully described, there is evidence that it interacts with the intracellular membrane lectin, ERGIC-53 (Endoplasmatic Reticule Golgi Intermediate Compartment). Inside the AH, N- and O-glycosylation, sulfation of tyrosine residues, and limited proteolysis occur. The critical amino acid for processing in AH is Arg 2307, its replacement with Glu or Leu leads to a significant increase in the secretion of mature protein (Gitschier J., WI Wood, et al. (1986). "Identification of a missense mutation in the factor VIII gene of a mild hemophiliac ". Science, 232 (4756): 1415-1416).

Mature natural fVIII is represented in plasma by a series of forms with masses ranging from 170 to 280 kDa. Normally, it is expressed in vivo as a single-chain polypeptide, 2332 amino acids long, including the structural domains A1 (1-336) -A2 (372-710) -B (741-1648) -A3 (1896-2019) -C1 (2020-2172 ) -C2 (2173-2332), in physiological concentrations represented by the monomeric form. Physiologically active in the bloodstream factor VIII is a heterodimer consisting of a light chain (domains A3-C1-C2; molecular weight (MM) 80 kDa) and various heavy chain variants (domains A1-A2-B; MM 90-200 kDa). The light and heavy chains of factor VIII are retained by coordinating the copper ion and are stabilized in the bloodstream by the chaperone, von Willebrandt factor (vWF), secreted by vascular endothelial cells. The double-stranded form results from the prolytic cleavage of the precursor (Lenting PJ, J. A. van Mourik, et al. (1998). "The life cycle of coagulation factor VIII in view of its structure and function". Blood, 92 (11): 3983-3996), the heterogeneity of the length of the heavy chains is due to the limited proteolysis of the (C) end of the B domain.

The following are used in hemophilia therapy: 1) preparations of natural factor VIII, 2) preparations of recombinant full-sized factor VIII, 3) preparations based on recombinant factor VIII with B-domain deletion (BDD-rfVIII). Natural factor VIII preparations are traditionally obtained from the fraction of cryoprecipitate of the pulsed donor plasma. In general, the amount of factor VIII extracted from the donor blood plasma is physically limited by the volume of the obtained plasma, taking into account the loss of the factor upon receipt of cryoprecipitate and purification, and cannot be increased by any methods. It should be noted that about a quarter of patients with hemophilia A develop the so-called inhibitory form of the disease, that is, antibodies to factor VIII begin to develop in their body, as a result of which it is necessary for such patients to enter a larger amount of factor. The incidence of an inhibitory form of hemophilia has increased significantly over the past 20 years, which may be due to the use of purified factor VIII. However, the need for viral inactivation of natural factor VIII does not allow the continued use of untreated weakly immunogenic cryoprecipitate. A natural way out of this situation was the creation of recombinant (genetic engineering) variants of factor VIII. Factor VIII is a polypeptide (> 200 kDa), which has a wide variety of post-translational modifications and circulates in vivo only in combination with chaperone - von Willebrandt factor. As a result, industrially suitable methods for producing full-sized recombinant factor VIII were based on its expression in animal cells while co-expression of monoclonal antibodies that stabilize the product in the culture medium, or co-expression of von Willebrand factor, or the introduction of human plasma proteins into the culture medium. The latter method actually leads to the fact that recombinant factor VIII has most of the disadvantages of natural.

Over the past 20 years, studies of the effect of mutations on the activity, stability and immunogenicity of factor VIII preparations have been actively carried out in the world, the purpose of which was to obtain an analogue of a natural factor that is expressed with greater productivity and is more stable in the environment, which preserves proagulant activity and is not immunogenic. Most of the work is focused on the removal of the cDNA region encoding the B domain (DD Pittman, EM Alderman, et al. (1993). "Biochemical, immunological, and in vivo functional characterization of B-domain-deleted factor VIII." Blood, 81 (11): 2925-2935). The best results for producing lines of producers of deletion forms of factor VIII with a specific amino acid sequence were obtained by the research division of Pharmacia (Lind P., K. Larsson, et al. (1995). "Novel forms of B-domain-deleted recombinant factor VIII molecules. Construction and biochemical characterization. "Eur J Biochem, 232 (1): 19-27).

Currently, there is only one mutant form approved for clinical use - a deletion mutant of factor VIII, an SQ variant.

A known method of creating eukaryotic producers of recombinant coagulation factor VIII with a deletion of the B domain in mammalian cells (US patent US 4868112). It consists in constructing a plasmid containing the target gene and the dihydrofolate reductase gene (DHFR), transfecting this plasmid into mammalian cells of the COS-1, CHO (DUKX-B11) lines, obtaining colonies of stably transfected cells and selecting them in a medium containing methotrexate. When using this method, the level of secretion of the target protein in the culture medium is 2 U / ml / day at a cell density of 1 million / ml. In this case, the cultivation is carried out in the presence of cattle serum containing von Willebrandt factor that binds tightly to factor VIII.

Methods for producing producers for the industrial production of the target protein without the use of protein preparations of natural origin is not known.

Various methods are known to increase the secretion level of BDD-rfVIII producers, the basis of which is optimization of the domain structure and amino acid composition of the target protein. So, in US patents US 6376463, US 7122634 in addition to deletion of the B domain apply the introduction of point mutations in domains A and the creation of fusion proteins based on the pig and human factor VIII genes. This method has limited practical suitability, since, as with the use of natural porcine factor VIII for patients with an inhibitory form of hemophilia A, there is a risk of secondary resistance to factor VIII due to the immunogenicity of the drug (Parker E. T., N. N. Craddock, et al. (2004). "Comparative immunogenicity of recombinant In domain-deleted porcine factor VIII and Hyate: C in hemophilia A mice presensitized to human factor VIII." J Thromb Haemost, 2 (4): 605-611).

There is also known a method of increasing the productivity of expression systems based on the introduction of bicistronic genetic constructs into the genome of cultured cells, followed by amplification of the target protein gene (US patent US 6114146). Cells of lines 293 and SK-HEP1 are transfected with the plasmid pCMVF / EDHPro containing the DHFR gene and the artificial factor VIII gene with a deletion of the B domain, connected to the site containing the ribosome internal binding site (IRES). Subsequent cultivation in the presence of increasing concentrations of methotrexate produces cell lines secreting BDD-rfVIII into the culture medium at a level of from 0.1 to 3 U / million cells per day. However, obtaining producers according to the proposed method requires the use of fetal cattle serum in the culture medium, which leads to the formation of a dense complex of factor VIII and bovine factor von Willebrandt.

The closest to the technical implementation of the analogue of the invention is described in US patent US 6358703 heterologous expression system obtained by transfection of a bicistronic plasmid vector pCIS25DTR into cells of the HKB11 line. The use of this producer on the scale of a 15-liter perfusion bioreactor allows to achieve a total productivity of 4 million IU / day, the probable level of productivity with standard parameters of cell culture should be in the range of 10-30 IU / million cells per day. A disadvantage of the known technical solution is the use of a hybrid cell line obtained by fusion of 293 S line cells and Burkitt’s cancer cells cultured in the presence of cattle fetal serum as part of the culture medium. Serum is also used in the selection of a master clone of the final producer line and only when a bank of working producers is obtained is it replaced with fractionated human plasma preparations. In addition, the applicability of using human cancer cells to create producer cell lines has several limitations for safety reasons (Yallop, S.A., P.L. Norby, et al. (2003). "Characterization of G418-induced metabolic load in recombinant CHO and BHK cells: effect on the activity and expression of central metabolic enzymes ". Cytotechnology, 42 (2): 87-99); U.S. Patent Application US 2006/0099685 A1, 0058).

An object of the invention is the creation of a highly productive and free from the use of animal products of the Chinese hamster ovary cell line to obtain recombinant coagulation factor VIII with a deletion of the B-domain for biopharmaceutical production.

The problem is solved by creating expression plasmid DNA pOptivec / F8BDD, including the DNA region, the sequence of which is shown in SEQ ID 2, and encoding the polypeptide shown in SEQ ID 1, containing the sequence of coagulation factor VIII with a delegated B domain;

and also by creating the Chinese hamster ovary cell line DG-OV-F8BDD-18, the genome of which contains the plasmid DNA sequence pOptivec / F8BDD, a producer of recombinant coagulation factor VIII with a delegated B domain.

The technical result consists in increasing the yield of the target protein in the culture medium of a certain chemical composition, that is, not containing animal or vegetable products or hydrolysates of such products, and conducting work on creating a production line without using animal products, which minimizes the risk of presence in the product pathogenic viruses and prions.

The pOptivec / F8BDD expression plasmid DNA consists of a 6359 bp DNA fragment containing the cDNA sequence of the human blood coagulation factor VIII gene with a deletion of the SQ B domain, and a 4382 bp fragment. plasmids pOptivec containing

- regulatory elements for the expression of factor VIII: constitutive promoter of the CMV virus, Kozak sequence (ribosome binding site), and herpes simplex virus (HSV) polyadenylation signal;

- the sequence of transfected cell resistance factor to methotrexate - dihydrofolate reductase (DHFR) - and regulatory elements for DHFR expression - the IRES sequence of encephalomyocarditis virus (EMCV), which provides bicistronic expression in animal cells and a polyadenylation signal;

- the antibiotic resistance gene ampicillin and the bacterial promoter of the ampicillin resistance gene, allowing for the preparative production of plasmids in E. coli.

The plasmid pOptivec / F8BDD contains unique recognition sites for restriction endonucleases - FspI (8918); MfeI (4940); PsiI (1039); PvuI (9065); RleAI (2281); SapI (7686); SnaBI (9995); SphI (3663); SwaI (3650). Has a molecular weight of 6.64 mDa. The plasmid was introduced into CHO DG-44 cells by liposomal transfection (Straus SE, T. Wilson, et al. (1981). "Transfection of KB cells by liposomes containing adenovirus type 2 DNA." J Virol, 39 (1): 290- 294), a pool of stably transfected cells is obtained by culturing in a medium of a chemically defined composition that does not contain hypoxanthine and thymidine. Amplification of the cassette in the cell genome is carried out by successive cultivations in the presence of increasing concentrations of methotrexate from 25 nM to 500 nM. A pool of cells resistant to a high concentration of methotrexate is obtained and used for cloning by the limiting dilution method. The obtained clones of producer cells are analyzed by enzyme-linked immunosorbent assay and clones are selected that give the maximum expression level of the target protein. Among them, clone DG-OV-F8BDD-18 is chosen, when cultured in suspension in serum-free medium, the level of secretion of the B domain of the deleted blood coagulation factor VIII normally is at least 500 IU / L. Features of the created plasmids are shown in the drawing.

The drawing shows a schematic map of pOptivec / F8BDD.

Designations

The arrows → indicate the regions encoding the coagulation factor polypeptide VIII (including and not including the leader peptide region).

The characteristic restriction sites are indicated in italics, and the cutting position is indicated in parentheses. NotI - restriction enzymes flanking the insertion region of the factor VIII cDNA fragment into the parent vector pOptivec.

Ampicillin (bla) resistance gene - ampicillin resistance gene.

bla promoter is a bacterial promoter of the ampicillin resistance gene.

CMV Promoter is a constitutive eukaryotic promoter of cytomegalovirus.

Kozak - ribosome binding site - Kozak sequence.

Start ATG is the first codon of the reading frame of the factor VIII polypeptide.

polyA is the region corresponding to the polyA pathway of factor VIII cDNA.

ECMV IRES - ribosome binding site - an IRES sequence of encephalomyocarditis that provides bicistronic expression in animal cells.

DHFR is the sequence of the resistance factor of transfected cells to the effects of methotrexate - dihydrofolate reductase (DHFR).

TC polyA signal - polyadenylation signal.

pUC origin - the region of origin of replication (origin) of plasmids of the pUC family.

The invention is illustrated by examples.

Example 1. Obtaining plasmid DNA pOptivec / F8BDD encoding a protein of human blood coagulation factor VIII with a deletion of the B domain, for transfection of the cell line CHO-DG-44.

As an acceptor plasmid for cloning a deletion variant of the BDD-rfVIII gene, the pOptivec expression vector, previously obtained in the laboratory of medical biotechnology at the State Scientific Center of the Russian Academy of Medical Sciences based on the commercially available linearized plasmid DNA pOptivec-TOPO, is used for 30 minutes after incubation with deionized water followed by ligation of ligation T4 (Fermentas, Lithuania), carried out in a standard buffer solution according to the method of the enzyme manufacturer. The obtained ligase mixture was used to transform E. coli cells of strain DH5α, with the genotype F-φ80lacZΔM15 Δ (lacZYA-argF) U169 recA1 endA1 hsdR17 (r _k -, m _k +) phoA supE44 λ-thi-1 gyrA96 relA1. For this, 5 μl of the ligase mixture is added to 200 μl of a frozen suspension of E. coli cells, incubated on ice for 30 minutes to sorb plasmid DNA, heated to 42 ° C for 60 seconds and incubated on ice for 5 minutes. Then add 800 μl of nutrient broth SOC (20 g / l tryptone, 5 g / l yeast extract, 0.5 g / l NaCl, 250 mm KCl, 10 mm MgCl ₂ ) and incubated at 37 ° C for 60 minutes. After incubation, transfer the suspension to a Petri dish with solid agar medium 2xYT-agar (16 g / l tryptone, 10 g / l yeast extract, 10 g / l NaCl, 18 g / l agar) containing ampicillin at a concentration of 100 μg / ml, and placed in a thermostat at 37 ° C for 18 hours. Separate clones of transformants were inoculated in 5 ml of LB nutrient broth with the addition of ampicillin at a concentration of 50 μg / ml, increased for 18 hours at 37 ° C and plasmid DNA was isolated using the Wizard Plus SV Minipreps reagent kit (Promega, USA) according to standard protocol of the manufacturer.

Plasmid pCMV6-XL4 / NM_000132 (Origene, United States) containing the complete sequence of the full-length fVIII cDNA matching the theoretically determined fVIII cDNA published in the GenBank database is used as a matrix for the insertion. PCR with specific primers O1KpnIfor (5'GCTGGTACCTCACAGAGAATATACA3 '), O1Hindrev (5' GGAGAAGCTTCTTGGTTCAATG3 '), O2Hindfor (5'CCAAGCTTCTCCCAAAACCC ACCAGTCTTGAAAC3'), O2Blprev (5'CTGCCCATGCTGAGCAGATAC3 '), containing recognition sites for specific endonucleases obtained two PCR product F1 and F2, flanking the delegated region encoding the B-domain, the total length of which does not exceed one and a half thousand base pairs, that is, subject to amplification with a mixture of high-precision polymerases, the probability of mutation will be minimal. PCR products are cloned into a T-vector and the primary nucleotide sequence is determined from both strands. For sequencing, 350 ng of plasmid DNA was mixed with a primer (3.2 pmol) and the samples were evaporated at 65 ° C. Sequencing is performed using the ABI PRISMR BigDye ™ Terminator v. Reagent Kit. 3.1, followed by analysis of the reaction products on an ABI PRISM 3100-Avant automated DNA sequencer. Chromatogram analysis is performed using the Chromas v 2.13 program or the VNT Suite.

The F3 fragment corresponding to the N-terminal portion of the heavy chain of fVIII is obtained without PCR by preparative restriction of the plasmid pCMV6-XL4 / NM_000132 with restriction endonucleases NotI and KpnI. Restriction products are separated on a 1% agarose gel, TBE buffer solution, with the addition of ethidium bromide (0.4 μg / ml). To isolate DNA, the band corresponding to the amplification product is visualized by UV irradiation, excised from an agarose gel, placed in a 1.5 ml tube, and DNA is extracted using the Wizard SV Gel and PCR Clean-Up System reagent kit (" Promega ", USA) according to the protocol of the manufacturer.

The assembly of three fragments F1, F2, F3 is carried out in the plasmid vector pAL-TA (Eurogen, RF), which provides a number of methodological advantages compared to the assembly in a larger vector.

The selection of positive E. coli clones was carried out by PCR from the clones using the Odelf primer (5'GCCACAACTCAGACTTTCG3 ') and standard primers for the vector sequence: M13for and M13rev. Amplification is carried out using the Tertsik device (DNA technology, RF) according to the following scheme: incubation mixture at the rate of 25 μl per reaction (2.5 μl of a 10x Taq polymerase buffer solution; 10 pM forward and reverse primers; 2 mM each deoxyribonucleotide triphosphate; water up to 24 μl). The resulting mixture was dispensed into 22 μl tubes, a piece of paraffin was placed in each tube. Bacterial colonies are looped into test tubes and at the same time make strokes on a fresh, labeled Petri dish with solid nutrient medium (which is then placed in an air thermostat at 37 ° C). Place the tubes in the device, denature at 94 ° C for 3 minutes, add 0.5 U Taq polymerase to the remaining incubation mixture and place them in the tubes at the last minute of the first denaturation cycle. 25 cycles of PCR are carried out (denaturation: 94 ° C for 30 s, annealing of the primer X = 2 ° C × n (A / T) + 4 ° C × n (G / C) -5 ° C 30 s, elongation 72 ° C 30 -90 s). Polymerase chain reaction products are analyzed by electrophoresis on a 1% agarose gel. For selected positive clones, plasmid isolation and sequencing are performed. After confirming the correct assembly of the fragments, the selected plasmid is designated pAL-TA / F123.

The NotI-NotI fragment is transferred from plasmid pCMV6-XL4 / NM_000132 to plasmid pOptivec linearized by NotI using the procedures described above. After confirming the sequence identity of the factor VIII gene in the resulting plasmid pOptivec / F8 by complete sequencing of both chains in the insertion region, the BlpI-BlpI fragment in pOptivec / F8 is replaced by the BlpI-BlpI fragment from pAL-TA / F123.

For this, the obtained artificial fragment of the B-domain of the deleted factor VIII gene is ligated with the site-restricted BlpI and dephosphorylated vector pOptivec / F8 and E. coli strain TOP10 cells are transformed with the ligation product. Initial analysis of the obtained clones was carried out using colony PCR using primers 8sq4f (5'TGTATTTGATGAGAACCGAAGC3 ') and 8sq5r (5'GCCACTCTGAGCCCTGTT3') or CMVfor (Invitrogen, United States) and 8sq15r (5TGTTTTTGTTC. The sequence of the obtained plasmid constructs pOptivec / F8BDD is verified by sequencing on both chains of the coding region throughout the entire inserted region. The data on the determination of the primary nucleotide sequence of a region of a plasmid encoding recombinant human factor VIII with a deleted B domain obtained from an automatic capillary electrophoresis device are analyzed in the ContigExpress application of the VectorNTI Suite software package (Invitrogen, USA). Using the standard algorithm, trimming of the 5'-terminal and / or 3'-terminal regions of the fragments is carried out. After that, the assembly of the contig is carried out using standard settings. A ponucleotide comparison of the obtained consensus sequence with the theoretically predicted BDD-rfVIII sequence is carried out, and the absence of nucleotide substitutions is checked. In addition to the coding region, the restriction sites are also sequenced using a similar algorithm to clone the cDNA fragment, as well as the regions of the CMV promoter and the internal ribosome binding site (IRES) of the pOptivec expression vector, and the absence of point mutations is checked.

The obtained expression plasmid DNA pOptivec / F8BDD encodes a coagulation factor of human VIII with a deleted B domain, has a size of 10,741 nucleotide base pairs and contains unique FspI restriction sites (8918); MfeI (4940); PsiI (1039); PvuI (9065); RleAI (2281); SapI (7686); SnaBI (9995); SphI (3663); SwaI (3650). This design is intended for constitutive transfection of eukaryotic cells with the human coagulation factor VIII genome with a deleted B domain, followed by selection and amplification based on the linked DHFR ⁺ trait.

It informs the recipient cells of the following phenotypic signs: during transformation of prokaryotes, resistance to ampicillin; during transfection of eukaryotic cells - limited resistance to methotrexate, increasing with selective selection, loss of auxotrophy for hypoxanthine and thymidine, expression of the BDD-rfVIII protein into the growth medium.

The created plasmid DNA is used to produce a producer line.

Example 2. Obtaining a clonal line of eukaryotic producers of recombinant coagulation factor VIII with a deletion of the B domain DG-OV-F8BDD-18, a derivative of the Chinese hamster ovary cell line DG-44

The expression plasmid DNA pOptivec / F8BDD encoding the recombinant coagulation factor VIII with a deletion of the B domain, constructed by the method described in Example 1, is amplified in bacterial cells in preparative quantities. For this, cells of the E. coli strain TOP10 transformed with verified plasmid DNA were cultured in 0.5 L of LB liquid medium for 14 hours. Isolation of plasmid DNA is carried out by alkaline lysis of bacteria using a kit for preparative DNA isolation (EndoFree Plasmid MaxiKit, Qaigen) according to the manufacturer's method. The concentration of highly purified plasmid DNA containing no pyrogens is 190 μg / ml. To carry out constitutive transfection of eukaryotic cells with isolated plasmid DNA, it is additionally converted into a linear form, quantitatively restricted with PvuI endonuclease, which leads to the destruction of the beta-lactamase gene (resistance to ampicillin). Then plasmid DNA is purified from restrictase, precipitated with 70% ethanol. The isolated plasmid intended for transient transfection is not subjected to restriction. The resulting plasmid forms are dissolved in phosphate-buffered saline and sterilized with a 0.22 μm filter.

CHO DG-44 cells (Invitrogen, USA) were obtained from the manufacturer in 1 ml cryovials containing a frozen suspension of cells with a density of approximately 10 million cells per ml in CD DG-44 medium (Gibco, USA) with 10% dimethyl sulfoxide (DMSO). The contents of the vessel are thawed at 37 ° C and added to 30 ml of complete medium CD DG-44. The complete medium consists of DG-44 CD, 8 mM L-glutamine and 1.8 ml / L Pluronic F-68 surfactant (BASF Inc., USA) and contains sufficient amounts of hypoxanthine and thymidine for the growth of DHFR negative cells. Cells are cultured in Erlenmeyer flasks on an orbital shaker at 130 rpm in an atmosphere containing 8% carbon dioxide at a temperature of 37 ° C. Calculation of the density of the cell suspension and the proportion of living cells is carried out in the counting chamber of Goryaev, when stained with trypan blue. Subcultured with a frequency of 1 time in 24-48 hours after reaching a concentration of living cells of 1.2 million cells / ml. To do this, the conditioned medium is removed by centrifugation for 5 minutes at a speed of 1200 rpm, the cell pellet is resuspended with fresh medium and distributed into new Erlenmeyer flasks with a subculture ratio of 1: 6.

48 hours before transfection, cells are seeded according to the described procedure in the amount of 9 million cells per 1 flask. From these cells, 24 million cells were also seeded per 1 flask 24 hours before transfection. On the day of transfection, the proportion of living cells should be at least 95%. Cells on the day of transfection, not centrifuged, are diluted to a final concentration of 0.5 million cells / ml in DG-44 medium in Erlenmeyer flasks. Sterile ethanol precipitated plasmid DNA was dissolved in phosphate-saline solution and used to obtain a transfection mixture.

Transfection of the obtained plasmid pOptivec / F8BDD into CHO DG-44 cells was performed using the FreeStyle MAX liposome reagent (Invitrogen) in OptiPro SFM serum-free medium (Invitrogen). Cells on the day of transfection, not centrifuged, are diluted to a final concentration of 0.5 million cells / ml in DG-44 medium in Erlenmeyer flasks. Sterile ethanol-precipitated plasmid DNA was dissolved in PBS buffer and used to obtain a transfection mixture containing 18 μg of plasmid DNA, 15 μl of transfection agent.

The plasmid DNA used for transfection is a 20: 1 mixed by weight pOptivec / F8BDD plasmid, linearized with PvuI restriction endonuclease, and a supercoiled control pEGFP plasmid (Clontech, USA). The transfection mixture is carefully mixed and incubated for 10 to 20 minutes, and then carefully added to the rotating flask containing CHO DG-44 cells in the above quantity. The fluorescent protein expressed in transfected cells is used to evaluate transfection efficiency. For this, 12 hours after transfection in the cell sample, the proportion of fluorescent cells is determined by analysis using a pair of optical EGFP filters. The resulting ratio characterizes the intensity of transient expression in transfected cells.

To select stable transformants with the inclusion of pOptivec / F8BDD plasmid DNA into the chromosomal sequence, transfected CHO DG-44 cells were transplanted into OptiCHO CD medium (Invitrogen) not containing hypoxanthine and thymidine and cultured according to the following procedure.

The density of the cell suspension and the proportion of living cells in the Goryaev's counting chamber are measured by trypan blue staining. The old medium is then removed by centrifugation for 5 minutes at a speed of 1200 rpm, the cell pellet is resuspended with fresh CD OptiCHO medium (Invitrogen), with the addition of L-glutamine at a final concentration of 8 mM, and 9 × 10 ⁶ cells are distributed into new Erlenmeyer flasks to the flask. Cells were cultured in Erlenmeyer flasks on an orbital shaker at 130 rpm in an atmosphere containing 8% carbon dioxide at a temperature of 37 ° C. Subcultured with a frequency of 1 time in 2 days for 10-14 days until the percentage of living cells reaches more than 90%. Upon reaching the percentage of living cells of 90% or more, the intermediate cell bank is frozen with samples containing 10 ⁷ cells in 1 ml of OptiCHO CD medium supplemented with 10% DMSO. The pool of transfected cells obtained in the form of a suspension culture obtained by the above method is enriched by cultivation in a growth medium that does not contain hypoxanthine and thymidine for 14 days.

To amplify the target BDD-rfVIII gene, selective cultivation is carried out in the presence of increasing doses of methotrexate by successive passages in a growth medium additionally containing 50, 100, 250, 500 nM methotrexate. For this, samples from the intermediate bank are thawed according to the protocol described above, with the changes that CD OptiCHO (Invitrogen) is used as the cultivation medium, with the addition of L-glutamine at a final concentration of 8 mM. Then, methotrexate is added to the cultivation medium in a concentration range from 50 nM to 500 nM, with a doubling of the working concentration of methotrexate at each amplification step. The transition to the next step of amplification is carried out every 14-21 days after reaching a proportion of living cells of more than 90%.

An enriched culture of transfected cells is used to create a primary cryobank and to obtain clones of transfected cells.

At each step of amplification, the level of expression of the target protein in cell culture is determined by enzyme immunoassay. The cells producing the last step of amplification are cloned by the method of limiting dilutions, in the calculation of the final concentration of 2 cells per well under conditions of adherent cultivation.

Get 22 viable clone of cells secreting the B-domain of the delegated coagulation factor of human blood VIII in the growth medium. Among them, 4 clones were selected giving the highest concentration of recombinant protein in terms of the number of cells in the well.

Selected clones are cultured for four consecutive passages and subjected to cryopreservation to create a master bank of producer cells. Then these clones are re-adapted to suspension cultivation for another three passages to obtain a conditioned growth medium containing the target protein. For selected clones, an analysis of mycoplasma contamination is carried out, and it is verified that none of the clones contains mycoplasma DNA.

Measurement of the concentration of recombinant coagulation factor VIII with deletion of the B domain in the conditioned growth medium, performed using ELISA, showed that the productivity of the heterologous expression system based on the best clone is about 0.5 U / million cells / day. System productivity was approximately constant over three consecutive passages, indicating the stability of all or most of the genomic DNA copies of BDD-rfVIII. The selected clone (code DG-OV-F8BDD-18) was subsequently cultured in 3, 15, 100 and 200 ml of OptiCHO growth medium CD until a cell density of 3 million / ml was reached. Cultivation in the volume of growth medium is additionally carried out for 3 days, adding glutamine up to 4 mM and glucose up to 3 mM daily.

The conditioned growth medium is separated from the cell mass, concentrated, desalted and frozen. The content of the target recombinant protein is determined using ELISA. It was shown that the concentration of the target protein is not less than 500 IU / l / day at a cell concentration in with a suspension of 1 million / ml. During all the work, materials of animal origin are not used, which avoids the contamination of the created cell line with animal viruses, including prions not yet characterized, and prions. The created cell line was obtained on the basis of the CHO DG-44 line, which is widely used in the biopharmaceutical industry and ensures the maximum possible viral and prion safety of the product.

Claims (2)

1. Plasmid DNA pOptivec / F8BDD having a molecular weight of 6.64 mDa and unique recognition sites by restriction endonucleases - FspI (8918); MfeI (4940); PsiI (1039); PvuI (9065); RleAI (2281); SapI (7686); SnaBI (9995); SphI (3663); SwaI (3650); consisting of a DNA fragment with SEQ ID NO: 2 6359 bp long, containing the cDNA sequence of the human blood coagulation factor VIII gene with a deletion of the B domain, the amino acid sequence of which is shown in SEQ ID NO: 1, and a fragment of 4382 bp pOptivec plasmid containing:
- regulatory elements that ensure the expression of the coagulation factor VIII gene with a B-domain deletion: constitutive promoter of the CMV virus, Kozak sequence (ribosome binding site) and herpes simplex virus (HSV) polyadenylation signal;
- a sequence of the resistance factor of transfected cells to the effects of methotrexate - dihydrofolate reductase (DHFR) and regulatory elements for the expression of DHFR - an IRES sequence of encephalomyocarditis virus (EMCV) providing bicistronic expression in animal cells and a polyadenylation signal;
- the antibiotic resistance gene ampicillin and the bacterial promoter of the ampicillin resistance gene, allowing for preparative production of the plasmid in E. coli; 2. Chinese hamster ovary cell line DG-OV-F8BDD-18 - producer of recombinant coagulation factor VIII with a delegated B domain, with a productivity of 0.5 U / million cells / day, obtained by liposomal transfection of Chinese hamster ovary cells of the CHO DG line -44 plasmid according to claim 1 and subsequent selective cultivation in the presence of increasing concentrations of methotrexate from 25 to 500 nM.

Images