KR102588469B1 - Modified stem cell memory t cells, methods of making and methods of using same - Google Patents

Abstract

The present invention provides methods for producing modified stem memory T cells (e.g., CAR-T cells) for administration to a subject, e.g., as adoptive cell therapy.

Description

Modified stem cell memory T cells, method of making and using the same {MODIFIED STEM CELL MEMORY T CELLS, METHODS OF MAKING AND METHODS OF USING SAME}

Related applications

This application is a provisional application: USSN 62/402,707 filed on September 30, 2016, USSN 62/502,508 filed on May 5, 2017, USSN 62/553,058 filed on August 31, 2017, and September 2017 The benefit of USSN 62/556,309, filed on the 8th, is claimed, the contents of each of which are hereby incorporated by reference in their entirety.

Inclusion of Sequence Listing

The text file named "POTH-012_001WO_SeqList.txt" was created on October 2, 2017 and is 110 KB in size, the contents of which are hereby incorporated by reference in their entirety.

field of invention

The present invention relates to molecular biology, and more particularly to methods of making and using modified stem cell memory T cells.

For example, there has been a long-felt but unmet need in the art for methods of producing modified stem cell memory T cells for administration to subjects as adoptive cell therapy. The present invention provides a solution to a long felt but unmet need.

Summary of the Invention

Unlike conventional biologics and chemotherapy, the modified T cells of the present invention have the ability to rapidly regenerate upon antigen recognition, potentially obviating the need for repeat treatments. To achieve this, the modified T cells of the invention must not only cause initial tumor destruction but also persist in the patient as a stable population of viable memory T cells to prevent potential cancer recurrence. Therefore, early memory cells, especially modified T cell products containing stem cell memory (T _SCM ), as well as antigen receptors that do not cause T cell exhaustion through antigen-independent (tonic) signaling Intensive efforts have been made to develop molecules. The stem cell-like modified T cells of the present invention induce maximal self-renewal capacity and central memory (T _CM ), effector memory (T _EM ) and effector T cells ( _TE ). By exhibiting pluripotency, it results in better tumor removal and long-term CAR-T engraftment. Modified T cells of the invention include, but are not limited to, cells expressing an antigen receptor comprising a protein scaffold of the invention. Modified T cells of the present invention include, but are not limited to, cells expressing a chimeric antigen receptor (CAR) (i.e., CAR-T cells of the present invention). The chimeric antigen receptor (CAR) of the present invention may comprise one or more sequences, each of which specifically binds to an antigen, including a single chain antibody (e.g., scFv), a sequence comprising one or more fragments of an antibody (e.g. Examples include, but are not limited to, VHH, referred to as VCAR in relation to CAR), antibody mimetics, and Centyrin (referred to as CARTyrin in relation to CAR).

Modified cells of the invention may further undergo genome editing. For example, a genome editing construct can be introduced into a modified cell of the invention via electroporation or nucleofection with a transposon or other delivery vehicle and integrated into the cell's genome during a subsequent incubation step. The resulting cells are modified T cells with an edited genome that retain a stem-like phenotype. These modified T cells with edited genomes that retain a stem-like phenotype can be used as cell therapy. Alternatively, or additionally, modified cells of the invention may undergo first electroporation or nucleofection and subsequent electroporation or nucleofection to introduce the genome editing construct.

Specifically, the present invention provides a method for producing modified stem memory T cells (T _SCM ), comprising (a) a transposon composition comprising a transposon comprising an antigen receptor or therapeutic protein and (b) a transposase or transposase agent. A transposase composition comprising a sequence encoding a primary human T cell is introduced into a primary human T cell to produce a modified T cell, wherein the modified T cell displays one or more cell surface marker(s) of a stem memory T cell (T _SCM ). ), thereby producing modified stem memory T cells (T _SCM ). The present invention provides a method for producing a plurality of modified stem memory T cells (T _SCM ), comprising (a) a transposon composition comprising a transposon comprising an antigen receptor or therapeutic protein and (b) a transposase or transposase. Introducing a transposase composition comprising a coding sequence into a plurality of primary human T cells to produce a plurality of modified T cells, wherein at least 2%, 5%, 10%, 15% of the plurality of modified T cells %, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or Any percentage in between provides a method comprising producing a plurality of modified stem memory T cells (T _SCM ) by expressing one or more cell surface marker(s) of the stem memory T cells (T _SCM ). . In certain embodiments, the method produces a plurality of modified T cells, wherein at least 25% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 50% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 60% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 75% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 80% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 85% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 90% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 95% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, cell surface markers include CD62L and CD45RA. In certain embodiments, the cell surface marker of the CAR-T _SCM includes one or more of CD62L, CD45RA, CD28, CCR7, CD127, CD45RO, CD95, CD95, and IL-2Rβ. In certain embodiments, the cell surface marker of the CAR-T _SCM includes one or more of CD45RA, CD95, IL-2Rβ, CR7, and CD62L. In certain embodiments of the method, the transposon is a plasmid DNA transposon having a sequence encoding an antigen receptor or therapeutic protein flanked by two cis-regulatory insulator elements. In certain embodiments, the transposon is a piggyBac transposon. In certain embodiments, particularly in those embodiments where the transposon is a piggyBac transposon, the transposase is a PiggyBac ^TM or Super PiggyBac ^TM (SPB) transposase.

In certain embodiments of the methods of the invention, the transposon is a plasmid DNA transposon having a sequence encoding an antigen receptor or therapeutic protein flanked by two cis regulatory sequestration factor elements. In certain embodiments, the transposon is a piggyback transposon. In certain embodiments, particularly in those embodiments where the transposon is a piggyback transposon, the transposase is a Piggyback ^TM or Super Piggyback ^TM (SPB) transposase. In certain embodiments, particularly in embodiments where the transposase is a Super Piggyback™ (SPB) transposase, the sequence encoding the transposase is an mRNA sequence.

In certain embodiments of the methods of the invention, the transposase enzyme is a Piggyback™ (PB) transposase enzyme. The piggyback (PB) transposase enzyme may comprise or consist of an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99% or any percentage therebetween identical to:

In certain embodiments of the methods of the invention, the transposase enzyme is a Piggyback ^TM (PB) transposase comprising or consisting of an amino acid sequence having an amino acid substitution at one or more of positions 30, 165, 282, or 538 of the sequence: Homemade enzymes are:

In certain embodiments, the transposase enzyme is a Piggyback ^TM (PB) transposase comprising or consisting of an amino acid sequence having amino acid substitutions at two or more of positions 30, 165, 282, or 538 of the sequence of SEQ ID NO:4. It is an enzyme. In certain embodiments, the transposase enzyme is a Piggyback ^TM (PB) transposase comprising or consisting of an amino acid sequence having amino acid substitutions at three or more of positions 30, 165, 282, or 538 of the sequence of SEQ ID NO:4. It is an enzyme. In certain embodiments, the transposase enzyme is a Piggyback ^™ (PB) transposase enzyme comprising or consisting of an amino acid sequence having amino acid substitutions at each of the following positions 30, 165, 282, and 538 of the sequence of SEQ ID NO:4: . In certain embodiments, the amino acid substitution at position 30 of the sequence of SEQ ID NO:4 is an isoleucine (I) to valine (V) substitution. In certain embodiments, the amino acid substitution at position 165 of sequence SEQ ID NO:4 is a glycine (G) to serine (S) substitution. In certain embodiments, the amino acid substitution at position 282 of the sequence of SEQ ID NO:4 is a methionine (M) to valine (V) substitution. In certain embodiments, the amino acid substitution at position 538 of the sequence of SEQ ID NO:4 is an asparagine (N) to lysine (K) substitution.

In certain embodiments of the methods of the invention, the transposase enzyme is a Super Piggyback™ (SPB) transposase enzyme. In certain embodiments, a Super Piggyback™ (SPB) transposase enzyme of the invention has an amino acid substitution at position 30 is an isoleucine (I) to valine (V) substitution and an amino acid substitution at position 165 is a glycine (G) substitution. to serine (S), the amino acid substitution at position 282 is a substitution from methionine (M) to valine (V), and the amino acid substitution at position 538 is a substitution from asparagine (N) to lysine (K). It may comprise or consist of the amino acid sequence of sequence number 4. In certain embodiments, the Super Piggyback™ (SPB) transposase enzyme comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or any percentage therebetween. Or it can be done like this:

In certain embodiments of the methods of the invention, including embodiments where the transposase comprises the mutations described above at positions 30, 165, 282, and/or 538, the PiggyBac™ or Super PiggyBac™ transposase enzyme is SEQ ID NO: 4 or positions 3, 46, 82, 103, 119, 125, 177, 180, 185, 187, 200, 207, 209, 226, 235, 240, 241, 243, 258, 296, 298 of the sequence of SEQ ID NO: 5 , 311, 315, 319, 327, 328, 340, 421, 436, 456, 470, 486, 503, 552, 570, and 591. In certain embodiments, including embodiments where the transposase comprises the mutations described above at positions 30, 165, 282, and/or 538, the PiggyBac™ or Super PiggyBac™ transposase enzyme has mutations at positions 46, 119, 125, 177, 180, 185, 187, 200, 207, 209, 226, 235, 240, 241, 243, 296, 298, 311, 315, 319, 327, 328, 340, 421, 436, 456, 470, 4 85, It may further include amino acid substitutions at one or more of 503, 552, and 570. In certain embodiments, the amino acid substitution at position 3 of SEQ ID NO:4 or SEQ ID NO:5 is a serine (S) to asparagine (N) substitution. In certain embodiments, the amino acid substitution at position 46 of SEQ ID NO:4 or SEQ ID NO:5 is an alanine (A) to serine (S) substitution. In certain embodiments, the amino acid substitution at position 46 of SEQ ID NO:4 or SEQ ID NO:5 is an alanine (A) to threonine (T) substitution. In certain embodiments, the amino acid substitution at position 82 of SEQ ID NO:4 or SEQ ID NO:5 is an isoleucine (I) to tryptophan (W) substitution. In certain embodiments, the amino acid substitution at position 103 of SEQ ID NO:4 or SEQ ID NO:5 is a serine (S) to proline (P) substitution. In certain embodiments, the amino acid substitution at position 119 of SEQ ID NO:4 or SEQ ID NO:5 is an arginine (R) to proline (P) substitution. In certain embodiments, the amino acid substitution at position 125 of SEQ ID NO:4 or SEQ ID NO:5 is a cysteine (C) to alanine (A) substitution. In certain embodiments, the amino acid substitution at position 125 of SEQ ID NO:4 or SEQ ID NO:5 is a cysteine (C) to leucine (L) substitution. In certain embodiments, the amino acid substitution at position 177 of SEQ ID NO:4 or SEQ ID NO:5 is a tyrosine (Y) to lysine (K) substitution. In certain embodiments, the amino acid substitution at position 177 of SEQ ID NO:4 or SEQ ID NO:5 is a tyrosine (Y) to histidine (H) substitution. In certain embodiments, the amino acid substitution at position 180 of SEQ ID NO:4 or SEQ ID NO:5 is a phenylalanine (F) to leucine (L) substitution. In certain embodiments, the amino acid substitution at position 180 of SEQ ID NO:4 or SEQ ID NO:5 is a phenylalanine (F) to isoleucine (I) substitution. In certain embodiments, the amino acid substitution at position 180 of SEQ ID NO:4 or SEQ ID NO:5 is a phenylalanine (F) to valine (V) substitution. In certain embodiments, the amino acid substitution at position 185 of SEQ ID NO:4 or SEQ ID NO:5 is a methionine (M) to leucine (L) substitution. In certain embodiments, the amino acid substitution at position 187 of SEQ ID NO:4 or SEQ ID NO:5 is an alanine (A) to glycine (G) substitution. In certain embodiments, the amino acid substitution at position 200 of SEQ ID NO:4 or SEQ ID NO:5 is a substitution of phenylalanine (F) to tryptophan (W). In certain embodiments, the amino acid substitution at position 207 of SEQ ID NO:4 or SEQ ID NO:5 is a valine (V) to proline (P) substitution. In certain embodiments, the amino acid substitution at position 209 of SEQ ID NO:4 or SEQ ID NO:5 is a valine (V) to phenylalanine (F) substitution. In certain embodiments, the amino acid substitution at position 226 of SEQ ID NO:4 or SEQ ID NO:5 is a methionine (M) to phenylalanine (F) substitution. In certain embodiments, the amino acid substitution at position 235 of SEQ ID NO:4 or SEQ ID NO:5 is a leucine (L) to arginine (R) substitution. In certain embodiments, the amino acid substitution at position 240 of SEQ ID NO:4 or SEQ ID NO:5 is a valine (V) to lysine (K) substitution. In certain embodiments, the amino acid substitution at position 241 of SEQ ID NO:4 or SEQ ID NO:5 is a phenylalanine (F) to leucine (L) substitution. In certain embodiments, the amino acid substitution at position 243 of SEQ ID NO:4 or SEQ ID NO:5 is a proline (P) to lysine (K) substitution. In certain embodiments, the amino acid substitution at position 258 of SEQ ID NO:4 or SEQ ID NO:5 is an asparagine (N) to serine (S) substitution. In certain embodiments, the amino acid substitution at position 296 of SEQ ID NO:4 or SEQ ID NO:5 is a leucine (L) to tryptophan (W) substitution. In certain embodiments, the amino acid substitution at position 296 of SEQ ID NO:4 or SEQ ID NO:5 is a leucine (L) to tyrosine (Y) substitution. In certain embodiments, the amino acid substitution at position 296 of SEQ ID NO:4 or SEQ ID NO:5 is a leucine (L) to phenylalanine (F) substitution. In certain embodiments, the amino acid substitution at position 298 of SEQ ID NO:4 or SEQ ID NO:5 is a methionine (M) to leucine (L) substitution. In certain embodiments, the amino acid substitution at position 298 of SEQ ID NO:4 or SEQ ID NO:5 is a methionine (M) to alanine (A) substitution. In certain embodiments, the amino acid substitution at position 298 of SEQ ID NO:4 or SEQ ID NO:5 is a methionine (M) to valine (V) substitution. In certain embodiments, the amino acid substitution at position 311 of SEQ ID NO:4 or SEQ ID NO:5 is a proline (P) to isoleucine (I) substitution. In certain embodiments, the amino acid substitution at position 311 of SEQ ID NO:4 or SEQ ID NO:5 is a proline (P) to valine substitution. In certain embodiments, the amino acid substitution at position 315 of SEQ ID NO:4 or SEQ ID NO:5 is an arginine (R) to lysine (K) substitution. In certain embodiments, the amino acid substitution at position 319 of SEQ ID NO:4 or SEQ ID NO:5 is a threonine (T) to glycine (G) substitution. In certain embodiments, the amino acid substitution at position 327 of SEQ ID NO:4 or SEQ ID NO:5 is a tyrosine (Y) to arginine (R) substitution. In certain embodiments, the amino acid substitution at position 328 of SEQ ID NO:4 or SEQ ID NO:5 is a tyrosine (Y) to valine (V) substitution. In certain embodiments, the amino acid substitution at position 340 of SEQ ID NO:4 or SEQ ID NO:5 is a cysteine (C) to glycine (G) substitution. In certain embodiments, the amino acid substitution at position 340 of SEQ ID NO:4 or SEQ ID NO:5 is a cysteine (C) to leucine (L) substitution. In certain embodiments, the amino acid substitution at position 421 of SEQ ID NO:4 or SEQ ID NO:5 is an aspartic acid (D) to histidine (H) substitution. In certain embodiments, the amino acid substitution at position 436 of SEQ ID NO:4 or SEQ ID NO:5 is a valine (V) to isoleucine (I) substitution. In certain embodiments, the amino acid substitution at position 456 of SEQ ID NO:4 or SEQ ID NO:5 is a methionine (M) to tyrosine (Y) substitution. In certain embodiments, the amino acid substitution at position 470 of SEQ ID NO:4 or SEQ ID NO:5 is a leucine (L) to phenylalanine (F) substitution. In certain embodiments, the amino acid substitution at position 485 of SEQ ID NO:4 or SEQ ID NO:5 is a serine (S) to lysine (K) substitution. In certain embodiments, the amino acid substitution at position 503 of SEQ ID NO:4 or SEQ ID NO:5 is a methionine (M) to leucine (L) substitution. In certain embodiments, the amino acid substitution at position 503 of SEQ ID NO:4 or SEQ ID NO:5 is a methionine (M) to isoleucine (I) substitution. In certain embodiments, the amino acid substitution at position 552 of SEQ ID NO:4 or SEQ ID NO:5 is a valine (V) to lysine (K) substitution. In certain embodiments, the amino acid substitution at position 570 of SEQ ID NO:4 or SEQ ID NO:5 is an alanine (A) to threonine (T) substitution. In certain embodiments, the amino acid substitution at position 591 of SEQ ID NO:4 or SEQ ID NO:5 is a glutamine (Q) to proline (P) substitution. In certain embodiments, the amino acid substitution at position 591 of SEQ ID NO:4 or SEQ ID NO:5 is a glutamine (Q) to arginine (R) substitution.

In certain embodiments of the methods of the invention, including embodiments where the transposase comprises the mutations described above at positions 30, 165, 282, and/or 538, the PiggyBac™ transposase enzyme has SEQ ID NO: 4 or SEQ ID NO: 5. may contain amino acid substitutions at one or more of positions 103, 194, 372, 375, 450, 509 and 570 of the sequence of or the Super PiggyBac™ transposase enzyme has an amino acid substitution at position 103 of the sequence of SEQ ID NO: 4 or SEQ ID NO: 5, It may further include amino acid substitutions at one or more of positions 194, 372, 375, 450, 509, and 570. In certain embodiments of the methods of the invention, including embodiments where the transposase comprises the mutations described above at positions 30, 165, 282, and/or 538, the PiggyBac™ transposase enzyme has SEQ ID NO: 4 or SEQ ID NO: 5. may contain amino acid substitutions at 2, 3, 4, 5, 6 or more of positions 103, 194, 372, 375, 450, 509 and 570 of the sequence or the Super Piggyback™ transposase enzyme has SEQ ID NO: 4 or It may further include amino acid substitutions at 2, 3, 4, 5, 6 or more of positions 103, 194, 372, 375, 450, 509 and 570 of SEQ ID NO: 5. In certain embodiments, including embodiments where the transposase comprises the mutations described above at positions 30, 165, 282, and/or 538, the PiggyBac™ transposase enzyme has a mutation at position 103 of the sequence of SEQ ID NO:4 or SEQ ID NO:5. , 194, 372, 375, 450, 509 and 570, or the Super Piggyback™ transposase enzyme may contain amino acid substitutions at positions 103, 194, 372, 375, 450 of the sequence of SEQ ID NO: 4 or SEQ ID NO: 5. It may further include amino acid substitutions at 509 and 570. In certain embodiments, the amino acid substitution at position 103 of SEQ ID NO:4 or SEQ ID NO:5 is a serine (S) to proline (P) substitution. In certain embodiments, the amino acid substitution at position 194 of SEQ ID NO:4 or SEQ ID NO:5 is a methionine (M) to valine (V) substitution. In certain embodiments, the amino acid substitution at position 372 of SEQ ID NO:4 or SEQ ID NO:5 is an arginine (R) to alanine (A) substitution. In certain embodiments, the amino acid substitution at position 375 of SEQ ID NO:4 or SEQ ID NO:5 is a lysine (K) to alanine (A) substitution. In certain embodiments, the amino acid substitution at position 450 of SEQ ID NO:4 or SEQ ID NO:5 is an aspartic acid (D) to asparagine (N) substitution. In certain embodiments, the amino acid substitution at position 509 of SEQ ID NO:4 or SEQ ID NO:5 is a serine (S) to glycine (G) substitution. In certain embodiments, the substitution at position 570 of SEQ ID NO:4 or SEQ ID NO:5 is an asparagine (N) to serine (S) substitution. In certain embodiments, the Piggyback™ transposase enzyme may comprise a methionine (M) to valine (V) substitution at position 194 of SEQ ID NO:4. In certain embodiments where the PiggyBac™ transposase enzyme comprises a methionine (M) to valine (V) substitution at position 194 of SEQ ID NO: 4, the PiggyBac™ transposase enzyme has SEQ ID NO: 4 or SEQ ID NO: 5. It may further include amino acid substitutions at positions 372, 375 and 450 of the sequence. In certain embodiments, the PiggyBac™ transposase enzyme comprises a methionine (M) to valine (V) substitution at position 194 in SEQ ID NO: 4, an arginine (R) to alanine (A) substitution at position 372 in SEQ ID NO: and a substitution of lysine (K) to alanine (A) at position 375 of SEQ ID NO:4. In certain embodiments, the PiggyBac™ transposase enzyme comprises a methionine (M) to valine (V) substitution at position 194 in SEQ ID NO: 4, an arginine (R) to alanine (A) substitution at position 372 in SEQ ID NO: , lysine (K) to alanine (A) at position 375 in SEQ ID NO:4, and aspartic acid (D) to asparagine (N) at position 450 in SEQ ID NO:4.

The present invention provides a method for producing modified stem memory T cells (T _SCM ), comprising (a) a transposon composition comprising a transposon comprising an antigen receptor or therapeutic protein and (b) a transposase or a transposase encoding A transposase composition comprising a sequence is introduced into a primary human T cell to produce a modified T cell, wherein the modified T cell expresses one or more cell surface marker(s) of stem memory T cells (T _SCM ). It provides a method comprising producing modified stem memory T cells (T _SCM ) by doing so. The present invention provides a method for producing a plurality of modified stem memory T cells (T _SCM ), comprising (a) a transposon composition comprising a transposon comprising an antigen receptor or therapeutic protein and (b) a transposase or transposase. Introducing a transposase composition comprising a coding sequence into a plurality of primary human T cells to produce a plurality of modified T cells, wherein at least 2%, 5%, 10%, 15% of the plurality of modified T cells %, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or Any percentage in between provides a method comprising producing a plurality of modified stem memory T cells (T _SCM ) by expressing one or more cell surface marker(s) of the stem memory T cells (T _SCM ). . In certain embodiments, the method produces a plurality of modified T cells, wherein at least 25% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 50% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 60% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 75% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 80% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 85% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 90% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 95% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, cell surface markers include CD62L and CD45RA. In certain embodiments, the cell surface marker of the CAR-T _SCM includes one or more of CD62L, CD45RA, CD28, CCR7, CD127, CD45RO, CD95, CD95, and IL-2Rβ. In certain embodiments, the cell surface marker of the CAR-T _SCM includes one or more of CD45RA, CD95, IL-2Rβ, CR7, and CD62L. In certain embodiments of the method, the transposon is a Sleeping Beauty transposon. In certain embodiments, particularly in embodiments where the transposon is a Sleeping Beauty transposon, the transposase is Sleeping Beauty Transposase or Hyperactive Sleeping Beauty Transposase (SB100X).

In certain embodiments of the methods of the invention, the Sleeping Beauty transposase enzyme comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99% or any percentage therebetween identical to: do:

In certain embodiments of the methods of the invention, the hyperactive Sleeping Beauty (SB100X) transposase enzyme is at least 75%, 80%, 85%, 90%, 95%, 99% or any percentage therebetween: Contains the same amino acid sequence:

The present invention provides a method for producing modified stem memory T cells (T _SCM ), comprising (a) a transposon composition comprising a transposon comprising an antigen receptor or therapeutic protein and (b) a transposase or a transposase encoding A transposase composition comprising a sequence is introduced into a primary human T cell to produce a modified T cell, wherein the modified T cell expresses one or more cell surface marker(s) of stem memory T cells (T _SCM ). It provides a method comprising producing modified stem memory T cells (T _SCM ) by doing so. The present invention provides a method for producing a plurality of modified stem memory T cells (T _SCM ), comprising (a) a transposon composition comprising a transposon comprising an antigen receptor and (b) a transposase or a sequence encoding the transposase. Introducing a transposase composition comprising a plurality of primary human T cells to produce a plurality of modified T cells, wherein at least 2%, 5%, 10%, 15%, 20% of the plurality of modified T cells %, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or between them. A method is provided comprising producing a plurality of modified stem memory T cells (T _SCM ), wherein any percentage expresses one or more cell surface marker(s) of the stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 25% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 50% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 60% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 75% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 80% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 85% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 90% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 95% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, cell surface markers include CD62L and CD45RA. In certain embodiments, the cell surface marker of the CAR-T _SCM includes one or more of CD62L, CD45RA, CD28, CCR7, CD127, CD45RO, CD95, CD95, and IL-2Rβ. In certain embodiments, the cell surface marker of the CAR-T _SCM includes one or more of CD45RA, CD95, IL-2Rβ, CR7, and CD62L. In certain embodiments of the above methods, the transposon is a Hellraiser transposon. In certain embodiments, particularly in embodiments where the transposon is a Helitron transposon, the transposase is a Helitron transposase.

In certain embodiments of the methods of the invention, the transposase is a helitron transposase. The helitron transposase mobilizes the hellraiser transposon, an ancient element of the bat genome that was active 3 to 3.6 million years ago. Exemplary Hellraiser transposons of the invention include Helibat1, which contains a nucleic acid sequence comprising:

Unlike other transposases, helitron transposase does not contain an RNase H-like catalytic domain, but instead contains a RepHel motif consisting of a replication initiation domain (Rep) and a DNA helicase domain. The Rep domain is the nuclease domain of the HUH superfamily nucleases.

Exemplary helitron transposases of the invention include an amino acid sequence comprising:

In helitron transposition, a hairpin close to the 3' end of the transposon functions as a termination factor. However, this hairpin can be bypassed by transphosphosases, resulting in transduction of flanking sequences. Additionally, the Hellraiser translocation generates a covalently closed circular intermediate. Additionally, helitron translocation may have no target site duplication. In the Hellraiser sequence, the transposase is flanked by left and right terminal sequences named LTS and RTS. These sequences terminate with a conserved 5'-TC/CTAG-3' motif. A 19 bp palindromic sequence with the potential to form a hairpin termination structure is located 11 nucleotides upstream of the RTS, and the sequence It consists of (SEQ ID NO: 29).

The present invention provides a method for producing modified stem memory T cells (T _SCM ), comprising (a) a transposon composition comprising a transposon comprising an antigen receptor or therapeutic protein and (b) a transposase or a transposase encoding A transposase composition comprising a sequence is introduced into a primary human T cell to produce a modified T cell, wherein the modified T cell expresses one or more cell surface marker(s) of stem memory T cells (T _SCM ). It provides a method comprising producing modified stem memory T cells (T _SCM ) by doing so. The present invention provides a method for producing a plurality of modified stem memory T cells (T _SCM ), comprising (a) a transposon composition comprising a transposon comprising an antigen receptor and (b) a transposase or a sequence encoding the transposase. Introducing a transposase composition comprising a plurality of primary human T cells to produce a plurality of modified T cells, wherein at least 2%, 5%, 10%, 15%, 20% of the plurality of modified T cells %, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or between them. A method is provided comprising producing a plurality of modified stem memory T cells (T _SCM ), wherein any percentage expresses one or more cell surface marker(s) of the stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 25% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 50% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 60% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 75% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 80% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 85% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 90% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 95% of the plurality of modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCMs ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, cell surface markers include CD62L and CD45RA. In certain embodiments, the cell surface marker of the CAR-T _SCM includes one or more of CD62L, CD45RA, CD28, CCR7, CD127, CD45RO, CD95, CD95, and IL-2Rβ. In certain embodiments, the cell surface marker of the CAR-T _SCM includes one or more of CD45RA, CD95, IL-2Rβ, CR7, and CD62L. In certain embodiments of the above methods, the transposon is a Tol2 transposon. In certain embodiments where the transposon is a Tol2 transposon, the transposase is a Tol2 transposase.

In certain embodiments of the methods of the invention, the transposase is a Tol2 transposase. The Tol2 transposon can be isolated or derived from the genome of medaka fish and may be similar to transposons of the hAT family. The exemplary Tol2 transposon of the invention is encoded by a sequence comprising approximately 4.7 kilobases and contains the Tol2 transposase encoding gene containing four exons. Exemplary Tol2 transposase of the invention comprises an amino acid sequence comprising:

Exemplary Tol2 transposons of the invention, including inverted repeat sequences, subterminal sequences and Tol2 transposase, are encoded by a nucleic acid sequence comprising:

The present invention provides a method for producing modified central memory T cells (T _CM ), comprising (a) a transposon composition comprising a transposon comprising an antigen receptor or therapeutic protein and (b) a transposase or a transposase encoding A transposase composition comprising a sequence is introduced into a primary human T cell to produce a modified T cell, wherein the modified T cell expresses one or more cell surface marker(s) of a central memory T cell (T _CM ). It provides a method comprising producing modified central memory T cells (T _CM ) by doing so. The present invention provides a method for producing a plurality of modified central memory T cells (T _CM ), comprising (a) a transposon composition comprising a transposon comprising an antigen receptor and (b) a transposase or a sequence encoding the transposase. Introducing a transposase composition comprising a plurality of primary human T cells to produce a plurality of modified T cells, wherein at least 2%, 5%, 10%, 15%, 20% of the plurality of modified T cells %, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or between them. A method is provided comprising producing a plurality of modified central memory T cells (T _CM ), wherein any percentage expresses one or more cell surface marker(s) of the central memory T cells (T _CM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 25% of the plurality of modified T cells express one or more cell surface marker(s) of central memory T cells (T _CM ), thereby Produces modified central memory T cells (T _CM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 50% of the plurality of modified T cells express one or more cell surface marker(s) of central memory T cells (T _CM ), thereby Produces modified central memory T cells (T _CM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 60% of the plurality of modified T cells express one or more cell surface marker(s) of central memory T cells (T _CM ), thereby Produces modified central memory T cells (T _CM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 75% of the plurality of modified T cells express one or more cell surface marker(s) of central memory T cells (T _CM ), thereby Produces modified central memory T cells (T _CM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 80% of the plurality of modified T cells express one or more cell surface marker(s) of central memory T cells (T _CM ), thereby Produces modified central memory T cells (T _CM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 85% of the plurality of modified T cells express one or more cell surface marker(s) of central memory T cells (T _CM ), thereby Produces modified central memory T cells (T _CM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 90% of the plurality of modified T cells express one or more cell surface marker(s) of central memory T cells (T _CM ), thereby Produces modified central memory T cells (T _CM ). In certain embodiments, the method produces a plurality of modified T cells, wherein at least 95% of the plurality of modified T cells express one or more cell surface marker(s) of central memory T cells (T _CM ), thereby Produces modified stem memory T cells (T _SCM ). In certain embodiments, the cell surface marker includes one or more of CD45RO, CD95, IL-2Rβ, CCR7, and CD62L. In certain embodiments of the above methods, the transposon is a plasmid DNA transposon having a sequence encoding an antigen receptor or therapeutic protein flanked by two cis regulatory sequestration factor elements. In certain embodiments, the transposon is a piggyback transposon. In certain embodiments, particularly in those embodiments where the transposon is a piggyback transposon, the transposase is a Piggyback ^TM or Super Piggyback ^TM (SPB) transposase. In certain embodiments of the above methods, the transposon is a Sleeping Beauty transposon. In certain embodiments, particularly in embodiments where the transposon is a Sleeping Beauty transposon, the transposase is Sleeping Beauty Transposase or Hyperactive Sleeping Beauty Transposase (SB100X). In certain embodiments of the above methods, the transposon is a hellraiser transposon. In certain embodiments, particularly in embodiments where the transposon is a hellraiser transposon, the transposase is a helitron transposase. In certain embodiments of the above methods, the transposon is a Tol2 transposon. In certain embodiments where the transposon is a Tol2 transposon, the transposase is a Tol2 transposase.

The present invention provides a method for producing a composition comprising a plurality of modified stem memory T cells (T _SCM ) and a plurality of modified central memory T cells (T _CM ), comprising: (a) a transposon comprising an antigen receptor or therapeutic protein; Introducing a transposon composition comprising and (b) a transposase composition comprising a transposase or a sequence encoding a transposase into a plurality of primary human T cells to form a plurality of modified T _SCMs and a plurality of modified T cells. Producing a composition comprising _{a CM ,} wherein the plurality of modified _T A method is provided comprising producing a plurality of modified T _SCMs and a composition comprising a plurality of modified T _CMs by expressing the above CD45RO, CD95, IL-2Rβ, CCR7, and CD62L. In certain embodiments of the above methods, the modified stem memory T cells (T _SCM ) comprise at least 1%, 2%, 5%, 7%, 10%, 15%, 20%, 25%, of the total number of cells in the composition. 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or between these. Contains any percentage of cells. In certain embodiments of the method, the modified central memory T cells (T _CM ) comprise at least 1%, 2%, 5%, 7%, 10%, 15%, 20%, 25% of the total number of cells in the composition. 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or between these. Contains any percentage of cells. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 10% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 90% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 90% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 10% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 20% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 80% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 80% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 20% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 30% of the total cell number of the composition and the modified central memory T cells (T _CM ) comprise at least 70% of the total cell number of the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 70% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 30% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 40% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 60% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 60% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 40% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 50% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 50% of the total number of cells in the composition. Includes %. In certain embodiments of the above methods, the transposon is a plasmid DNA transposon having a sequence encoding an antigen receptor or therapeutic protein flanked by two cis regulatory sequestering elements. In certain embodiments, the transposon is a piggyback transposon. In certain embodiments, particularly in those embodiments where the transposon is a piggyback transposon, the transposase is a Piggyback ^TM or Super Piggyback ^TM (SPB) transposase. In certain embodiments of the above methods, the transposon is a Sleeping Beauty transposon. In certain embodiments, particularly in embodiments where the transposon is a Sleeping Beauty transposon, the transposase is Sleeping Beauty Transposase or Hyperactive Sleeping Beauty Transposase (SB100X). In certain embodiments of the above methods, the transposon is a hellraiser transposon. In certain embodiments, particularly in embodiments where the transposon is a hellraiser transposon, the transposase is a helitron transposase. In certain embodiments of the above methods, the transposon is a Tol2 transposon. In certain embodiments, including embodiments where the transposon is a Tol2 transposon, the transposase is a Tol2 transposase.

In certain embodiments of the methods of the invention, the transposon may be derived from any species or may be recombinant. Alternatively, or additionally, the transposon may be synthetic.

In certain embodiments of the methods of the invention, the antigen receptor is a T cell receptor. In certain embodiments, the T cell receptor is naturally occurring. In certain embodiments, the T cell receptor is not naturally occurring. In certain embodiments, particularly in embodiments in which the T cell receptor is not naturally occurring, the T cell receptor comprises one or more mutation(s) compared to the wild-type T cell receptor. In certain embodiments, particularly in embodiments where the T cell receptor is not naturally occurring, the T cell receptor is a recombinant T cell receptor. In certain embodiments of the above methods, the antigen receptor is a chimeric antigen receptor (CAR). In certain embodiments, the CAR is CARTyrin. In certain embodiments, the CAR comprises one or more VHH sequence(s). In certain embodiments, CAR is VCAR.

The method comprises introducing (a) a transposon composition comprising a transposon comprising an antigen receptor and (b) a transposase composition comprising a transposase or a sequence encoding the transposase into a primary human T cell. In certain embodiments of the methods of the invention, including embodiments wherein the method comprises (c) introducing a second transposon composition comprising a transposon comprising a therapeutic protein into the first human T cell to produce the modified T cell. producing the modified T cells, and further comprising the step of allowing the modified T cells to express the therapeutic protein. In certain embodiments, the therapeutic protein is a secretory capable protein, and the method produces modified T cells capable of secreting the therapeutic protein. In certain embodiments, the transposase composition of (b) translocates the transposon of (a) and the transposon of (c). In certain embodiments, the method further comprises the step of (d) introducing a second transposase composition comprising a transposase or a sequence encoding a transposase into the primary human T cell. In certain embodiments, the second transposase composition translocates the transposon of (c). In certain embodiments, the transposase composition of (b) translocates the transposon of (a) and the transposase composition of (d) transposes the transposon of (c). In certain embodiments of the above methods, the transposon is a plasmid DNA transposon having a sequence encoding an antigen receptor or therapeutic protein flanked by two cis regulatory sequestering elements. In certain embodiments, the transposon is a piggyback transposon. In certain embodiments, particularly in those embodiments where the transposon is a piggyback transposon, the transposase is a Piggyback ^TM or Super Piggyback ^TM (SPB) transposase. In certain embodiments of the above methods, the transposon is a Sleeping Beauty transposon. In certain embodiments, particularly in embodiments where the transposon is a Sleeping Beauty transposon, the transposase is Sleeping Beauty Transposase or Hyperactive Sleeping Beauty Transposase (SB100X). In certain embodiments of the above methods, the transposon is a hellraiser transposon. In certain embodiments, particularly in embodiments where the transposon is a hellraiser transposon, the transposase is a helitron transposase. In certain embodiments of the above methods, the transposon is a Tol2 transposon. In certain embodiments where the transposon is a Tol2 transposon, the transposase is a Tol2 transposase.

The present invention is a method of producing modified stem memory T cells (T _SCM ), which (a) introduces a composition containing an antigen receptor into primary human T cells to produce modified T cells, and produces modified T cells, including an antigen receptor or a therapeutic protein; not included in the transposon, and (b) activating T cells comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement. Contacting said modified T cells with a composition to produce activated modified T cells, wherein said activated modified T cells are modified by expressing one or more cell surface marker(s) of stem memory T cells (T _SCM ). Provided is a method comprising producing stem memory T cells (T _SCM ). The present invention provides a method for producing a plurality of modified stem memory T cells (T _SCM ), comprising: (a) introducing a composition comprising an antigen receptor into a plurality of primary human T cells to produce a plurality of modified T cells; , wherein the antigen receptor or therapeutic protein is not included in the transposon, and (b) one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement. Contacting the plurality of modified T cells with a T cell activator composition comprising a plurality of activated modified T cells, producing a plurality of activated modified T cells, at least 2%, 5%, 10% of the plurality of activated modified T cells. , 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99 % or any percentage therebetween producing a plurality of activated modified stem memory T cells (T _SCM ) by producing one or more cell surface marker(s) of stem memory T cells (T _SCM ). Provides a method. In certain embodiments, the method produces a plurality of activated modified T cells, wherein at least 25% of the plurality of activated modified T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing , a large number of activated modified stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated modified T cells, wherein at least 50% of the plurality of activated modified T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing , a large number of activated modified stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated modified T cells, wherein at least 60% of the plurality of activated modified T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing , a large number of activated modified stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated modified T cells, wherein at least 75% of the plurality of activated modified T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing , a large number of activated modified stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated modified T cells, wherein at least 80% of the plurality of activated modified T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing , a large number of activated modified stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated modified T cells, wherein at least 85% of the plurality of activated modified T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing , a large number of activated modified stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated modified T cells, wherein at least 90% of the plurality of activated modified T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing , a large number of activated modified stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated modified T cells, wherein at least 95% of the plurality of activated modified T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing , a large number of activated modified stem memory T cells (T _SCM ) are produced. In certain embodiments, cell surface markers include CD62L and CD45RA. In certain embodiments, the cell surface marker of the activated modified T _SCM includes one or more of CD62L, CD45RA, CD28, CCR7, CD127, CD45RO, CD95, CD95, and IL-2Rβ. In certain embodiments, the cell surface marker of the activated modified T _SCM includes one or more of CD45RA, CD95, IL-2Rβ, CR7, and CD62L.

A method of producing modified stem memory T cells (T _SCM ), wherein (a) a composition comprising an antigen receptor is introduced into primary human T cells to produce modified T cells, wherein the antigen receptor or therapeutic protein is attached to the transposon; (b) a T cell activator composition comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement, and In certain embodiments of the method of the invention comprising contacting said modified T cells to produce activated modified T cells, the T cell activator composition of (b) is an anti-human CD2 single specific tetramer. It further comprises an antibody complex. In certain embodiments, the method comprises (c) a T cell proliferation composition comprising one or more of human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, Iscove's MDM, and a proliferation supplement. Contacting the hyperactivated modified T cells to produce a plurality of expanded modified T cells, wherein at least 2% of the plurality of expanded modified T cells display one or more cell surface markers of stem memory T cells (T _SCM ). It further includes the step of expressing (s). In certain embodiments of the method, at least 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% of the majority of the expanded modified T cells. , 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or any percentage in between are cell surface marker(s) of stem memory T cells (T _SCM ). manifests. In certain embodiments of the method, at least 60% of the majority of the expanded transformed T cells express cell surface marker(s) of stem memory T cells (T _SCM ). In certain embodiments, the method comprises at least 2%, 5%, 10%, 15%, ₂₀ %, 25%, Contains 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or any percentage in between. Concentrating the plurality of expanded modified T cells to produce a composition that further comprises: In certain embodiments, the method comprises a plurality of expanded modified T cells to produce a composition comprising at least 60% modified T cells expressing cell surface marker(s) of stem memory T cells (T _SCM ). It further includes the step of concentrating. In certain embodiments of the method, the enrichment step comprises isolating modified T cells expressing one or more cell surface marker(s) of stem memory T cells (T _SCM ) from the plurality of enriched modified T cells. do. In certain embodiments of the method, the enrichment step produces an isolated T cell proliferation composition comprising one or more of human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, Iscov's MDM, and proliferation supplements. It further comprises contacting the modified T _SCM to produce a plurality of expanded and concentrated modified T _SCM . In certain embodiments of the above methods, the T cell proliferation composition comprises octanoic acid, nicotinamide, 2,4,7,9-tetramethyl-5-decyne-4,7-diol (TMDD), diisopropyl adipate (DIPA) ), n-butyl-benzenesulfonamide, 1,2-benzenedicarboxylic acid, bis(2-methylpropyl) ester, palmitic acid, linoleic acid, oleic acid, stearic acid hydrazide, oleamide, sterol and alkanes. It additionally includes the above. In certain embodiments of the above methods, the T cell proliferation composition further comprises one or more of octanoic acid, palmitic acid, linoleic acid, oleic acid, and sterols. In certain embodiments of the method, the T cell proliferation composition comprises octanoic acid at a concentration of 0.9 mg/kg to 90 mg/kg, including endpoint; Palmitic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Linoleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Oleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; and sterols at a concentration of about 0.1 mg/kg to 10 mg/kg inclusive. In certain embodiments of the above methods, the T cell proliferation composition comprises octanoic acid at a concentration of about 9 mg/kg, palmitic acid at a concentration of about 2 mg/kg, linoleic acid at a concentration of about 2 mg/kg, It further comprises one or more of oleic acid and a sterol at a concentration of about 1 mg/kg. In certain embodiments of the method, the T cell proliferation composition comprises octanoic acid at a concentration of 6.4 μmol/kg to 640 μmol/kg including the end point, palmitic acid at a concentration of 0.7 μmol/kg to 70 μmol/kg including the end point, Linoleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including the end point, oleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including the end point, and 0.25 μmol/kg to 25 μmol/kg including the end point. It additionally contains one or more of the sterols at a concentration of In certain embodiments of the above methods, the T cell proliferation composition comprises octanoic acid at a concentration of about 64 μmol/kg, palmitic acid at a concentration of about 7 μmol/kg, linoleic acid at a concentration of about 7.5 μmol/kg, It further comprises one or more of oleic acid and a sterol at a concentration of about 2.5 μmol/kg.

The present invention provides a method for producing modified central memory T cells (T _CM ), wherein (a) a composition containing an antigen receptor is introduced into primary human T cells to produce modified T cells, and the antigen receptor or therapeutic protein is produced; not included in the transposon, and (b) activating T cells comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement. Contacting said modified T cells with a composition to produce activated modified T cells, wherein said activated modified T cells express one or more cell surface marker(s) of central memory T cells (T _CM ), thereby producing activated modified T cells. A method comprising producing memory T cells (T _CM ) is provided. The present invention provides a method for producing a plurality of modified central memory T cells (T _CM ), comprising: (a) introducing a composition comprising an antigen receptor into a plurality of primary human T cells to produce a plurality of modified T cells; , wherein the antigen receptor or therapeutic protein is not included in the transposon, and (b) one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement. Contacting the plurality of modified T cells with a T cell activator composition comprising a plurality of activated modified T cells, producing a plurality of activated modified T cells, at least 2%, 5%, 10% of the plurality of activated modified T cells. , 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99 % or any percentage therebetween producing a plurality of activated modified central memory T cells (T _CM ) by producing one or more cell surface marker(s) of central memory T cells (T _CM ). Provides a method. In certain embodiments, the method produces a plurality of activated modified T cells, wherein at least 25% of the plurality of activated modified T cells display one or more cell surface marker(s) of central memory T cells (T _CM ). By expressing , a large number of activated modified central memory T cells (T _CM ) are produced. In certain embodiments, the method produces a plurality of activated modified T cells, wherein at least 50% of the plurality of activated modified T cells display one or more cell surface marker(s) of central memory T cells (T _CM ). By expressing , a large number of activated modified central memory T cells (T _CM ) are produced. In certain embodiments, the method produces a plurality of activated modified T cells, wherein at least 60% of the plurality of activated modified T cells display one or more cell surface marker(s) of central memory T cells (T _CM ). By expressing , a large number of activated modified central memory T cells (T _CM ) are produced. In certain embodiments, the method produces a plurality of activated modified T cells, wherein at least 75% of the plurality of activated modified T cells display one or more cell surface marker(s) of central memory T cells (T _CM ). By expressing , a large number of activated modified central memory T cells (T _CM ) are produced. In certain embodiments, the method produces a plurality of activated modified T cells, wherein at least 80% of the plurality of activated modified T cells display one or more cell surface marker(s) of central memory T cells (T _CM ). By expressing , a large number of activated modified central memory T cells (T _CM ) are produced. In certain embodiments, the method produces a plurality of activated modified T cells, wherein at least 85% of the plurality of activated modified T cells display one or more cell surface marker(s) of central memory T cells (T _CM ). By expressing , a large number of activated modified central memory T cells (T _CM ) are produced. In certain embodiments, the method produces a plurality of activated modified T cells, wherein at least 90% of the plurality of activated modified T cells display one or more cell surface marker(s) of central memory T cells (T _CM ). By expressing , a large number of activated modified central memory T cells (T _CM ) are produced. In certain embodiments, the method produces a plurality of activated modified T cells, wherein at least 95% of the plurality of activated modified T cells display one or more cell surface marker(s) of central memory T cells (T _CM ). By expressing , a large number of activated modified central memory T cells (T _CM ) are produced. In certain embodiments, the cell surface marker of the activated modified T _CM includes one or more of CD45RO, CD95, IL-2Rβ, CCR7, and CD62L.

A method of producing modified central memory T cells (T _CM ), comprising: (a) introducing a composition comprising an antigen receptor into a primary human T cell to produce the modified T cell, wherein the antigen receptor or therapeutic protein is attached to the transposon; (b) a T cell activator composition comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement, and In certain embodiments of the method of the invention comprising contacting said modified T cells to produce activated modified T cells, the T cell activator composition of (b) is an anti-human CD2 single specific tetramer. It further comprises an antibody complex. In certain embodiments, the method comprises (c) a T cell proliferation composition comprising one or more of human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, Iscove's MDM, and a proliferation supplement. contacting hyperactivated modified T cells to produce a plurality of proliferated modified T cells, wherein at least 2% of the plurality of proliferated modified T cells display one or more cell surface markers of central memory T cells (T _CM ) It further includes the step of expressing (s). In certain embodiments of the method, at least 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% of the majority of the expanded modified T cells. , 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or any percentage in between are cell surface marker(s) of central memory T cells (T _CM ). manifests. In certain embodiments of the above methods, at least 60% of the majority of the expanded transformed T cells express cell surface marker(s) of stem central memory T cells (T _CM ). In certain embodiments, the method comprises at least 2%, 5%, 10% _, 15%, 20%, 25%, Contains 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or any percentage in between. Concentrating the plurality of expanded modified T cells to produce a composition that further comprises: In certain embodiments, the method comprises a plurality of expanded modified T cells to produce a composition comprising at least 60% modified T cells expressing cell surface marker(s) of central memory T cells (T _CM ). It further includes the step of concentrating. In certain embodiments of the method, the enrichment step comprises isolating modified T cells expressing one or more cell surface marker(s) of central memory T cells (T _CM ) from the plurality of enriched modified T cells. do. In certain embodiments of the method, the enrichment step produces an isolated T cell proliferation composition comprising one or more of human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, Iscov's MDM, and proliferation supplements. It further comprises contacting the modified T _CM to produce a plurality of expanded concentrated modified T _CM . In certain embodiments of the above methods, the T cell proliferation composition comprises octanoic acid, nicotinamide, 2,4,7,9-tetramethyl-5-decyne-4,7-diol (TMDD), diisopropyl adipate (DIPA) ), n-butyl-benzenesulfonamide, 1,2-benzenedicarboxylic acid, bis(2-methylpropyl) ester, palmitic acid, linoleic acid, oleic acid, stearic acid hydrazide, oleamide, sterol and alkanes. It additionally includes the above. In certain embodiments of the above methods, the T cell proliferation composition further comprises one or more of octanoic acid, palmitic acid, linoleic acid, oleic acid, and sterols. In certain embodiments of the method, the T cell proliferation composition comprises octanoic acid at a concentration of 0.9 mg/kg to 90 mg/kg, including endpoint; Palmitic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Linoleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Oleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; and sterols at a concentration of about 0.1 mg/kg to 10 mg/kg inclusive. In certain embodiments of the above methods, the T cell proliferation composition comprises octanoic acid at a concentration of about 9 mg/kg, palmitic acid at a concentration of about 2 mg/kg, linoleic acid at a concentration of about 2 mg/kg, It further comprises one or more of oleic acid and a sterol at a concentration of about 1 mg/kg. In certain embodiments of the method, the T cell proliferation composition comprises octanoic acid at a concentration of 6.4 μmol/kg to 640 μmol/kg including the end point, palmitic acid at a concentration of 0.7 μmol/kg to 70 μmol/kg including the end point, Linoleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including the end point, oleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including the end point, and 0.25 μmol/kg to 25 μmol/kg including the end point. It additionally contains one or more of the sterols at a concentration of In certain embodiments of the above methods, the T cell proliferation composition comprises octanoic acid at a concentration of about 64 μmol/kg, palmitic acid at a concentration of about 7 μmol/kg, linoleic acid at a concentration of about 7.5 μmol/kg, It further comprises one or more of oleic acid and a sterol at a concentration of about 2.5 μmol/kg.

The present invention provides a method for producing a composition comprising a plurality of modified stem memory T cells (T _SCM ) and a plurality of modified central memory T cells (T _CM ), comprising: (a) producing a composition comprising a plurality of antigen receptors; introducing a primary human T cell to produce a plurality of modified T cells, wherein no antigen receptor or therapeutic protein is included in the transposon, and (b) an anti-human CD3 monospecific tetrameric antibody complex, -Contacting said plurality of modified T cells with a T cell activator composition comprising one or more of a human CD28 monospecific tetrameric antibody complex and an activation supplement to form a plurality of activated modified stem memory T cells (T _SCM ) and a plurality of activated modified central memory T cells (T _CM ), wherein the plurality of activated modified T _SCM comprises one or more CD62L, CD45RA, CD28, CCR7, CD127, CD45RO, CD95, CD95. and a composition comprising _a plurality _of modified _T Provides a method including the step of producing. In certain embodiments of the above methods, the modified stem memory T cells (T _SCM ) comprise at least 1%, 2%, 5%, 7%, 10%, 15%, 20%, 25%, of the total number of cells in the composition. 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or between these. Contains any percentage of cells. In certain embodiments of the method, the modified central memory T cells (T _CM ) comprise at least 1%, 2%, 5%, 7%, 10%, 15%, 20%, 25% of the total number of cells in the composition. 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or between these. Contains any percentage of cells. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 10% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 90% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 90% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 10% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 20% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 80% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 80% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 20% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 30% of the total cell number of the composition and the modified central memory T cells (T _CM ) comprise at least 70% of the total cell number of the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 70% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 30% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 40% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 60% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 60% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 40% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 50% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 50% of the total number of cells in the composition. Includes %.

A method of producing a composition comprising a plurality of modified stem memory T cells (T _SCM ) or a plurality of modified central memory T cells (T _CM ), comprising: (a) producing a composition comprising an antigen receptor to a plurality of primary human introducing a T cell to produce a plurality of modified T cells, wherein no antigen receptor or therapeutic protein is included in the transposon, and (b) an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 By contacting the plurality of modified T cells with a T cell activator composition comprising one or more of a single specific tetrameric antibody complex and an activation supplement, a plurality of activated modified stem memory T cells (T _SCMs ) and a plurality of activated T cells are formed. In certain embodiments of the method of the invention comprising producing a composition comprising activated modified central memory T cells (T _CM ), the T cell activator composition of (b) is an anti-human CD2 monospecific It further comprises a tetrameric antibody complex. In certain embodiments, the method comprises (c) a T cell proliferation composition comprising one or more of human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, Icecove's MDM, and a proliferation supplement, and a plurality of Contacting said composition comprising activated modified stem memory T cells (T _SCM ) and a plurality of activated modified central memory T cells (T _CM ) to produce a plurality of proliferated modified T cells, said plurality The proliferated _{transformed T} It further comprises producing a composition comprising a plurality of proliferated modified T _SCMs and a plurality of proliferated modified T _CMs by expressing CCR7, and CD62L. In certain embodiments of the method, the enrichment step comprises isolating modified T cells expressing one or more cell surface marker(s) of stem memory T cells (T _SCM ) from the plurality of enriched modified T cells, or a plurality of isolating modified T cells expressing one or more cell surface marker(s) of central memory T cells (T _SM ) from the enriched modified T cells. In certain embodiments of the method, the enrichment step comprises isolating modified T cells expressing one or more cell surface marker(s) of stem memory T cells (T _SCM ) from the plurality of enriched modified T cells, and isolating modified T cells expressing one or more cell surface marker(s) of central memory T cells (T _SM ) from the enriched modified T cells. In certain embodiments of the method, the enrichment step comprises the T cell proliferation composition comprising one or more of human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, Iscov's MDM, and proliferation supplements. contacting the composition comprising the modified T _SCM and the isolated modified T _CM to produce a composition comprising a plurality of expanded concentrated modified T _SCM and a plurality of expanded concentrated modified T _CM . Includes. In certain embodiments of the above methods, the T cell proliferation composition comprises octanoic acid, nicotinamide, 2,4,7,9-tetramethyl-5-decyne-4,7-diol (TMDD), diisopropyl adipate (DIPA) ), n-butyl-benzenesulfonamide, 1,2-benzenedicarboxylic acid, bis(2-methylpropyl) ester, palmitic acid, linoleic acid, oleic acid, stearic acid hydrazide, oleamide, sterol and alkanes. It additionally includes the above. In certain embodiments of the above methods, the T cell proliferation composition further comprises one or more of octanoic acid, palmitic acid, linoleic acid, oleic acid, and sterols. In certain embodiments of the method, the T cell proliferation composition comprises octanoic acid at a concentration of 0.9 mg/kg to 90 mg/kg, including endpoint; Palmitic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Linoleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Oleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; and sterols at a concentration of about 0.1 mg/kg to 10 mg/kg inclusive. In certain embodiments of the above methods, the T cell proliferation composition comprises octanoic acid at a concentration of about 9 mg/kg, palmitic acid at a concentration of about 2 mg/kg, linoleic acid at a concentration of about 2 mg/kg, It further comprises one or more of oleic acid and a sterol at a concentration of about 1 mg/kg. In certain embodiments of the above methods, the T cell proliferation composition comprises octanoic acid at a concentration of 6.4 μmol/kg to 640 μmol/kg including endpoint; Palmitic acid at a concentration of 0.7 μmol/kg to 70 μmol/kg including end point; Linoleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including end point; Oleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including end point; and sterols at a concentration of 0.25 μmol/kg to 25 μmol/kg inclusive. In certain embodiments of the above methods, the T cell proliferation composition comprises octanoic acid at a concentration of about 64 μmol/kg, palmitic acid at a concentration of about 7 μmol/kg, linoleic acid at a concentration of about 7.5 μmol/kg, It further comprises one or more of oleic acid and a sterol at a concentration of about 2.5 μmol/kg. In certain embodiments of the above methods, the modified stem memory T cells (T _SCM ) comprise at least 1%, 2%, 5%, 7%, 10%, 15%, 20%, 25%, of the total number of cells in the composition. 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or between these. Contains any percentage of cells. In certain embodiments of the method, the modified central memory T cells (T _CM ) comprise at least 1%, 2%, 5%, 7%, 10%, 15%, 20%, 25% of the total number of cells in the composition. 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or between these. Contains any percentage of cells. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 10% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 90% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 90% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 10% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 20% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 80% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 80% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 20% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 30% of the total cell number of the composition and the modified central memory T cells (T _CM ) comprise at least 70% of the total cell number of the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 70% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 30% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 40% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 60% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 60% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 40% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 50% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 50% of the total number of cells in the composition. Includes %.

1. A method of producing an activated modified T _SCM or T _CM , comprising: (a) introducing a composition comprising an antigen receptor into a plurality of primary human T cells to produce a plurality of modified T cells, the antigen receptor or therapeutic protein; is not included in the transposon, and (b) contacting the plurality of modified T cells with a T cell activator composition comprising at least one anti-human CD3 monospecific tetrameric antibody complex. In certain embodiments of the method of producing an activated modified T _SCM or T _CM of the invention comprising, the introduction step comprises homologous recombination. In certain embodiments of the introduction step involving homologous recombination, the genome editing composition contacts the genomic sequence of at least one primary T cell of the plurality of T cells. In certain embodiments of the introduction step involving homologous recombination, the genome editing composition contacts the genomic sequence of a portion of the primary T cells of the plurality of T cells. In certain embodiments, the portion of primary T cells is at least 1%, 2%, 5%, 7%, 10%, 15%, 20%, 25%, 30% of the total number of primary T cells in the plurality of T cells. %, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or between them. It's an arbitrary percentage. In certain embodiments of the introduction step involving homologous recombination, the genome editing composition contacts the genomic sequence of each primary T cell of the plurality of T cells. In certain embodiments of the introduction step involving homologous recombination, the genome editing composition induces a single strand break. In certain embodiments of the introduction step involving homologous recombination, the genome editing composition induces double-strand breaks. In certain embodiments of the introduction step comprising homologous recombination, the introduction step further comprises a donor sequence composition. In certain embodiments, the donor sequence composition comprises a sequence encoding an antigen receptor. In certain embodiments, the donor sequence composition comprises a sequence encoding an antigen receptor, a 5' genomic sequence, and a 3' genomic sequence, wherein the 5' genomic sequence is a primary sequence 5' to the cleavage point induced by the genome editing composition. The 3' genomic sequence has homology or identity to the genomic sequence of a primary T cell 3' to the cleavage point induced by the genome editing composition. In certain embodiments of the introduction step involving homologous recombination, the genome editing composition and the donor sequence composition are contacted simultaneously or sequentially with the genomic sequence. In certain embodiments of the introduction step involving homologous recombination, the genome editing composition and the donor sequence composition are sequentially contacted with the genomic sequence, with the genome editing composition provided first. In certain embodiments of the introduction step involving homologous recombination, the genome editing composition comprises a sequence encoding a DAN binding domain and a sequence encoding a nuclease domain. In certain embodiments of the introduction step involving homologous recombination, the genome editing composition includes a DNA binding domain and a nuclease domain. In certain embodiments of the genome editing composition, the DNA binding domain comprises a guide RNA (gRNA). In certain embodiments of the genome editing composition, the DNA binding domain comprises the DNA binding domain of a TALEN. In certain embodiments of the genome editing composition, the DNA binding domain comprises the DNA binding domain of a ZFN. In certain embodiments of the genome editing composition, the nuclease domain comprises Cas9 nuclease or a sequence thereof. In certain embodiments of the genome editing composition, the nuclease domain is an inactive Cas9 (SEQ ID NO: 33, aspartic acid (D) to alanine (A) substitution at position 10 (D10A) and histidine (H) to alanine at position 840. (A), including the substitution (H840A). In certain embodiments of the genome editing composition, the nuclease domain comprises a short inactive Cas9 (SEQ ID NO: 32, an aspartic acid (D) to alanine (A) substitution at position 10 (D10A) and an asparagine (N) at position 540. Includes substitution (N540A) to alanine (A). In certain embodiments of the genome editing composition, the nuclease domain comprises or further comprises a type IIS endonuclease. In certain embodiments of the genome editing composition, type IIS endonucleases include AciI, Mn1I, AlwI, BbvI, BccI, BceAI, BsmAI, BsmFI, BspCNI, BsrI, BtsCI, HgaI, HphI, HpyAV, Mbo1I, My1I, PleI, SfaNI, AcuI, BciVI, BfuAI, BmgBI, BmrI, BpmI, BpuEI, BsaI, BseRI, BsgI, BsmI, BspMI, BsrBI, BsrBI, BsrDI, BtgZI, BtsI, EarI, EciI, MmeI, NmeAIII, BbvCI, Bpu10I, BspQI, Contains SapI, BaeI, BsaXI, CspCI, BfiI, MboII, Acc36I, FokI or Clo051. In certain embodiments, the type IIS endonuclease comprises Clo051. In certain embodiments of the genome editing composition, the nuclease domain comprises or further comprises a TALEN or a nuclease domain thereof. In certain embodiments of the genome editing composition, the nuclease domain comprises or further comprises a ZFN or a nuclease domain thereof. In certain embodiments of the introduction step involving homologous recombination, the genome editing composition induces breaks in the genomic sequence and the donor sequence composition is inserted using the endogenous DNA repair mechanisms of the primary T cell. In certain embodiments of the introduction step involving homologous recombination, insertion of the donor sequence composition removes the DNA binding site of the genome editing composition, thereby preventing further activity of the genome editing composition.

1. A method of producing an activated modified T _SCM or T _CM , comprising: (a) introducing a composition comprising an antigen receptor into a plurality of primary human T cells to produce a plurality of modified T cells, the antigen receptor or therapeutic protein; is not included in the transposon, and (b) activating T cells comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement. In certain embodiments of the method of producing an activated modified T _SCM or T _CM of the invention comprising contacting said plurality of modified T cells with a composition, the viral vector comprises an antigen receptor. do. In certain embodiments, the viral vector comprises one or more sequences isolated, derived, or recombinant from an RNA virus. In certain embodiments, the RNA virus is a single-stranded or double-stranded virus. In certain embodiments, the viral vector comprises one or more sequences isolated, derived, or recombinant from a DNA virus. In certain embodiments, the DNA virus is a single-stranded or double-stranded virus. In certain embodiments, the virus is replication defective.

1. A method of producing an activated modified T _SCM or T _CM , comprising: (a) introducing a composition comprising an antigen receptor into a plurality of primary human T cells to produce a plurality of modified T cells, the antigen receptor or therapeutic protein; not included in the transposon, and (b) activating T cells comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement. In certain embodiments of the method of producing an activated modified T _SCM or T _CM of the invention comprising contacting said plurality of modified T cells with a composition, the viral vector comprises an antigen receptor. do. In certain embodiments, the viral vector comprises sequences isolated or derived from a retrovirus. In certain embodiments, the viral vector comprises sequences isolated or derived from a lentivirus.

1. A method of producing an activated modified T _SCM or T _CM , comprising: (a) introducing a composition comprising an antigen receptor into a plurality of primary human T cells to produce a plurality of modified T cells, the antigen receptor or therapeutic protein; is not included in the transposon, and (b) activating T cells comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement. In certain embodiments of the method of producing an activated modified T _SCM or T _CM of the invention comprising contacting said plurality of modified T cells with a composition, the viral vector comprises an antigen receptor. do. In certain embodiments, the viral vector comprises sequences isolated or derived from a retrovirus. In certain embodiments, the viral vector comprises sequences isolated or derived from a gamma retrovirus.

1. A method of producing an activated modified T _SCM or T _CM , comprising: (a) introducing a composition comprising an antigen receptor into a plurality of primary human T cells to produce a plurality of modified T cells, the antigen receptor or therapeutic protein; not included in the transposon, and (b) activating T cells comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement. In certain embodiments of the method of producing an activated modified T _SCM or T _CM of the invention comprising contacting said plurality of modified T cells with a composition, the viral vector comprises an antigen receptor. do. In certain embodiments, the viral vector comprises sequences isolated or derived from an adeno-associated virus (AAV). In certain embodiments, the AAV is serotype AV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or AAV11. In certain embodiments, the AAV comprises sequences from one or more of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or AAV11. In certain embodiments, AAV comprises sequences isolated, derived, or recombinant from one or more of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or AAV11. In certain embodiments, AAV comprises sequences isolated, derived, or recombinant from AAV2. In certain embodiments where the vector crosses the blood brain barrier (BBB), the AAV comprises sequences isolated, derived, or recombinant from AAV9. Exemplary adeno-associated viruses and recombinant adeno-associated viruses of the invention include AAV hybrids containing the genome of one serotype and the capsid of another serotype (e.g., AAV2/5, AAV-DJ, and AAV-DJ8) Including, but not limited to, self-complementary AAV (scAAV). Exemplary adeno-associated viruses and recombinant adeno-associated viruses of the invention include, but are not limited to, rAAV-LK03, rAAV-NP59, and rAAV-NP84.

In certain embodiments of the methods of producing activated modified T _SCM or T _CM of the invention, the nucleic acid vector comprises an antigen receptor. In certain embodiments, the DNA vector comprises an antigen receptor. In certain embodiments, the mRNA vector comprises an antigen receptor. In certain embodiments, the nucleic acid vector is a plasmid or minicircle vector.

In certain embodiments of the methods of producing activated modified T _SCM or T _CM of the invention, the nanoparticle vector comprises an antigen receptor. Nanoparticles are described, for example, in International Patent Publication No. WO 2012/094679, International Patent Publication WO 2016/022805, International Patent Publication WO/2011/133635, International Patent Publication WO/2016/090111, International Patent Publication WO/2017. /004498, WO/2017/004509, International Patent Application PCT/US2017/030271, US Patent No. 6,835,394, US Patent No. 7,217,427 and US Patent No. 7,867,512.

In certain embodiments of the methods of producing activated modified T _SCM or T _CM of the invention, in certain embodiments, the antigen receptor is a T cell receptor. In certain embodiments, the T cell receptor is naturally occurring. In certain embodiments, the T cell receptor is not naturally occurring. In certain embodiments, particularly in embodiments in which the T cell receptor is not naturally occurring, the T cell receptor comprises one or more mutation(s) compared to the wild-type T cell receptor. In certain embodiments, particularly in embodiments where the T cell receptor is not naturally occurring, the T cell receptor is a recombinant T cell receptor. In certain embodiments of the above methods, the antigen receptor is a chimeric antigen receptor (CAR). In certain embodiments, the CAR is CARTyrin. In certain embodiments, the CAR comprises one or more VHH sequence(s). In certain embodiments, CAR is VCAR.

1. A method of producing an activated modified T _SCM or T _CM , comprising: (a) introducing a composition comprising an antigen receptor into a plurality of primary human T cells to produce a plurality of modified T cells, the antigen receptor or therapeutic protein; not included in the transposon, and (b) activating T cells comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement. In certain embodiments of the method of producing an activated modified T _SCM or T _CM of the invention comprising contacting the plurality of modified T cells with a composition, the method may express a therapeutic protein. The method further includes introducing a composition comprising a therapeutic protein into primary human T cells to produce modified T cells capable of producing a modified T cell. In certain embodiments, the therapeutic protein is a secretory capable protein, and the method produces modified T cells capable of secreting the therapeutic protein. In certain embodiments, the introduction step comprises homologous recombination and the donor sequence comprises a sequence encoding a therapeutic protein. In certain embodiments, the donor sequence comprising an antigen receptor further comprises a therapeutic protein. In certain embodiments, the first donor sequence comprises an antigen receptor and the second donor sequence comprises a therapeutic protein. In certain embodiments, the vector comprises a sequence encoding a therapeutic protein. In certain embodiments, the vector is a viral vector. In certain embodiments, the vector is a nanoparticle. In certain embodiments, the vector comprising an antigen receptor further comprises a therapeutic protein. In certain embodiments, the first vector comprises an antigen receptor and the second vector template comprises a therapeutic protein.

The present invention is a method of producing modified stem memory T cells (T _SCM ), wherein (a) a composition containing an antigen receptor is introduced into primary human T cells to produce modified T cells, and the transposon is an antigen receptor and (b) a T cell activator composition comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement, and Contacting modified T cells to produce activated modified T cells, wherein the activated modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCM ), thereby producing modified stem memory T cells. A method comprising producing cells (T _SCM ) is provided. The present invention provides a method for producing a plurality of modified stem memory T cells (T _SCM ), comprising: (a) introducing a composition comprising an antigen receptor into a plurality of primary human T cells to produce a plurality of modified T cells; , wherein the transposon comprises an antigen receptor, and (b) a T comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activating supplement. Contacting the plurality of modified T cells with a cell activator composition produces a plurality of activated modified T cells, at least 25%, 50%, 60%, 75% of the plurality of activated modified T cells, producing modified stem memory T cells (T _SCM ), wherein 80%, 85%, 90%, 95% or 99% express one or more cell surface marker(s) of stem memory T cells (T _SCM ). Provides a method of inclusion. In certain embodiments of the method, at least 60% of the majority of activated modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCM ). In certain embodiments of the above methods, the T cell activator composition of (b) further comprises an anti-human CD2 monospecific tetrameric antibody complex. The present invention provides a method for producing modified stem memory T cells (T _SCM ), comprising: (a) introducing a composition containing a chimeric antigen receptor (CAR) into primary human T cells to produce CAR-T cells, and (b) a T comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, an anti-human CD2 monospecific tetrameric antibody complex, and an activation supplement. Contacting the CAR-T cells with a cell activator composition produces activated CAR-T cells, wherein the activated CAR-T cells express one or more cell surface marker(s) of stem memory T cells (T _SCM ). By doing so, it provides a method comprising producing CAR-expressing stem memory T cells (T _SCM ) (CAR-T _SCM ). The present invention provides a method for producing a large number of modified stem T cells (T _SCM ), comprising: (a) introducing a composition comprising a chimeric antigen receptor (CAR) into a large number of primary human T cells to produce a large number of CAR-T cells; producing, and (b) one of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, an anti-human CD2 monospecific tetrameric antibody complex and an activation supplement. A plurality of activated CAR-T cells are produced by contacting a plurality of CAR-T cells with a T cell activator composition comprising the above, and at least 2%, 5%, and 10% of the plurality of activated CAR-T cells , 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99 % or or any percentage therebetween comprising producing a plurality of activated CAR stem memory T cells (T _SCM ) by expressing one or more cell surface marker(s) of the stem memory T cells (T _SCM ). Provides a method. In certain embodiments, the method comprises (c) a T cell proliferation composition comprising one or more of human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, Iscov's MDM, and a proliferation supplement, and an activated modified contacting the T cells to produce a plurality of proliferated modified T cells, wherein at least 2% of the plurality of proliferated modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCM ) It additionally includes the step of doing so. In certain embodiments, the T cell proliferation composition comprises octanoic acid, nicotinamide, 2,4,7,9-tetramethyl-5-decyne-4,7-diol (TMDD), diisopropyl adipate (DIPA), n -Contains one or more of butyl-benzenesulfonamide, 1,2-benzenedicarboxylic acid, bis(2-methylpropyl) ester, palmitic acid, linoleic acid, oleic acid, stearic acid hydrazide, oleamide, sterol and alkanes. or include additionally. In certain embodiments, the T cell proliferation composition includes one or more of octanoic acid, palmitic acid, linoleic acid, oleic acid, and sterols (e.g., cholesterol). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 0.9 mg/kg to 90 mg/kg including endpoint; Palmitic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Linoleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Oleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; and sterols at a concentration of about 0.1 mg/kg to 10 mg/kg inclusive, where mg/kg = parts per million. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 9 mg/kg, palmitic acid at a concentration of about 2 mg/kg, linoleic acid at a concentration of about 2 mg/kg, oleic acid at a concentration of about 2 mg/kg, and Contains one or more of the sterols at a concentration of 1 mg/kg (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 9.19 mg/kg, palmitic acid at a concentration of 1.86 mg/kg, linoleic acid at a concentration of about 2.12 mg/kg, oleic acid at a concentration of about 2.13 mg/kg, and oleic acid at a concentration of about 1.01 mg/kg. Contains one or more of the sterols at a concentration of mg/kg (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 9.19 mg/kg, palmitic acid at a concentration of 1.86 mg/kg, linoleic acid at a concentration of 2.12 mg/kg, oleic acid at a concentration of about 2.13 mg/kg, and 1.01 mg/kg. Contains sterols in kg concentration (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 6.4 μmol/kg to 640 μmol/kg including endpoint; Palmitic acid at a concentration of 0.7 μmol/kg to 70 μmol/kg including end point; Linoleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including end point; Oleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including end point; and sterols at a concentration of 0.25 μmol/kg to 25 μmol/kg inclusive. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 64 μmol/kg, palmitic acid at a concentration of about 7 μmol/kg, linoleic acid at a concentration of about 7.5 μmol/kg, oleic acid at a concentration of about 7.5 μmol/kg, and about Contains one or more of the sterols at a concentration of 2.5 μmol/kg. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 63.75 μmol/kg, palmitic acid at a concentration of about 7.27 μmol/kg, linoleic acid at a concentration of about 7.57 μmol/kg, oleic acid at a concentration of about 7.56 μmol/kg, and about Contains one or more of the sterols at a concentration of 2.61 μmol/kg. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 63.75 μmol/kg, palmitic acid at a concentration of about 7.27 μmol/kg, linoleic acid at a concentration of about 7.57 μmol/kg, oleic acid at a concentration of about 7.56 μmol/kg, and 2.61 μmol/kg. Contains sterols at a concentration of /kg. In certain embodiments, at least 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60% of the majority of the expanded modified T cells. , 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or any percentage in between express cell surface marker(s) of stem memory T cells (T _SCM ). . In certain embodiments, at least 60% of the majority of the expanded transformed T cells express cell surface marker(s) of stem memory T cells (T _SCM ). In certain embodiments, the method comprises (d) at least 2%, 5%, 10%, 15%, 20%, 25% of modified T cells expressing cell surface marker(s) of stem memory T cells (T _SCM ). %, 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or any percentage in between. It further comprises concentrating the plurality of expanded modified T cells to produce a composition comprising. In certain embodiments, the method comprises (d) a plurality of expanded modified T cells to produce a composition comprising at least 60% modified T cells expressing cell surface marker(s) of stem memory T cells (T _SCM ). It further includes the step of concentrating T cells. In certain embodiments, the enrichment step further comprises isolating modified T cells expressing one or more cell surface marker(s) of stem memory T cells (T _SCM ) from the plurality of enriched modified T cells. . In certain embodiments, the enrichment step is a T cell proliferation composition comprising one or more of human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, Iscov's MDM, and a proliferation supplement It further comprises contacting _{the SCM} to produce a plurality of expanded concentrated modified T _SCM . In certain embodiments, the T cell proliferation composition comprises octanoic acid, nicotinamide, 2,4,7,9-tetramethyl-5-decyne-4,7-diol (TMDD), diisopropyl adipate (DIPA), n -Add one or more of butyl-benzenesulfonamide, 1,2-benzenedicarboxylic acid, bis(2-methylpropyl) ester, palmitic acid, linoleic acid, oleic acid, stearic acid hydrazide, oleamide, sterol, and alkane. Included as. In certain embodiments, the T cell proliferation composition includes one or more of octanoic acid, palmitic acid, linoleic acid, oleic acid, and sterols (e.g., cholesterol). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 0.9 mg/kg to 90 mg/kg including endpoint; Palmitic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Linoleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Oleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; and sterols at a concentration of about 0.1 mg/kg to 10 mg/kg inclusive, where mg/kg = parts per million. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 9 mg/kg, palmitic acid at a concentration of about 2 mg/kg, linoleic acid at a concentration of about 2 mg/kg, oleic acid at a concentration of about 2 mg/kg, and Contains one or more of the sterols at a concentration of 1 mg/kg (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 9.19 mg/kg, palmitic acid at a concentration of 1.86 mg/kg, linoleic acid at a concentration of about 2.12 mg/kg, oleic acid at a concentration of about 2.13 mg/kg, and oleic acid at a concentration of about 1.01 mg/kg. Contains one or more of the sterols at a concentration of mg/kg (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 9.19 mg/kg, palmitic acid at a concentration of 1.86 mg/kg, linoleic acid at a concentration of 2.12 mg/kg, oleic acid at a concentration of about 2.13 mg/kg, and 1.01 mg/kg. Contains sterols in kg concentration (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 6.4 μmol/kg to 640 μmol/kg including endpoint; Palmitic acid at a concentration of 0.7 μmol/kg to 70 μmol/kg including end point; Linoleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including end point; Oleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including end point; and sterols at a concentration of 0.25 μmol/kg to 25 μmol/kg inclusive. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 64 μmol/kg, palmitic acid at a concentration of about 7 μmol/kg, linoleic acid at a concentration of about 7.5 μmol/kg, oleic acid at a concentration of about 7.5 μmol/kg, and about Contains one or more of the sterols at a concentration of 2.5 μmol/kg. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 63.75 μmol/kg, palmitic acid at a concentration of about 7.27 μmol/kg, linoleic acid at a concentration of about 7.57 μmol/kg, oleic acid at a concentration of about 7.56 μmol/kg, and about Contains one or more of the sterols at a concentration of 2.61 μmol/kg. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 63.75 μmol/kg, palmitic acid at a concentration of about 7.27 μmol/kg, linoleic acid at a concentration of about 7.57 μmol/kg, oleic acid at a concentration of about 7.56 μmol/kg, and 2.61 μmol/kg. Contains sterols at a concentration of /kg.

The present invention is a method of producing modified central memory T cells (T _CM ), wherein (a) a composition containing an antigen receptor is introduced into primary human T cells to produce modified T cells, and the transposon is an antigen receptor and (b) a T cell activator composition comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement, and Contacting a modified T cell to produce an activated modified T cell, wherein the activated modified T cell expresses one or more cell surface marker(s) of a central memory T cell (T _CM ), thereby producing a modified central memory T cell. A method comprising producing cells (T _CM ) is provided. The present invention provides a method for producing a plurality of modified central memory T cells (T _CM ), comprising: (a) introducing a composition comprising an antigen receptor into a plurality of primary human T cells to produce a plurality of modified T cells; , wherein the transposon comprises an antigen receptor, and (b) a T comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activating supplement. Contacting the plurality of modified T cells with a cell activator composition produces a plurality of activated modified T cells, at least 25%, 50%, 60%, 75% of the plurality of activated modified T cells, producing modified central memory T cells (T _{CM) by having 80%, 85%, 90%, 95% or 99% express one or more cell surface marker(s) of central memory T cells (T CM )} . Provides a method of inclusion. In certain embodiments of the above methods, at least 60% of the majority of activated modified T cells express one or more cell surface marker(s) of central memory T cells (T _CM ). In certain embodiments of the above methods, the T cell activator composition of (b) further comprises an anti-human CD2 monospecific tetrameric antibody complex. In certain embodiments, the method comprises (c) a T cell proliferation composition comprising one or more of human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, Iscov's MDM, and a proliferation supplement, and an activated modified contacting the T cells to produce a plurality of proliferated modified T cells, wherein at least 2% of the plurality of proliferated modified T cells express one or more cell surface marker(s) of central memory T cells (T _CM ) It additionally includes the step of doing so. In certain embodiments, the T cell proliferation composition comprises octanoic acid, nicotinamide, 2,4,7,9-tetramethyl-5-decyne-4,7-diol (TMDD), diisopropyl adipate (DIPA), n -Contains one or more of butyl-benzenesulfonamide, 1,2-benzenedicarboxylic acid, bis(2-methylpropyl) ester, palmitic acid, linoleic acid, oleic acid, stearic acid hydrazide, oleamide, sterol and alkanes. or include additionally. In certain embodiments, the T cell proliferation composition includes one or more of octanoic acid, palmitic acid, linoleic acid, oleic acid, and sterols (e.g., cholesterol). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 0.9 mg/kg to 90 mg/kg including endpoint; Palmitic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Linoleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Oleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; and sterols at a concentration of about 0.1 mg/kg to 10 mg/kg inclusive, where mg/kg = parts per million. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 9 mg/kg, palmitic acid at a concentration of about 2 mg/kg, linoleic acid at a concentration of about 2 mg/kg, oleic acid at a concentration of about 2 mg/kg, and Contains one or more of the sterols at a concentration of 1 mg/kg (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 9.19 mg/kg, palmitic acid at a concentration of 1.86 mg/kg, linoleic acid at a concentration of about 2.12 mg/kg, oleic acid at a concentration of about 2.13 mg/kg, and oleic acid at a concentration of about 1.01 mg/kg. Contains one or more of the sterols at a concentration of mg/kg (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 9.19 mg/kg, palmitic acid at a concentration of 1.86 mg/kg, linoleic acid at a concentration of 2.12 mg/kg, oleic acid at a concentration of about 2.13 mg/kg, and 1.01 mg/kg. Contains sterols in kg concentration (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 6.4 μmol/kg to 640 μmol/kg including endpoint; Palmitic acid at a concentration of 0.7 μmol/kg to 70 μmol/kg including end point; Linoleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including end point; Oleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including end point; and sterols at a concentration of 0.25 μmol/kg to 25 μmol/kg inclusive. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 64 μmol/kg, palmitic acid at a concentration of about 7 μmol/kg, linoleic acid at a concentration of about 7.5 μmol/kg, oleic acid at a concentration of about 7.5 μmol/kg, and about Contains one or more of the sterols at a concentration of 2.5 μmol/kg. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 63.75 μmol/kg, palmitic acid at a concentration of about 7.27 μmol/kg, linoleic acid at a concentration of about 7.57 μmol/kg, oleic acid at a concentration of about 7.56 μmol/kg, and about Contains one or more of the sterols at a concentration of 2.61 μmol/kg. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 63.75 μmol/kg, palmitic acid at a concentration of about 7.27 μmol/kg, linoleic acid at a concentration of about 7.57 μmol/kg, oleic acid at a concentration of about 7.56 μmol/kg, and 2.61 μmol/kg. Contains sterols at a concentration of /kg. In certain embodiments, at least 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60% of the majority of the expanded modified T cells. , 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or any percentage in between express cell surface marker(s) of central memory T cells (T _CM ) . In certain embodiments, at least 60% of the majority of the expanded transformed T cells express cell surface marker(s) of central memory T cells (T _CM ). In certain embodiments, the method comprises (d) at least 2%, 5%, 10%, 15%, 20%, 25% of the modified T cells expressing cell surface marker(s) of central memory T cells (T _CM ). %, 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or any percentage in between. It further comprises concentrating the plurality of expanded modified T cells to produce a composition comprising. In certain embodiments, the method comprises (d) a plurality of expanded modified T cells to produce a composition comprising at least 60% modified T cells expressing cell surface marker(s) of central memory T cells (T _CM ). It further includes the step of concentrating T cells. In certain embodiments, the enrichment step further comprises isolating modified T cells expressing one or more cell surface marker(s) of central memory T cells (T _CM ) from the plurality of enriched modified T cells. . In certain embodiments of the method, the enrichment step produces an isolated T cell proliferation composition comprising one or more of human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, Iscov's MDM, and proliferation supplements. It further comprises contacting the modified T _CM to produce a plurality of expanded concentrated modified T _CM . In certain embodiments, the T cell proliferation composition comprises octanoic acid, nicotinamide, 2,4,7,9-tetramethyl-5-decyne-4,7-diol (TMDD), diisopropyl adipate (DIPA), n -Add one or more of butyl-benzenesulfonamide, 1,2-benzenedicarboxylic acid, bis(2-methylpropyl) ester, palmitic acid, linoleic acid, oleic acid, stearic acid hydrazide, oleamide, sterol, and alkane. Included as. In certain embodiments, the T cell proliferation composition includes one or more of octanoic acid, palmitic acid, linoleic acid, oleic acid, and sterols (e.g., cholesterol). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 0.9 mg/kg to 90 mg/kg including endpoint; Palmitic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Linoleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Oleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; and sterols at a concentration of about 0.1 mg/kg to 10 mg/kg inclusive, where mg/kg = parts per million. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 9 mg/kg, palmitic acid at a concentration of about 2 mg/kg, linoleic acid at a concentration of about 2 mg/kg, oleic acid at a concentration of about 2 mg/kg, and Contains one or more of the sterols at a concentration of 1 mg/kg (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 9.19 mg/kg, palmitic acid at a concentration of 1.86 mg/kg, linoleic acid at a concentration of about 2.12 mg/kg, oleic acid at a concentration of about 2.13 mg/kg, and oleic acid at a concentration of about 1.01 mg/kg. Contains one or more of the sterols at a concentration of mg/kg (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 9.19 mg/kg, palmitic acid at a concentration of 1.86 mg/kg, linoleic acid at a concentration of 2.12 mg/kg, oleic acid at a concentration of about 2.13 mg/kg, and 1.01 mg/kg. Contains sterols in kg concentration (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 6.4 μmol/kg to 640 μmol/kg including endpoint; Palmitic acid at a concentration of 0.7 μmol/kg to 70 μmol/kg including end point; Linoleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including end point; Oleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including end point; and sterols at a concentration of 0.25 μmol/kg to 25 μmol/kg inclusive. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 64 μmol/kg, palmitic acid at a concentration of about 7 μmol/kg, linoleic acid at a concentration of about 7.5 μmol/kg, oleic acid at a concentration of about 7.5 μmol/kg, and about Contains one or more of the sterols at a concentration of 2.5 μmol/kg. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 63.75 μmol/kg, palmitic acid at a concentration of about 7.27 μmol/kg, linoleic acid at a concentration of about 7.57 μmol/kg, oleic acid at a concentration of about 7.56 μmol/kg, and about Contains one or more of the sterols at a concentration of 2.61 μmol/kg. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 63.75 μmol/kg, palmitic acid at a concentration of about 7.27 μmol/kg, linoleic acid at a concentration of about 7.57 μmol/kg, oleic acid at a concentration of about 7.56 μmol/kg, and 2.61 μmol/kg. Contains sterols at a concentration of /kg.

The present invention provides a method for producing a composition comprising a plurality of modified stem memory T cells (T _SCM ) and a plurality of modified central memory T cells (T _CM ), comprising: (a) producing a composition comprising a plurality of antigen receptors; Introduction to primary human T cells produces a composition comprising a plurality of modified stem memory T cells (T _SCM ) and a plurality of modified central memory T cells (T _CM ), wherein the transposon includes an antigen receptor. step, and (b) contacting the composition with a T cell activator composition comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement. Producing a composition comprising a plurality of activated modified T _SCMs and _a plurality of activated _modified T , expressing CD95 and IL-2Rβ, and said plurality of activated modified T _CMs express one or more of CD45RO, CD95, IL-2Rβ, CCR7, and CD62L, thereby producing a plurality of modified T _SCMs and a plurality of modified T _CMs . A method comprising producing a composition comprising: In certain embodiments of the above methods, the T cell activator composition of (b) further comprises an anti-human CD2 monospecific tetrameric antibody complex. In certain embodiments, the method comprises (c) a T cell proliferation composition comprising the composition and one or more of human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, Iscov's MDM, and a proliferation supplement. contacting produces a plurality of proliferated modified T cells, wherein at least 2% of the composition comprising the plurality of proliferated modified T cells express one or more cell surface marker(s) of stem memory T cells (T _SCM ). It additionally includes the step of doing so. In certain embodiments, the method comprises (c) a T cell proliferation composition comprising the composition and one or more of human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, Iscov's MDM, and a proliferation supplement. contacting produces a plurality of proliferated modified T cells, wherein at least 2% of the composition comprising the plurality of proliferated modified T cells express one or more cell surface marker(s) of central memory T cells (T _CM ). It additionally includes the step of doing so. In certain embodiments, the T cell proliferation composition comprises octanoic acid, nicotinamide, 2,4,7,9-tetramethyl-5-decyne-4,7-diol (TMDD), diisopropyl adipate (DIPA), n -Contains one or more of butyl-benzenesulfonamide, 1,2-benzenedicarboxylic acid, bis(2-methylpropyl) ester, palmitic acid, linoleic acid, oleic acid, stearic acid hydrazide, oleamide, sterol and alkanes. or include additionally. In certain embodiments, the T cell proliferation composition includes one or more of octanoic acid, palmitic acid, linoleic acid, oleic acid, and sterols (e.g., cholesterol). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 0.9 mg/kg to 90 mg/kg including endpoint; Palmitic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Linoleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Oleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; and sterols at a concentration of about 0.1 mg/kg to 10 mg/kg inclusive, where mg/kg = parts per million. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 9 mg/kg, palmitic acid at a concentration of about 2 mg/kg, linoleic acid at a concentration of about 2 mg/kg, oleic acid at a concentration of about 2 mg/kg, and and one or more of the sterols at a concentration of about 1 mg/kg (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 9.19 mg/kg, palmitic acid at a concentration of 1.86 mg/kg, linoleic acid at a concentration of about 2.12 mg/kg, oleic acid at a concentration of about 2.13 mg/kg, and oleic acid at a concentration of about 1.01 mg/kg. Contains one or more of the sterols at a concentration of mg/kg (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 9.19 mg/kg, palmitic acid at a concentration of 1.86 mg/kg, linoleic acid at a concentration of 2.12 mg/kg, oleic acid at a concentration of about 2.13 mg/kg, and 1.01 mg/kg. Contains sterols in kg concentration (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 6.4 μmol/kg to 640 μmol/kg including endpoint; Palmitic acid at a concentration of 0.7 μmol/kg to 70 μmol/kg including end point; Linoleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including end point; Oleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including end point; and sterols at a concentration of 0.25 μmol/kg to 25 μmol/kg inclusive. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 64 μmol/kg, palmitic acid at a concentration of about 7 μmol/kg, linoleic acid at a concentration of about 7.5 μmol/kg, oleic acid at a concentration of about 7.5 μmol/kg, and about Contains one or more of the sterols at a concentration of 2.5 μmol/kg. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 63.75 μmol/kg, palmitic acid at a concentration of about 7.27 μmol/kg, linoleic acid at a concentration of about 7.57 μmol/kg, oleic acid at a concentration of about 7.56 μmol/kg, and about Contains one or more of the sterols at a concentration of 2.61 μmol/kg. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 63.75 μmol/kg, palmitic acid at a concentration of about 7.27 μmol/kg, linoleic acid at a concentration of about 7.57 μmol/kg, oleic acid at a concentration of about 7.56 μmol/kg, and 2.61 μmol/kg. Contains sterols at a concentration of /kg. In certain embodiments, at least 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35% of a composition comprising a plurality of proliferated modified T _SCMs and a plurality of proliferated modified T _CMs . %, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or any percentage in between, of the cells are stem memory T Express cell surface marker(s) of the cells (T _SCM ). In certain embodiments, at least 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35% of a composition comprising a plurality of proliferated modified T _SCMs and a plurality of proliferated modified T _CMs . %, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or any percentage in between, of the cells are central memory T Express cell surface marker(s) of the cells (T _CM ). In certain embodiments, the method comprises (d) at least 2%, 5%, 10%, 15%, 20%, 25% of modified T cells expressing cell surface marker(s) of stem memory T cells (T _SCM ). %, 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or any percentage in between. It further includes concentrating the composition to produce a composition comprising: In certain embodiments, the method comprises (d) at least 2%, 5%, 10%, ₁₅ %, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or any in between. It further includes concentrating the composition to produce a composition comprising: In certain embodiments, the enrichment step includes isolating modified T cells expressing one or more cell surface marker(s) of stem memory T cells (T _SCM ) from the composition or central memory T cells (T _CM ) from the composition. It further comprises isolating modified T cells expressing one or more cell surface marker(s). In certain embodiments, the enrichment step includes isolating modified T cells expressing one or more cell surface marker(s) of stem memory T cells (T _SCM ) from the composition and central memory T cells (T _CM ) from the composition. It further comprises isolating modified T cells expressing one or more cell surface marker(s). In certain embodiments, the enrichment step comprises a T cell proliferation composition comprising one or more of human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, Icecove's MDM, and proliferation supplements and the isolated modified T It further comprises contacting _{the SCM} and/or T _CM to produce a composition comprising a plurality of expanded, concentrated, modified T _SCM and/or T _CM . In certain embodiments, the T cell proliferation composition comprises octanoic acid, nicotinamide, 2,4,7,9-tetramethyl-5-decyne-4,7-diol (TMDD), diisopropyl adipate (DIPA), n -Add one or more of butyl-benzenesulfonamide, 1,2-benzenedicarboxylic acid, bis(2-methylpropyl) ester, palmitic acid, linoleic acid, oleic acid, stearic acid hydrazide, oleamide, sterol, and alkane. Included as. In certain embodiments, the T cell proliferation composition includes one or more of octanoic acid, palmitic acid, linoleic acid, oleic acid, and sterols (e.g., cholesterol). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 0.9 mg/kg to 90 mg/kg including endpoint; Palmitic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Linoleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Oleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; and sterols at a concentration of about 0.1 mg/kg to 10 mg/kg inclusive, where mg/kg = parts per million. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 9 mg/kg, palmitic acid at a concentration of about 2 mg/kg, linoleic acid at a concentration of about 2 mg/kg, oleic acid at a concentration of about 2 mg/kg, and Contains one or more of the sterols at a concentration of 1 mg/kg (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 9.19 mg/kg, palmitic acid at a concentration of 1.86 mg/kg, linoleic acid at a concentration of about 2.12 mg/kg, oleic acid at a concentration of about 2.13 mg/kg, and oleic acid at a concentration of about 1.01 mg/kg. Contains one or more of the sterols at a concentration of mg/kg (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 9.19 mg/kg, palmitic acid at a concentration of 1.86 mg/kg, linoleic acid at a concentration of 2.12 mg/kg, oleic acid at a concentration of about 2.13 mg/kg, and 1.01 mg/kg. Contains sterols in kg concentration (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 6.4 μmol/kg to 640 μmol/kg including endpoint; Palmitic acid at a concentration of 0.7 μmol/kg to 70 μmol/kg including end point; Linoleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including end point; Oleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including end point; and one or more of the sterols at a concentration between 0.25 μmol/kg and 25 μmol/kg inclusive. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 64 μmol/kg, palmitic acid at a concentration of about 7 μmol/kg, linoleic acid at a concentration of about 7.5 μmol/kg, oleic acid at a concentration of about 7.5 μmol/kg, and about Contains one or more of the sterols at a concentration of 2.5 μmol/kg. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 63.75 μmol/kg, palmitic acid at a concentration of about 7.27 μmol/kg, linoleic acid at a concentration of about 7.57 μmol/kg, oleic acid at a concentration of about 7.56 μmol/kg, and about 2.61 μmol/kg. Contains one or more of the sterols at a concentration of μmol/kg. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 63.75 μmol/kg, palmitic acid at a concentration of about 7.27 μmol/kg, linoleic acid at a concentration of about 7.57 μmol/kg, oleic acid at a concentration of about 7.56 μmol/kg, and 2.61 μmol/kg. Contains sterols at a concentration of /kg. In certain embodiments of the above methods, the modified stem memory T cells (T _SCM ) comprise at least 1%, 2%, 5%, 7%, 10%, 15%, 20%, 25%, of the total number of cells in the composition. 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or between these. Contains an arbitrary percentage of In certain embodiments of the method, the modified central memory T cells (T _CM ) comprise at least 1%, 2%, 5%, 7%, 10%, 15%, 20%, 25% of the total number of cells in the composition. 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or between these. Contains an arbitrary percentage of In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 10% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 90% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 90% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 10% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 20% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 80% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 80% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 20% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 30% of the total cell number of the composition and the modified central memory T cells (T _CM ) comprise at least 70% of the total cell number of the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 70% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 30% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 40% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 60% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 60% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 40% of the total number of cells in the composition. Includes %. In certain embodiments of the method, the modified stem memory T cells (T _SCM ) comprise at least 50% of the total number of cells in the composition and the modified central memory T cells (T _CM ) comprise at least 50% of the total number of cells in the composition. Includes %.

The method comprises (a) introducing a composition comprising an antigen receptor into primary human T cells to produce modified T cells, wherein the transposon comprises an antigen receptor; and (b) contacting said modified T cell with a T cell activator composition comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement. In certain embodiments of the methods of the invention, including embodiments comprising the step of producing activated modified T cells by (c) producing a modified T cell activated by Introducing primary human T cells to produce modified T cells, wherein the modified T cells are capable of expressing a therapeutic protein. In certain embodiments, the therapeutic protein is a secretory capable protein, and the method produces modified T cells capable of secreting the therapeutic protein. In certain embodiments, the method further comprises introducing a transposase composition. In certain embodiments, the transposase composition translocates the transposon of (a) and a second transposon. In certain embodiments, the method includes introducing a first transposase composition and a second transposase composition. In certain embodiments, including embodiments wherein the method comprises introducing a first transposase composition and a second transposase composition, the first transposase composition transposes the transzone of (a) and , the second transposase composition translocates the second transposon. In certain embodiments of the above methods, the transposon is a plasmid DNA transposon having a sequence encoding an antigen receptor or therapeutic protein flanked by two cis regulatory sequestering elements. In certain embodiments, the transposon is a piggyback transposon. In certain embodiments, particularly in those embodiments where the transposon is a piggyback transposon, the transposase is a Piggyback ^TM or Super Piggyback ^TM (SPB) transposase. In certain embodiments of the above methods, the transposon is a Sleeping Beauty transposon. In certain embodiments, particularly in embodiments where the transposon is a Sleeping Beauty transposon, the transposase is Sleeping Beauty Transposase or Hyperactive Sleeping Beauty Transposase (SB100X). In certain embodiments of the above methods, the transposon is a hellraiser transposon. In certain embodiments, particularly in embodiments where the transposon is a hellraiser transposon, the transposase is a helitron transposase. In certain embodiments of the above methods, the transposon is a Tol2 transposon. In certain embodiments, including embodiments where the transposon is a Tol2 transposon, the transposase is a Tol2 transposase.

The method comprises (a) introducing a composition comprising an antigen receptor into primary human T cells to produce modified T cells, wherein the transposon comprises an antigen receptor; and (b) contacting the modified T cell with a T cell activator composition comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement. In certain embodiments of the methods of the invention, including embodiments comprising a method comprising producing activated modified T cells, the method comprises introducing a sequence encoding a therapeutic protein into a primary human T cell. producing a modified T cell, wherein the modified T cell is capable of expressing a therapeutic protein. In certain embodiments of introducing a sequence encoding a therapeutic protein, the introducing step comprises homologous recombination. In certain embodiments of introducing a sequence encoding a therapeutic protein, the vector comprises a sequence encoding a therapeutic protein. In certain embodiments, the vector is a viral vector. In certain embodiments, the vector is a nanoparticle,

In certain embodiments of the methods of the invention, the introducing step further comprises a composition comprising the genome editing construct. In certain embodiments, the genome editing construct comprises a guide RNA and a clustered regularly interspaced short palindromic repeats (CRISPR) associated protein 9 (Cas9) DNA endonuclease. In certain embodiments, the genome editing construct comprises a DNA binding domain and a type IIS endonuclease. In certain embodiments, the genome editing construct encodes a fusion protein. In certain embodiments, the genome editing construct encodes a DNA binding domain and a type IIS endonuclease, wherein the expressed DNA binding domain and the expressed type IIS endonuclease are non-covalently linked. In certain embodiments, including embodiments where the genome editing construct comprises a DNA binding domain and a type IIS endonuclease, the genome editing construct comprises a sequence derived from a Cas9 endonuclease. In certain embodiments, including embodiments where the genome editing construct comprises a DNA binding domain and a type IIS endonuclease, the sequence derived from the Cas9 endonuclease is the DNA binding domain. In certain embodiments, including embodiments where the sequence derived from the Cas9 endonuclease is a DNA binding domain, the sequence derived from the Cas9 endonuclease encodes an inactive Cas9. In certain embodiments, including embodiments where the sequence derived from the Cas9 endonuclease is a DNA binding domain, the sequence derived from the Cas9 endonuclease encodes truncated Cas9. In certain embodiments, the sequence derived from the Cas9 endonuclease includes an amino acid substitution from aspartic acid (D) to alanine (A) at position 10 (D10A). In certain embodiments, the sequence derived from the Cas9 endonuclease includes an amino acid substitution (H840A) from histidine (H) to alanine (A) at position 840. In certain embodiments, the sequence derived from the Cas9 endonuclease comprises dCas9 (SEQ ID NO: 33). In certain embodiments, the sequence derived from the Cas9 endonuclease includes an amino acid substitution (N580A) from asparagine (N) to alanine (A) at position 580. In certain embodiments, the sequence derived from the Cas9 endonuclease comprises dSaCas9 (SEQ ID NO: 32). In certain embodiments, including embodiments where the genome editing construct comprises a DNA binding domain and a type IIS endonuclease, the genome editing construct is derived from a transcription activator-like effector nuclease (TALEN). Contains the derived sequence. In certain embodiments, including embodiments where the genome editing construct comprises a DNA binding domain and a type IIS endonuclease, the sequence derived from a TALEN is a DNA binding domain. In certain embodiments, the genome editing construct comprises TALENs. In certain embodiments, including embodiments where the genome editing construct comprises a DNA binding domain and a type IIS endonuclease, the genome editing construct comprises a sequence derived from a zinc-finger nuclease (ZFN). do. In certain embodiments, including embodiments where the genome editing construct comprises a DNA binding domain and a type IIS endonuclease, the sequence derived from the ZFN is the DNA binding domain. In certain embodiments, the genome editing construct comprises a zinc finger nuclease (ZFN).

In certain embodiments of the methods of the invention, the transposon is a plasmid DNA transposon having a sequence encoding an antigen receptor or therapeutic protein flanked by two cis regulatory sequestering elements. In certain embodiments of the method, the introducing step further comprises a composition comprising an mRNA sequence encoding the transposase. In certain embodiments, the transposon is a piggyback transposon. In certain embodiments, particularly in embodiments where the transposon is a piggyback transposon, the transposase is a Super Piggyback™ (SPB) transposase. In certain embodiments, particularly in embodiments where the transposase is a Super Piggyback™ (SPB) transposase, the sequence encoding the transposase is an mRNA sequence. In certain embodiments, the piggyback transposase comprises an amino acid sequence comprising SEQ ID NO:4. In certain embodiments, the piggyback transposase is a hyperactive variant and the hyperactive variant comprises amino acid substitutions at one or more of positions 30, 165, 282, and 538 of SEQ ID NO:4. In certain embodiments, the amino acid substitution at position 30 of SEQ ID NO:4 is an isoleucine (I) to valine (V) substitution (I30V). In certain embodiments, the amino acid substitution at position 165 in SEQ ID NO:4 is a glycine (G) to serine (S) substitution (G165S). In certain embodiments, the amino acid substitution at position 282 of SEQ ID NO:4 is a methionine (M) to valine (V) substitution (M282V). In certain embodiments, the amino acid substitution at position 538 of SEQ ID NO:4 is an asparagine (N) to lysine (K) substitution (N538K). In certain embodiments, the super piggyback (SPB) transposase comprises an amino acid sequence comprising SEQ ID NO:5. In certain embodiments, the transposon is a Sleeping Beauty transposon. In certain embodiments, particularly in embodiments where the transposon is a Sleeping Beauty transposon, the transposase is Sleeping Beauty Transposase or Hyperactive Sleeping Beauty Transposase (SB100X). In certain embodiments, the transposon is a hellraiser transposon. In certain embodiments, particularly in embodiments where the transposon is a hellraiser transposon, the transposase is a helitron transposase. In certain embodiments, the transposon is a Tol2 transposon. In certain embodiments, particularly in embodiments where the transposon is a Tol2 transposon, the transposase is a Tol2 transposase. In certain embodiments, the sequence encoding the transposase is an mRNA sequence. In certain embodiments, the transposon may be derived from any species or may be recombinant. Alternatively, or additionally, the transposon may be synthetic.

In certain embodiments of the methods of the invention, the transposon further comprises a selection gene. In certain embodiments, the T cell proliferation composition further comprises a selection agent.

In certain embodiments of the methods of the invention, the antigen receptor is a T cell receptor. In certain embodiments, the T cell receptor is naturally occurring. In certain embodiments, the T cell receptor is not naturally occurring. In certain embodiments, particularly in embodiments in which the T cell receptor is not naturally occurring, the T cell receptor comprises one or more mutation(s) compared to the wild-type T cell receptor. In certain embodiments, particularly in embodiments where the T cell receptor is not naturally occurring, the T cell receptor is a recombinant T cell receptor. In certain embodiments of the above methods, the antigen receptor is a chimeric antigen receptor (CAR). In certain embodiments, the CAR is CARTyrin. In certain embodiments, the CAR comprises one or more VHH sequence(s). In certain embodiments, CAR is VCAR.

In certain embodiments of the methods of the invention, the cell surface markers of the modified T _SCM include CD62L and CD45RA. In certain embodiments, the cell surface marker of the modified T _SCM includes one or more of CD62L, CD45RA, CD28, CCR7, CD127, CD45RO, CD95, CD95, and IL-2Rβ. In certain embodiments, the cell surface marker of the modified T _SCM includes one or more of CD45RA, CD95, IL-2Rβ, CR7, and CD62L.

In certain embodiments of the methods of the invention, the plurality of expanded modified T cells comprise naive T cells (modified T _N ) and the cell surface marker of the CAR-T _N is one of CD45RA, CCR7, and CD62L. Includes more. In certain embodiments, the plurality of expanded modified T cells comprise central memory T cells (modified T _CM ) and the cell surface marker of the CAR-T _CM is one or more of CD45RO, CD95, IL-2Rβ, CCR7, and CD62L. Includes. In certain embodiments, the plurality of expanded modified T cells comprise effector memory T cells (modified T _EMs ) and the cell surface marker of the CAR-T _EMs includes one or more of CD45RO, CD95, and IL-2Rβ. In certain embodiments, the plurality of expanded modified T cells comprise effector T cells (modified T _EFF ) and the cell surface marker of the CAR-T _EFF includes one or more of CD45RA, CD95, and IL-2Rβ.

In certain embodiments of the methods of the invention, the plurality of expanded modified T cells comprise central memory T cells (modified T _CM ) and the cell surface markers of the CAR-T _CM include CD45RO, CD95, IL-2Rβ, CCR7 , and CD62L. In certain embodiments, the most abundant cells in the majority of expanded modified T cells are central memory T cells (modified T _CMs ) and the cell surface markers of CAR-T _CMs are CD45RO, CD95, IL-2Rβ, CCR7, and CD62L. Contains one or more of In certain embodiments, wherein the most abundant cells in the plurality of expanded modified T cells are central memory T cells (transformed T _CM ), the plurality of expanded modified T cells comprise T _SCM cells and cellular markers of the T _SCM cells. Includes one or more of CD62L, CD45RA, CD28, CCR7, CD127, CD45RO, CD95, CD95 and IL-2Rβ.

The present invention provides a method for producing modified stem memory T cells (T _SCM ), comprising: (a) introducing a composition containing a chimeric antigen receptor (CAR) into primary human T cells to produce CAR-T cells, and (b) a T comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, an anti-human CD2 monospecific tetrameric antibody complex, and an activation supplement. Contacting the CAR-T cells with a cell activator composition produces activated CAR-T cells, wherein the activated CAR-T cells express one or more cell surface marker(s) of stem memory T cells (T _SCM ). By doing so, it provides a method comprising producing CAR-expressing stem memory T cells (T _SCM ). The present invention is a method of producing a plurality of modified stem memory T cells (T _SCM ), comprising: (a) introducing a composition comprising a chimeric antigen receptor (CAR) into a plurality of primary human T cells to produce a plurality of CAR-T cells; producing cells, and (b) an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, an anti-human CD2 monospecific tetrameric antibody complex, and an activation supplement. producing a plurality of activated CAR-T cells by contacting the plurality of CAR-T cells with a T cell activator composition comprising one or more, at least 2%, 5%, of the plurality of activated CAR-T cells; 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% , 99% or any percentage therebetween, producing a plurality of activated CAR stem memory T cells (T _SCM ) by expressing one or more cell surface marker(s) of the stem memory T cells (T _SCM ). Provides a way to do this. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 25% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 50% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 60% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 75% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 80% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 85% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 90% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 95% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, cell surface markers include CD62L and CD45RA. In certain embodiments, the cell surface marker of the activated CAR T _SCM includes one or more of CD62L, CD45RA, CD28, CCR7, CD127, CD45RO, CD95, CD95, and IL-2Rβ. In certain embodiments, the cell surface marker of the activated CAR T _SCM includes one or more of CD45RA, CD95, IL-2Rβ, CR7, and CD62L. The present invention provides a method for producing modified stem memory T cells (T _SCM ), comprising: (a) introducing a composition containing a chimeric antigen receptor (CAR) into primary human T cells to produce CAR-T cells, and (b) contacting the CAR-T cell with a T cell activator composition comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement. to produce activated CAR-T cells, wherein the activated CAR-T cells express one or more cell surface marker(s) of stem memory T cells (T _SCM ), thereby producing CAR-expressing stem memory T cells (T _SCM ) ( Provides a method including the step of producing CAR-T _SCM ).

The present invention is a method of producing a plurality of modified stem memory T cells (T _SCM ), comprising: (a) introducing a composition comprising a chimeric antigen receptor (CAR) into a plurality of primary human T cells to produce a plurality of CAR-T cells; producing cells, and (b) a T cell activator composition comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement, and contacting a plurality of CAR-T cells to produce a plurality of activated CAR-T cells, at least 2%, 5%, 10%, 15%, 20%, 25% of the plurality of activated CAR-T cells; Stem 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or any percentage in between. A method is provided comprising producing a plurality of activated CAR stem memory T cells (T _SCM ) by expressing one or more cell surface marker(s) of memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 25% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 50% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 60% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 75% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 80% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 85% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 90% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 95% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, cell surface markers include CD62L and CD45RA. In certain embodiments, the cell surface marker of the activated CAR T _SCM includes one or more of CD62L, CD45RA, CD28, CCR7, CD127, CD45RO, CD95, CD95, and IL-2R. In certain embodiments, the cell surface marker of the activated CAR T _SCM includes one or more of CD45RA, CD95, IL-2Rβ, CR7, and CD62L.

In certain embodiments, the method comprises: (c) a T cell proliferation composition comprising one or more of human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, Iscov's MDM, and a proliferation supplement; Contacting CAR-T cells produces a plurality of expanded CAR-T cells, wherein at least 2% of the plurality of expanded CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). It may further include the step of expressing (CAR-T _SCM ). In certain embodiments, the T cell proliferation composition comprises octanoic acid, nicotinamide, 2,4,7,9-tetramethyl-5-decyne-4,7-diol (TMDD), diisopropyl adipate (DIPA), n -Add one or more of butyl-benzenesulfonamide, 1,2-benzenedicarboxylic acid, bis(2-methylpropyl) ester, palmitic acid, linoleic acid, oleic acid, stearic acid hydrazide, oleamide, sterol, and alkane. Included as. In certain embodiments, the T cell proliferation composition includes one or more of octanoic acid, palmitic acid, linoleic acid, oleic acid, and sterols (e.g., cholesterol). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 0.9 mg/kg to 90 mg/kg including endpoint; Palmitic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Linoleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Oleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; and sterols at a concentration of about 0.1 mg/kg to 10 mg/kg inclusive, where mg/kg = parts per million. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 9 mg/kg, palmitic acid at a concentration of about 2 mg/kg, linoleic acid at a concentration of about 2 mg/kg, oleic acid at a concentration of about 2 mg/kg, and Contains one or more of the sterols at a concentration of 1 mg/kg (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 9.19 mg/kg, palmitic acid at a concentration of 1.86 mg/kg, linoleic acid at a concentration of about 2.12 mg/kg, oleic acid at a concentration of about 2.13 mg/kg, and oleic acid at a concentration of about 1.01 mg/kg. Contains one or more of the sterols at a concentration of mg/kg (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 9.19 mg/kg, palmitic acid at a concentration of 1.86 mg/kg, linoleic acid at a concentration of 2.12 mg/kg, oleic acid at a concentration of about 2.13 mg/kg, and 1.01 mg/kg. Contains sterols in kg concentration (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 6.4 μmol/kg to 640 μmol/kg including endpoint; Palmitic acid at a concentration of 0.7 μmol/kg to 70 μmol/kg including end point; Linoleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including end point; Oleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including end point; and one or more of the sterols at a concentration between 0.25 μmol/kg and 25 μmol/kg inclusive. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 64 μmol/kg, palmitic acid at a concentration of about 7 μmol/kg, linoleic acid at a concentration of about 7.5 μmol/kg, oleic acid at a concentration of about 7.5 μmol/kg, and about Contains one or more of the sterols at a concentration of 2.5 μmol/kg. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 63.75 μmol/kg, palmitic acid at a concentration of about 7.27 μmol/kg, linoleic acid at a concentration of about 7.57 μmol/kg, oleic acid at a concentration of about 7.56 μmol/kg, and about 2.61 μmol/kg. Contains one or more of the sterols at a concentration of μmol/kg. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 63.75 μmol/kg, palmitic acid at a concentration of about 7.27 μmol/kg, linoleic acid at a concentration of about 7.57 μmol/kg, oleic acid at a concentration of about 7.56 μmol/kg, and 2.61 μmol/kg. Contains sterols at a concentration of /kg. In certain embodiments, at least 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60% of the majority of the expanded CAR-T cells. , 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or any percentage in between express cell surface marker(s) of stem memory T cells (T _SCM ). (CAR-T _SCM ). In certain embodiments, the plurality of expanded CAR-T cells may be enriched for CAR-T cells expressing cell surface marker(s) of stem memory T cells (T _SCMs ) (CAR-T _SCMs ), such that enrichment After the step, the method comprises at least 2%, 5%, 10%, 15%, 20% of CAR-T cells (CAR-T _SCM ) expressing cell surface marker(s) of stem memory T cells (T _SCM ), 25%, 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or any percentage of these. A concentrated composition containing can be produced. In certain embodiments, cell surface markers include CD62L and CD45RA. In certain embodiments, the cell surface marker of the CAR-T _SCM includes one or more of CD62L, CD45RA, CD28, CCR7, CD127, CD45RO, CD95, CD95, and IL-2Rβ. In certain embodiments, the cell surface marker of the CAR-T _SCM includes one or more of CD45RA, CD95, IL-2Rβ, CR7, and CD62L. In certain embodiments, the plurality of expanded CAR-T cells comprise naïve T cells (CAR-T _N ) and the cell surface marker of the CAR-T _N includes one or more of CD45RA, CCR7, and CD62L. In certain embodiments, the plurality of expanded CAR-T cells comprise central memory T cells (CAR-T _CM ) and the cell surface marker of the CAR-T _CM is one of CD45RO, CD95, IL-2Rβ, CCR7, and CD62L. Includes more. In certain embodiments, the plurality of expanded CAR-T cells comprise effector memory T cells (CAR-T _EMs ) and the cell surface marker of the CAR-T _EMs comprises one or more of CD45RO, CD95, and IL-2Rβ. In certain embodiments, the plurality of expanded CAR-T cells comprise effector T cells (CAR-T _EFF ) and the cell surface marker of the CAR-T _EFF comprises one or more of CD45RA, CD95, and IL-2Rβ. Additional cell surface markers are described in Gattinoni et al. (Nat Med. 2011 Sep 18; 17(10): 1290-7; the contents of which are incorporated herein by reference in their entirety).

The present invention provides a method for producing modified stem memory T cells (T _SCM ), comprising: (a) introducing a composition containing a chimeric antigen receptor (CAR) into primary human T cells to produce CAR-T cells, and (b) contacting said CAR-T cells with a T cell activator composition comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement. producing activated CAR-T cells, wherein the activated CAR-T cells express one or more cell surface marker(s) of stem memory T cells (T _SCM ), thereby generating CAR-expressing stem memory T cells (T _SCM ) ( Provides a method including the step of producing CAR-T _SCM ). The present invention is a method of producing a plurality of modified stem memory T cells (T _SCM ), comprising: (a) introducing a composition comprising a chimeric antigen receptor (CAR) into a plurality of primary human T cells to produce a plurality of CAR-T cells; producing cells, and (b) a T cell activator composition comprising one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement, and contacting a plurality of CAR-T cells to produce a plurality of activated CAR-T cells, at least 2%, 5%, 10%, 15%, 20%, 25% of the plurality of activated CAR-T cells; Stem 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or any percentage in between. A method is provided comprising producing a plurality of activated CAR stem memory T cells (T _SCM ) by expressing one or more cell surface marker(s) of memory T cells (T _SCM ). In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 25% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 50% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 60% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 75% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 80% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 85% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 90% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, the method produces a plurality of activated CAR-T cells, wherein at least 95% of the plurality of activated CAR-T cells display one or more cell surface marker(s) of stem memory T cells (T _SCM ). By expressing, a large number of activated CAR stem memory T cells (T _SCM ) are produced. In certain embodiments, cell surface markers of activated CAR T _SCM include CD62L and CD45RA. In certain embodiments, the cell surface marker of the activated CAR-T _SCM includes one or more of CD62L, CD45RA, CD28, CCR7, CD127, CD45RO, CD95, CD95, and IL-2R. In certain embodiments, the cell surface marker of the activated CAR T _SCM includes one or more of CD45RA, CD95, IL-2Rβ, CR7, and CD62L.

In certain embodiments of the methods of the invention, the plurality of expanded CAR-T cells comprise naïve T cells (CAR-T _N ) and the cell surface marker of the CAR-T _N includes one or more of CD45RA, CCR7, and CD62L. do. In certain embodiments, the plurality of expanded CAR-T cells comprise central memory T cells (modified T _CM ) and the cell surface marker of the CAR-T _CM is one or more of CD45RO, CD95, IL-2Rβ, CCR7, and CD62L. Includes. In certain embodiments, the plurality of expanded CAR-T cells comprise effector memory T cells (modified TE _EMs ) and the cell surface markers of the CAR-T _EMs include one or more of CD45RO, CD95, and IL-2Rβ. In certain embodiments, the plurality of expanded CAR-T cells comprise effector T cells (modified T _EFF ) and the cell surface marker of the CAR-T _EFF includes one or more of CD45RA, CD95, and IL-2Rβ.

In certain embodiments of the methods of the invention, the transposon comprises a chimeric antigen receptor (CAR) of the invention. The transposon may be a plasmid DNA transposon having a sequence encoding a CAR flanked by two cis regulatory sequestering elements. In certain preferred embodiments, the transposon is a piggyback transposon. In certain embodiments, introducing a composition comprising a chimeric antigen receptor (CAR) of the invention may further comprise a composition comprising an mRNA sequence encoding a transposase. In certain preferred embodiments, the transposase is a Super Piggyback™ (SPB) transposase.

In certain embodiments, transposons of the invention may further comprise a selection gene. When the transposon of the present invention includes a selection gene, the T cell proliferation composition of the method of the present invention may further include a selection agent that simultaneously selects and proliferates the activated or modified T cells of the present invention.

In certain embodiments, the CAR of the invention may be CARTyrin. In certain embodiments, the CAR comprises one or more VHH sequence(s). In certain embodiments, CAR is VCAR.

In certain embodiments of the methods of producing modified T _SCMs of the invention, the introduction step may include electroporation or nucleofection. If the introduction step includes nucleofection, nucleofection may include (a) contacting the composition comprising the transposon composition, the transposase composition, and a plurality of primary human T cells in a cuvette; (b) applying one or more electrical pulses to the cuvette, and (c) one or more of human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, Icecove's MDM, and proliferation supplement. Incubating a composition comprising a plurality of primary human T cells at 37°C in a composition comprising a T cell proliferation composition. In certain embodiments, the T cell proliferation composition comprises octanoic acid, nicotinamide, 2,4,7,9-tetramethyl-5-decyne-4,7-diol (TMDD), diisopropyl adipate (DIPA), n -Add one or more of butyl-benzenesulfonamide, 1,2-benzenedicarboxylic acid, bis(2-methylpropyl) ester, palmitic acid, linoleic acid, oleic acid, stearic acid hydrazide, oleamide, sterol, and alkane. Included as. In certain embodiments, the T cell proliferation composition includes one or more of octanoic acid, palmitic acid, linoleic acid, oleic acid, and sterols (e.g., cholesterol). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 0.9 mg/kg to 90 mg/kg including endpoint; Palmitic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Linoleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Oleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; and sterols at a concentration of about 0.1 mg/kg to 10 mg/kg inclusive, where mg/kg = parts per million. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 9 mg/kg, palmitic acid at a concentration of about 2 mg/kg, linoleic acid at a concentration of about 2 mg/kg, oleic acid at a concentration of about 2 mg/kg, and Contains one or more of the sterols at a concentration of 1 mg/kg (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 9.19 mg/kg, palmitic acid at a concentration of 1.86 mg/kg, linoleic acid at a concentration of about 2.12 mg/kg, oleic acid at a concentration of about 2.13 mg/kg, and oleic acid at a concentration of about 1.01 mg/kg. Contains one or more of the sterols at a concentration of mg/kg (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 9.19 mg/kg, palmitic acid at a concentration of 1.86 mg/kg, linoleic acid at a concentration of 2.12 mg/kg, oleic acid at a concentration of about 2.13 mg/kg, and 1.01 mg/kg. Contains sterols in kg concentration (where mg/kg = parts per million). In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of 6.4 μmol/kg to 640 μmol/kg including endpoint; Palmitic acid at a concentration of 0.7 μmol/kg to 70 μmol/kg including end point; Linoleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including end point; Oleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including end point; and one or more of the sterols at a concentration between 0.25 μmol/kg and 25 μmol/kg inclusive. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 64 μmol/kg, palmitic acid at a concentration of about 7 μmol/kg, linoleic acid at a concentration of about 7.5 μmol/kg, oleic acid at a concentration of about 7.5 μmol/kg, and about Contains one or more of the sterols at a concentration of 2.5 μmol/kg. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 63.75 μmol/kg, palmitic acid at a concentration of about 7.27 μmol/kg, linoleic acid at a concentration of about 7.57 μmol/kg, oleic acid at a concentration of about 7.56 μmol/kg, and about Contains one or more of the sterols at a concentration of 2.61 μmol/kg. In certain embodiments, the T cell proliferation composition comprises octanoic acid at a concentration of about 63.75 μmol/kg, palmitic acid at a concentration of about 7.27 μmol/kg, linoleic acid at a concentration of about 7.57 μmol/kg, oleic acid at a concentration of about 7.56 μmol/kg, and 2.61 μmol/kg. Contains sterols at a concentration of /kg. In certain embodiments of nucleofection, the transposon composition is a 0.5 μg/μl solution containing nuclease-free water, and the cuvette contains 2 μl of the transposon composition to produce 1 μg of transposon. The transposon composition may include a piggyback transposon. The transposon composition may include Sleeping Beauty transposon. In certain embodiments of nucleofection, the transposase composition comprises 5 μg of transposase. The transposase composition may include a hyperactive Piggyback™ or Super Piggyback™ (SPB) transposase. The transposase composition may include a hyperactive Sleeping Beauty (SB100X) transposase. In certain embodiments, the transposon may include a hellraiser transposon and the transposase composition may include a helitron transposase. In certain embodiments, the transposon may comprise a Tol2 transposon and the transposase composition comprises a Tol2 transposase.

In certain embodiments of the methods of the invention, including embodiments where the introduction step comprises nucleofection or electroporation, nucleofection comprises the first transposon composition and the first transposase composition and the plurality of primary humans in a cuvette. It includes contacting T cells. In certain embodiments of the methods of the invention, including embodiments where the introduction step comprises nucleofection or electroporation, nucleofection comprises the first transposon composition, the second transposon composition, the first transposase composition, and and contacting the composition comprising a plurality of primary human T cells. In certain embodiments of the methods of the invention, including embodiments where the introduction step comprises nucleofection or electroporation, nucleofection comprises in a cuvette the first transposon composition, the second transposon composition, the first transposase composition, and contacting a second transposase composition and a plurality of primary human T cells. In certain embodiments, the first transposon comprises a sequence encoding an antigen receptor. In certain embodiments, the second transposon comprises a sequence that encodes a therapeutic protein. In certain embodiments, the first and second transposon compositions are the same. In certain embodiments, the first and second transposon compositions are not the same. In certain embodiments, the first transposase mobilizes the first transposon composition and the second transposon composition. In certain embodiments, the first transposase mobilizes the first transposon composition but does not mobilize the second transposon composition. In certain embodiments, the second transposase mobilizes the second transposon composition but does not mobilize the first transposon composition. In certain embodiments, the first transposase recruits a first transposon composition and the second transposase recruits a second transposon composition. In certain embodiments, the first or second transposon composition comprises a sequence encoding an antigen receptor. In certain embodiments, the first or second transposon composition comprises a sequence encoding a therapeutic protein. In certain embodiments, the first transposon composition comprises a sequence encoding an antigen receptor and the second transposon composition comprises a sequence encoding a therapeutic protein. In certain embodiments, the therapeutic protein is a secreted or secretable protein. In certain embodiments of the methods of the invention, including embodiments where the introduction step comprises nucleofection or electroporation, nucleofection comprises the transposon composition, the first transposase composition, the second transposase composition, and and contacting the composition comprising a plurality of primary human T cells. In certain embodiments, the transposon composition comprises a sequence encoding an antigen receptor. In certain embodiments, the transposon composition includes a sequence encoding a therapeutic protein. In certain embodiments of the methods of the invention, including embodiments where the introduction step comprises nucleofection or electroporation, nucleofection involves introducing a composition capable of inducing homologous recombination at a specific region of the genome in a cuvette into a plurality of 1 It further comprises contacting the composition with primary human T cells. In certain embodiments, compositions capable of inducing homologous recombination include an exogenous donor molecule. In certain embodiments, the exogenous donor molecule comprises a sequence encoding an antigen receptor and the transposon comprises a sequence encoding a therapeutic protein. In certain embodiments, the exogenous donor molecule comprises a sequence encoding a therapeutic protein and the transposon comprises a sequence encoding an antigen receptor. In certain embodiments, a composition comprising a transposon, a composition comprising a transposase, and a composition capable of inducing homologous recombination at specific sites in the genome are simultaneously contacted with a composition comprising a plurality of primary human T cells. In certain embodiments, a composition comprising a transposon and a composition comprising a transposase are first contacted with a composition comprising a plurality of primary human T cells, and the composition capable of inducing homologous recombination at a specific region of the genome is first contacted with the composition comprising a plurality of primary human T cells. is contacted a second time with a composition comprising primary human T cells. In certain embodiments, a composition capable of inducing homologous recombination at a specific region of the genome is first contacted with a composition comprising a plurality of primary human T cells, and the composition comprising the transposon and the composition comprising the transposase are first contacted with the composition comprising the plurality of primary human T cells. A second contact is made with primary human T cells. In certain embodiments of the methods of producing modified T _SCMs of the invention, the composition comprising primary human T cells comprises a buffer that maintains or enhances cell viability and/or stem-like phenotype of the primary human T cells. do. In certain embodiments, the buffer maintains or enhances cell viability and/or stem-like phenotype of primary human T cells prior to nucleofection. In certain embodiments, the buffer maintains or enhances cell viability and/or stem-like phenotype of primary human T cells during nucleofection. In certain embodiments, the buffer maintains or enhances cell viability and/or stem-like phenotype of primary human T cells following nucleofection. In certain embodiments, the buffer includes P3 primary cell solution (Lonza). In certain embodiments, the buffer comprises one or more of KCl, MgCl ₂ , ClNa, glucose, and Ca(NO ₃ ) ₂ in any absolute or relative abundance or concentration, and optionally the buffer includes HEPES, Tris, / It further comprises a supplement selected from the group consisting of HCl and phosphate buffer. In certain embodiments, the buffer contains 5mM KCl, 15mM _MgCl2 , 90mMClNa, 10mMglucose, and 0.4mM Ca( _NO3 ) ₂ . In certain embodiments, the buffer comprises 5mM KCl, 15mM _MgCl2 , 90mM ClNa, 10mM glucose and 0.4mM Ca( _NO3 ) ₂ , and supplements comprising 20mM HEPES and 75mM Tris/HCl. do. In certain embodiments, the _buffer comprises 5mM KCl, 15mM _MgCl2 , 90mMClNa, 10mMglucose, _and 0.4mMCa( _NO3 ) ₂ , and _40mMNa2HPO4 / _{NaH2PO4atpH7.2} . Includes supplements that: In certain embodiments, the composition comprising primary human T cells comprises 100 μl of buffer and 5×10 ⁶ to 25×10 ⁶ cells.

In certain embodiments of the methods of producing modified T _SCMs of the invention, cells expressing CD14, CD56, and/or CD19 are removed from the composition comprising primary human T cells. In certain embodiments, the composition comprising primary human T cells comprises 100 μl of buffer and 5×10 ⁶ to 25×10 ⁶ cells.

As used herein, the term “supplemented T cell proliferation composition” or “T cell proliferation composition” refers to a mixture of human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, Icecove's MDM, and proliferation supplements at 37°C. Can be used interchangeably with media containing one or more of the following. Alternatively, or additionally, the terms “supplemented T cell proliferation composition” or “T cell proliferation composition” are interchangeable with media comprising one or more of phosphorus, octane fatty acid, palmitic fatty acid, linoleic fatty acid, and oleic acid. It can be used as In certain embodiments, the medium is, for example, Icove's Modified Dulbecco's Medium (IMDM); (available from ThermoFisher Scientific under catalog number 12440053).

As used herein, the term “supplemented T cell proliferation composition” or “T cell proliferation composition” refers to a mixture of human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, Icecove's MDM, and proliferation supplements at 37°C. Can be used interchangeably with media containing one or more of the following. Alternatively, or additionally, the terms “supplemented T cell proliferation composition” or “T cell proliferation composition” may be used interchangeably with a medium containing one or more of the following elements: boron, sodium, magnesium, phosphorus. , potassium, and calcium. In certain embodiments, the terms “supplemented T cell proliferation composition” or “T cell proliferation composition” may be used interchangeably with medium comprising one or more of the following elements present at a corresponding average concentration: 3.7 mg/L of boron, 3000 mg/L sodium, 18 mg/L magnesium, 29 mg/L phosphorus, 15 mg/L potassium and 4 mg/L calcium.

As used herein, the term “supplemented T cell proliferation composition” or “T cell proliferation composition” refers to a mixture of human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, Icecove's MDM, and proliferation supplements at 37°C. Can be used interchangeably with media containing one or more of the following. Alternatively, or additionally, the terms “supplemented T cell proliferation composition” or “T cell proliferation composition” may be used interchangeably with a medium comprising one or more of the following components: Octanoic acid (CAS No. 124 -07-2), nicotinamide (CAS No. 98-92-0), 2,4,7,9-tetramethyl-5-decyne-4,7-diol (TMDD) (CAS No. 126-86- 3), diisopropyl adipate (DIPA) (CAS No. 6938-94-9), n-butyl-benzenesulfonamide (CAS No. 3622-84-2), 1,2-benzenedicarboxylic acid, Bis(2-methylpropyl) ester (CAS No. 84-69-5), palmitic acid (CAS No. 57-10-3), linoleic acid (CAS No. 60-33-3), oleic acid (CAS No. 112-80-1), stearic acid hydrazide (CAS No. 4130-54-5), oleamide (CAS No. 3322-62-1), sterols (e.g. cholesterol) (CAS No. 57-88) -5), and alkanes (e.g. nonadecane) (CAS No. 629-92-5). In certain embodiments, the terms “supplemented T cell proliferation composition” or “T cell proliferation composition” may be used interchangeably with medium comprising one or more of the corresponding components: octanoic acid (CAS No. 124-07 -2), nicotinamide (CAS No. 98-92-0), 2,4,7,9-tetramethyl-5-decyne-4,7-diol (TMDD) (CAS No. 126-86-3) , diisopropyl adipate (DIPA) (CAS No. 6938-94-9), n-butyl-benzenesulfonamide (CAS No. 3622-84-2), 1,2-benzenedicarboxylic acid, bis( 2-methylpropyl) ester (CAS No. 84-69-5), palmitic acid (CAS No. 57-10-3), linoleic acid (CAS No. 60-33-3), oleic acid (CAS No. 112- 80-1), stearic acid hydrazide (CAS No. 4130-54-5), oleamide (CAS No. 3322-62-1), sterols (e.g. cholesterol) (CAS No. 57-88-5) ), alkanes (e.g., nonadecane) (CAS No. 629-92-5), and phenol red (CAS No. 143-74-8). In certain embodiments, the terms “supplemented T cell proliferation composition” or “T cell proliferation composition” may be used interchangeably with a medium comprising one or more of the following components: Octanoic acid (CAS No. 124-07-2 ), nicotinamide (CAS No. 98-92-0), 2,4,7,9-tetramethyl-5-decyne-4,7-diol (TMDD) (CAS No. 126-86-3), di Isopropyl adipate (DIPA) (CAS No. 6938-94-9), n-butyl-benzenesulfonamide (CAS No. 3622-84-2), 1,2-benzenedicarboxylic acid, bis(2- Methylpropyl) ester (CAS No. 84-69-5), palmitic acid (CAS No. 57-10-3), linoleic acid (CAS No. 60-33-3), oleic acid (CAS No. 112-80- 1), stearic acid hydrazide (CAS No. 4130-54-5), oleamide (CAS No. 3322-62-1), phenol red (CAS No. 143-74-8) and lanolin alcohol.

As used herein, the term “supplemented T cell proliferation composition” or “T cell proliferation composition” refers to a mixture of human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, Icecove's MDM, and proliferation supplements at 37°C. Can be used interchangeably with media containing one or more of the following. Alternatively, or additionally, the terms “supplemented T cell proliferation composition” or “T cell proliferation composition” may be used interchangeably with medium containing one or more of the following ions: sodium, ammonium, potassium, magnesium. , calcium, chloride, sulfuric acid and phosphoric acid.

As used herein, the term “supplemented T cell proliferation composition” or “T cell proliferation composition” refers to a mixture of human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, Icecove's MDM, and proliferation supplements at 37°C. Can be used interchangeably with media containing one or more of the following. Alternatively, or additionally, the terms “supplemented T cell proliferation composition” or “T cell proliferation composition” may be used interchangeably with medium comprising one or more of the following free amino acids: histidine, asparagine, serine, Glutamate, arginine, glycine, aspartic acid, glutamic acid, threonine, alanine, proline, cysteine, lysine, tyrosine, methionine, valine, isoleucine, leucine, phenylalanine and tryptophan. In certain embodiments, the terms “supplemented T cell proliferation composition” or “T cell proliferation composition” may be used interchangeably with media comprising a corresponding average molar percent of one or more of the following free amino acids: histidine (about 1 %), asparagine (about 0.5%), serine (about 1.5%), glutamine (about 67%), arginine (about 1.5%), glycine (about 1.5%), aspartic acid (about 1%), glutamic acid (about 2%) %), threonine (about 2%), alanine (about 1%), proline (about 1.5%), cysteine (about 1.5%), lysine (about 3%), tyrosine (about 1.5%), methionine (about 1%) ), valine (about 3.5%), isoleucine (about 3%), leucine (about 3.5%), phenylalanine (about 1.5%) and tryptophan (about 0.5%). In certain embodiments, the terms “supplemented T cell proliferation composition” or “T cell proliferation composition” may be used interchangeably with medium comprising a corresponding average mole percent of one or more of the following free amino acids: histidine (about 0.78 %), asparagine (about 0.4%), serine (about 1.6%), glutamine (about 67.01%), arginine (about 1.67%), glycine (about 1.72%), aspartic acid (about 1.00%), glutamic acid (about 1.93%) %), threonine (approx. 2,38%), alanine (approx. 1.11%), proline (approx. 1.49%), cysteine (approx. 1.65%), lysine (approx. 2.84%), tyrosine (approx. 1.62%), methionine (approx. 0.85%), valine (about 3.45%), isoleucine (about 3.14%), leucine (about 3.3%), phenylalanine (about 1.64%) and tryptophan (about 0.37%).

As used herein, the terms “supplemented T cell proliferation composition” or “T cell proliferation composition” are interchangeable with media comprising one or more of octanoic acid, palmitic acid, linoleic acid, oleic acid, and sterols (e.g., cholesterol). It can be used as In certain embodiments, the terms “supplemented T cell proliferation composition” or “T cell proliferation composition” may be used interchangeably with a medium comprising one or more of the following; Octanoic acid at a concentration of 0.9 mg/kg to 90 mg/kg including end point; Palmitic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Linoleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; Oleic acid at a concentration of 0.2 mg/kg to 20 mg/kg including end point; and sterols at a concentration of about 0.1 mg/kg to 10 mg/kg inclusive, where mg/kg = parts per million. In certain embodiments, the terms “supplemented T cell proliferation composition” or “T cell proliferation composition” may be used interchangeably with a medium comprising one or more of the following: octanoic acid at a concentration of about 9 mg/kg, about 2 Palmitic acid at a concentration of mg/kg, linoleic acid at a concentration of about 2 mg/kg, oleic acid at a concentration of about 2 mg/kg and sterols at a concentration of about 1 mg/kg, where mg/kg = parts per million. In certain embodiments, the terms “supplemented T cell proliferation composition” or “T cell proliferation composition” may be used interchangeably with a medium comprising one or more of the following: octanoic acid at a concentration of 9.19 mg/kg, 1.86 mg/kg palmitic acid at a concentration of about 2.12 mg/kg, linoleic acid at a concentration of about 2.12 mg/kg, oleic acid at a concentration of about 2.13 mg/kg and sterols at a concentration of about 1.01 mg/kg, where mg/kg = parts per million. In certain embodiments, the terms “supplemented T cell proliferation composition” or “T cell proliferation composition” may be used interchangeably with a medium comprising one or more of the following: octanoic acid at a concentration of 9.19 mg/kg, 1.86 mg/kg kg concentration of palmitic acid, linoleic acid at a concentration of 2.12 mg/kg, oleic acid at a concentration of about 2.13 mg/kg and sterols at a concentration of 1.01 mg/kg (where mg/kg = parts per million). In certain embodiments, the terms “supplemented T cell proliferation composition” or “T cell proliferation composition” may be used interchangeably with a medium comprising one or more of the following: 6.4 μmol/kg to 640 μmol/kg including the endpoint. octanoic acid in kg concentration; Palmitic acid at a concentration of 0.7 μmol/kg to 70 μmol/kg including end point; Linoleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including end point; Oleic acid at a concentration of 0.75 μmol/kg to 75 μmol/kg including end point; and sterols at a concentration of 0.25 μmol/kg to 25 μmol/kg inclusive. In certain embodiments, the terms “supplemented T cell proliferation composition” or “T cell proliferation composition” may be used interchangeably with a medium comprising one or more of the following: octanoic acid at a concentration of about 64 μmol/kg, about 7 Palmitic acid at a concentration of μmol/kg, linoleic acid at a concentration of about 7.5 μmol/kg, oleic acid at a concentration of about 7.5 μmol/kg, and sterols at a concentration of about 2.5 μmol/kg. In certain embodiments, the terms “supplemented T cell proliferation composition” or “T cell proliferation composition” may be used interchangeably with a medium comprising one or more of the following: octanoic acid at a concentration of about 63.75 μmol/kg, about 7.27 Palmitic acid at a concentration of μmol/kg, linoleic acid at a concentration of about 7.57 μmol/kg, oleic acid at a concentration of about 7.56 μmol/kg, and sterols at a concentration of about 2.61 μmol/kg. In certain embodiments, the terms “supplemented T cell proliferation composition” or “T cell proliferation composition” may be used interchangeably with a medium comprising one or more of the following: octanoic acid at a concentration of about 63.75 μmol/kg, about 7.27 Palmitic acid at a concentration of μmol/kg, linoleic acid at a concentration of approximately 7.57 μmol/kg, oleic acid at a concentration of 7.56 μmol/kg, and sterols at a concentration of 2.61 μmol/kg.

As used herein, the term “P3 buffer” includes one or more of KCl, MgCl ₂ , ClNa, glucose and Ca(NO ₃ ) ₂ in any absolute or relative abundance or concentration, and optionally HEPES, Tris/HCl. and a buffer solution further comprising a supplement selected from the group consisting of phosphate buffer solution. The term “P3 buffer” includes 5mM KCl, 15mM MgCl ₂ , 90mM ClNa, 10mM glucose and 0.4mM Ca(NO ₃ ) ₂ and optionally from the group consisting of HEPES, Tris/HCl and phosphate buffer. Can be used interchangeably with buffer solutions that additionally contain selected supplements. The term “P3 buffer” refers to 5mM KCl, 15mM _MgCl2 , 90mM ClNa, 10mM glucose and 0.4mM Ca( _NO3 ) ₂ , and supplements containing 20mM HEPES and 75mM Tris/HCl. Can be used interchangeably with buffer solutions. The term “P3 _buffer ” refers to a supplement containing 5mM KCl, 15mM _MgCl2 , 90mM ClNa, 10mM glucose, 0.4mM Ca( _NO3 ) ₂ , and _{40mM Na2HPO4} / _NaH2PO4 at pH 7.2. It can be used interchangeably with buffer solutions containing water.

As used herein, the term “supplemented RPMI-1640 medium” or “T-cell conditioned media (TCCM)” refers to water, fetal bovine serum, HEPES, sodium pyruvate, one or more non-essential amino acids, and phenol red indicator. , calcium nitrate, magnesium sulfate, potassium chloride, sodium bicarbonate, sodium chloride, dibasic sodium phosphate (anhydrous), L-alanyl-L-glutamine, L-arginine, L-asparagine (anhydrous), L-aspartic acid, L-cysteine 2HCl, L-glutamic acid, glycine, L-histidine, hydroxy-L-proline, L-isoleucine, L-leucine, L-lysine HCl, L-methionine, L-phenylalanine, L-proline, L-serine, L- Threonine, L-tryptophan, L-tyrosine 2Na 2H ₂ O, L-valine, D-biotin, choline chloride, folic acid, myo-inositol, niacinamide, p-aminobenzoic acid, D-pantothenic acid (hemicalcium), pyridoxine HCl, Can be used interchangeably with media containing one or more of riboflavin, thiamine HCl, vitamin B12, D-glucose, glutathione (reduced), L-glutamine and 2-mercaptoethanol in any absolute or relative abundance or concentration. . The term “supplemented RPMI-1640 medium” or “T cell conditioned medium (TCCM)” means water, fetal bovine serum, HEPES, sodium pyruvate, one or more non-essential amino acids, phenol red indicator, calcium nitrate, magnesium sulfate, potassium chloride, bicarbonate. Sodium, sodium chloride, dibasic sodium phosphate (anhydrous), L-alanyl-L-glutamine, L-arginine, L-asparagine (anhydrous), L-aspartic acid, L-cysteine 2HCl, L-glutamic acid, glycine, L- Histidine, hydroxy-L-proline, L-isoleucine, L-leucine, L-lysine HCl, L-methionine, L-phenylalanine, L-proline, L-serine, L-threonine, L-tryptophan, L-tyrosine 2Na 2H ₂ O, L-valine, D-biotin, choline chloride, folic acid, myo-inositol, niacinamide, p-aminobenzoic acid, D-pantothenic acid (hemicalcium), pyridoxine HCl, riboflavin, thiamine HCl, vitamin B12, D- Can be used interchangeably with media containing glucose, glutathione (reduced), L-glutamine and 2-mercaptoethanol in any absolute or relative abundance or concentration.

As used herein, the term “supplemented AIM-V” or “supplemented AIMV” medium includes water, human serum albumin, streptomycin sulfate, gentamicin, fetal bovine serum, HEPES, sodium pyruvate, one or more non-essential amino acids, and phenol red. Indicator, calcium nitrate, magnesium sulfate, potassium chloride, sodium bicarbonate, sodium chloride, dibasic sodium phosphate (anhydrous), L-alanyl-L-glutamine, L-arginine, L-asparagine (anhydrous), L-aspartic acid, L- Cysteine 2HCl, L-glutamic acid, glycine, L-histidine, hydroxy-L-proline, L-isoleucine, L-leucine, L-lysine HCl, L-methionine, L-phenylalanine, L-proline, L-serine, L -Threonine, L-tryptophan, L-tyrosine 2Na 2H ₂ O, L-valine, D-biotin, choline chloride, folic acid, myo-inositol, niacinamide, p-aminobenzoic acid, D-pantothenic acid (hemicalcium), pyridoxine HCl. , riboflavin, thiamine HCl, vitamin B12, D-glucose, glutathione (reduced), L-glutamine and 2-mercaptoethanol in any absolute or relative abundance or concentration. there is. The term “supplemented AIM-V” or “supplemented AIMV” medium means water, human serum albumin, streptomycin sulfate, gentamicin, fetal bovine serum, HEPES, sodium pyruvate, one or more non-essential amino acids, phenol red indicator, calcium nitrate. , Magnesium sulfate, potassium chloride, sodium bicarbonate, sodium chloride, sodium phosphate dibasic (anhydrous), L-alanyl-L-glutamine, L-arginine, L-asparagine (anhydrous), L-aspartic acid, L-cysteine 2HCl, L -Glutamic acid, glycine, L-histidine, hydroxy-L-proline, L-isoleucine, L-leucine, L-lysine HCl, L-methionine, L-phenylalanine, L-proline, L-serine, L-threonine, L -Tryptophan, L-tyrosine 2Na 2H ₂ O, L-valine, D-biotin, choline chloride, folic acid, myo-inositol, niacinamide, p-aminobenzoic acid, D-pantothenic acid (hemicalcium), pyridoxine HCl, riboflavin, thiamine Can be used interchangeably with media comprising HCl, vitamin B12, D-glucose, glutathione (reduced), L-glutamine and 2-mercaptoethanol in any absolute or relative abundance or concentration.

As used herein, the term “ImmunoCult™ medium” refers to human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, L-glutamine, phenol red, glycine, L-alanine, L-arginine hydrochloride. Chloride, L-asparagine, L-aspartic acid, L-cysteine 2HCl, L-glutamic acid, L-glutamine, L-histidine hydrochloride H20, L-isoleucine, L-leucine, L-lysine hydrochloride, L-methionine, L -Phenylalanine, L-proline, L-serine, L-threonine, L-tryptophan, L-tyrosine disodium salt, L-valine, biotin, choline chloride, D-calcium pantothenate, folic acid, niacinamide, pyridoxal hydrochloride. Chloride, riboflavin, thiamine hydrochloride, vitamin B12, i-inositol, calcium chloride (anhydrous), magnesium sulfate (anhydrous), potassium chloride, potassium nitrate, sodium bicarbonate, sodium chloride, sodium phosphate monobasic, sodium selenate, D-glucose, Can be used interchangeably with media comprising one or more of HEPES and sodium pyruvate in any absolute or relative abundance or concentration. The term “Immunocult™ medium” refers to water, human serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, L-glutamine, phenol red, glycine, L-alanine, L-arginine hydrochloride, L-asparagine. , L-aspartic acid, L-cysteine 2HCl, L-glutamic acid, L-glutamine, L-histidine hydrochloride H20, L-isoleucine, L-leucine, L-lysine hydrochloride, L-methionine, L-phenylalanine, L- Proline, L-serine, L-threonine, L-tryptophan, L-tyrosine disodium salt, L-valine, biotin, choline chloride, D-calcium pantothenate, folic acid, niacinamide, pyridoxal hydrochloride, riboflavin, thiamine. Hydrochloride, vitamin B12, i-inositol, calcium chloride (anhydrous), magnesium sulfate (anhydrous), potassium chloride, potassium nitrate, sodium bicarbonate, sodium chloride, sodium phosphate monobasic, sodium selenite, D-glucose, HEPES and sodium pyruvate. Can be used interchangeably with media comprising any absolute or relative abundance or concentration.

The modified T cells herein comprising the modified T _SCM and/or T _CM herein may be incubated, cultured, grown, stored at any step of the method of the procedure using a growth medium comprising one or more inhibitors of PI3K pathway components. It can be combined or combined in some other way. Exemplary inhibitors of PI3K _pathway components include, but _are not limited to, inhibitors of _GSK3β , such as TWS119 (also known as _GSK 3B inhibitor . Exemplary inhibitors of PI3K pathway components include, but are not limited to, bb007 (BLUEBIRDBIO™).

As used herein, the terms “electroporation” and “nucleofection” refer to an electric pulse that induces a cell membrane (cell membrane, nuclear membrane, or both) to become or become more permeable to the nucleic acid, transposon, vector, or composition of the present invention. is meant to describe alternative means of delivering a nucleic acid, transposon, vector or composition of the invention to a cell.

In certain embodiments of nucleofection, the method is performed simultaneously in more than one cuvette(s). In certain embodiments of nucleofection, the method is performed simultaneously in two cuvettes. In processes performed on a larger scale for clinical or commercial applications, for example, nucleofection can be performed in large-capacity cassettes with many procedures running simultaneously. In certain embodiments of nucleofection, the incubating step includes incubating a composition comprising a plurality of primary human T cells in a pre-warmed T cell proliferation composition. The incubation steps are at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, It may take a period of 24 hours or any number/fraction of hours in between. The incubation step may take a period of at least 1, 2, 3, 4, 5, 6 or 7 days or any number/part days in between. The incubation step may take at least one week. In certain embodiments of nucleofection, the incubation step takes a period of 2 days. In certain embodiments of nucleofection, the application steps include the following program(s) EI-115, EI-151, EI-156, EI-158, EG-115, EG-142, EG-151, ES-115, ES It may include applying one or more of -151, EO-151, EO-148, EO-156, EO-210, EO-213, and FI-156. In certain embodiments, the application steps include the following program(s) EI-115, EI-151, EI-156, EI-158, EG-115, EG-142, EG-151, ES-115, ES-151, EO One or more of -151, EO-148, EO-156, EO-210, EO-213, and FI-156, or an equal number of pulses with each pulse having the same duration and intensity, and periods between pulses that are substantially similar. and applying a program that provides pulses. In certain embodiments, the application step may be performed using a known electrochemical device including, but not limited to, Lonza Amaxa, MaxCyte technology, BTX PulseAgile, and BioRad GenePulser. It can be performed using a perforation/nucleofection device. In certain embodiments of nucleofection, the applying step may include applying at least one electrical pulse. In certain embodiments of nucleofection, the applying step may include applying to the composition of the invention at least one electrical pulse sufficient to induce the cell membrane and/or nuclear membrane of the cell to become permeable.

Although the amounts provided herein are illustrative and non-limiting, the relationships between these amounts (e.g., ratios or relative abundances) can be used to modify the methods illustrated herein for larger scale processing and manufacturing.

In certain embodiments of the methods of producing modified T cells (e.g., T _SCM and/or T _CM ) of the invention, the activating supplement comprises one or more cytokine(s). The one or more cytokine(s) may include any cytokine, including but not limited to lymphokines. Exemplary lymphokines include interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), and interleukin-6 (IL-6). , interleukin-7 (IL-7), interleukin-15 (IL-15), interleukin-21 (IL-21), granulocyte-macrophage colony-stimulating factor (GM-CSF), and interferon- Including, but not limited to, gamma (INFγ). One or more cytokine(s) may include IL-2.

In certain embodiments of the methods of producing modified T cells (e.g., T _SCM and/or T _CM ) of the invention, the proliferation supplement comprises one or more cytokine(s). The one or more cytokine(s) may include any cytokine, including but not limited to lymphokines. Exemplary lymphokines include interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), and interleukin-6 (IL-6). , interleukin-7 (IL-7), interleukin-15 (IL-15), interleukin-21 (IL-21), granulocyte-macrophage colony-stimulating factor (GM-CSF), and interferon-gamma (INFγ). Not limited. One or more cytokine(s) may include IL-2.

In certain embodiments of the methods of producing modified T cells (e.g., T _SCM and/or T _CM ) of the invention, the primary human T cells are naive T cells. Naive T cells can express CD45RA, CCR7, and CD62L. In certain embodiments, the method comprises at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, Applies to cell populations comprising naïve T cells of 75%, 80%, 85%, 90%, 95%, 99%, or any percentage in between. In certain embodiments, the production efficiency of the modified T _SCM and/or T _CM of the invention can be increased by increasing the proportion or percentage of naive T cells in the cell population to which the method of the invention is applied.

In certain embodiments of the methods of producing modified T _SCMs and/or T _CMs of the invention, the primary human T cells are memory T cells.

In certain embodiments of the methods for producing modified T _SCMs and/or T _CMs herein, the primary human T cells express one or more of CD62L, CD45RA, CD28, CCR7, CD127, CD45RO, CD95, CD95, and IL-2Rβ. It manifests.

In certain embodiments of the methods of producing modified T _SCMs and/or T _CMs of the invention, the primary human T cells are naïve T cells (modified T _N ) and the modified T _N is one of CD45RA, CCR7, and CD62L. manifests abnormalities. In certain embodiments of the methods of producing modified T _SCMs and/or T _CMs of the invention, the primary human T cells are modified T _SCM T memory stem cells (modified T _SCMs ) and the modified T _SCMs are CD45RA, Expresses one or more of CD95, IL-2Rβ, CR7, and CD62L. In certain embodiments of the methods of producing modified T _SCMs and/or T _CMs of the invention, the primary human T cells are central memory T cells (modified T _CMs ) and the modified T _CMs are CD45RO, CD95, IL- Expresses one or more of 2Rβ, CCR7, and CD62L. In certain embodiments of the methods of producing modified T _SCMs and/or T _CMs of the invention, the primary human T cells are effector memory T cells (modified T _EMs ) and the modified T _EMs are CD45RO, CD95 and IL- Expresses one or more of 2Rβ. In certain embodiments of the methods of producing modified T _SCMs and/or T _CMs of the invention, the primary human T cells are effector T cells (modified T _EFFs ) and the modified T _EFFs have CD45RA, CD95, and IL-2Rβ. Expresses one or more of the following:

In certain embodiments of the methods of producing modified T _SCMs and/or T _CMs of the invention, the primary human T cells can express CD4 and/or CD8. In certain embodiments, primary human T cells may express varying proportions of CD4 and/or CD8. In certain embodiments, primary human T cells may express varying proportions of CD4 and/or CD8 that do not naturally occur. In certain embodiments, primary human T cells expressing varying proportions of CD4 and/or CD8, which may not occur naturally, are a heterogeneous cell population.

In certain embodiments of the methods of generating modified T _SCMs and/or T _CMs of the invention, primary human T cells are derived from, for example, whole blood, peripheral blood, umbilical cord blood, lymphatic fluid, lymph node tissue, bone marrow, and cerebral spinal fluid (CSF). As used herein, the term "peripheral blood" refers to the cellular component of blood that is obtained or prepared from the circulating blood pool and is not sequestered within the lymphatic system, spleen, liver, or bone marrow (e.g. , red blood cells, white blood cells, and platelets). Cord blood is distinct from peripheral blood and blood sequestered within the lymphatic system, spleen, liver, or bone marrow. The terms "cord blood", "placental blood" or "umbilical cord blood" may be used interchangeably and refer to the blood that remains in the placenta and attached umbilical cord after birth. Umbilical cord blood often contains stem cells, including hematopoietic cells.

Primary human T cells of the present invention may include pan T cells. As used herein, pan T cells include all T lymphocytes isolated from a biological sample without classification by subtype, activation state, maturation state, or cell surface marker expression.

In certain embodiments of the methods of the invention, the methods further comprise introducing a composition or compositions comprising a genome editing construct into a modified T _SCM or T _CM cell. In certain embodiments, the genome editing construct comprises a guide RNA and a CRISPR (clustered regularly interspaced short palindromic repeat)-related protein 9 (Cas9) DNA endonuclease. In certain embodiments, the genome editing construct comprises a DNA binding domain and a type IIS endonuclease. In certain embodiments, the genome editing construct encodes a fusion protein. In certain embodiments, the genome editing construct encodes a DNA binding domain and a type IIS endonuclease, wherein the expressed DNA binding domain and the expressed type IIS endonuclease are non-covalently linked. In certain embodiments, including embodiments where the genome editing construct comprises a DNA binding domain and a type IIS endonuclease, the genome editing construct comprises a sequence derived from a Cas9 endonuclease. In certain embodiments, including embodiments where the genome editing construct comprises a DNA binding domain and a type IIS endonuclease, the sequence derived from the Cas9 endonuclease is the DNA binding domain. In certain embodiments, including embodiments where the sequence derived from the Cas9 endonuclease is a DNA binding domain, the sequence derived from the Cas9 endonuclease encodes an inactive Cas9. In certain embodiments, including embodiments where the sequence derived from the Cas9 endonuclease is a DNA binding domain, the sequence derived from the Cas9 endonuclease encodes truncated Cas9. In certain embodiments, the sequence derived from the Cas9 endonuclease includes an amino acid substitution at position 10 from aspartic acid (D) to alanine (A) (D10A). In certain embodiments, the sequence derived from the Cas9 endonuclease comprises or further comprises an amino acid substitution from histidine (H) to alanine (A) at position 840 (H840A). In certain embodiments, the sequence derived from the Cas9 endonuclease comprises inactivated Cas9 (dCas9) (SEQ ID NO: 33). In certain embodiments, the sequence derived from the Cas9 endonuclease includes an amino acid substitution (N580A) from asparagine (N) to alanine (A) at position 580. In certain embodiments, the sequence derived from the Cas9 endonuclease comprises truncated and inactivated Cas9 (dSaCas9) (SEQ ID NO: 32). In certain embodiments, including embodiments where the genome editing construct comprises a DNA binding domain and a type IIS endonuclease, the genome editing construct comprises a sequence derived from a transcription activator-like effector nuclease (TALEN). In certain embodiments, including embodiments where the genome editing construct comprises a DNA binding domain and a type IIS endonuclease, the sequence derived from a TALEN is a DNA binding domain. In certain embodiments, the genome editing construct includes TALENs. In certain embodiments, including embodiments where the genome editing construct comprises a DNA binding domain and a type IIS endonuclease, the genome editing construct comprises a sequence derived from a zinc finger nuclease (ZFN). In certain embodiments, including embodiments where the genome editing construct comprises a DNA binding domain and a type IIS endonuclease, the sequence derived from the ZFN is the DNA binding domain. In certain embodiments, the genome editing construct comprises a zinc finger nuclease (ZFN).

The methods of producing modified T _SCM and/or T _CM cells of the present invention can be optimized to produce larger numbers or greater proportions of modified T _SCM and/or T _CM cells. For example, a cell population that has undergone a method of the invention can be enriched to contain an increased number or greater proportion of naïve T cells. As the number and/or proportion of naive T cells in a T cell population that has undergone the method of the invention increases, the number and/or proportion of T _SCM and/or T _CM cells of the invention produced also increases. Alternatively, or additionally, the _number and/or _modified T Or the ratio increases. The length of time or period of time required for the method of the invention or the "period of manufacture" may also be referred to as the "out-of-life period" of the cells undergoing the method of the invention.

In certain embodiments of the methods of producing modified T cells of the invention, the primary human T cells express one or more of CD62L, CD45RA, CD28, CCR7, CD127, CD45RO, CD95, CD95, and IL-2Rβ. In certain embodiments, the primary human T cells are naive T cells (T _N ) and the T _N express one or more of one or more of CD45RA, CCR7, and CD62L. In certain embodiments, the primary human T cells are T memory stem cells (T _SCMs ) and the T _SCMs express one or more of CD45RA, CD95, IL-2Rβ, CR7, and CD62L. In certain embodiments, the primary human T cell is a central memory T cell (T _CM ) and the T _CM expresses one or more of CD45RO, CD95, IL-2Rβ, CCR7, and CD62L. In certain embodiments, the primary human T cells are effector memory T cells (TE _EMs ) and the TE _EMs express one or more of CD45RO, CD95, and IL-2Rβ. In certain embodiments, the primary human T cell is an effector T cell (T _EFF ) and the T _EFF expresses one or more of CD45RA, CD95, and IL-2Rβ. In certain embodiments, the primary human T cells express CD4 and/or CD8.

The present invention provides compositions comprising modified T _SCM produced by the method of the present invention. The present invention provides compositions comprising modified T _CM produced by the method of the present invention. The present invention provides modified T _SCM and compositions comprising modified T _CM produced by the method of the present invention. In certain embodiments of the modified T _SCM produced by the method of the present invention and the composition comprising the modified T _CM , the majority of the T _SCM represents at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97% , may include 98% or 99%. In certain embodiments of the modified T _SCM produced by the method of the present invention and the composition comprising the modified T _CM , the majority of the T _CM is at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97% , may include 98% or 99%.

The present invention provides the use of compositions comprising modified T _SCM and/or T _CM produced by the method of the present invention for the manufacture of a medicament for the treatment of a subject in need thereof. In certain embodiments of this use, the modified T _SCM and/or T _CM is autologous. In certain embodiments of this use, the modified T _SCM and/or T _CM are allogeneic. In certain embodiments, the antigen receptor is a T cell receptor. In certain embodiments, the T cell receptor is naturally occurring. In certain embodiments, the T cell receptor is not naturally occurring. In certain embodiments, particularly in embodiments in which the T cell receptor is not naturally occurring, the T cell receptor comprises one or more mutation(s) compared to the wild-type T cell receptor. In certain embodiments, particularly in embodiments where the T cell receptor is not naturally occurring, the T cell receptor is a recombinant T cell receptor. In certain embodiments, the antigen receptor is a chimeric antigen receptor (CAR). In certain embodiments, the CAR is CARTyrin. In certain embodiments, the CAR comprises one or more VHH sequence(s). In certain embodiments, CAR is VCAR.

The present invention provides a method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a composition comprising a modified T _SCM and/or T _CM produced by the method of the present invention. Provides a method including. In certain embodiments of the above methods, the modified T _SCM and/or T _CM are autologous. In certain embodiments of the above methods, the modified T _SCM and/or T _CM are allogeneic. In certain embodiments, the antigen receptor is a T cell receptor. In certain embodiments, the T cell receptor is naturally occurring. In certain embodiments, the T cell receptor is not naturally occurring. In certain embodiments, particularly in embodiments in which the T cell receptor is not naturally occurring, the T cell receptor comprises one or more mutation(s) compared to the wild-type T cell receptor. In certain embodiments, particularly in embodiments where the T cell receptor is not naturally occurring, the T cell receptor is a recombinant T cell receptor. In certain embodiments, the antigen receptor is a chimeric antigen receptor (CAR). In certain embodiments, the CAR is CARTyrin. In certain embodiments, the CAR comprises one or more VHH sequence(s). In certain embodiments, CAR is VCAR. In certain embodiments of the above methods, the disease or disorder is cancer and the antigen receptor specifically targets a cancer antigen. In certain embodiments of the above methods, the disease or disorder is an infectious disease or disorder and the antigen receptor specifically targets a viral, bacterial, yeast or microbial antigen. In certain embodiments, the disease or disorder is one caused by lack of activity or insufficient amount of a secreted protein. In certain embodiments, the disease or disorder is one that is treated by replacing the activity of a therapeutic protein or increasing the amount of a therapeutic protein. In certain embodiments, the therapeutic protein is a secreted protein. In certain embodiments, the secreted protein lacks activity or sufficient quantity within a localized region of the body. In certain embodiments, local regions of the body are accessible by natural T cells or modified T cells. In certain embodiments, modified T cells are produced in vivo, ex vivo, in vitro, or in situ.

Figure 1 is a series of plots showing the appearance of the CAR-T _SCM phenotype on day 11 of the method of Example 1. Cells were nucleofected with a surrogate CARTyrin plasmid. CAR-T _SCM cells express CD62L and CD45RA as shown in the two plots below.
Figure 2 is a series of plots showing the purity of CAR-T _SCM produced by the method of Example 1 at day 19. The CAR-T _SCM cell population produced by the method described in Example 1 on day 19 did not contain B cells or lymphocytes. Most of the cells are CD3+ T cells. Only 1.1% are natural killer cells and 1.7% are natural killer T cells.
Figure 3 is a plot showing that the majority of T cells express CARTyrin on day 11 of the method described in Example 1.
Figure 4 is a series of plots showing enrichment of the CAR-T _SCM phenotype at day 19 of the method described in Example 1. Cells were nucleofected with a surrogate CARTyrin plasmid. CAR-T _SCM cells express CD62L and CD45RA as shown in the two plots below.
Figure 5 is a series of plots showing no T cell depletion at day 19 of the method described in Example 1. At day 19, the cell population generated by this method does not express PD1, a marker for T cell activation and exhaustion. These cells expressing CARTyrin almost successfully reached the quiescent state after preparation. They do not otherwise show signs of antigen-independent (tonic) signaling that increases PD1 expression levels. Tonic signaling is hypothesized to be caused by some CAR molecules causing premature exhaustion and reduced efficacy of CAR T cell therapy.
Figure 6A shows T cells transduced with a plasmid containing sequences encoding an inducible caspase polypeptide (safety switch, "iC9"), CARTyrin (anti-BCMA), and a transposon containing sequences encoding a selectable marker. It is a series of plots that represent The left plot shows surviving T cells exposed to transposase in the absence of plasmid. The right plot shows surviving T cells exposed to transposase in the presence of plasmid. Cells were exposed to hyperactive transposase (“super piggyback”) or wild-type piggyback transposase.
Figure 6B is a series of plots showing T cells transduced with a plasmid containing a sequence encoding green fluorescent protein (GFP). The left plot shows surviving T cells exposed to transposase in the absence of plasmid. The right plot shows surviving T cells exposed to transposase in the presence of plasmid. Cells were exposed to hyperactive transposase (“super piggyback”) or wild-type piggyback transposase.
Figure 6C is a table showing the percentage of T cells transformed due to translocation to WT for hyperactive PiggyBac transposase. T cells contacted with hyperactive piggyback transposase (super piggyback transposase) were transformed at a rate four times greater than with WT transposase.
Figure 6D is a table showing the percentage of T cells transformed due to translocation to WT for hyperactive Piggyback transposase at 5 days after nucleofection. T cells contacted with hyperactive piggyback transposase (super piggyback transposase) were transformed at a much greater rate than with WT transposase.
Figure 7 is a graph showing the phenotypic differences between PiggyBac™ _- and lentivirus-produced CAR+ T cells. CAR+ T cells were produced using piggyback translocation or lentiviral transduction. Human pan T cells were transduced with piggybacks encoding CAR, stimulated with anti-CD3/CD28 beads 2 days after transposition, proliferated, and examined 19 days after transposition. For production using lentivirus, pan T cells were stimulated with CD3/CD28 beads, transduced with CAR-encoding lentivirus (MOI 5), proliferated, and examined at day 18 post-stimulation. Each population of CAR+ T cells was then characterized based on expression of standard memory markers CD62L, CD45RA, and CD95. The proportion (%) of each CAR+ T cell subset was defined as naïve (CD62L+CD45RA+), Tcm (CD62L+CD45RA-), Tem (CD62L-CD45RA-), and Teff (CD62L-CD45RA+). All CAR+ T cells were CD95+.
Figures 8A and 8B are a pair of graphs showing that Piggyback™ preferentially translocates naïve T cells. Human pan T cells were sorted into naive (CD62L+ CD45RA+), Tcm (CD62L+ CD45RA-), Tem (CD62L-CD45RA-), and Teff (CD62L-CD45RA+) subsets (using a BD FACSAria II flow cytometer). Sorted subsets were translocated with piggyback-GFP or transduced with lentivirus-GFP, respectively. In the former case, each sorted subset was transfected with piggyback-GFP, stimulated with anti-CD3/CD28 beads at day 2 post-implantation, proliferated, and examined at day 19 post-transplantation. In the latter case, sorted subsets were stimulated with CD3/CD28 beads, transduced with lentivirus encoding GFP (MOI 5), propagated, and examined at day 19 after stimulation. n = 3 donors.
Figure 9 is a pair of graphs showing that the PiggyBac™ manufacturing process produces high levels of T _SCM in samples from multiple myeloma (MM) patients even when naïve T cells are rare. T cells from MM patients (triangles) and healthy donors (circles) were characterized for memory marker expression by flow cytometry before (left) and after (right) the Poseida manufacturing process. Expression of CD45RA and CD62L was assessed by FACS and plotted for MM patients and healthy donors. It is known that T cells from MM patients generally have low frequencies of naive and T _SCM cells but high frequencies of Teff, unlike T cells from healthy normal donors, which are the opposite. Regardless of the naive contact and typing frequency of Tscm in different MM patients, P-BCMA-101 was produced using the Poseida manufacturing process to obtain a product that displayed high levels of CD8+ Tscm (E). This also applied to MM patients receiving active treatment (red triangle).
Figure 10 is a series of Fluorescence Activated Cell Sorting (FACs) plots characterizing T and T _SCM cell markers in human pan T cells transformed with the Sleeping Beauty (SB100x) translocation system and the methods of the invention. . The Sleeping Beauty (SB100x) potential produces predominantly the T _scm phenotype using the Poseida manufacturing process. As indicated, 1 μg each of Sleeping Beauty or Piggyback transposon plasmids and SB100x or SPB mRNA were used to transduce human pan T cells. After translocation, cells were grown in vitro and all non-translocated cells were removed using a drug selection system manufactured by Poseida. After 18 days of culture, cells were stained with phenotypic markers CD4, CD8, CD45RA, and CD62L. The stem cell memory phenotype (Tscm) is defined as CD45RA and CD62L double positive cells, accounting for >65% of cells in all samples. All panels in a column share common x- and y-axis parameters. In each row, from top to bottom, 2.5 micrograms (μg) of Sleeping Beauty transposon SB100x (top), 5 μg of SB100x (second from top), 10 μg of SB100x (third from top), 5 μg of Piggyback Transposon. Data from T cells transduced with zone P-BCMA-101 (second from bottom) and unstained control at bottom are shown. The x-axis, from left to right in the first and second columns, represents Forward Scatter (FSC) in units from 0 to 250,000 (1000 is abbreviated as "k") in increments of 50k. The x-axis in the third column from the left represents CD8 expression on a scale written from 0 to 10 ⁵ in increasing powers of 10. The last right column shows CD62L expression on a scale written from 0 to 10 ⁵ in increasing powers of 10. The y-axis in the first column represents Side Scatter (SSC) in units from 0 to 250k in increments of 50k. The y-axis in the second column from the left represents the expression of the cell viability marker 7-aminoactinomycin D (7AAD). is represented from 0 to 10 ⁵ increasing in powers of 10. The y-axis in the third column from the left represents the expression of the marker CD4, increasing in powers of 10 from 0 to 10 ^5. The y-axis in the right column represents the expression of the marker CD45RA. Expressions are expressed from 0 to 10 ⁵ increasing in powers of 10.
Figure 11 is a schematic diagram showing the human coagulation pathway leading to blood coagulation. For example, contact activation by endothelial injury activates the intrinsic coagulation pathway. Tissue factor activates the extrinsic coagulation pathway, for example after trauma. Both pathways meet in the conversion of prothrombin to thrombin, which catalyzes the conversion of fibrinogen to fibrin. Fibrin polymerized together with platelets forms a clot. Absence of factor IX (circle) causes coagulation defects. Factor VIII (FVIII) deficiency leads to the development of hemophilia A. Factor IX (FIX) deficiency leads to the development of hemophilia B. Hemophilia B is a rare disease that occurs in approximately 1 in 25,000 to 30,000 people. 60% of hemophilia B cases are severe. Less than 1% of hemophilia B patients have normal FIX levels. Prior to the compositions and methods of the present invention, standard treatment for hemophilia B involves infusions of recombinant Factor IX protein every 2 to 3 days at a cost of approximately $250,000 per year. In striking contrast to this standard treatment option, our T _SCM cells persist in humans for decades.
Figure 12 is a series of fluorescence activated cell sorting (FACS plots) showing FIX secreting T cells. T cells encoding the human factor IX transgene showed a T _SCM phenotype in approximately 80% of cells. The six panels are explained from left to right. (1) Forward scattering (FSC) on the x-axis versus side scattering (SSC) on the y-axis. The x-axis goes from 0 to 250,000 (1000 abbreviated as k) in increments of 50k, and the y-axis goes from 0 to 250k in increments of 50k. (2) FSC versus cell viability marker 7-aminoactinomycin D (7AAD) on the x-axis. The x-axis is plotted from 0 to 250k in increments of 50k. The y-axis is indicated as -10 ³ , 0, 10 ³ , 10 ⁴ , and 10 ⁵ from top to bottom. (3) On the x-axis, anti-CD56-APC (CDC56-APC-Cy7) conjugated to Cy7 dye is shown in units from 0 to 10 ⁵ increasing in powers of 10. On the y axis, anti-CD3 conjugated to phycoerythrin (PE) is shown in units from 0 to 10 ⁵ in increasing powers of 10. ⁽ 4) On the On the y axis, anti-CD4 conjugated to Brilliant Violet 650 dye (BV650) is shown in units from 0 to 10 ⁵ in increasing powers of 10. ( ⁵ ) On the On the y axis, anti-CD45RA antibodies conjugated to PE and Cy7 are shown in units from 0 to 10 ⁵ in increasing powers of 10. This panel is marked with a box. (6) On the x-axis, anti-CCR7 antibody conjugated to Brilliant Violet 786 (BV786) is shown in units from 0 to 10 ⁵ increasing in powers of 10. On the y axis, anti-CD45RA conjugated to PE and Cy7 is shown in units from 0 to 10 ⁵ in increasing powers of 10.
Figure 13A is a graph showing human factor IX secretion during production of modified T cells of the invention. The Y axis represents the Factor IX concentration in nanograms (ng) per milliliter (mL) from 0 to 80 in increments of 20. The x-axis shows T cells at days 9 and 12.
Figure 13B is a graph showing the coagulant activity of secreted human factor IX produced by T cells. The y-axis represents factor IX activity (%) against human plasma from 0 to 8 in increments of 2. The x-axis represents T cells on days 9 and 12.
Figures 14A-14E are a series of plasmid maps for site-specific integration into the AAVS1 site using HR or MMEJ and the corresponding sequences. A) site-specific (AAVS1) homologous recombination (HR), B) site-specific (AAVS1) microhomology-mediated end-joining (MMEJ) recombination, and C) TTAA-specific piggyback. ™ Donor plasmid for testing stable integration into the genome of human pan T cells via translocation. For the HR and MMEJ donor plasmids, the GFP-2A-DHFR gene expression cassette was flanked by homology arms for integration of the AAVS1 site and a CRISPR/Cas9 targeting site; For the Piggyback™ donor plasmid, the GFP-2A-DHFR gene expression cassette is flanked by Piggyback™ transposon elements. The homology arms for HR and MMEJ plasmids are 500 bp and 25 bp, respectively. Panels D, E, and F represent SEQ ID NOs: 41 and 42, respectively.
Figure 15 is a graph showing transgene (GFP) expression in primary human pan T cells 3 days after nucleofection. HR or MMEJ donor plasmids with or without CRISPR ribonucleotide (RNP) targeting reagent were simultaneously transferred to pan T cells via nucleofection. As a control, T cells that received only the donor plasmid were included. pan T cells were also transformed using the PiggyBac™ transposon delivery system. T cells were activated via TCR stimulation on day 0, and the percentage of GFP+ T cells was assessed by flow cytometry on day 3 after nucleofection, and the data are summarized in bar graphs.
Figure 16 is a graph showing transgene (GFP) expression and selection in primary human pan T cells 11 days after nucleofection. The DHFR selection gene encoded in the bi-cistronic GFP-2A-DHFR integration cassette was used to select activated T cells carrying the stably integrated transgene by adding methotrexate. Percent GFP+ T cells were determined by flow cytometry at day 11 after nucleofection and data are summarized in bar graphs. Selection highly enriched GFP+ cells in pan T cells receiving transposition reagent, RNP + HR, or MMEJ donor plasmids, but not in T cells receiving only the donor plasmid.
Figures 17A-17C are a series of graphs showing the phenotype of primary human pan T cells modified by HR and MMEJ at the AAVS1 site. The phenotype of GFP+ CD8+ pan T cells was analyzed by flow analysis at day 11 after nucleofection. A) Cells were stained with 7AAD (cell viability), CD4, CD8, CD45RA and CD62L, and FACS plot shows the gating strategy. CD45RA+CD62L+ (stem memory T cells (Tscm)), CD45RA-CD62L+ (central memory T cells (Tcm)), CD45RA-CD62L- (effector memory T cells (Tem)) and CD45RA+CD62L- (T effector T cells (Teff) ) CD8+ cell subsets were defined by the expression of ). B) The percentage of total GFP+ CD8+ T cells in each T cell subset is summarized in bar graphs. Enriched GFP+ Tscm populations were achieved in all cases using the Piggyback™ transposon system with Cas9 RNP, or HR and MMEJ. C) The total number of pan T cells is analyzed at day 13 after nucleofection and the data is summarized in bar graphs.
Figures 18A-18B are a pair of photographs of gel electrophoresis results showing site-specific integration into the AAVS1 site. Selected cells from each group were collected, genomic DNA was extracted, and used as a template for PCR to confirm site-specific integration into the AAVS1 site for A) HR and B) MMEJ. Two pairs of primers were individually directed to the 5'-end junction of the AAVS1 target site [one primer EF1a-2r CACCGGAGCCAATTCCCACT (SEQ ID NO: 36) priming the promoter region of the insert and the AAVS1 region beyond the 500 bp homology arm at the 5' end. obtained a 0.73 kb DNA fragment for both HR or MMEJ with another primer AAVS-3r CTGCACCACGTGATGTCCTC (SEQ ID NO: 37) priming the 3'-end junction [one primer SV40pA-1r GTAACCATTATAAGCTGCAATAAACAAG priming the poly A signal region] (SEQ ID NO: 38) and other primers AAVS-2f CTGGGGACTCTTTAAGGAAAGAAG (SEQ ID NO: 39) priming the AAVS1 region beyond the 500 bp 5' homology arm to obtain a 0.76 kb DNA fragment for HR or MMEJ]. PCR products were displayed on an agarose gel. Non-specific bands in HR samples were obtained after only one round and would probably have been analyzed if additional rounds had been provided.

The present invention uses the PiggyBac™ transposon system under conditions to preserve or induce stem cell memory T cells (T _SCMs ) with potent CAR activity (herein referred to as CAR-T _SCMs ) to produce human chimeric antigen receptor (CAR) cells. A method of producing expressing T cells is provided. Compositions comprising CAR-T _SCMs produced using the methods of the invention contain ≧60% CAR-T _SCMs and exhibit distinct functional profiles consistent with these T cell subsets. Other T cell subsets found in the compositions of the invention include central memory CAR-T cells (CAR-T _CM ), effector memory CAR-T cells (CAR-T _EM ), and effector CAR-T cells (CAR-T _E ). , and terminally differentiated effector CAR-T cells (CAR-T _TE ). A linear pathway of differentiation may be responsible for the generation of these cells: naïve T cells ( _TN ) > T _SCM > T _CM > T _EM > _TE > T _TE , whereby T _N is the parent that directly gives rise to T _SCM . It is a precursor, and then directly generates T _CM , etc. in turn. Compositions comprising CAR _- T _SCMs , CARTyrin-T _SCMs and/or VCAR-T _SCMs of the invention may be comprised of one or more respective parental CAR-T cell subsets (e.g., T It may include _SCM > T _CM > T _EM > T _E > T _TE ). The absolute quantity/abundance and relative proportions of each parental T cell subset may vary between patient blood and naturally occurring cell population samples, although naturally occurring cell populations may have high abundances and/or proportions of T _SCMs . Compositions of the present invention comprising non-naturally occurring CAR-T _SCMs are more potent and effective in treating patients against diseases and cancer.

Immunotherapy using chimeric-antigen receptor (CAR)-T cells is emerging as an interesting treatment option for cancer therapy. Autologous CAR-modified T cells targeting tumor-associated antigens (Ags) can produce potent tumor killing and, in some cases, complete remission of CD19 ⁺ hematologic malignancies. Unlike conventional biologics and chemotherapy, CAR-T cells retain the ability to rapidly regenerate upon Ag recognition, potentially eliminating the need for repeat treatments. To achieve this, CAR-T cells must persist in the patient as a stable population of viable memory T cells to not only cause initial tumor destruction but also prevent potential cancer recurrence. Therefore, there has been intensive effort to develop CAR molecules that do not cause T cell exhaustion through Ag-independent (tonic) signaling, as well as CAR-T products containing early memory cells, especially stem cell memory (T _SCM ). Stem cell-like CAR-T exhibits maximal self-renewal capacity and pluripotent ability to induce central memory (T _CM ), effector memory (TE _EM ) and effector T cells ( _TE ), resulting in better tumor elimination and long-term CAR -T will result in engraftment.

The CAR-T _SCM of the invention may comprise a Centyrin-based CAR, referred to as CARTyrin (and thus the cells may be referred to as a CARTyrin-T _SCM ). Centyrin is another scaffold molecule based on the human consensus tenascin FN3 domain, is smaller than scFv molecules, and can be screened for its monomeric properties, which increases stability and reduces the potential for tonic signaling in CAR molecules. . CARTyrin of the present invention is derived from T cells using a plasmid DNA transposon encoding carthyrin flanked by two cis-regulatory sequestering elements to help stabilize CARTyrin expression by blocking inappropriate gene activation or silencing. can be introduced.

CAR-T _SCMs of the invention may comprise VHH-based CARs, referred to as VCARs (thus, the cells may be referred to as VCAR-T _SCMs ). The VCAR of the invention can be introduced into T cells using a plasmid DNA transposon encoding the VHH flanked by two cis-regulatory sequestering elements to help stabilize VHH expression by blocking inappropriate gene activation or silencing. .

In certain embodiments of the methods of the invention, the PiggyBac™ (PB) transposon system can be used to stably integrate antigen (including cancer antigen) specific CARTyrin or VCAR into resting pan T cells, whereby the transposon It was co-delivered with an mRNA transposase called Super Piggyback™ (SPB) in a single electroporation reaction (however, the transposon and transposase were contained in separate compositions until introduced into the cells). Transfer of the Piggyback™ transposon into untouched resting primary human pan T cells resulted in stable integration and expression of the PB transfer gene in 20-30% of the cells. Unexpectedly, most of these modified CARTyrin-expressing T cells were positive for the expression of CD62L and CD45RA, markers commonly associated with stem memory T cells (T _SCM cells). To confirm that this phenotype was maintained upon CAR-T cell stimulation and proliferation, modified CARTyrin-expressing T cells positive for expression of CD62L and CD45RA were activated through stimulation of CD3 and CD28. As a result of stimulation of CD3 and CD28, >60% of CARTyrin+ T cells displayed a stem cell memory phenotype. In addition, these cells expressing CARTyrin specific for cancer antigen were able to sufficiently express a strong anti-tumor effector function.

To determine whether the PB system directly contributes to enhancing the expression of stemness-like markers, we compared the phenotypes of CAR-T cells generated by PB translocation or lentiviral (LV) transduction. To accomplish this, a new vector was created by subcloning the CARTyrin transgene into a common LV construct for virus production. After introducing CARTyrin into uncontacted resting T cells by PB translocation or LV transduction, CARTyrin+ cells were allowed to proliferate and then return to the resting state. A variety of phenotypic and functional properties were measured, including kinetic analysis of memory- and depletion-related markers, secondary proliferation in response to homeostatic cytokines or tumor-specific Ags, cytokine production, and lytic capacity in response to target tumor cells. Unlike PB transduced CARTyrin+ T cells, LV transduced CARTyrin+ T cells did not show an increased memory phenotype. Additionally, PB-translocated cells showed equal or better ability for secondary proliferation and killing of target tumor cells. Collectively, these data demonstrate that CAR-T cells produced by PB translocation are mostly T _SCM cells, a highly desirable product phenotype in the CAR-T field. Additionally, these CARTyrin+ T cells exhibit potent anti-tumor activity and may generate cells that persist longer in vivo due to the use of Centyrin-based CARs, which may be less prone to tonic signaling and functional exhaustion.

Chimeric antigen receptor

The present invention provides (a) an ectodomain comprising an antigen recognition region comprising one or more sequences that each specifically bind to an antigen; (b) a transmembrane domain, and (c) an endodomain comprising at least one costimulatory domain. In certain embodiments, the antigen recognition region may comprise two sequences that each specifically bind an antigen to produce a dual specific or tandem CAR. In certain embodiments, the antigen recognition region may comprise three sequences that each specifically bind to an antigen to produce a tri-specific CAR. In certain embodiments, the ectodomain may further comprise a signal peptide. Alternatively, or additionally, in certain embodiments, the ectodomain may further comprise a hinge between the antigen recognition region and the transmembrane domain. Sequences that each specifically bind to an antigen include single chain antibodies (e.g., scFv), sequences comprising one or more fragments of an antibody (e.g., VHH, referred to as VCAR in relation to CAR), antibody mimetics, and Including, but not limited to, Centyrin (referred to as CARTyrin in reference to CAR).

In certain embodiments of the CARs of the invention, the signal peptide may comprise a sequence encoding a human CD2, CD3δ, CD3ε, CD3γ, CD3ζ, CD4, CD8α, CD19, CD28, 4-1BB or GM-CSFR signal peptide. . In certain embodiments of the CARs of the invention, the signal peptide may comprise a sequence encoding the human CD8α signal peptide. Human CD8α signal peptide is It may contain an amino acid sequence comprising (SEQ ID NO: 8). Human CD8α signal peptide is An amino acid sequence comprising (SEQ ID NO: 8) or It may include a sequence having at least 70%, 80%, 90%, 95% or 99% identity with the amino acid sequence comprising (SEQ ID NO: 8). Human CD8α signal peptide is (SEQ ID NO: 9).

In certain embodiments of the CAR of the invention, the transmembrane domain may comprise a sequence encoding a human CD2, CD3δ, CD3ε, CD3γ, CD3ζ, CD4, CD8α, CD19, CD28, 4-1BB or GM-CSFR transmembrane domain. You can. In certain embodiments of the CARs of the invention, the transmembrane domain may comprise a sequence encoding a human CD8α transmembrane domain. The CD8α transmembrane domain is An amino acid sequence comprising (SEQ ID NO: 10) or It may include a sequence having at least 70%, 80%, 90%, 95% or 99% identity with the amino acid sequence comprising (SEQ ID NO: 10). The CD8α transmembrane domain is (SEQ ID NO: 11).

In certain embodiments of the CARs of the invention, the endodomain may comprise a human CD3ζ endodomain.

In certain embodiments of the CARs of the invention, the at least one costimulatory domain may comprise a human 4-1BB, CD28, CD40, ICOS, MyD88, OX-40 intracellular segment, or any combination thereof. In certain embodiments of the CARs of the invention, the at least one costimulatory domain may comprise a CD28 and/or 4-1BB costimulatory domain. The CD28 costimulatory domain is An amino acid sequence comprising (SEQ ID NO: 12) or (SEQ ID NO: 12). The CD28 costimulatory domain is (SEQ ID NO: 13). The 4-1BB costimulatory domain is An amino acid sequence comprising (SEQ ID NO: 14) or (SEQ ID NO: 14). The 4-1BB costimulatory domain is (SEQ ID NO: 15). The 4-1BB costimulatory domain may be located between the transmembrane domain and the CD28 costimulatory domain.

In certain embodiments of the CARs of the invention, the hinge may comprise sequences derived from human CD8α, IgG4, and/or CD4 sequences. In certain embodiments of the CARs of the invention, the hinge may comprise a sequence derived from the human CD8α sequence. The hinge is A human CD8α amino acid sequence comprising (SEQ ID NO: 16) or (SEQ ID NO: 16). The human CD8α hinge amino acid sequence is (SEQ ID NO: 17).

The present invention provides a composition comprising a CAR of the present invention and at least one pharmaceutically acceptable carrier.

The present invention provides a transposon comprising the CAR of the present invention. Transposons of the invention can be maintained episomally or integrated into the genome of recombinant/transformed cells. Transposons can be part of a two-component piggyback system that uses transposons and transposases to enhance nonviral gene transfer.

The transposon of the invention may contain a selection gene for identification, enrichment and/or isolation of cells expressing the transposon. Exemplary selection genes encode any gene product (e.g., transcript, protein, enzyme) essential for cell viability and survival. Exemplary selection genes are any gene products (e.g., transcripts, proteins, Enzyme) coding. Exemplary selection genes include any gene product (e.g., transcript, protein, enzyme) that is essential for viability and/or survival in a cell medium lacking one or more nutrients essential for cell viability and/or survival in the absence of the selection gene. Code it. Exemplary selection genes include neo (which confers resistance to neomycin), DHFR (encodes dihydrofolate reductase and confers resistance to methotrexate), and TYMS (encodes thymidylate synthetase). , MGMT (encoding O(6)-methylguanine-DNA methyltransferase), multidrug resistance gene (MDR1), ALDH1 (aldehyde dehydrogenase 1 family, member A1), FRANCF, RAD51C (RAD51 paralog C) , GCS (encodes glucosylceramide synthase), and NKX2.2 (encodes NK2 Homeobox 2).

The transposon of the present invention may include, for example, at least one self-cleaving peptide(s) located between one or more sequences that specifically bind to an antigen and the selection gene of the present invention. The at least one self-cleaving peptide may comprise, for example, a T2A peptide, a GSG-T2A peptide, an E2A peptide, a GSG-E2A peptide, an F2A peptide, a GSG-F2A peptide, a P2A peptide, or a GSG-P2A peptide. T2A peptide is An amino acid sequence comprising (SEQ ID NO: 18) or (SEQ ID NO: 18). GSG-T2A peptide is An amino acid sequence comprising (SEQ ID NO: 19) or (SEQ ID NO: 19). GSG-T2A peptide is (SEQ ID NO: 20). E2A peptide is An amino acid sequence comprising (SEQ ID NO: 21) or (SEQ ID NO: 21). GSG-E2A peptide is An amino acid sequence comprising (SEQ ID NO: 22) or (SEQ ID NO: 22). The F2A peptide is An amino acid sequence comprising (SEQ ID NO: 23) or (SEQ ID NO: 23). GSG-F2A peptide is An amino acid sequence comprising (SEQ ID NO: 24) or (SEQ ID NO: 24). P2A peptide is An amino acid sequence comprising (SEQ ID NO: 25) or (SEQ ID NO: 25). GSG-P2A peptide is An amino acid sequence comprising (SEQ ID NO: 26) or (SEQ ID NO: 26).

The transposon of the invention may comprise a first and a second self-cleaving peptide, the first self-cleaving peptide being located upstream of, for example, one or more sequences that specifically bind to the antigen of the invention; The second self-cleaving peptide is located downstream of, for example, one or more sequences that specifically bind to the antigen of the invention. The first and/or second self-cleaving peptide comprises, for example, a T2A peptide, a GSG-T2A peptide, an E2A peptide, a GSG-E2A peptide, an F2A peptide, a GSG-F2A peptide, a P2A peptide, or a GSG-P2A peptide. can do. T2A peptide is An amino acid sequence comprising (SEQ ID NO: 18) or (SEQ ID NO: 18). GSG-T2A peptide is An amino acid sequence comprising (SEQ ID NO: 19) or (SEQ ID NO: 19). GSG-T2A peptide is (SEQ ID NO: 20). E2A peptide is An amino acid sequence comprising (SEQ ID NO: 21) or (SEQ ID NO: 21). GSG-E2A peptide is An amino acid sequence comprising (SEQ ID NO: 22) or (SEQ ID NO: 22). The F2A peptide is An amino acid sequence comprising (SEQ ID NO: 23) or (SEQ ID NO: 23). GSG-F2A peptide is An amino acid sequence comprising (SEQ ID NO: 24) or (SEQ ID NO: 24). P2A peptide is An amino acid sequence comprising (SEQ ID NO: 25) or (SEQ ID NO: 25). GSG-P2A peptide is An amino acid sequence comprising (SEQ ID NO: 26) or (SEQ ID NO: 26).

The present invention provides compositions comprising the transposon of the present invention. In certain embodiments, a method of introducing a composition may further comprise a composition comprising a plasmid comprising a sequence encoding a transposase enzyme. The sequence encoding the transposase enzyme may be an mRNA sequence.

Transposons of the present invention may include piggyback transposons. Transposase enzymes of the invention may include piggyback transposase or compatible enzymes.

The present invention provides a vector containing the CAR of the present invention. In certain embodiments, the vector is a viral vector. The vector may be a recombinant vector.

The viral vector of the present invention may include sequences isolated or derived from a retrovirus, lentivirus, adenovirus, adeno-associated virus, or any combination thereof. Viral vectors may contain sequences isolated or derived from adeno-associated virus (AAV). Viral vectors may include recombinant AAV (rAAV). Exemplary adeno-associated viruses and recombinant adeno-associated viruses of the invention include two or more inverted terminal repeat (ITR) sequences located in cis next to one or more sequences that specifically bind to an antigen. Exemplary adeno-associated viruses and recombinant adeno-associated viruses of the invention include, but are not limited to, all serotypes (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9). Exemplary adeno-associated viruses and recombinant adeno-associated viruses of the invention include AAV hybrids containing the genome of one serotype and the capsid of another serotype (e.g., AAV2/5, AAV-DJ, and AAV-DJ8) Including, but not limited to, self-complementary AAV (scAAV). Exemplary adeno-associated viruses and recombinant adeno-associated viruses of the invention include, but are not limited to, rAAV-LK03.

The viral vector of the present invention may contain a selection gene. Selected genes may encode gene products essential for cell viability and survival. Selected genes may encode gene products that are essential for cellular potency and survival when challenged by selective cell culture conditions. Selective cell culture conditions may include compounds that are detrimental to cell viability or viability, where the gene product confers resistance to the compound. Exemplary selection genes include neo (which confers resistance to neomycin), DHFR (encodes dihydrofolate reductase and confers resistance to methotrexate), and TYMS (encodes thymidylate synthetase). , MGMT (encoding O(6)-methylguanine-DNA methyltransferase), multidrug resistance gene (MDR1), ALDH1 (aldehyde dehydrogenase 1 family, member A1), FRANCF, RAD51C (RAD51 paralog C) ), GCS (encoding glucosylceramide synthase), and NKX2.2 (encoding NK2 homeobox 2), or any combination thereof.

The viral vector of the present invention may contain at least one self-cleaving peptide. In some embodiments, the vector may comprise at least one cleaving peptide wherein the self-cleaving peptide is located between the CAR and the selection gene. In some embodiments, the vector may comprise at least one self-cleaving peptide, where the first self-cleaving peptide is located upstream of the CAR and the second self-cleaving peptide is located downstream of the CAR. Self-cleaving peptides may include, for example, T2A peptide, GSG-T2A peptide, E2A peptide, GSG-E2A peptide, F2A peptide, GSG-F2A peptide, P2A peptide, or GSG-P2A peptide. T2A peptide is An amino acid sequence comprising (SEQ ID NO: 18) or (SEQ ID NO: 18). GSG-T2A peptide is An amino acid sequence comprising (SEQ ID NO: 19) or (SEQ ID NO: 19). GSG-T2A peptide is (SEQ ID NO: 20). E2A peptide is An amino acid sequence comprising (SEQ ID NO: 21) or (SEQ ID NO: 21). GSG-E2A peptide is An amino acid sequence comprising (SEQ ID NO: 22) or (SEQ ID NO: 22). The F2A peptide is A sequence comprising (SEQ ID NO: 23) or (SEQ ID NO: 23). GSG-F2A peptide is A sequence comprising (SEQ ID NO: 24) or (SEQ ID NO: 24). P2A peptide is An amino acid sequence comprising (SEQ ID NO: 25) or (SEQ ID NO: 25). GSG-P2A peptide is A sequence comprising (SEQ ID NO: 26) or (SEQ ID NO: 26).

The present invention provides a vector containing the CAR of the present invention. In certain embodiments, the vector is an mRNA vector. The vector may be a recombinant mRNA vector. T cells of the present invention may be expanded prior to contacting the T cells with an mRNA vector containing the CAR of the present invention. The modified T cells, which are T cells containing the mRNA vector, can then be administered to the subject.

The present invention provides a vector containing the CAR of the present invention. In certain embodiments, the vector is a nanoparticle. Exemplary nanoparticle vectors of the invention include nucleic acids (e.g., RNA, DNA, synthetic nucleotides, modified nucleotides, or any combination thereof), amino acids (L-amino acids, D-amino acids, synthetic amino acids, modified amino acids, or any combination thereof), polymers (e.g., polymersomes), micelles, lipids (e.g., liposomes), organic molecules (e.g., carbon atoms, sheets, fibers, tubes), inorganic molecules (e.g. For example, calcium phosphate or gold) or any combination thereof. Nanoparticle vectors can be transported across cell membranes either passively or actively.

Nanoparticles of the present invention may contain a selection gene. Selected genes may encode gene products essential for cell viability and survival. Selected genes may encode gene products that are essential for cell viability and survival when challenged by selective cell culture conditions. Selective cell culture conditions may include compounds that are detrimental to cell viability or viability, where the gene product confers resistance to the compound. Exemplary selection genes include neo (which confers resistance to neomycin), DHFR (encodes dihydrofolate reductase and confers resistance to methotrexate), and TYMS (encodes thymidylate synthetase). , MGMT (encoding O(6)-methylguanine-DNA methyltransferase), multidrug resistance gene (MDR1), ALDH1 (aldehyde dehydrogenase 1 family, member A1), FRANCF, RAD51C (RAD51 paralog C) ), GCS (encoding glucosylceramide synthase), and NKX2.2 (encoding NK2 homeobox 2), or any combination thereof.

The nanoparticle vector of the present invention may contain at least one self-cleaving peptide. In some embodiments, the nanoparticle vector may include at least one self-cleaving peptide, where the self-cleaving peptide is positioned between the CAR and the nanoparticle. In some embodiments, the nanoparticle vector may comprise at least one self-cleaving peptide, where the first self-cleaving peptide is located upstream of the CAR and the second self-cleaving peptide is located downstream of the CAR. In some embodiments, the nanoparticle vector may comprise at least one self-cleaving peptide, where the first self-cleaving peptide is located between the CAR and the nanoparticle and the second self-cleaving peptide is located downstream of the CAR. In some embodiments, the nanoparticle vector may comprise at least one self-cleaving peptide, wherein the first self-cleaving peptide is located between the CAR and the nanoparticle and the second self-cleaving peptide is downstream of the CAR, e.g., selected from the CAR. Located between genes. Self-cleaving peptides may include, for example, T2A peptide, GSG-T2A peptide, E2A peptide, GSG-E2A peptide, F2A peptide, GSG-F2A peptide, P2A peptide, or GSG-P2A peptide. T2A peptide is A sequence comprising (SEQ ID NO: 18) or (SEQ ID NO: 18). GSG-T2A peptide is A sequence comprising (SEQ ID NO: 19) or (SEQ ID NO: 19). GSG-T2A peptide is (SEQ ID NO: 20). E2A peptide is A sequence comprising (SEQ ID NO: 21) or (SEQ ID NO: 21). GSG-E2A peptide is A sequence comprising (SEQ ID NO: 22) or (SEQ ID NO: 22). The F2A peptide is A sequence comprising (SEQ ID NO: 23) or (SEQ ID NO: 23). GSG-F2A peptide is A sequence comprising (SEQ ID NO: 24) or (SEQ ID NO: 24). P2A peptide is A sequence comprising (SEQ ID NO: 25) or (SEQ ID NO: 25). GSG-P2A peptide is A sequence comprising (SEQ ID NO: 26) or (SEQ ID NO: 26).

Provided herein are compositions comprising the vectors of the invention.

CARTyrin

The present invention provides (a) an ectodomain comprising an antigen recognition region comprising at least one Centyrin; (b) a transmembrane domain, and (c) an endodomain comprising at least one costimulatory domain. As used throughout this specification, CARs comprising Centyrin are referred to as CARTyrin. In certain embodiments, the antigen recognition region may include two Centyrin to produce a dual specific or tandem CAR. In certain embodiments, the antigen recognition region may include three Centyrin to produce a tri-specific CAR. In certain embodiments, the ectodomain may further comprise a signal peptide. Alternatively, or additionally, in certain embodiments, the ectodomain may further comprise a hinge between the antigen recognition region and the transmembrane domain.

The present invention provides an ectodomain comprising (a) an antigen recognition region comprising at least one protein scaffold or antibody mimetic; (b) a transmembrane domain and (c) an endodomain comprising at least one costimulatory domain. In certain embodiments, the antigen recognition region may comprise two scaffold proteins or antibody mimetics to produce a bispecific or tandem CAR. In certain embodiments, the antigen recognition region may comprise three protein scaffolds or antibody mimetics to produce a tri-specific CAR. In certain embodiments, the ectodomain may further comprise a signal peptide. Alternatively, or additionally, in certain embodiments, the ectodomain may further comprise a hinge between the antigen recognition region and the transmembrane domain.

In certain embodiments of the CARs of the invention, the signal peptide may comprise a sequence encoding a human CD2, CD3δ, CD3ε, CD3γ, CD3ζ, CD4, CD8α, CD19, CD28, 4-1BB or GM-CSFR signal peptide. . In certain embodiments of the CARs of the invention, the signal peptide may comprise a sequence encoding the human CD8α signal peptide. Human CD8α signal peptide is It may contain an amino acid sequence comprising (SEQ ID NO: 8). Human CD8α signal peptide is An amino acid sequence comprising (SEQ ID NO: 8) or It may include a sequence having at least 70%, 80%, 90%, 95% or 99% identity with the amino acid sequence comprising (SEQ ID NO: 8). Human CD8α signal peptide is (SEQ ID NO: 9).

In certain embodiments of the CAR of the invention, the transmembrane domain may comprise a sequence encoding a human CD2, CD3δ, CD3ε, CD3γ, CD3ζ, CD4, CD8α, CD19, CD28, 4-1BB or GM-CSFR transmembrane domain. You can. In certain embodiments of the CARs of the invention, the transmembrane domain may comprise a sequence encoding a human CD8α transmembrane domain. The CD8α transmembrane domain is An amino acid sequence comprising (SEQ ID NO: 10) or It may include a sequence having at least 70%, 80%, 90%, 95% or 99% identity with the amino acid sequence comprising (SEQ ID NO: 10). The CD8α transmembrane domain is (SEQ ID NO: 11).

In certain embodiments of the CARs of the invention, the endodomain may comprise a human CD3ζ endodomain.

In certain embodiments of the CARs of the invention, the at least one costimulatory domain may comprise a human 4-1BB, CD28, CD40, ICOS, MyD88, OX-40 intracellular segment, or any combination thereof. In certain embodiments of the CARs of the invention, the at least one costimulatory domain may comprise a CD28 and/or 4-1BB costimulatory domain. The CD28 costimulatory domain is An amino acid sequence comprising (SEQ ID NO: 12) or (SEQ ID NO: 12). The CD28 costimulatory domain is (SEQ ID NO: 13). The 4-1BB costimulatory domain is An amino acid sequence comprising (SEQ ID NO: 14) or (SEQ ID NO: 14). The 4-1BB costimulatory domain is (SEQ ID NO: 15). The 4-1BB costimulatory domain may be located between the transmembrane domain and the CD28 costimulatory domain.

In certain embodiments of the CARs of the invention, the hinge may comprise sequences derived from human CD8α, IgG4, and/or CD4 sequences. In certain embodiments of the CARs of the invention, the hinge may comprise a sequence derived from the human CD8α sequence. The hinge is A human CD8α amino acid sequence comprising (SEQ ID NO: 16) or (SEQ ID NO: 16). The human CD8α hinge amino acid sequence is (SEQ ID NO: 17).

Centyrin of the present invention may include a protein scaffold, and the scaffold may specifically bind to an antigen. Centyrin of the present invention may include a protein scaffold comprising a consensus sequence of at least one fibronectin type III (FN3) domain, and the scaffold may specifically bind to an antigen. At least one fibronectin type III (FN3) domain may be derived from a human protein. The human protein may be tenascin-C. The consensus sequence is (SEQ ID NO: 1) or (SEQ ID NO: 2). The consensus sequence is (SEQ ID NO: 3). The consensus sequence includes (a) an AB loop comprising or consisting of amino acid residues TEDS at positions 13 to 16 of the consensus sequence; (b) a BC loop comprising or consisting of amino acid residues TAPDAAF at positions 22 to 28 of the consensus sequence; (c) a CD loop comprising or consisting of amino acid residues SEKVGE at positions 38 to 43 of the consensus sequence; (d) a DE loop comprising or consisting of amino acid residues GSER at positions 51 to 54 of the consensus sequence; (e) an EF loop comprising or consisting of amino acid residues GLKPG at positions 60 to 64 of the consensus sequence; (f) an FG loop comprising or consisting of amino acid residues KGGHRSN at positions 75 to 81 of the consensus sequence; or (g) may be modified at one or more positions within any combination of (a) to (f). Centyrin of the invention may comprise at least 5 fibronectin type III (FN3) domains, at least 10 fibronectin type III (FN3) domains, or at least 15 fibronectin type III (FN3) domains. The scaffold has at least a K _D selected from 10 ^-9 M or less, 10 ^-10 M or less, 10 ^-11 M or less, 10 ^-12 M or less, 10 ^-13 M or less, 10 ^-14 M or less and 10 ^-15 M or less. Can bind to antigen with one affinity. K _D can be determined by surface plasmon resonance.

The present invention provides a composition comprising a CAR of the present invention and at least one pharmaceutically acceptable carrier.

The present invention provides a transposon comprising the CAR of the present invention. Transposons of the invention can be maintained episomally or integrated into the genome of recombinant/transformed cells. Transposons can be part of a two-component piggyback system that uses transposons and transposases to enhance nonviral gene transfer.

The transposon of the invention may contain a selection gene for identification, enrichment and/or isolation of cells expressing the transposon. Exemplary selection genes encode any gene product (e.g., transcript, protein, enzyme) essential for cell viability and survival. Exemplary selection genes are any gene products (e.g., transcripts, proteins, Enzyme) coding. Exemplary selection genes include any gene product (e.g., transcript, protein, enzyme) that is essential for viability and/or survival in a cell medium lacking one or more nutrients essential for cell viability and/or survival in the absence of the selection gene. Code it. Exemplary selection genes include neo (which confers resistance to neomycin), DHFR (encodes dihydrofolate reductase and confers resistance to methotrexate), and TYMS (encodes thymidylate synthetase). , MGMT (encoding O(6)-methylguanine-DNA methyltransferase), multidrug resistance gene (MDR1), ALDH1 (aldehyde dehydrogenase 1 family, member A1), FRANCF, RAD51C (RAD51 paralog C) , GCS (encodes glucosylceramide synthase), and NKX2.2 (encodes NK2 homeobox 2).

The transposon of the invention may comprise, for example, one or more protein scaffolds, at least one self-cleaving peptide(s) positioned between a centrin or CARTyrin of the invention and a selection gene of the invention. The at least one self-cleaving peptide may comprise, for example, a T2A peptide, a GSG-T2A peptide, an E2A peptide, a GSG-E2A peptide, an F2A peptide, a GSG-F2A peptide, a P2A peptide, or a GSG-P2A peptide. T2A peptide is An amino acid sequence comprising (SEQ ID NO: 18) or (SEQ ID NO: 18). GSG-T2A peptide is An amino acid sequence comprising (SEQ ID NO: 19) or (SEQ ID NO: 19). GSG-T2A peptide is (SEQ ID NO: 20). E2A peptide is An amino acid sequence comprising (SEQ ID NO: 21) or (SEQ ID NO: 21). GSG-E2A peptide is An amino acid sequence comprising (SEQ ID NO: 22) or (SEQ ID NO: 22). The F2A peptide is An amino acid sequence comprising (SEQ ID NO: 23) or (SEQ ID NO: 23). GSG-F2A peptide is An amino acid sequence comprising (SEQ ID NO: 24) or (SEQ ID NO: 24). P2A peptide is An amino acid sequence comprising (SEQ ID NO: 25) or (SEQ ID NO: 25). GSG-P2A peptide is An amino acid sequence comprising (SEQ ID NO: 26) or (SEQ ID NO: 26).

The transposon of the invention may comprise a first and a second self-cleaving peptide, the first self-cleaving peptide being located upstream of, for example, one or more protein scaffolds, a centrin or CARTyrin of the invention, The second self-cleaving peptide is located downstream of the sequence of, for example, one or more protein scaffolds, a centrin or CARTyrin of the invention. The first and/or second self-cleaving peptide comprises, for example, a T2A peptide, a GSG-T2A peptide, an E2A peptide, a GSG-E2A peptide, an F2A peptide, a GSG-F2A peptide, a P2A peptide, or a GSG-P2A peptide. can do. T2A peptide is An amino acid sequence comprising (SEQ ID NO: 18) or (SEQ ID NO: 18). GSG-T2A peptide is An amino acid sequence comprising (SEQ ID NO: 19) or (SEQ ID NO: 19). GSG-T2A peptide is (SEQ ID NO: 20). E2A peptide is An amino acid sequence comprising (SEQ ID NO: 21) or (SEQ ID NO: 21). GSG-E2A peptide is An amino acid sequence comprising (SEQ ID NO: 22) or (SEQ ID NO: 22). The F2A peptide is An amino acid sequence comprising (SEQ ID NO: 23) or (SEQ ID NO: 23). GSG-F2A peptide is An amino acid sequence comprising (SEQ ID NO: 24) or (SEQ ID NO: 24). P2A peptide is An amino acid sequence comprising (SEQ ID NO: 25) or (SEQ ID NO: 25). GSG-P2A peptide is An amino acid sequence comprising (SEQ ID NO: 26) or (SEQ ID NO: 26).

The present invention provides compositions comprising the transposon of the present invention. In certain embodiments, a method of introducing a composition may further comprise a composition comprising a plasmid comprising a sequence encoding a transposase enzyme. The sequence encoding the transposase enzyme may be an mRNA sequence.

Transposons of the present invention may include piggyback transposons. Transposase enzymes of the invention may include piggyback transposase or compatible enzymes.

The present invention provides a vector containing the CAR of the present invention. In certain embodiments, the vector is a viral vector. The vector may be a recombinant vector.

The viral vector of the present invention may include sequences isolated or derived from a retrovirus, lentivirus, adenovirus, adeno-associated virus, or any combination thereof. Viral vectors may contain sequences isolated or derived from adeno-associated virus (AAV). Viral vectors may include recombinant AAV (rAAV). Exemplary adeno-associated viruses and recombinant adeno-associated viruses of the invention include two or more inverted terminal repeat (ITR) sequences located in cis next to a protein scaffold, a sequence encoding a centrin or CARTyrin of the invention. Exemplary adeno-associated viruses and recombinant adeno-associated viruses of the invention include, but are not limited to, all serotypes (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9). Exemplary adeno-associated viruses and recombinant adeno-associated viruses of the invention include AAV hybrids containing the genome of one serotype and the capsid of another serotype (e.g., AAV2/5, AAV-DJ, and AAV-DJ8) Including, but not limited to, self-complementary AAV (scAAV). Exemplary adeno-associated viruses and recombinant adeno-associated viruses of the invention include, but are not limited to, rAAV-LK03.

The viral vector of the present invention may contain a selection gene. Selected genes may encode gene products essential for cell viability and survival. Selected genes may encode gene products that are essential for cell viability and survival when challenged by selective cell culture conditions. Selective cell culture conditions may include compounds that are detrimental to cell viability or viability, where the gene product confers resistance to the compound. Exemplary selection genes include neo (which confers resistance to neomycin), DHFR (encodes dihydrofolate reductase and confers resistance to methotrexate), and TYMS (encodes thymidylate synthetase). , MGMT (encoding O(6)-methylguanine-DNA methyltransferase), multidrug resistance gene (MDR1), ALDH1 (aldehyde dehydrogenase 1 family, member A1), FRANCF, RAD51C (RAD51 paralog C) ), GCS (encoding glucosylceramide synthase), and NKX2.2 (encoding NK2 homeobox 2), or any combination thereof.

The viral vector of the present invention may contain at least one self-cleaving peptide. In some embodiments, the vector may comprise at least one cleaving peptide wherein the self-cleaving peptide is located between the CAR and the selection gene. In some embodiments, the vector may comprise at least one self-cleaving peptide, where the first self-cleaving peptide is located upstream of the CAR and the second self-cleaving peptide is located downstream of the CAR. Self-cleaving peptides may include, for example, T2A peptide, GSG-T2A peptide, E2A peptide, GSG-E2A peptide, F2A peptide, GSG-F2A peptide, P2A peptide, or GSG-P2A peptide. T2A peptide is An amino acid sequence comprising (SEQ ID NO: 18) or (SEQ ID NO: 18). GSG-T2A peptide is An amino acid sequence comprising (SEQ ID NO: 19) or (SEQ ID NO: 19). GSG-T2A peptide is (SEQ ID NO: 20). E2A peptide is An amino acid sequence comprising (SEQ ID NO: 21) or (SEQ ID NO: 21). GSG-E2A peptide is An amino acid sequence comprising (SEQ ID NO: 22) or (SEQ ID NO: 22). The F2A peptide is A sequence comprising (SEQ ID NO: 23) or (SEQ ID NO: 23). GSG-F2A peptide is A sequence comprising (SEQ ID NO: 24) or (SEQ ID NO: 24). P2A peptide is An amino acid sequence comprising (SEQ ID NO: 25) or (SEQ ID NO: 25). GSG-P2A peptide is A sequence comprising (SEQ ID NO: 26) or (SEQ ID NO: 26).

The present invention provides a vector containing the CAR of the present invention. In certain embodiments, the vector is an mRNA vector. The vector may be a recombinant mRNA vector. T cells of the present invention can be expanded prior to contacting the T cells with an mRNA vector containing the CAR of the present invention. The modified T cells, which are T cells containing the mRNA vector, can then be administered to the subject.

The present invention provides a vector containing the CAR of the present invention. In certain embodiments, the vector is a nanoparticle. Exemplary nanoparticle vectors of the invention include nucleic acids (e.g., RNA, DNA, synthetic nucleotides, modified nucleotides, or any combination thereof), amino acids (L-amino acids, D-amino acids, synthetic amino acids, modified amino acids, or any combination thereof), polymers (e.g., polymersomes), micelles, lipids (e.g., liposomes), organic molecules (e.g., carbon atoms, sheets, fibers, tubes), inorganic molecules (e.g. For example, calcium phosphate or gold) or any combination thereof. Nanoparticle vectors can be transported across cell membranes either passively or actively.

Nanoparticles of the present invention may contain a selection gene. Selected genes may encode gene products essential for cell viability and survival. Selected genes may encode gene products that are essential for cell viability and survival when challenged by selective cell culture conditions. Selective cell culture conditions may include compounds that are detrimental to cell viability or viability, where the gene product confers resistance to the compound. Exemplary selection genes include neo (which confers resistance to neomycin), DHFR (encodes dihydrofolate reductase and confers resistance to methotrexate), and TYMS (encodes thymidylate synthetase). , MGMT (encoding O(6)-methylguanine-DNA methyltransferase), multidrug resistance gene (MDR1), ALDH1 (aldehyde dehydrogenase 1 family, member A1), FRANCF, RAD51C (RAD51 paralog C) ), GCS (encoding glucosylceramide synthase), and NKX2.2 (encoding NK2 homeobox 2), or any combination thereof.

The nanoparticle vector of the present invention may contain at least one self-cleaving peptide. In some embodiments, the nanoparticle vector may include at least one self-cleaving peptide, where the self-cleaving peptide is positioned between the CAR and the nanoparticle. In some embodiments, the nanoparticle vector may comprise at least one self-cleaving peptide, where the first self-cleaving peptide is located upstream of the CAR and the second self-cleaving peptide is located downstream of the CAR. In some embodiments, the nanoparticle vector may comprise at least one self-cleaving peptide, where the first self-cleaving peptide is located between the CAR and the nanoparticle and the second self-cleaving peptide is located downstream of the CAR. In some embodiments, the nanoparticle vector may comprise at least one self-cleaving peptide, wherein the first self-cleaving peptide is located between the CAR and the nanoparticle and the second self-cleaving peptide is downstream of the CAR, e.g., selected from the CAR. Located between genes. Self-cleaving peptides may include, for example, T2A peptide, GSG-T2A peptide, E2A peptide, GSG-E2A peptide, F2A peptide, GSG-F2A peptide, P2A peptide, or GSG-P2A peptide. T2A peptide is A sequence comprising (SEQ ID NO: 18) or (SEQ ID NO: 18). GSG-T2A peptide is A sequence comprising (SEQ ID NO: 19) or (SEQ ID NO: 19). GSG-T2A peptide is (SEQ ID NO: 20). E2A peptide is A sequence comprising (SEQ ID NO: 21) or (SEQ ID NO: 21). GSG-E2A peptide is A sequence comprising (SEQ ID NO: 22) or (SEQ ID NO: 22). The F2A peptide is A sequence comprising (SEQ ID NO: 23) or (SEQ ID NO: 23). GSG-F2A peptide is A sequence comprising (SEQ ID NO: 24) or (SEQ ID NO: 24). P2A peptide is A sequence comprising (SEQ ID NO: 25) or (SEQ ID NO: 25). GSG-P2A peptide is A sequence comprising (SEQ ID NO: 26) or (SEQ ID NO: 26).

Provided herein are compositions comprising the vectors of the invention.

scaffold protein

Centyrin is an example of a protein scaffold of the present invention. The antigen recognition region of the CAR of the present invention may include at least one protein scaffold.

Protein scaffolds of the invention may be derived from fibronectin type III (FN3) repeat proteins, encoding or complementary nucleic acids, vectors, host cells, compositions, combinations, formulations, devices, and methods of making and using the same. In a preferred embodiment, the protein scaffold consists of the consensus sequence of multiple FN3 domains of human tenascin-C (hereinafter “tenascin”). In a further preferred embodiment, the protein scaffold of the invention is the consensus sequence of the 15FN3 domain. Protein scaffolds of the invention can be designed to bind a variety of molecules, such as cellular target proteins. In preferred embodiments, protein scaffolds of the invention may be designed to bind epitopes of wild-type and/or variant forms of an antigen.

Protein scaffolds of the invention may comprise additional molecules or moieties, such as the Fc region of an antibody, an albumin binding domain, or other moieties that affect half-life. In a further embodiment, the protein scaffold of the invention may be linked to a nucleic acid molecule capable of encoding the protein scaffold.

The present invention provides at least one method of expressing at least one protein scaffold based on a consensus sequence of multiple FN3 domains in a host cell, under conditions wherein the at least one protein scaffold is expressed in a detectable and/or recoverable amount. A method is provided comprising culturing a host cell as described herein.

The present invention provides a protein scaffold based on (a) a consensus sequence of multiple FN3 domains and/or coding nucleic acids as described herein; and (b) a suitable and/or pharmaceutically acceptable carrier or diluent.

The present invention provides a method for generating libraries of protein scaffolds based on a consensus sequence of fibronectin type III (FN3) repeat proteins, preferably multiple FN3 domains, more preferably on a consensus sequence of multiple FN3 domains from human tenascin. do. Libraries are formed by sequentially creating scaffolds by altering (by mutation) the amino acid or number of amino acids in the molecule at specific positions in a portion of the scaffold, for example, a loop region. Libraries can be generated by altering the amino acid composition of a single loop or by simultaneously altering additional positions in multiple loops or scaffold molecules. The modified loop can be lengthened or shortened accordingly. Such libraries can be generated to contain all possible amino acids or a designed subset of amino acids at each position. Library members can be used for screening in vitro or by displays such as CIS displays (DNA, RNA, ribosome displays, etc.), yeast, bacterial and phage displays.

The protein scaffolds of the present invention provide improved biophysical properties such as stability under reducing conditions and solubility at high concentrations; These are these. It can be expressed and folded in prokaryotic systems such as E. coli , eukaryotic systems such as yeast, and in vitro transcription/translation systems such as the rabbit reticulocyte lysate system.

The present invention provides isolated recombinant and/or synthetic protein scaffolds based on the consensus sequence of fibronectin type III (FN3), including, without limitation, mammalian-derived scaffolds, as well as at least one protein scaffold encoding a protein scaffold based on the consensus FN3 sequence. Compositions comprising polynucleotides and encoding nucleic acid molecules are provided. The invention further includes, but is not limited to, methods of making and using the nucleic acid and protein scaffolds, including diagnostic and therapeutic compositions, methods and devices.

The protein scaffolds of the present invention have the ability to be administered topically, orally or across the blood-brain barrier, and can target multiple targets or multiple epitopes of the same target for increased expression of proteins as a function of resource relative to mammalian cell expression capacity. This allows them to be manipulated into dual specific or tandem molecules that bind together. Advantages over conventional therapies include the ability to express in E. coli, the ability to be conjugated to drugs, polymers, and probes, the ability to be formulated at high concentrations, and the ability of these molecules to effectively penetrate diseased tissues and tumors. to provide.

Additionally, protein scaffolds have many of the characteristics of antibodies, with the folds mimicking the variable regions of antibodies. This orientation may cause the FN3 loop to be exposed similarly to the antibody complementarity determining region (CDR). They must be able to bind to cellular targets, and to improve specific binding or related properties, the loops can be altered, for example, affinity matured.

Of the six loops of the protein scaffold of the present invention, three topologically correspond to the complementarity determining regions (CDRs 1 to 3) of an antibody, i.e., the antigen binding region, while the remaining three loops are located on the surface in a manner similar to the antibody CDRs. is exposed to These loops span or approximately residues 13 to 16, 22 to 28, 38 to 43, 51 to 54, 60 to 64, and 75 to 81 of SEQ ID NO:1. Preferably, the loop region at or approximately residues 22 to 28, 51 to 54 and 75 to 81 is altered for binding specificity and affinity. One or more of these loop regions can be randomized with other loop regions and/or other strands that maintain their sequence as backbone portions to form a library, and strong binders can be selected from the library with high affinity for a particular protein target. One or more loop regions may interact with the target protein, similar to protein-antibody CDR interactions.

Scaffolds of the invention may comprise single chain antibodies (e.g., scFv). A single chain antibody of the invention may comprise the three light and three heavy chain CDRs of the antibody. In certain embodiments, a single chain antibody of the invention comprises the three light and three heavy chain CDRs of the antibody, wherein the complementarity determining regions (CDRs) of the single chain antibody are human sequences. The present invention provides (a) an ectodomain comprising an antigen recognition region comprising at least one single chain antibody (e.g., scFv); (b) a transmembrane domain, and (c) an endodomain comprising at least one costimulatory domain. In certain embodiments, the antigen recognition region may comprise two single chain antibodies (e.g., two scFvs) to produce a dual specific or tandem CAR. In certain embodiments, the antigen recognition region may comprise three single chain antibodies (e.g., three scFvs) to produce a tri-specific CAR. In certain embodiments, the ectodomain may further comprise a signal peptide. Alternatively, or additionally, in certain embodiments, the ectodomain may further comprise a hinge between the antigen recognition region and the transmembrane domain.

Scaffolds of the invention may comprise sequences comprising one or more fragments of an antibody (e.g., VHH). A sequence comprising one or more fragments of an antibody of the invention may comprise the two heavy chain variable regions of the antibody. In certain embodiments, the sequence comprises the two heavy chain variable regions of an antibody, and the complementarity determining region (CDR) of the VHH is a human sequence. Scaffolds of the invention may comprise sequences comprising one or more fragments of an antibody (e.g., VHH). The present invention provides an ectodomain comprising (a) an antigen recognition region comprising at least one sequence comprising one or more fragments of an antibody (e.g., VHH); (b) a transmembrane domain, and (c) an endodomain comprising at least one costimulatory domain. In certain embodiments, the antigen recognition region may comprise two sequences comprising one or more fragments of an antibody (e.g., two VHHs) to produce a dual-specific or tandem CAR. In certain embodiments, the antigen recognition region may comprise three sequences comprising one or more fragments of an antibody (e.g., three VHHs) to produce a tri-specific CAR. In certain embodiments, the ectodomain may further comprise a signal peptide. Alternatively, or additionally, in certain embodiments, the ectodomain may further comprise a hinge between the antigen recognition region and the transmembrane domain.

Scaffolds of the present invention may include antibody mimetics.

The term “antibody mimetic” is meant to describe an organic compound that binds specifically to a target sequence and has a structure different from that of a naturally occurring antibody. Antibody mimetics may include proteins, nucleic acids, or small molecules. The target sequence to which the antibody mimetic of the present invention specifically binds may be an antigen. Antibody mimetics can provide properties superior to antibodies, including, but not limited to, superior solubility, tissue penetration, stability to heat and enzymes (e.g., resistance to enzymatic degradation), and low production costs. Exemplary antibody mimetics include affibodies, apilin, aphimer, apitin, alphabody, anticalin, and avimer (also known as avidity multimer), and Designed Ankyrin Repeat Protein (DARPin). repeat proteins), Fynomers, Kunitz domain peptides, and monobodies.

The apibody molecules of the invention comprise a protein scaffold comprising or consisting of one or more alpha helices without any disulfide bridges. Preferably, the affibody molecule of the invention contains or consists of three alpha helices. For example, an affibody molecule of the invention may include an immunoglobulin binding domain. Affibody molecules of the present invention may include the Z domain of protein A.

Apilin molecules of the invention comprise protein scaffolds produced, for example, by modification of exposed amino acids of gamma-B crystallin or ubiquitin. Apilin molecules functionally mimic the affinity of antibodies for antigens, but do not structurally mimic antibodies. In any protein scaffold used to make apilin, amino acids that are accessible to the solvent or possible binding partners in a properly folded protein molecule are considered exposed amino acids. Any one or more of these exposed amino acids can be modified to specifically bind to the target sequence or antigen.

Affimer molecules of the invention comprise protein scaffolds comprising highly stable proteins engineered to exhibit peptide loops that provide high affinity binding sites for specific target sequences. Exemplary epimer molecules of the invention include protein scaffolds based on cystatin proteins or their tertiary structures. Exemplary epimer molecules of the invention may share a common tertiary structure comprising an alpha-helix surmounted by an anti-parallel beta-sheet.

The apitin molecule of the invention comprises an artificial protein scaffold, the structure of which may be derived, for example, from a DNA binding protein (e.g., DNA binding protein Sac7d). Apitin of the present invention selectively binds to a target sequence that may be all or part of an antigen. Exemplary apitin of the invention is prepared by randomizing the sequence of one or more amino acids on the binding surface of a DNA binding protein and subjecting the resulting protein to ribosome display and selection. The target sequence of apitin of the invention may be found, for example, in the genome or on the surface of a peptide, protein, virus or bacterium. In certain embodiments of the invention, the apitin molecule can be used as a specific inhibitor of the enzyme. The apitin molecule of the present invention may include a heat-resistant protein or a derivative thereof.

The alpha body molecules of the present invention may also be referred to as cell-penetrating alpha bodies (CPAB). Alphabody molecules of the invention comprise small proteins (typically less than 10 kDa) that bind to a variety of target sequences (including antigens). Alphabody molecules can reach and bind to target sequences within cells. Structurally, the alphabody molecules of the invention contain artificial sequences that form a single-chain α-helix (similar to the naturally occurring coiled-coil structure). The alpha body molecule of the present invention may comprise a protein scaffold containing one or more amino acids modified to specifically bind to a target protein. Regardless of the binding specificity of the molecule, the alpha body molecules of the invention maintain correct folding and thermal stability.

Anticalin molecules of the present invention include artificial proteins that bind to a target sequence or site of a protein or small molecule. Anticalin molecules of the present invention may include artificial proteins derived from human lipocalin. Anticalin molecules of the present invention can be used, for example, in place of monoclonal antibodies or fragments thereof. Anticalin molecules may exhibit superior tissue penetration and thermal stability than monoclonal antibodies or fragments thereof. Exemplary anticalin molecules of the invention may contain about 180 amino acids with a mass of about 20 kDa. Structurally, the anticalin molecule of the invention comprises a barrel structure comprising antiparallel β-strands linked in pairs by loops and attached alpha helices. In a preferred embodiment, the anticalin molecule of the invention comprises a barrel structure comprising eight anti-parallel β-strands linked in pairs by loops and attached alpha helices.

Avimer molecules of the invention include artificial proteins that specifically bind to a target sequence (which may be an antigen). Avimers of the invention can recognize multiple binding sites within the same target or within separate targets. When an Avimer of the invention recognizes more than one target, the Avimer mimics the function of a bispecific antibody. The artificial protein avimer may comprise two or more peptide sequences of about 30 to 35 amino acids each. These peptides may be linked via one or more linker peptides. The amino acid sequence of one or more peptides of the Avimer may be derived from the A domain of the membrane receptor. Avimers have a rigid structure that may, in some cases, contain disulfide bonds and/or calcium. Avimer of the present invention can exhibit better thermal stability compared to antibodies.

DARPins (designed ankyrin repeat proteins) of the invention include genetically engineered, recombinant or chimeric proteins with high specificity and high affinity for target sequences. In certain embodiments, a DARPin of the invention is derived from an ankyrin protein and, in some cases, comprises at least three repeat motifs (also referred to as repetitive structural units) of an ankyrin protein. Ankyrin proteins mediate high-affinity protein-protein interactions. The DARPins of the present invention contain a large target interaction surface.

The pinomer of the invention comprises a small binding protein (about 7 kDa) derived from the human Fyn SH3 domain and engineered to bind target sequences and molecules with the same affinity and same specificity as an antibody.

Kunitz domain peptides of the invention comprise a protein scaffold comprising a Kunitz domain. The Kunitz domain contains an active site for inhibiting protease activity. Structurally, the Kunitz domain of the invention comprises a disulfide-rich alpha+beta fold. This structure is exemplified by bovine pancreatic trypsin inhibitor. Kunitz domain peptides recognize specific protein structures and act as competitive protease inhibitors. The Kunitz domain of the present invention may include ecalantide (derived from human lipoprotein-associated coagulation inhibitor (LACI)).

Monobodies of the invention are small proteins (containing about 94 amino acids and have a mass of about 10 kDa) similar in size to single chain antibodies. These genetically engineered proteins bind specifically to target sequences, including antigens. Monobodies of the invention can specifically target one or more unique proteins or target sequences. In a preferred embodiment, the monobodies of the invention comprise a protein scaffold that mimics the structure of human fibronectin, more preferably a protein scaffold that mimics the structure of the 10th extracellular type III domain of fibronectin. The 10th extracellular type III domain of fibronectin and its monobody mimetics contains seven beta sheets forming a barrel and three exposed loops on each side corresponding to the three complementarity determining regions (CDRs) of the antibody. . In contrast to the structure of the variable domain of an antibody, the monobody lacks a central disulfide bond as well as no binding sites for metal ions. Multispecific monobodies can be optimized by modifying loops BC and FG. The monobody of the present invention may include adnectin.

Production and production of scaffold proteins

At least one scaffold protein of the invention may optionally be produced by a cell line, mixed cell line, immortalized cell, or clonal population of immortalized cells, as is well known in the art. See, for example, Ausubel, et al., ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, N.Y. (1987-2001); Sambrook, et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor, N.Y. (1989); Harlow and Lane, Antibodies, a Laboratory Manual, Cold Spring Harbor, N.Y. (1989); Colligan, et al., eds., Current Protocols in Immunology, John Wiley & Sons, Inc., NY (1994-2001); See Colligan et al., Current Protocols in Protein Science, John Wiley & Sons, NY, N.Y., (1997-2001).

Amino acids from the scaffold protein are altered to reduce immunogenicity or to reduce, enhance or modify binding affinity, on-rate, off-rate, avidity, specificity, half-life, stability, solubility or any other suitable property; Additions and/or deletions may be made.

In some cases, scaffold proteins can be engineered while maintaining high affinity for antigen and other advantageous biological properties. To achieve this goal, scaffold proteins can be prepared by analytical processes of the parent sequence and engineered products of various concepts, optionally using three-dimensional models of the parent sequence and engineered sequence. Three-dimensional models are commonly available and familiar to those skilled in the art. Computer programs can be used to illustrate and display the possible three-dimensional conformational structure of the selected candidate sequence and to determine possible immunogenicity (e.g., Immuno™ from Xencor, Inc., Monrovia, CA). Filter (Immunofilter program). These displays can be examined to analyze the possible role of the residues in the function of the candidate sequence, i.e., residues that affect the ability of the candidate scaffold protein to bind its antigen. In this way, residues from the parent and reference sequences can be selected and combined so that the desired properties, such as affinity for the target antigen(s), are achieved. Alternatively to or in addition to the above procedures, other suitable operating methods may be used.

Piggyback transposon system

The methods of the invention produce modified T _SCMs of the invention regardless of the method used to introduce the antigen receptor into the primary human T cells of the invention. The method of the present invention provides greater potency and/or higher abundance and ratio of the modified T _SCM of the present invention when introducing the antigen receptor or therapeutic protein of the present invention into primary human T cells using the piggyback transposon system. , producing the modified T _SCM of the present invention with a yield. The piggyback transposon system of the present invention may include a piggyback transposon containing the antigen receptor of the present invention. Preferably, primary human T cells are contacted simultaneously (or in very close temporal proximity) with a piggyback transposon comprising an antigen receptor of the invention and a transposase of the invention. For example, primary human T cells, transposon and transposase are contained in the same container (e.g. cuvette) before introducing the transposon and transposase into the cell - but they are not allowed to interact without the cells. . Preferably, primary human T cells are simultaneously contacted with a Piggyback transposon comprising an antigen receptor of the invention and a Super Piggyback™ (SPB) transposase prior to introducing the transposon and transposase into the cell. In certain preferred embodiments, the Super Piggyback™ (SPB) transposase is an mRNA sequence encoding the Super Piggyback™ (SPB) transposase.

Additional disclosure regarding piggyback transposons and Super Piggyback™ (SPB) transposase is in International Patent Publication No. WO 2010/099296, US Patent Nos. 8,399,643, US Patent Nos. 9,546,382, US Patent Nos. 6,218,185, and 6,551,825. No. 6,962,810, and U.S. Patent No. 7,105,343, the contents of which are each incorporated herein by reference in their entirety.

The present invention provides a method for introducing a polynucleotide structure containing a DNA sequence into a host cell. Preferably, the introduction step is mediated by a piggyback transposon system.

In certain embodiments of the methods of the invention, the transposon is a plasmid DNA transposon having a sequence encoding an antigen receptor or therapeutic protein flanked by two cis regulatory sequestering elements. In certain embodiments, the transposon is a piggyback transposon. In certain embodiments, particularly in those embodiments where the transposon is a piggyback transposon, the transposase is a Piggyback™ or Super Piggyback™ (SPB) transposase. In certain embodiments, particularly in embodiments where the transposase is a Super Piggyback™ (SPB) transposase, the sequence encoding the transposase is an mRNA sequence.

In certain embodiments of the methods of the invention, the transposase enzyme is a Piggyback™ (PB) transposase enzyme. The piggyback (PB) transposase enzyme may comprise or consist of an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99% or any percentage therebetween identical to:

In certain embodiments of the methods of the invention, the transposase enzyme is a Piggyback ^TM (PB) transposase comprising or consisting of an amino acid sequence having an amino acid substitution at one or more of positions 30, 165, 282, or 538 of the sequence: Homemade enzymes are:

In certain embodiments, the transposase enzyme is a Piggyback ^TM (PB) transposase comprising or consisting of an amino acid sequence having amino acid substitutions at two or more of positions 30, 165, 282, or 538 of the sequence of SEQ ID NO:4. It is an enzyme. In certain embodiments, the transposase enzyme is a Piggyback ^TM (PB) transposase comprising or consisting of an amino acid sequence having amino acid substitutions at three or more of positions 30, 165, 282, or 538 of the sequence of SEQ ID NO:4. It is an enzyme. In certain embodiments, the transposase enzyme is a PiggyBac ^™ (PB) transposase enzyme comprising or consisting of an amino acid sequence having amino acid substitutions at each of the following positions 30, 165, 282, and 538 of the sequence of SEQ ID NO:4: . In certain embodiments, the amino acid substitution at position 30 of sequence SEQ ID NO:4 is an isoleucine (I) to valine (V) substitution. In certain embodiments, the amino acid substitution at position 165 of sequence SEQ ID NO:4 is a glycine (G) to serine (S) substitution. In certain embodiments, the amino acid substitution at position 282 of sequence SEQ ID NO:4 is a methionine (M) to valine (V) substitution. In certain embodiments, the amino acid substitution at position 538 of the sequence of SEQ ID NO:4 is an asparagine (N) to lysine (K) substitution.

In certain embodiments of the methods of the invention, the transposase enzyme is a Super Piggyback™ (SPB) transposase enzyme. In certain embodiments, a Super Piggyback™ (SPB) transposase enzyme of the invention has an amino acid substitution at position 30 is an isoleucine (I) to valine (V) substitution and an amino acid substitution at position 165 is a glycine (G) substitution. to serine (S), the amino acid substitution at position 282 is a substitution from methionine (M) to valine (V), and the amino acid substitution at position 538 is a substitution from asparagine (N) to lysine (K). It may comprise or consist of the amino acid sequence of sequence number 4. In certain embodiments, the Super Piggyback™ (SPB) transposase enzyme comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or any percentage therebetween. Or it can be done like this:

In certain embodiments of the methods of the invention, including embodiments where the transposase comprises the mutations described above at positions 30, 165, 282, and/or 538, the PiggyBac™ or Super PiggyBac™ transposase enzyme is SEQ ID NO: 4 or positions 3, 46, 82, 103, 119, 125, 177, 180, 185, 187, 200, 207, 209, 226, 235, 240, 241, 243, 258, 296, 298 of the sequence of SEQ ID NO: 5 , 311, 315, 319, 327, 328, 340, 421, 436, 456, 470, 486, 503, 552, 570, and 591. In certain embodiments, including embodiments where the transposase comprises the mutations described above at positions 30, 165, 282, and/or 538, the PiggyBac™ or Super PiggyBac™ transposase enzyme has mutations at positions 46, 119, 125, 177, 180, 185, 187, 200, 207, 209, 226, 235, 240, 241, 243, 296, 298, 311, 315, 319, 327, 328, 340, 421, 436, 456, 470, 4 85, It may further include amino acid substitutions at one or more of 503, 552, and 570. In certain embodiments, the amino acid substitution at position 3 of SEQ ID NO:4 or SEQ ID NO:5 is a serine (S) to asparagine (N) substitution. In certain embodiments, the amino acid substitution at position 46 of SEQ ID NO:4 or SEQ ID NO:5 is an alanine (A) to serine (S) substitution. In certain embodiments, the amino acid substitution at position 46 of SEQ ID NO:4 or SEQ ID NO:5 is an alanine (A) to threonine (T) substitution. In certain embodiments, the amino acid substitution at position 82 of SEQ ID NO:4 or SEQ ID NO:5 is an isoleucine (I) to tryptophan (W) substitution. In certain embodiments, the amino acid substitution at position 103 of SEQ ID NO:4 or SEQ ID NO:5 is a serine (S) to proline (P) substitution. In certain embodiments, the amino acid substitution at position 119 of SEQ ID NO:4 or SEQ ID NO:5 is an arginine (R) to proline (P) substitution. In certain embodiments, the amino acid substitution at position 125 of SEQ ID NO:4 or SEQ ID NO:5 is a cysteine (C) to alanine (A) substitution. In certain embodiments, the amino acid substitution at position 125 of SEQ ID NO:4 or SEQ ID NO:5 is a cysteine (C) to leucine (L) substitution. In certain embodiments, the amino acid substitution at position 177 of SEQ ID NO:4 or SEQ ID NO:5 is a tyrosine (Y) to lysine (K) substitution. In certain embodiments, the amino acid substitution at position 177 of SEQ ID NO:4 or SEQ ID NO:5 is a tyrosine (Y) to histidine (H) substitution. In certain embodiments, the amino acid substitution at position 180 of SEQ ID NO:4 or SEQ ID NO:5 is a phenylalanine (F) to leucine (L) substitution. In certain embodiments, the amino acid substitution at position 180 of SEQ ID NO:4 or SEQ ID NO:5 is a phenylalanine (F) to isoleucine (I) substitution. In certain embodiments, the amino acid substitution at position 180 of SEQ ID NO:4 or SEQ ID NO:5 is a phenylalanine (F) to valine (V) substitution. In certain embodiments, the amino acid substitution at position 185 of SEQ ID NO:4 or SEQ ID NO:5 is a methionine (M) to leucine (L) substitution. In certain embodiments, the amino acid substitution at position 187 of SEQ ID NO:4 or SEQ ID NO:5 is an alanine (A) to glycine (G) substitution. In certain embodiments, the amino acid substitution at position 200 of SEQ ID NO:4 or SEQ ID NO:5 is a substitution of phenylalanine (F) to tryptophan (W). In certain embodiments, the amino acid substitution at position 207 of SEQ ID NO:4 or SEQ ID NO:5 is a valine (V) to proline (P) substitution. In certain embodiments, the amino acid substitution at position 209 of SEQ ID NO:4 or SEQ ID NO:5 is a valine (V) to phenylalanine (F) substitution. In certain embodiments, the amino acid substitution at position 226 of SEQ ID NO:4 or SEQ ID NO:5 is a methionine (M) to phenylalanine (F) substitution. In certain embodiments, the amino acid substitution at position 235 of SEQ ID NO:4 or SEQ ID NO:5 is a leucine (L) to arginine (R) substitution. In certain embodiments, the amino acid substitution at position 240 of SEQ ID NO:4 or SEQ ID NO:5 is a valine (V) to lysine (K) substitution. In certain embodiments, the amino acid substitution at position 241 of SEQ ID NO:4 or SEQ ID NO:5 is a phenylalanine (F) to leucine (L) substitution. In certain embodiments, the amino acid substitution at position 243 of SEQ ID NO:4 or SEQ ID NO:5 is a proline (P) to lysine (K) substitution. In certain embodiments, the amino acid substitution at position 258 of SEQ ID NO:4 or SEQ ID NO:5 is an asparagine (N) to serine (S) substitution. In certain embodiments, the amino acid substitution at position 296 of SEQ ID NO:4 or SEQ ID NO:5 is a leucine (L) to tryptophan (W) substitution. In certain embodiments, the amino acid substitution at position 296 of SEQ ID NO:4 or SEQ ID NO:5 is a leucine (L) to tyrosine (Y) substitution. In certain embodiments, the amino acid substitution at position 296 of SEQ ID NO:4 or SEQ ID NO:5 is a leucine (L) to phenylalanine (F) substitution. In certain embodiments, the amino acid substitution at position 298 of SEQ ID NO:4 or SEQ ID NO:5 is a methionine (M) to leucine (L) substitution. In certain embodiments, the amino acid substitution at position 298 of SEQ ID NO:4 or SEQ ID NO:5 is a methionine (M) to alanine (A) substitution. In certain embodiments, the amino acid substitution at position 298 of SEQ ID NO:4 or SEQ ID NO:5 is a methionine (M) to valine (V) substitution. In certain embodiments, the amino acid substitution at position 311 of SEQ ID NO:4 or SEQ ID NO:5 is a proline (P) to isoleucine (I) substitution. In certain embodiments, the amino acid substitution at position 311 of SEQ ID NO:4 or SEQ ID NO:5 is a proline (P) to valine substitution. In certain embodiments, the amino acid substitution at position 315 of SEQ ID NO:4 or SEQ ID NO:5 is an arginine (R) to lysine (K) substitution. In certain embodiments, the amino acid substitution at position 319 of SEQ ID NO:4 or SEQ ID NO:5 is a threonine (T) to glycine (G) substitution. In certain embodiments, the amino acid substitution at position 327 of SEQ ID NO:4 or SEQ ID NO:5 is a tyrosine (Y) to arginine (R) substitution. In certain embodiments, the amino acid substitution at position 328 of SEQ ID NO:4 or SEQ ID NO:5 is a tyrosine (Y) to valine (V) substitution. In certain embodiments, the amino acid substitution at position 340 of SEQ ID NO:4 or SEQ ID NO:5 is a cysteine (C) to glycine (G) substitution. In certain embodiments, the amino acid substitution at position 340 of SEQ ID NO:4 or SEQ ID NO:5 is a cysteine (C) to leucine (L) substitution. In certain embodiments, the amino acid substitution at position 421 of SEQ ID NO:4 or SEQ ID NO:5 is an aspartic acid (D) to histidine (H) substitution. In certain embodiments, the amino acid substitution at position 436 of SEQ ID NO:4 or SEQ ID NO:5 is a valine (V) to isoleucine (I) substitution. In certain embodiments, the amino acid substitution at position 456 of SEQ ID NO:4 or SEQ ID NO:5 is a methionine (M) to tyrosine (Y) substitution. In certain embodiments, the amino acid substitution at position 470 of SEQ ID NO:4 or SEQ ID NO:5 is a leucine (L) to phenylalanine (F) substitution. In certain embodiments, the amino acid substitution at position 485 of SEQ ID NO:4 or SEQ ID NO:5 is a serine (S) to lysine (K) substitution. In certain embodiments, the amino acid substitution at position 503 of SEQ ID NO:4 or SEQ ID NO:5 is a methionine (M) to leucine (L) substitution. In certain embodiments, the amino acid substitution at position 503 of SEQ ID NO:4 or SEQ ID NO:5 is a methionine (M) to isoleucine (I) substitution. In certain embodiments, the amino acid substitution at position 552 of SEQ ID NO:4 or SEQ ID NO:5 is a valine (V) to lysine (K) substitution. In certain embodiments, the amino acid substitution at position 570 of SEQ ID NO:4 or SEQ ID NO:5 is an alanine (A) to threonine (T) substitution. In certain embodiments, the amino acid substitution at position 591 of SEQ ID NO:4 or SEQ ID NO:5 is a glutamine (Q) to proline (P) substitution. In certain embodiments, the amino acid substitution at position 591 of SEQ ID NO:4 or SEQ ID NO:5 is a glutamine (Q) to arginine (R) substitution.

In certain embodiments of the methods of the invention, including embodiments where the transposase comprises the mutations described above at positions 30, 165, 282, and/or 538, the PiggyBac™ transposase enzyme has SEQ ID NO: 4 or SEQ ID NO: 5. may contain amino acid substitutions at one or more of positions 103, 194, 372, 375, 450, 509 and 570 of the sequence of or the Super PiggyBac™ transposase enzyme has an amino acid substitution at position 103 of the sequence of SEQ ID NO: 4 or SEQ ID NO: 5, It may further include amino acid substitutions at one or more of positions 194, 372, 375, 450, 509, and 570. In certain embodiments of the methods of the invention, including embodiments where the transposase comprises the mutations described above at positions 30, 165, 282, and/or 538, the PiggyBac™ transposase enzyme has SEQ ID NO: 4 or SEQ ID NO: 5. may contain amino acid substitutions at 2, 3, 4, 5, 6 or more of positions 103, 194, 372, 375, 450, 509 and 570 of the sequence or the Super Piggyback™ transposase enzyme has SEQ ID NO: 4 or It may further include amino acid substitutions at 2, 3, 4, 5, 6 or more of positions 103, 194, 372, 375, 450, 509 and 570 of SEQ ID NO: 5. In certain embodiments, including embodiments where the transposase comprises the mutations described above at positions 30, 165, 282, and/or 538, the PiggyBac™ transposase enzyme has a mutation at position 103 of the sequence of SEQ ID NO:4 or SEQ ID NO:5. , 194, 372, 375, 450, 509 and 570, or the Super Piggyback™ transposase enzyme may contain amino acid substitutions at positions 103, 194, 372, 375, 450 of the sequence of SEQ ID NO: 4 or SEQ ID NO: 5. It may further include amino acid substitutions at 509 and 570. In certain embodiments, the amino acid substitution at position 103 of SEQ ID NO:4 or SEQ ID NO:5 is a serine (S) to proline (P) substitution. In certain embodiments, the amino acid substitution at position 194 of SEQ ID NO:4 or SEQ ID NO:5 is a methionine (M) to valine (V) substitution. In certain embodiments, the amino acid substitution at position 372 of SEQ ID NO:4 or SEQ ID NO:5 is an arginine (R) to alanine (A) substitution. In certain embodiments, the amino acid substitution at position 375 of SEQ ID NO:4 or SEQ ID NO:5 is a lysine (K) to alanine (A) substitution. In certain embodiments, the amino acid substitution at position 450 of SEQ ID NO:4 or SEQ ID NO:5 is an aspartic acid (D) to asparagine (N) substitution. In certain embodiments, the amino acid substitution at position 509 of SEQ ID NO:4 or SEQ ID NO:5 is a serine (S) to glycine (G) substitution. In certain embodiments, the substitution at position 570 of SEQ ID NO:4 or SEQ ID NO:5 is an asparagine (N) to serine (S) substitution. In certain embodiments, the Piggyback™ transposase enzyme may comprise a methionine (M) to valine (V) substitution at position 194 of SEQ ID NO:4. In certain embodiments where the PiggyBac™ transposase enzyme comprises a methionine (M) to valine (V) substitution at position 194 of SEQ ID NO: 4, the PiggyBac™ transposase enzyme has SEQ ID NO: 4 or SEQ ID NO: 5. It may further include amino acid substitutions at positions 372, 375 and 450 of the sequence. In certain embodiments, the PiggyBac™ transposase enzyme comprises a methionine (M) to valine (V) substitution at position 194 in SEQ ID NO: 4, an arginine (R) to alanine (A) substitution at position 372 in SEQ ID NO: and a substitution of lysine (K) to alanine (A) at position 375 of SEQ ID NO:4. In certain embodiments, the PiggyBac™ transposase enzyme comprises a methionine (M) to valine (V) substitution at position 194 in SEQ ID NO: 4, an arginine (R) to alanine (A) substitution at position 372 in SEQ ID NO: , lysine (K) to alanine (A) at position 375 in SEQ ID NO:4, and aspartic acid (D) to asparagine (N) at position 450 in SEQ ID NO:4.

“Introduction” means providing the polynucleotide construct to the factory in such a way that it gains access to the interior of the host cell. As long as the polynucleotide structure has access to the interior of one cell of the host, the method of the present invention does not depend on a specific method of introducing the polynucleotide structure into the host cell. Methods for introducing polynucleotide structures into bacteria, plants, fungi, and animals are well known in the art and include, but are not limited to, stable transformation methods, transient transformation methods, and virus-mediated methods.

As used throughout this specification, the term “endogenous” refers to a nucleic acid or protein sequence that is naturally associated with the target gene or the host cell into which it is introduced.

“Stable transformation” means that the polynucleotide construct introduced into the plant is integrated into the host's genome and can be inherited by its offspring.

“Transient transformation” means that the polynucleotide construct introduced into the host is not integrated into the host's genome.

In a preferred embodiment, the piggyback transposon system is used to introduce exogenous sequences into primary human T cells by stable transformation to generate modified T _SCMs or T _CMs .

Additional transposon systems

In certain embodiments of the methods of the invention, the transposon is a Sleeping Beauty transposon. In certain embodiments, particularly embodiments where the transposon is Sleeping Beauty transposon, the transposase is Sleeping Beauty transposase or hyperactive Sleeping Beauty transposase (SB100X).

The present invention provides a method for producing modified stem memory T cells (T _SCM ) or modified central memory T cells (T _CM ), comprising (a) a transposon composition comprising a transposon comprising an antigen receptor or therapeutic protein, and (b) ) A transposase or a transposase composition containing a sequence encoding a transposase is introduced into primary human T cells to produce modified T cells, wherein the modified T cells are modified stem memory T cells (T Producing modified stem memory T cells (T _SCM ) or modified central memory T cells (T _CM ) by expressing one or more cell surface marker(s) of _{the SCM} ) or modified central memory T cells (T _CM ). Provides a method including. The present invention provides a method for producing a plurality of modified stem memory T cells (T _SCM ) or a plurality of modified central memory T cells (T _CM ), comprising (a) a transposon composition comprising a transposon comprising an antigen receptor and ( b) introducing a transposase or a transposase composition comprising a sequence encoding a transposase into a plurality of primary human T cells to produce a plurality of modified T cells, wherein at least one of the plurality of modified T cells 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85% , 90%, 95%, 99% or any percentage in between express one or more cell surface marker(s) of stem memory T cells (T _SCM ) or central memory T cells (T _CM ), thereby A method is provided comprising producing stem memory T cells (T _SCM ) or a plurality of modified central memory T cells (T _CM ).

In certain embodiments of the methods of the invention, the transposon is a Sleeping Beauty transposon. In certain embodiments, particularly embodiments where the transposon is a Sleeping Beauty transposon, the transposase is Sleeping Beauty Transposase or Hyperactive Sleeping Beauty Transposase (SB100X).

In certain embodiments of the methods of the invention, the Sleeping Beauty transposase enzyme comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99% or any percentage therebetween identical to: do:

In certain embodiments of the methods of the invention, the hyperactive Sleeping Beauty (SB100X) transposase enzyme is at least 75%, 80%, 85%, 90%, 95%, 99% or any percentage therebetween: Contains the same amino acid sequence:

In certain embodiments of the methods of the invention, the transposase is a helitron transposase. The helitron transposase mobilizes the hellraiser transposon, an ancient element of the bat genome that was active 3 to 3.6 million years ago. Exemplary Hellraiser transposons of the invention include Helibat1, which contains a nucleic acid sequence comprising:

Unlike other transposases, helitron transposase does not contain an RNase H-like catalytic domain, but instead contains a RepHel motif consisting of a replication initiation domain (Rep) and a DNA helicase domain. The Rep domain is the nuclease domain of the HUH superfamily nucleases.

Exemplary helitron transposases of the invention include an amino acid sequence comprising:

In helitron translocation, a hairpin close to the 3' end of the transposon functions as a termination factor. However, this hairpin can be bypassed by transphosphosases, resulting in transduction of flanking sequences. Additionally, the Hellraiser translocation generates a covalently closed circular intermediate. Additionally, helitron translocation may have no target site overlap. In the Hellraiser sequence, the transposase is flanked by left and right terminal sequences named LTS and RTS. These sequences terminate with a conserved 5'-TC/CTAG-3' motif. A 19 bp palindromic sequence with the potential to form a hairpin termination structure is located 11 nucleotides upstream of the RTS, and the sequence It consists of (SEQ ID NO: 29).

In certain embodiments of the methods of the invention, the transposase is a Tol2 transposase. The Tol2 transposon can be isolated or derived from the genome of medaka fish and may be similar to transposons of the hAT family. The exemplary Tol2 transposon of the invention is encoded by a sequence comprising approximately 4.7 kilobases and contains the Tol2 transposase encoding gene containing four exons. Exemplary Tol2 transposase of the invention comprises an amino acid sequence comprising:

Exemplary Tol2 transposons of the invention, including inverted repeat sequences, proximal sequences and Tol2 transposase, are encoded by a nucleic acid sequence comprising:

homologous recombination

In certain embodiments of the methods of the invention, the modified CAR-T _SCM or CAR-T _CM of the invention is produced by introducing an antigen receptor into a primary human T cell of the invention by homologous recombination. In certain embodiments of the invention, homologous recombination is induced by single or double strand breaks induced by the genome editing composition or construct of the invention. The homologous recombination method of the invention includes contacting a genomic sequence with a genome editing composition or construct of the invention to induce one or more breaks in the sequence and provide an entry point within the genomic sequence for the exogenous donor sequence composition. The donor sequence compositions of the invention are integrated into the genomic sequence at an entry point induced by the cell's natural DNA repair machinery.

In certain embodiments of the methods of the invention, homologous recombination introduces sequences encoding antigen receptors and/or donor sequence compositions of the invention into “genomic safe harbor” sites. In certain embodiments, the mammalian genome sequence includes a genomic safe harbor region. In certain embodiments, the primate genome sequence includes a genomic safe harbor region. In certain embodiments, the human genomic sequence includes a genomic safe harbor region.

Genomic safe harbor sites must ensure that the newly inserted genetic element functions reliably (e.g., is expressed at a therapeutically effective expression level) and does not cause deleterious changes in the host genome that pose a risk to the host organism. integration can be accepted. Possible genomic safe harbors include the intronic sequence of the human albumin gene, adeno-associated virus site 1 (AAVS1), the naturally occurring integration site of the AAV virus on chromosome 19, the region of the chemokine (CC motif) receptor 5 ( CCR5 ) gene, and the mouse Rosa26 locus. Including, but not limited to, the human ortho log region.

In certain embodiments of the methods of the invention, homologous recombination involves converting sequences encoding antigen receptors and/or donor sequence compositions of the invention into one or more components of the endogenous T cell receptor or major histocompatibility complex (MHC). is introduced into the coding sequence. In certain embodiments, inducing homologous recombination within the genomic sequence encoding the endogenous T cell receptor or MHC destroys the endogenous gene and, optionally, replaces a portion of the coding sequence of the endogenous gene with the donor sequence composition of the invention. In certain embodiments, inducing homologous recombination within the genomic sequence encoding the endogenous T cell receptor or MHC destroys the endogenous gene and, in some cases, replaces the entire coding sequence of the endogenous gene with the donor sequence composition of the invention. In certain embodiments of the methods of the invention, introduction of a sequence encoding an antigen receptor of the invention or a donor sequence composition by homologous recombination operably links the antigen receptor to an endogenous T cell promoter. In certain embodiments of the methods of the invention, introduction of a sequence encoding an antigen receptor or donor sequence composition of the invention by homologous recombination operably links the antigen receptor or therapeutic protein to a transcriptional or translational regulatory element. In certain embodiments of the methods of the invention, introduction of a sequence encoding an antigen receptor or donor sequence composition of the invention by homologous recombination operably links the antigen receptor or therapeutic protein to a transcriptional regulatory element. In certain embodiments, the transcriptional regulatory element comprises an endogenous T cell 5'UTR.

In certain embodiments of the introduction step involving homologous recombination, the genome editing composition contacts the genomic sequence of at least one primary T cell of the plurality of T cells. In certain embodiments of the introduction step involving homologous recombination, the genome editing composition contacts the genomic sequence of a portion of the primary T cells of the plurality of T cells. In certain embodiments, the portion of primary T cells is at least 1%, 2%, 5%, 7%, 10%, 15%, 20%, 25%, 30% of the total number of primary T cells in the plurality of T cells. %, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or between them. It's an arbitrary percentage. In certain embodiments of the introduction step involving homologous recombination, the genome editing composition contacts the genomic sequence of each primary T cell of the plurality of T cells. In certain embodiments of the introduction step involving homologous recombination, the genome editing composition induces a single strand break. In certain embodiments of the introduction step involving homologous recombination, the genome editing composition induces double-strand breaks. In certain embodiments of the introduction step comprising homologous recombination, the introduction step further comprises a donor sequence composition. In certain embodiments, the donor sequence composition comprises a sequence encoding an antigen receptor. In certain embodiments, the donor sequence composition comprises a sequence encoding an antigen receptor, a 5' genomic sequence, and a 3' genomic sequence, wherein the 5' genomic sequence is 1 5' of the cleavage point induced by the genome editing composition. is homologous to or identical to the genomic sequence of a primary T cell, and the 3' genomic sequence is homologous to or identical to the genomic sequence of a primary T cell 3' of the cleavage point induced by the genome editing composition. In certain embodiments, the 5' genomic sequence and/or 3' genomic sequence is at least 50 bp, 100 bp, at least 200 bp, at least 300 bp, at least 400 bp, at least 500 bp, at least 600 bp, at least 700 bp, at least 800 bp. bp, at least 900 bp, at least 1000 bp, at least 1100 bp, at least 1200 bp, at least 1300 bp, at least 1400, or at least 1500 bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, at least 2000 bp in length or the base pair (bp) length of any of these, including the endpoints. In certain embodiments of the introduction step involving homologous recombination, the genome editing composition and the donor sequence composition are contacted simultaneously or sequentially with the genomic sequence. In certain embodiments of the introduction step involving homologous recombination, the genome editing composition and the donor sequence composition are contacted sequentially with the genomic sequence, with the genome editing composition provided first. In certain embodiments of the introduction step involving homologous recombination, the genome editing composition comprises a sequence encoding a DAN binding domain and a sequence encoding a nuclease domain. In certain embodiments of the introduction step involving homologous recombination, the genome editing composition includes a DNA binding domain and a nuclease domain. In certain embodiments of the genome editing composition, the DNA binding domain comprises a guide RNA (gRNA). In certain embodiments of the genome editing composition, the DNA binding domain comprises the DNA binding domain of a TALEN. In certain embodiments of the genome editing composition, the DNA binding domain comprises the DNA binding domain of a ZFN. In certain embodiments of the genome editing composition, the nuclease domain comprises Cas9 nuclease or a sequence thereof. In certain embodiments of the genome editing composition, the nuclease domain is an inactive Cas9 (SEQ ID NO: 33, aspartic acid (D) to alanine (A) substitution at position 10 (D10A) and histidine (H) to alanine at position 840. (A), including the substitution (H840A). In certain embodiments of the genome editing composition, the nuclease domain comprises a short inactive Cas9 (SEQ ID NO: 32, an aspartic acid (D) to alanine (A) substitution at position 10 (D10A) and an asparagine (N) at position 540. Includes substitution (N540A) to alanine (A). In certain embodiments of the genome editing composition, the nuclease domain comprises or further comprises a type IIS endonuclease. In certain embodiments of the genome editing composition, type IIS endonucleases include AciI, Mn1I, AlwI, BbvI, BccI, BceAI, BsmAI, BsmFI, BspCNI, BsrI, BtsCI, HgaI, HphI, HpyAV, Mbo1I, My1I, PleI, SfaNI, AcuI, BciVI, BfuAI, BmgBI, BmrI, BpmI, BpuEI, BsaI, BseRI, BsgI, BsmI, BspMI, BsrBI, BsrBI, BsrDI, BtgZI, BtsI, EarI, EciI, MmeI, NmeAIII, BbvCI, Bpu10I, BspQI, Contains SapI, BaeI, BsaXI, CspCI, BfiI, MboII, Acc36I, FokI or Clo051. In certain embodiments, the type IIS endonuclease comprises Clo051. In certain embodiments of the genome editing composition, the nuclease domain comprises or further comprises a TALEN or a nuclease domain thereof. In certain embodiments of the genome editing composition, the nuclease domain comprises or further comprises a ZFN or a nuclease domain thereof. In certain embodiments of the introduction step involving homologous recombination, the genome editing composition induces breaks in the genomic sequence and the donor sequence composition is inserted using the endogenous DNA repair mechanisms of the primary T cell. In certain embodiments of the introduction step involving homologous recombination, insertion of the donor sequence composition removes the DNA binding site of the genome editing composition, thereby preventing further activity of the genome editing composition.

In certain embodiments of the homologous recombination methods of the invention, the nuclease domain of the genome editing composition or construct is capable of introducing cleavages at defined positions within the genomic sequence of a primary human T cell, producing homodimers or heterodimers. It may include, consist essentially of, or consist of. In certain embodiments, the nuclease is an endonuclease. Effector molecules, including effector molecules comprising homodimers or heterodimers, may comprise, consist essentially of, or consist of Cas9, a Cas9 nuclease domain, or fragments thereof. In certain embodiments, Cas9 is catalytically inactive or “deactivated” Cas9 (dCas9). In certain embodiments, Cas9 is the catalytically inactive or “deactivated” nuclease domain of Cas9. In certain embodiments, dCas9 is encoded by a shorter sequence derived from full-length catalytically inactivated Cas9, referred to herein as “small” dCas9 or dSaCas9.

In certain embodiments, inactivated small Cas9 (dSaCas9) is operably linked to an active nuclease. In certain embodiments, the invention provides a fusion protein comprising, consisting essentially of, or consisting of a DNA binding domain and a molecular nuclease, the nuclease comprising small inactivated Cas9 (dSaCas9). In certain embodiments, dSaCas9 of the invention comprises the mutations D10A and N580A (underlined and bold) that inactivate the catalytic site. In certain embodiments, dSaCas9 of the invention comprises the following amino acid sequence:

In certain embodiments, dCas9 of the invention comprises dCas9 isolated or derived from Staphyloccocus pyogenes. In certain embodiments, the dCas9 comprises a dCas9 with substitutions at positions 10 and 840 of the amino acid sequence of dCas9 that inactivate the catalytic site. In certain embodiments, these substitutions are D10A and H840A. In certain embodiments, the amino acid sequence of dCas9 comprises the following sequence:

In certain embodiments of the invention, the nuclease domain may comprise, consist essentially of, or consist of dCas9 or dSaCas9 and a type IIS endonuclease. In certain embodiments herein, the nuclease domain is AciI, Mn1I, AlwI, BbvI, BccI, BceAI, BsmAI, BsmFI, BspCNI, BsrI, BtsCI, HgaI, HphI, HpyAV, Mbo1I, My1I, PleI, SfaNI, AcuI, BciVI, BfuAI, BmgBI, BmrI, BpmI, BpuEI, BsaI, BseRI, BsgI, BsmI, BspMI, BsrBI, BsrBI, BsrDI, BtgZI, BtsI, EarI, EciI, MmeI, NmeAIII, BbvCI, Bpu10I, BspQI, SapI, BaeI, It may comprise, consist essentially of, or consist of a type IIS endonuclease, including but not limited to BsaXI, CspCI, BfiI, MboII, Acc36I, FokI, or Clo051, and dSaCas9. In certain embodiments of the invention, the nuclease domain may comprise, consist essentially of, or consist of dSaCas9 and Clo051. An exemplary Clo051 nuclease domain may comprise, consist essentially of, or consist of the following amino acid sequence:

An exemplary dCas9-Clo051 nuclease domain may comprise, consist essentially of, or consist of the following amino acid sequences (Clo051 sequence is underlined, linker is in bold italics, dCas9 sequence is in italics):

In certain embodiments, the nuclease capable of introducing a cleavage at a defined location within the genomic DNA of a primary human T cell may comprise, consist essentially of, or consist of a homodimer or heterodimer. The nuclease domain of the genome editing composition or construct of the invention may comprise, consist essentially of, or consist of a nuclease domain isolated, derived, or recombinant from a transcription activator-like effector nuclease (TALEN). TALENs are transcription factors with programmable DNA binding domains that provide a way to create designer proteins that bind to predetermined DNA sequences or individual nucleic acids. Modular DNA-binding domains have been identified in transcriptional activator-like (TAL) proteins, or more specifically transcriptional activator-like effector nucleases (TALENs), to enable the discovery of new (new) sequences of synthetic transcription factors that bind to DNA sequences of interest. de novo) and, if desired, enable the second domain present on the protein or polypeptide to perform DNA-related activities. TAL proteins are derived from the organisms Xanthomonas and Ralstonia .

In certain embodiments of the invention, the nuclease domain of the genome editing composition or construct may comprise, consist essentially of, or consist of a nuclease domain isolated, derived, or recombinant from a TALEN and type IIS endonuclease. there is. In certain embodiments of the invention, the type IIS endonuclease is AciI, Mn1I, AlwI, BbvI, BccI, BceAI, BsmAI, BsmFI, BspCNI, BsrI, BtsCI, HgaI, HphI, HpyAV, Mbo1I, My1I, PleI, SfaNI , AcuI, BciVI, BfuAI, BmgBI, BmrI, BpmI, BpuEI, BsaI, BseRI, BsgI, BsmI, BspMI, BsrBI, BsrBI, BsrDI, BtgZI, BtsI, EarI, EciI, MmeI, NmeAIII, BbvCI, Bpu10I, BspQI, SapI , BaeI, BsaXI, CspCI, BfiI, MboII, Acc36I, FokI or Clo051. In certain embodiments of the invention, the type IIS endonuclease may comprise, consist essentially of, or consist of Clo051 (SEQ ID NO: 34).

In certain embodiments of the invention, the nuclease domain of the genome editing composition or construct comprises a nuclease domain isolated, derived or recombinant from zinc finger nucleases (ZFNs) and type IIS endonucleases, or It may consist essentially or consist of this. In certain embodiments of the invention, the type IIS endonuclease is AciI, Mn1I, AlwI, BbvI, BccI, BceAI, BsmAI, BsmFI, BspCNI, BsrI, BtsCI, HgaI, HphI, HpyAV, Mbo1I, My1I, PleI, SfaNI , AcuI, BciVI, BfuAI, BmgBI, BmrI, BpmI, BpuEI, BsaI, BseRI, BsgI, BsmI, BspMI, BsrBI, BsrBI, BsrDI, BtgZI, BtsI, EarI, EciI, MmeI, NmeAIII, BbvCI, Bpu10I, BspQI, SapI , BaeI, BsaXI, CspCI, BfiI, MboII, Acc36I, FokI or Clo051. In certain embodiments of the invention, the type IIS endonuclease may comprise, consist essentially of, or consist of Clo051 (SEQ ID NO: 34).

In certain embodiments of the genome editing compositions or structures herein, the DNA binding domain and nuclease domain can be covalently linked. For example, a fusion protein may include a DNA binding domain and a nuclease domain. In certain embodiments of the genome editing compositions or structures of the invention, the DNA binding domain and the nuclease domain can be operably linked via a non-covalent bond.

Secreted proteins from modified T cells

In certain embodiments of the compositions and methods of the invention, the modified T cells express therapeutic proteins. Therapeutic proteins of the invention include secreted proteins. Preferably, in the context of treatment, the therapeutic protein is a human protein, including a secreted human protein. When expressed or secreted by CAR-T cells of the invention, combinations comprising CAR-T cells and therapeutic proteins secreted therefrom can be considered monotherapy. However, the CAR-T cells of the present invention can be administered in combination therapy with a second drug. A database of human secreted proteins that can be expressed or secreted by the modified T cells of the invention can be found at proteinatlas.org/search/protein_class:Predicted%20secreted%20proteins, the contents of which are incorporated herein by reference. Exemplary human secreted proteins are provided, but are not limited to the human secreted proteins in Table 1.

<Table 1>

In some embodiments of the invention, T cells are modified to express therapeutic proteins, including secreted proteins and secreted human proteins. In some embodiments of the methods of treating disorders, a coagulation disorder is treated using a composition comprising CAR-T cells modified to express or secrete a human protein. Blood clotting occurs through a multistep process known as the coagulation cascade. In the extrinsic pathway, tissue factor (also known as factor III or thromboplastin) contacts factor VII to form the activated VIIa complex. This initiates the coagulation protease cascade, converting inactive factor In the endogenous pathway, collagen forms a complex with high molecular weight kininogen, prekallikrein, and factor XII, converting factor XII to factor XIIa. Factor XIIa converts factor Converts to thrombin (IIa). Thrombin in turn converts fibrinogen (I) to fibrin, which, together with factor XIIIa, forms cross-linked fibrin clots. Many coagulation disorders are the result of low levels of secreted proteins in the blood involved in the coagulation cascade. Clotting disorders can significantly increase the amount of blood lost from the body during an injury or cause bleeding under the skin or in vital organs. This disorder is often genetic. Exemplary, but non-limiting, diseases caused by deficiencies of clotting factors include hemophilia, von Willebrand disease, and deficiencies of antithrombin III, protein C, or protein S. Hemophilia A and B are X-linked and are caused by insufficient levels of clotting factor VIII and factor IX (FIX), respectively. Hemophilia C is caused by insufficient factor XI. Factor II, VII, X, or XII deficiency can also cause bleeding disorders. Von Willebrand disease is caused by low levels of von Willebrand clotting factor in the blood. In some cases, a deficiency in a blood protein that regulates clotting can result in too many clots. Factor V Leiden is an inherited disease in which the Factor V Leiden protein overreacts, causing too frequent or excessive clotting of the blood. Deficiency of antithrombin III, protein C, or protein S, which help control bleeding, can also cause excessive clotting. Currently, coagulation disorders such as hemophilia are treated with blood transfusions or injections of deficient clotting factors (replacement therapy). However, complications of replacement therapy include the development of antibodies to clotting factors, viral infections from blood-derived products, and joint damage. Therefore, additional treatments are required.

In some embodiments of the invention, T cells are modified to express therapeutic proteins, including secreted proteins and secreted human proteins. In some embodiments of the methods of treatment, compositions comprising CAR-T cells modified to express or secrete human proteins are used in enzyme replacement therapy. Enzyme replacement therapy typically involves intravenous infusion of a therapeutically effective amount of a composition containing an enzyme that counteracts the underlying enzyme defect causing the symptoms of the disease. Therefore, the missing enzyme activity is supplied exogenously in this way. Exemplary diseases that can be treated by the modified T cells of the present invention include lysosomal storage disease, Gaucher disease (glucocerebrosidase enzyme), Fabry disease, mucopolysaccharidosis I (MPS I), mucopolysaccharidosis II (MPS II, or Hunter syndrome, caused by iduronate 2-sulfatase deficiency), mucopolysaccharidosis VI (MPS VI, caused by arylsulfatase B deficiency), and Pompe disease (or glycogen storage disease) Type II, caused by acid alpha-glucosidase deficiency). Additional conditions that can be treated with enzyme replacement therapy include adenosine deaminase (ADA) deficiency, hyperammonemia due to deficiency of the liver enzyme N-acetylglutamate synthetase (NAGS), and hypophosphatemia. Includes, but is not limited to, enzymopathy, lysosomal acid lipase deficiency, Morchio syndrome A, Wolman's LAL lysosomal acid lipase deficiency, A1AT (Alpha1-Antitrypsin) deficiency, and urea cycle disease. The enzymes supplied to patients during enzyme replacement therapy are alpha1-antitrypsin, β-glucocerebrosidase, adenosine deaminase, alpha-galactosidase A, α-L-iduronidase, and iduronate- Including, but not limited to, 2-sulfatase, N-acetylgalactosamine-6 sulfatase, N-acetylgalactosamine-4 sulfatase, and lysosomal acid lipase.

In some embodiments of the invention, T cells are modified to express therapeutic proteins, including secreted proteins and secreted human proteins. In some embodiments of the methods of the disorder, a composition comprising CAR-T cells modified to express or secrete a human protein is used to produce a human antibody. In some embodiments, the disease treated by modified T cells expressing secretory proteins is a disease that can be treated via intravenous infusion or injection of an antibody or antibody fragment. In addition to cancer, antibody-based therapies are used to treat many types of conditions as well as other conditions, including infections and immune-based diseases such as arthritis and asthma. An exemplary, but non-limiting list of diseases that can be treated with the modified T cells of the invention include platelet aggregation, Clostirdium difficile infection, rheumatoid arthritis, Crohn's disease, plaque psoriasis, psoriatic arthritis, ankylosing arthritis. Spondylitis, juvenile idiopathic arthritis, Alzheimer's disease, sepsis, multiple sclerosis, hypercholesterolemia, systemic lupus erythematosus, prevention of organ transplant rejection, viral infections, asthma, severe allergic disorders, retinopathy, osteoporosis, inflammatory bowel disease, inflammatory diseases, Influenza A, paroxysmal nocturnal hemoglobinuria, sepsis caused by Gram-negative bacteria, psoriasis, invasive Candida infection, ulcerative colitis, hypocholesterolemia, respiratory syncytial virus infection, focal segmental glomerulosclerosis, graft-versus-host disease, ankylosing spondylitis, HIV infection. , ulcerative colitis, autoimmune disease, chronic asthma, reduction of scars after glaucoma surgery, hypercholesterolemia, leukocyte disease, systemic scleroderma, respiratory syncytial virus (prevention), lupus erythematosus, type 1 diabetes, inflammation, Pseudomonas aeruginosa (Pseudomonas aeruginosa) infection, macular degeneration, anthrax, cytomegalovirus infection, inflammation of the respiratory tract, skin and digestive tract, systemic lupus erythematosus, rheumatic diseases, uveitis, cytomegalovirus infection, dermatomyositis, polymyositis, fibrosis, choroid and retina. These include angiogenesis, muscular dystrophy, Staphylococcus aureus infection, lupus nephritis, follicular lymphoma, chronic hepatitis B and ulcerative colitis.

Infusion of modified cells as adoptive cell therapy

In certain embodiments of the invention, the modified cells of the invention are delivered to the patient via injection or intravenous infusion. In certain embodiments, a therapeutically effective amount of a composition of the invention or a composition comprising modified cells of the invention comprises 2x10 ⁵ to 5x10 ⁸ cells per kg of patient body weight per administration, or any range, value or fraction thereof. .

In certain embodiments herein, the modified cells of the invention are delivered to the patient via injection or intravenous infusion. In certain embodiments, a therapeutically effective amount of a composition of the invention or a composition comprising modified cells of the invention comprises 0.2x10 ⁶ to 20x10 ⁶ cells per kg of patient body weight per administration. In certain embodiments, a therapeutically effective amount of a composition of the invention or a composition comprising modified cells of the invention is 0.2x10 ⁶ cells per kg of patient body weight per dose, 2x10 ⁶ cells per kg of patient body weight per dose, kg of patient body weight per dose. Includes 20x10 ⁶ cells per dose, and any cells in between per kg of patient body weight per dose.

In certain embodiments of the invention, the modified cells of the invention are delivered to the patient via injection or intravenous infusion. In certain embodiments, a therapeutically effective amount of a composition of the invention or a composition comprising modified cells of the invention comprises 1x10 ⁶ cells or about 1x10 ⁶ cells per kg of patient body weight per administration.

In certain embodiments of the invention, the modified cells of the invention are delivered to the patient via injection or intravenous infusion. In certain embodiments, a therapeutically effective amount of a composition herein or a composition comprising modified cells of the invention comprises 3x10 ⁶ cells or about 3x10 ⁶ cells per kilogram of patient body weight per administration.

In certain embodiments of the invention, the modified cells of the invention are delivered to the patient via injection or intravenous infusion. In certain embodiments, a therapeutically effective amount of a composition of the invention or a composition comprising modified cells of the invention comprises 0.7x10 ⁶ to 6.7x10 ⁶ cells per kg of patient body weight per administration. In certain embodiments, a therapeutically effective amount of a composition of the invention or a composition comprising modified cells of the invention is 0.7x10 ⁶ cells per kg of patient body weight per dose, 6.7x10 6 cells per kg of patient body weight per dose, or 6.7x10 ⁶ cells per kg of patient body weight per dose. Includes any cells in between these per kg of body weight.

In certain embodiments of the invention, the modified cells of the invention are delivered to the patient via injection or intravenous infusion. In certain embodiments, a therapeutically effective amount of a composition of the invention or a composition comprising modified cells of the invention comprises 0.7x10 ⁶ to 16x10 ⁶ cells per kg of patient body weight per administration. In certain embodiments, a therapeutically effective amount of a composition of the invention or a composition comprising modified cells of the invention is 0.7x10 ⁶ cells per kg of patient body weight per dose, 2x10 ⁶ cells per kg of patient body weight per dose, kg of patient body weight per dose. 6x10 ⁶ cells per kg of patient body weight per dose, 10.7x10 ⁶ cells per kg of patient body weight per dose, 16x10 ⁶ cells per kg of patient body weight per dose, or any cells in between.

In certain embodiments herein, the modified cells of the invention are delivered to the patient via injection or intravenous infusion. In certain embodiments, a therapeutically effective amount of a composition of the invention or a composition comprising modified cells of the invention comprises 1.2x10 ⁶ to 7.1x10 ⁶ cells per kg of patient body weight per administration. In certain embodiments, a therapeutically effective amount of a composition of the invention or a composition comprising modified cells of the invention is 1.2x10 ⁶ cells per kg of patient body weight per dose, 7.1x10 6 cells per kg of patient body weight per dose, or 7.1x10 ⁶ cells per kg of patient body weight per dose. Includes any number of cells in between these per kg of body weight. In certain embodiments, a therapeutically effective amount of a composition of the invention or a composition comprising modified cells of the invention comprises 2x10 ⁶ to 3x10 ⁶ cells per kg of patient body weight per administration.

In certain embodiments of the invention, the modified cells of the invention are delivered to the patient via injection or intravenous infusion. In certain embodiments, a therapeutically effective amount of a composition of the invention or a composition comprising modified cells of the invention comprises 1106x10 ⁶ to 2106x10 ⁶ cells per kg of patient body weight per administration. In certain embodiments, a therapeutically effective amount of a composition of the invention or a composition comprising modified cells of the invention is 1106x10 ⁶ cells per kg of patient body weight per dose, 2106x10 ⁶ cells per kg of patient body weight per dose, or per kg of patient body weight per dose. Includes any number of cells in between. In certain embodiments of the invention, the modified cells of the invention are delivered to the patient via injection or intravenous infusion. In certain embodiments, a therapeutically effective amount of a composition of the invention or a composition comprising modified cells of the invention comprises 0.7x10 ⁶ to 1.3x10 ⁶ cells per kg of patient body weight per administration. In certain embodiments, a therapeutically effective amount of a composition of the invention or a composition comprising modified cells of the invention is 0.7x10 ⁶ cells per kg of patient body weight per dose, 1.3x10 6 cells per kg of patient body weight per dose, or 0.7x10 ⁶ cells per kg of patient body weight per dose. Includes any number of cells in between these per kg of body weight.

In certain embodiments of the invention, the modified cells of the invention are delivered to the patient via injection or intravenous infusion. In certain embodiments, a therapeutically effective amount of a composition of the invention or a composition comprising modified cells of the invention comprises single or multiple doses. In certain embodiments, a therapeutically effective amount of a composition of the invention or a composition comprising modified cells of the invention comprises divided doses. In certain embodiments, a therapeutically effective amount of a composition of the invention or a composition comprising modified cells includes an initial dose and a maintenance dose.

In certain embodiments of the invention, the modified cells are T cells, and the T cells can be propagated in vitro or sorted according to T cell markers prior to formulation with a pharmaceutically acceptable carrier. In some embodiments, modified T cells can be sorted using CD8+ and/or CD4+ markers.

nucleic acid molecule

Nucleic acid molecules of the invention encoding protein scaffolds may be in the form of RNA, such as mRNA, hnRNA, tRNA, or any other form, including, but not limited to, cDNA and genomic DNA obtained by cloning or synthetically produced. It may be in the form of DNA, or any combination thereof. DNA may be triple-stranded, double-stranded or single-stranded or any combination thereof. Any portion of at least one strand of DNA or RNA may be the coding strand, also known as the sense strand, or the non-coding strand, also known as the antisense strand.

Isolated nucleic acid molecules of the invention may contain at least one specific element of at least one protein scaffold, such as, but not limited to, an open reading frame (ORF), optionally together with one or more introns. A nucleic acid molecule containing a portion; A nucleic acid molecule comprising a coding sequence for a protein scaffold or loop region that binds to a target protein; and protein scaffolds, Centyrin, CAR, CARTyrin, transposons and/or as described herein and/or known in the art, but comprising nucleotide sequences that differ substantially from those described above, but due to the degeneracy of the genetic code. It may contain a nucleic acid molecule that still encodes a transposase. Of course, the genetic code is well known in the art. Accordingly, it will be routine for those skilled in the art to generate such degenerate nucleic acid variants encoding specific protein scaffolds of the invention. See, for example, Ausubel, et al., supra, and such nucleic acid variants are encompassed by the present invention.

As indicated herein, a nucleic acid molecule of the invention comprising a nucleic acid encoding a protein scaffold, Centyrin, CAR, CARTyrin, transposon and/or transposase may be a protein scaffold, Centyrin, CAR, CARTyrin, transposon and/or or encoding the amino acid sequence of the transposase fragment itself; Coding sequences for full protein scaffolds, Centyrin, CAR, CARTyrin, transposon, and/or transposase or portions thereof; The splicing and Additional molecules, including but not limited to non-coding 5' and 3' sequences, such as transcribed untranslated sequences, play a role in transcription, mRNA processing, including polyadenylation signals (e.g., ribosome binding and stability of mRNA). In addition to non-coding sequences, additional sequences, such as at least one signal leader or coding sequence for a fusion peptide; It may include, but is not limited to, additional coding sequences that code for additional amino acids, such as amino acids that provide additional functions. Accordingly, a sequence encoding a protein scaffold, Centyrin, CAR, CARTyrin, transposon and/or transposase may be a fused protein scaffold, Centyrin, CAR, CARTyrin, transposon and/or transposase comprising a protein scaffold fragment or portion. Can be fused to a marker sequence, such as a sequence encoding a peptide, which facilitates purification of the blastase.

Production of nucleic acids

Isolated nucleic acids of the invention can be prepared using (a) recombinant methods, (b) synthetic techniques, (c) purification techniques, and/or (d) combinations thereof, as are well known in the art. .

Nucleic acids may conveniently include sequences other than the polynucleotides of the invention. For example, multiple cloning sites containing one or more endonuclease restriction sites can be inserted into the nucleic acid to aid in the isolation of polynucleotides. Additionally, translatable sequences can be inserted to aid in the isolation of translated polynucleotides of the invention. For example, hexa-histidine marker sequences provide a convenient means of purifying proteins of the invention. Nucleic acids herein, excluding coding sequences, are vectors, adapters or linkers, as appropriate, for cloning and/or expression of polynucleotides of the invention.

Additional sequences may be added to the cloning and/or expression sequences to optimize function in cloning and/or expression, to aid isolation of the polynucleotide, or to enhance introduction of the polynucleotide into cells. The use of cloning vectors, expression vectors, adapters and linkers is well known in the art (see, for example, Ausubel, supra or Sambrook, supra).

Recombinant method for producing nucleic acids

Isolated nucleic acid compositions of the invention, such as RNA, cDNA, genomic DNA, or any combination thereof, can be obtained from biological sources using many cloning methodologies known to those skilled in the art. In some embodiments, oligonucleotide probes that selectively hybridize to polynucleotides of the invention under stringent conditions are used to identify sequences of interest in a cDNA or genomic DNA library. Isolation of RNA and construction of cDNA and genomic libraries are well known to those skilled in the art (see, for example, Ausubel, supra or Sambrook, supra).

Vector and host cell

The invention also relates to the production of vectors containing isolated nucleic acid molecules of the invention, host cells genetically engineered with recombinant vectors, and at least one protein scaffold by recombinant techniques, as known in the art. See, for example, Sambrook, et al.; Ausubel, et al., each of which is hereby incorporated by reference in its entirety.

For example, the PB-EF1a vector can be used. The vector contains the following nucleotide sequence:

The polynucleotide may optionally be linked to a vector containing a selection marker for propagation in the host. Typically, the plasmid vector is introduced as a precipitate such as calcium phosphate precipitate or as a complex with a charged lipid. If the vector is a virus, it can be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.

The DNA insert must be operably linked to an appropriate promoter. The expression construct will further include sites for transcription initiation and termination and ribosome binding sites for translation within the region to be transcribed. The coding portion of the mature transcript expressed by the construct will preferably comprise translation initiation at start and stop codons (e.g., UAA, UGA or UAG) appropriately positioned at the terminus of the mRNA to be translated, and Alternatively, UAA and UAG are preferred in eukaryotic expression.

The expression vector will preferably but optionally also contain at least one selectable marker. These markers include, for example, ampicillin, zeocin ( Sh bla gene), puromycin ( pac gene), hygromycin B ( hygB gene), G418/geneticin ( neo gene), for eukaryotic cell culture. Mycophenolic acid or glutamine synthetase (GS, U.S. Patent Nos. 5,122,464; 5,770,359; 5,827,739), blasticidin ( bsd gene) resistance genes, as well as E. Ampicillin, zeocin ( Sh bla gene), puromycin ( pac gene), hygromycin B ( hygB gene), G418/geneticin ( neo gene), kanamycin, speck for culturing in E. coli and other bacteria or prokaryotes. Resistance genes include, but are not limited to, tinomycin, streptomycin, carbenicillin, bleomycin, erythromycin, polymyxin B or tetracycline (the above patents are hereby incorporated by reference in their entirety). Culture media and conditions suitable for the host cells described above are known in the art. Suitable vectors will be readily apparent to those skilled in the art. Introduction of vector constructs into host cells can be accomplished by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid mediated transfection, electroporation, transduction, infection or other known methods. This method is described in Sambrook, Chapters 1-4 and 16-18; See Ausubel, Chapters 1, 9, 13, 15, 16.

The expression vector will preferably, however optionally, include at least one selectable cell surface marker for isolating cells modified by the compositions and methods of the invention. Selectable cell surface markers of the invention include surface proteins, glycoproteins, or groups of proteins that distinguish a cell or subset of cells from another defined subset of cells. Preferably the selectable cell surface marker distinguishes cells that have been modified by a composition or method of the invention from cells that have not been modified by a composition or method of the invention. These cell surface markers are “cell surface antigen clusters of designation” or “classification of determinant” proteins (often abbreviated “CD”), such as CD19, CD271, CD34, CD22, CD20. , truncated or full-length forms of CD33, CD52, or any combination thereof. Cell surface markers further include the suicide gene marker RQR8 (Philip B et al. Blood. 2014 Aug 21; 124(8):1277-87).

The expression vector will preferably, however optionally, contain at least one selectable drug resistance marker for isolating cells modified by the compositions and methods of the invention. Selectable drug resistance markers of the present invention may include wild-type or mutant Neo, DHFR, TYMS, FRANCF, RAD51C, GCS, MDR1, ALDH1, NKX2.2, or any combination thereof.

At least one protein scaffold of the invention can be expressed in modified forms, such as fusion proteins, and can contain additional heterologous functional regions as well as secretion signals. For example, additional amino acids, especially regions of charged amino acids, can be added to the N-terminus of the protein scaffold to improve stability and persistence in host cells, during purification, or during subsequent handling and storage. Additionally, peptide moieties can be added to the protein scaffolds of the invention to facilitate purification. These regions may be removed prior to final fabrication of the protein scaffold or at least one fragment thereof. This method is described in Sambrook, Chapters 17.29-17.42 and 18.1-18.74; It is described in many standard laboratory manuals such as Ausubel, Chapters 16, 17 and 18].

Those skilled in the art are familiar with the numerous expression systems available for expression of nucleic acids encoding proteins of the invention. Alternatively, the nucleic acids of the invention can be expressed in a host cell by turning on (by engineering) a host cell containing endogenous DNA encoding a protein scaffold of the invention. These methods are well known in the art, as described in U.S. Patent Nos. 5,580,734, 5,641,670, 5,733,746, and 5,733,761, all of which are incorporated herein by reference.

Examples of cell cultures useful for the production of protein scaffolds, specific portions or variants thereof are bacterial, yeast and mammalian cells, as known in the art. Mammalian cell systems will often exist in the form of a single layer of cells, although mammalian cell suspensions or bioreactors may be used. A number of suitable host cell lines capable of expressing intact glycosylated proteins have been developed in the art, for example, American Type Culture Collection (Manassas, VA) (www.atcc). .org), COS-1 (e.g., ATCC CRL 1650), COS-7 (e.g., ATCC CRL-1651), HEK293, BHK21 (e.g., ATCC CRL-10), CHO ( e.g. ATCC CRL 1610) and BSC-1 (e.g. ATCC CRL-26) cell lines, Cos-7 cells, CHO cells, hep G2 cells, P3X63Ag8.653, SP2/0-Ag14, 293 cells, HeLa Including cells, etc. Preferred host cells include cells of lymphoid origin, such as myeloma and lymphoma cells. Particularly preferred host cells are P3X63Ag8.653 cells (ATCC Accession No. CRL-1580) and SP2/0-Ag14 cells (ATCC Accession No. CRL-1851). In a particularly preferred embodiment, the recombinant cells are P3X63Ab8.653 or SP2/0-Ag14 cells.

Expression vectors for these cells may include one or more of the following expression control sequences, such as, but not limited to: an origin of replication; Promoters (e.g., late or early SV40 promoter, CMV promoter (U.S. Patent Nos. 5,168,062; 5,385,839), HSV tk promoter, pgk (phosphoglycerate kinase) promoter, EF-1 alpha promoter (U.S. Patent No. 5,266,491 ), at least one human promoter, enhancer, and/or processing information site, such as a ribosome binding site, RNA splice site, polyadenylation site (e.g., SV40 large T Ag poly A addition site), and transcription Termination sequence. See, e.g., Ausubel et al.; Sambrook, et al., supra. Other cells useful for the production of nucleic acids or proteins of the invention are known or include, for example, cell lines and hybridomas. Available from the American Type Culture Collection Catalog (www.atcc.org) or other known or commercial sources.

When eukaryotic host cells are used, polyadenylation or transcription termination sequences are typically incorporated into the vector. An example of a termination sequence is the polyadenylation sequence of the bovine growth hormone gene. Sequences for correct splicing of the transcript may also be included. An example of a splicing sequence is the VP1 intron of SV40 (Sprague, et al., J. Virol. 45:773-781 (1983)). Additionally, genetic sequences for controlling replication in host cells can be incorporated into the vector as is known in the art.

Purification of protein scaffolds

Protein scaffolds can be used for protein A purification, ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography, and lectins. Can be recovered and purified from recombinant cell culture by well-known methods including, but not limited to, chromatography. High performance liquid chromatography (“HPLC”) can also be used for purification. See, for example, Colligan, Current Protocols in Immunology, or Current Protocols in Protein Science, John Wiley & Sons, NY, N.Y., (1997-2001), e.g., Chapters 1, 4, 6, 8, 9, 10, each of which is hereby incorporated by reference in its entirety.

Protein scaffolds of the present invention can be obtained as natural purified products, products of chemical synthesis procedures, and, for example, E. coli. Includes products produced by recombinant techniques from prokaryotic or eukaryotic hosts, including coli, yeast, higher plant, insect and mammalian cells. Depending on the host used in the recombinant production procedure, the protein scaffolds of the invention may or may not be glycosylated. This method is described in Sambrook, Sections 17.37-17.42; Ausubel, Chapters 10, 12, 13, 16, 18 and 20, and Colligan, Protein Science, Chapters 12-14, all of which are incorporated herein by reference in their entirety.

variant

The amino acids that make up the protein scaffolds of the invention are often abbreviated. Amino acid notation may be indicated by designating the amino acid by a single letter code, a three letter code, a name, or by three nucleotide codon(s) as is well understood in the art (Alberts, B., et al., Molecular Biology of The Cell, Third Ed., Garland Publishing, Inc., New York, 1994]. Protein scaffolds herein may include one or more amino acid substitutions, deletions, or additions, either from natural mutations or human manipulation, as specified herein. Amino acids essential for function in the protein scaffolds of the invention can be identified by site-directed mutagenesis or alanine scanning mutagenesis (see, e.g., Ausubel, Chapters 8, 15; Cunningham and Wells, Science 244:1081, supra) -1085 (1989)]). The latter procedure introduces a single alanine mutation to every residue within the molecule. The resulting mutant molecules are then tested for biological activity, such as, but not limited to, one or more neutralizing activities. Sites critical for protein scaffold binding can also be identified by structural analysis, such as crystallization, nuclear magnetic resonance, or photoaffinity labeling (Smith, et al., J. Mol. Biol. 224:899-904 (1992) and de Vos, et al., Science 255:306-312 (1992)).

As used throughout this specification, the term “substantially complementary” includes 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, A region of at least 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 180, 270, 360, 450, 540 nucleotides or amino acids. refers to a first sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to the complement of a second sequence, or It means that two sequences hybridize under stringent hybridization conditions.

As used throughout this specification, the term "substantially identical" means that the first sequence and the second sequence are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20. , 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 180, 270, 360, 450, 540 At least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to a region of one or more nucleotides or amino acids, or with respect to a nucleic acid It refers to the case where the first sequence is substantially complementary to the complement of the second sequence.

As used throughout this specification, the term “variant”, when used to describe a nucleic acid, refers to (i) a portion or fragment of a referenced nucleotide sequence; (ii) the complement of the referenced nucleotide sequence or portion thereof; (iii) a nucleic acid that is substantially identical to the referenced nucleic acid or its complement; or (iv) a nucleic acid that hybridizes under stringent conditions to the referenced nucleic acid, its complement, or a sequence substantially identical thereto.

As used throughout this specification, the term “vector” refers to a nucleic acid sequence that contains an origin of replication. The vector may be a viral vector, bacteriophage, bacterial artificial chromosome, or yeast artificial chromosome. The vector may be a DNA or RNA vector. The vector may be a self-replicating extrachromosomal vector, and is preferably a DNA plasmid.

As used throughout this specification, the term “variant,” when used to describe a peptide or polypeptide, differs in amino acid sequence by insertion, deletion, or conservative substitution of amino acids, but retains at least one biological activity. Refers to a peptide or polypeptide. Additionally, a variant may refer to a protein having an amino acid sequence that is substantially identical to a reference protein having an amino acid sequence that retains at least one biological activity.

Conservative substitution of amino acids, i.e., replacement of an amino acid with a different amino acid of similar properties (e.g., hydrophilicity, degree and distribution of charged regions), is recognized in the art as generally involving minor changes. These minor changes can be identified, in part, by considering the hydropathic index of the amino acid, as understood in the art (Kyte et al., J. Mol. Biol. 157: 105-132 (1982 )). The hydrophobicity index of an amino acid is based on considerations of hydrophobicity and charge. Amino acids of similar hydrophilic index can be substituted and still maintain protein function. In one embodiment, an amino acid with a hydrophobic index of ±2 is substituted. The hydrophilicity of amino acids can also be used to reveal substitutions that allow proteins to maintain biological function. Considering the hydrophilicity of the amino acids in relation to the peptide, the greatest local average hydrophilicity of the peptide can be calculated, which is a useful measure that has been reported to have an excellent correlation with antigenicity and immunogenicity. No. 4,554,101, incorporated herein by reference in its entirety.

Substitution of amino acids with similar hydrophilicity values can allow the peptide to retain biological activity, such as immunogenicity. Substitutions can be made with amino acids having hydrophilicity values within ±2 of each other. Both the hydrophobicity index and the hydrophilicity value of an amino acid are influenced by the specific side chain of that amino acid. Consistent with such observations, amino acid substitutions compatible with biological function are understood to be determined by the relative similarity of amino acids, especially the side chains of the amino acids, as indicated by hydrophobicity, hydrophilicity, charge, size and other properties.

As used herein, “conservative” amino acid substitutions may be defined as set forth in Tables A, B, or C below. In some embodiments, the fusion polypeptide and/or the nucleic acid encoding such fusion polypeptide comprises conservative substitutions introduced by modification of the polynucleotide encoding the polypeptide of the invention. Amino acids can be classified according to their physical properties and contribution to secondary and tertiary protein structure. A conservative substitution is the substitution of one amino acid for another amino acid with similar properties. Exemplary conservative substitutions are presented in Table A.

<Table A>

Alternatively, conservative amino acids are described in Lehninger, Biochemistry, Second Edition; Worth Publishers, Inc. NY, N.Y. (1975), pp.71-77].

<Table B>

Alternatively, exemplary conservative substitutions are presented in Table C.

<Table C>

Polypeptides of the invention should be understood to include polypeptides having modifications other than insertions, deletions or substitutions of amino acid residues, as well as one or more insertions, deletions or substitutions of amino acid residues, or any combination thereof. A polypeptide or nucleic acid of the invention may contain one or more conservative substitutions.

As used throughout this specification, the term “more than one” of such amino acid substitutions includes 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, Contains 17, 18, 19 or 20 or more of the amino acid substitutions listed above. The term “more than one” may refer to 2, 3, 4 or 5 listed amino acid substitutions.

The polypeptides and proteins of the invention, their entire sequence or any portion thereof may be non-naturally occurring. Polypeptides and proteins of the invention may contain one or more mutations, substitutions, deletions or insertions that do not occur naturally, rendering the overall amino acid sequence non-naturally occurring. Polypeptides and proteins of the invention may contain one or more overlapping, inverted, or repeated sequences, resulting in the sequence being non-naturally occurring and rendering the overall amino acid sequence non-naturally occurring. Polypeptides and proteins of the invention may contain modified, artificial or synthetic amino acids that are not naturally occurring, rendering the overall amino acid sequence non-naturally occurring.

As used throughout this specification, “sequence identity” means blasting two sequences (bl2seq) that can be retrieved from the National Center for Biotechnology Information (NCBI) ftp site using default parameters. (Tatusova and Madden, FEMS Microbiol Lett., 1999, 174, 247-250; incorporated herein by reference in its entirety). The terms “identical” or “identity” when used in reference to two or more nucleic acid or polypeptide sequences refer to a specified percentage of identical residues over a specified region of each sequence. The percentage optimally aligns the two sequences, compares the two sequences over a specified region, determines the number of positions where identical residues occur in the two sequences, yields the number of matched positions, and calculates the number of matched positions as specified. It can be calculated by dividing by the total number of positions in the region and multiplying the result by 100 to get the percent sequence identity. If the two sequences differ in length or the alignment produces one or more staggered ends and the specified comparison region contains only a single sequence, residues from the single sequence are included in the denominator of the calculation but not in the numerator. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered equivalent. Identity can be obtained manually or using computer sequence algorithms such as BLAST or BLAST 2.0.

Example

Example 1: Production of stem-like modified T cells

The following is an illustrative, non-limiting example of one protocol to modify T cells to express chimeric antigen receptors (CARs) under conditions that induce or preserve the desired stem-like properties of the T cells.

Day 0: Nucleofection of T cells

Prewarm Immunocult™-XF T Cell Proliferation Medium (Stemcell Technologies, Cat #: 10981) in a high humidity incubator at 37°C, 5% CO ₂ . For 5x10 ⁶ T cells/reaction (100 μl cuvette size), warm 3 mL of medium per reaction in a single well of a 6-well plate. For ^25x106 T cells/reaction (100 μl cuvette size), warm 20 mL of medium per reaction in Gx-Rex10 (Wilson Wolf, Cat #: 80040S).

Warm P3 primary cell solution (Lonza, Cat #: PBP3-02250) to room temperature and add supplements if necessary.

Turn on the core unit (Lonza, Cat #: AAF-1002B) of the 4D-Nucleofector™ system, which controls the X-Unit (Lonza, Cat #: AAF-1002X). Program the number of nucleofection required to use P3 buffer. EO-210 Program.

Label cuvettes, pre-open transfer pipettes (provided with the Lonza P3 kit), and prepare appropriate dilutions of nucleic acids before working with cells.

For transposon plasmids, prepare a 0.5 μg/μl solution in nuclease-free H ₂ O.

Count the collected CD14, CD56, and CD19 depleted cells using CliniMACs Prodigy and calculate the volume required for the required cell number.

Centrifuge T cells for 10 minutes at 90 g with braking at 7 in a Heraeus Multifuge X3R benchtop centrifuge (Thermofisher Scientific). When performing multiple reactions using the same number of cells per reaction, centrifuge all cells needed in a single centrifuge tube. Depending on volume, 15 mL (Fisher, Cat #: 14-959-49B) or 50 mL (Fisher, Cat #: 14-959-49A) conical tubes can be used. During the centrifugation process, nucleic acids are added directly to the bottom of the cuvette provided with the P3 Primary Cell Solution box (Lonza, Cat #: PBP3-02250). Add 2 µl of the 0.5 µg/µl transposon plasmid solution made in Step 4 to one bottom corner of the cuvette for a total of 1 µg of transposon. Add 5 μg of Super Piggyback™ (SPB) transposase mRNA to the other corner of the cuvette.

Because mRNA can be rapidly degraded, it is optimal to minimize contact time with other nucleic acid solutions and cells prior to electroporation due to the potential presence of RNases. This is why, for example, the transposon and transposase are delivered to opposite corners of the cuvette to prevent mixing. Additionally, it is optimal to keep the total volume of nucleic acids below 10 μl (10%) of the total reaction volume.

The amounts of both transposon (1 μg) and transposase (5 μg) are kept the same regardless of the number of cells per reaction. Translocation efficiency remains unchanged between 5x10 ⁶ cells/100 μl reaction and 25x10 ⁶ cells/100 μl reaction.

After centrifugation, completely aspirate the medium without disturbing the cell pellet.

Suspend the cell pellet in 100 μl of room temperature P3 buffer containing supplements per reaction.

Optimally, transfer 100 μl of cells in P3 buffer to a cuvette containing the appropriate nucleic acid, taking care to avoid introducing any air bubbles into the solution. It is recommended to load cells only into a maximum of two cuvettes at a time. After adding cells to the cuvette, it is optimal to work quickly and efficiently to reduce contact time between cells and mRNA before nucleofection. Although no reduction in translocation efficiency was observed for cells resting in P3 buffer for up to 10 min, it is recommended to minimize the time cells remain in P3.

Mix the contents of the cuvettes by flicking several times and load up to two cuvettes into the 4D-Nucleofector™ X-Unit.

Pulse the cells with program EO-210 to check that there were no errors recorded by the machine.

Immediately transfer nucleofected cells to a 6-well plate or G-Rex10 using the dedicated pipette provided in the Lonza P3 kit. To transfer cells, first draw a small amount of pre-warmed medium from a 6-well plate or G-Rex flask into a dedicated pipette. The medium is then pipetted into the cuvette and the entire contents of the cuvette are transferred to the final culture dish using a pipette. It is recommended not to pipet cells up and down in the cuvette or final culture dish.

For all remaining reactions, repeat the protocol from transferring the cells in P3 buffer to a cuvette containing the appropriate nucleic acid to mixing, pulsing, and transferring the nucleofected cells to a 6-well plate or G-Rex10.

Place the cells in an incubator at 37°C, 5% CO ₂ , and high humidity.

Day 2: T cell activation

Add 25 μl/mL Immutocult™ Human CD3/CD28/CD2 T Cell Activator (Stemcell Technologies, Cat #: 10970) to the nucleofected cells.

Mix the cells gently by pipetting.

Place the cells back in the incubator at 37°C, 5% CO ₂ , and high humidity.

For cells cultured in G-Rex flasks : It is essential not to disturb the culture until distinct cell clumps are observed. Therefore, it is recommended to separate cell disruption/mixing/pipetting from medium addition and exchange.

Culture Media Precautions : When culturing cells in G-Rex flasks, media additions and/or exchanges should be performed based on glucose and other metabolite levels. If glucose levels (or another indicator metabolite) fall to a critical level (e.g., ~100 mg/dL of glucose), double the medium volume using pre-warmed Immunocult™-XF T Cell Proliferation Medium. Alternatively, it must be replenished by replacing half of the medium. Addition of medium should be done slowly and care should be taken to destroy as few cells as possible. Medium half exchange should be performed at least 12 hours after physical disruption of the cell culture to allow cells to fully settle to the bottom of the culture flask.

Cell Sampling and Destruction: Cells should be left undisturbed for most of the culture period.

If large, distinct cell aggregates are formed, a primary disruption of the cell culture should be performed after addition of activation reagent (aggregates will measure 3 to 4 x 3 to 4 square grids visible on the G-Rex membrane).

When cell aggregates reach the required size, they can be physically disrupted using a 10 mL serum pipette. This time point can occur between days 11 and 14, depending on donation and translocation efficiency. In some cases, this time point may occur closer to day 14 than day 11, for example, if manual cassettes, large volumes, and/or high cell numbers are used for nucleofection. At this point, cell samples should be collected for cell counting, viability, and flow analysis. Ideally, the volume of culture medium at this point will not exceed twice the initial volume used (200 mL for G-Rex100). It is recommended that you collect all the cells you need at once so that you do not have to touch the cells again.

Once the cells have been destroyed, they should be left undisturbed for 12 hours in the same volume of medium in which the cells were started. Cells should reaggregate at this point; However, the aggregates will become smaller and more numerous. These aggregates should measure 1 to 2 x 1 to 2 squares on a G-Rex membrane grid.

Three days after the primary disruption of the cells (days 14 to 17 depending on the culture), they can be pipetted a second time. Samples should be taken again for cell count, viability and flow cytometry. Again, cells should be left undisturbed for at least 12 hours after sampling. It is recommended that you collect all the cells you need at once so that the cells do not need to be touched again.

After this secondary destruction, the cells will probably not form clumps at all, and the rate of cell growth will slow significantly.

Cells should be harvested 3 days after secondary destruction of cells on days 17 to 20 of culture.

flow cytometry

Flow analysis should be performed on Day 5, D-Day, D-Day + 3, and D-Day + 6.

On Day 5, D-Day, and D-Day + 3, CD45, CD4, CD8, and CARTyrin flow panels are used.

On D-Day + 6, there were three target panels:

a. Panel 1: CD3, CD8, CD4, CARTyrin, CD45RA, CD45RO, CD62L

b. Panel 2: CD3, CD8, CD4, CARTyrin, CD25, CXCR4, PD-1

c. Panel 3: CD45, CD14, CD20, CD56, CD8, CD4, CD3

Example 2: Functional characterization of CARTyrin+ stem memory T cells

CARTyrins of the invention can be introduced into T cells using a plasmid DNA transposon encoding CARTyrin flanked by two cis-regulatory sequestering elements to help stabilize CARTyrin expression by blocking inappropriate gene activation or silencing.

In certain embodiments of the methods of the invention, the Piggyback™ (PB) transposon system can be used to stably integrate antigen-specific (including cancer antigen-specific) carotinins into resting pan T cells, thereby allowing a single transposon. In the perforation reaction, the transposon was co-delivered with an mRNA transposase enzyme called Super Piggyback™ (SPB). PiggyBac™ transposons were transferred to naive stable primary human pan T cells, resulting in stable integration and expression of the PB-transferred gene in 20 to 30% of cells. Unexpectedly, most of these modified CARTyrin-expressing T cells were positive for the expression of CD62L and CD45RA, markers commonly associated with stem memory T cells (T _SCM cells). To confirm that this phenotype was maintained upon CAR-T cell stimulation and proliferation, modified CARTyrin-expressing T cells positive for expression of CD62L and CD45RA were activated through stimulation of CD3 and CD28. As a result of stimulation of CD3 and CD28, >60% of CARTyrin+ T cells displayed a stem cell memory phenotype. In addition, these cells expressing CARTyrin specific for cancer antigen were able to sufficiently express a strong anti-tumor effector function.

To determine whether the PB system directly contributes to enhancing the expression of stemness-like markers, we compared the phenotypes of CAR-T cells generated by PB translocation or lentiviral (LV) transduction. To accomplish this, a new vector was created by subcloning the CARTyrin transgene into a common LV construct for virus production. After introducing CARTyrin into uncontacted resting T cells by PB translocation or LV transduction, CARTyrin+ cells were allowed to proliferate and then return to the resting state. A variety of phenotypic and functional properties were measured, including kinetic analysis of memory- and depletion-related markers, secondary proliferation in response to homeostatic cytokines or tumor-specific Ags, cytokine production, and lytic capacity in response to target tumor cells. Unlike PB transduced CARTyrin+ T cells, LV transduced CARTyrin+ T cells did not show an increased memory phenotype. Additionally, PB-translocated cells showed equal or better ability for secondary proliferation and killing of target tumor cells. Collectively, these data demonstrate that CAR-T cells produced by PB translocation are mostly T _SCM cells, a highly desirable product phenotype in the CAR-T field. Additionally, these CARTyrin+ T cells exhibit potent anti-tumor activity and may generate cells that persist longer in vivo due to the use of Centyrin-based CARs, which may be less prone to tonic signaling and functional exhaustion.

Example 3: Sleeping Beauty Potential is mostly T _SCM generate a phenotype

Sleeping Beauty (SB100x) translocations generated a predominantly T _SCM phenotype using the methods of the present invention. Human pan T cells were transduced using 1 μg each of Sleeping Beauty or Piggyback transposon plasmid and SB100x or SPB mRNA as shown in [Figure 10]. After translocation, cells were grown in vitro and all non-translocated cells were removed using a drug selection system. After 18 days of culture, cells were stained with phenotypic markers CD4, CD8, CD45RA, and CD62L. The stem cell memory phenotype (Tscm) is defined by CD45RA and CD62L double positive cells, accounting for >65% of cells in all samples.

Example 4: Expression of Factor IX in Transformed T Cells

Genetic deficiency of factor IX (Figure 11) causes a life-threatening disease called hemophilia B. Hemophilia B is a rare disease that affects 1 in 25,000 to 1 in 30,000 people. Current hemophilia B treatment involves infusions of recombinant Factor IX protein every two to three days at a cost of approximately $250,000 per year.

Stem T cells (T _SCM cells) have been maintained in humans for decades and are therefore an ideal vehicle for secreting factor IX by supplying the factor IX deficiency in hemophilia B patients without the need for frequent blood transfusions. T cells were transformed into piggybacks that secrete factor IX. When transgenic T cells encoding the human factor IX transgene were examined for T and T _SCM cell markers using FACS, approximately 80% of all cells displayed a T _SCM phenotype (Figure 12). These modified T cells were able to secrete human factor IX (Figure 13A), and this secreted factor IX provided coagulant activity (Figure 13B).

Inclusion by reference

All documents cited herein, including any cross-referenced or related patents or applications, are hereby incorporated by reference in their entirety unless expressly excluded or otherwise limited. The citation of any document acknowledges that it is prior art with respect to any invention disclosed or claimed herein or that it teaches, suggests or discloses any such invention, either alone or in any combination with any other reference or document. I'm not admitting it. Additionally, to the extent that any meaning or definition of a term in this document conflicts with any meaning or definition of the same term in a document incorporated by reference, the meaning or definition assigned to that term in this document will apply.

Other Embodiments

Although specific embodiments of the invention have been illustrated and described, various other changes and modifications may be made without departing from the spirit and scope of the invention. The scope of the appended claims includes all such changes and modifications as fall within the scope of the present invention.

SEQUENCE LISTING <110> Poseida Therapeutics OSTERTAG, Eric SHEDLOCK, Devon <120> MODIFIED STEM CELL MEMORY T CELLS, METHODS OF MAKING AND METHODS OF USING SAME <130> POTH-012/01WO <150> 62/402,707 <151> 2016-09-30 <150> 62/553,058 <151> 2017-08-31 <150> 62/556,309 <151> 2017-09-08 <150> 62/502,508 <151> 2017-05-05 <160> 42 <170> PatentIn version 3.5 <210> 1 <211> 89 <212> PRT <213> Artificial Sequence <220> <223> FN3 domain consensus sequence <400> 1 Leu Pro Ala Pro Lys Asn Leu Val Val Ser Glu Val Thr Glu Asp Ser 1 5 10 15 Leu Arg Leu Ser Trp Thr Ala Pro Asp Ala Ala Phe Asp Ser Phe Leu 20 25 30 Ile Gln Tyr Gln Glu Ser Glu Lys Val Gly Glu Ala Ile Asn Leu Thr 35 40 45 Val Pro Gly Ser Glu Arg Ser Tyr Asp Leu Thr Gly Leu Lys Pro Gly 50 55 60 Thr Glu Tyr Thr Val Ser Ile Tyr Gly Val Lys Gly Gly His Arg Ser 65 70 75 80 Asn Pro Leu Ser Ala Glu Phe Thr Thr 85 <210> 2 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> FN3 consensus sequence <400> 2 Met Leu Pro Ala Pro Lys Asn Leu Val Val Ser Glu Val Thr Glu Asp 1 5 10 15 Ser Leu Arg Leu Ser Trp Thr Ala Pro Asp Ala Ala Phe Asp Ser Phe 20 25 30 Leu Ile Gln Tyr Gln Glu Ser Glu Lys Val Gly Glu Ala Ile Asn Leu 35 40 45 Thr Val Pro Gly Ser Glu Arg Ser Tyr Asp Leu Thr Gly Leu Lys Pro 50 55 60 Gly Thr Glu Tyr Thr Val Ser Ile Tyr Gly Val Lys Gly Gly His Arg 65 70 75 80 Ser Asn Pro Leu Ser Ala Glu Phe Thr Thr 85 90 <210> 3 <211> 270 <212> DNA <213> Artificial Sequence <220> <223> FN3 consensus sequence <400> 3 atgctgcctg caccaaagaa cctggtggtg tctcatgtga cagaggatag tgccagactg 60 tcatggactg ctcccgacgc agccttcgat agttttatca tcgtgtaccg ggagaacatc 120 gaaaccggcg aggccattgt cctgacagtg ccagggtccg aacgctctta tgacctgaca 180 gatctgaagc ccggaactga gtactatgtg cagatcgccg gcgtcaaagg aggcaatatc 240 agcttccctc tgtccgcaat cttcaccaca 270 <210> 4 <211> 594 <212> PRT <213> Trichoplusia ni <400> 4 Met Gly Ser Ser Leu Asp Asp Glu His Ile Leu Ser Ala Leu Leu Gln 1 5 10 15 Ser Asp Asp Glu Leu Val Gly Glu Asp Ser Asp Ser Glu Ile Ser Asp 20 25 30 His Val Ser Glu Asp Asp Val Gln Ser Asp Thr Glu Glu Ala Phe Ile 35 40 45 Asp Glu Val His Glu Val Gln Pro Thr Ser Ser Gly Ser Glu Ile Leu 50 55 60 Asp Glu Gln Asn Val Ile Glu Gln Pro Gly Ser Ser Leu Ala Ser Asn 65 70 75 80 Arg Ile Leu Thr Leu Pro Gln Arg Thr Ile Arg Gly Lys Asn Lys His 85 90 95 Cys Trp Ser Thr Ser Lys Ser Thr Arg Arg Ser Arg Val Ser Ala Leu 100 105 110 Asn Ile Val Arg Ser Gln Arg Gly Pro Thr Arg Met Cys Arg Asn Ile 115 120 125 Tyr Asp Pro Leu Leu Cys Phe Lys Leu Phe Phe Thr Asp Glu Ile Ile 130 135 140 Ser Glu Ile Val Lys Trp Thr Asn Ala Glu Ile Ser Leu Lys Arg Arg 145 150 155 160 Glu Ser Met Thr Gly Ala Thr Phe Arg Asp Thr Asn Glu Asp Glu Ile 165 170 175 Tyr Ala Phe Phe Gly Ile Leu Val Met Thr Ala Val Arg Lys Asp Asn 180 185 190 His Met Ser Thr Asp Asp Leu Phe Asp Arg Ser Leu Ser Met Val Tyr 195 200 205 Val Ser Val Met Ser Arg Asp Arg Phe Asp Phe Leu Ile Arg Cys Leu 210 215 220 Arg Met Asp Asp Lys Ser Ile Arg Pro Thr Leu Arg Glu Asn Asp Val 225 230 235 240 Phe Thr Pro Val Arg Lys Ile Trp Asp Leu Phe Ile His Gln Cys Ile 245 250 255 Gln Asn Tyr Thr Pro Gly Ala His Leu Thr Ile Asp Glu Gln Leu Leu 260 265 270 Gly Phe Arg Gly Arg Cys Pro Phe Arg Met Tyr Ile Pro Asn Lys Pro 275 280 285 Ser Lys Tyr Gly Ile Lys Ile Leu Met Met Cys Asp Ser Gly Tyr Lys 290 295 300 Tyr Met Ile Asn Gly Met Pro Tyr Leu Gly Arg Gly Thr Gln Thr Asn 305 310 315 320 Gly Val Pro Leu Gly Glu Tyr Tyr Val Lys Glu Leu Ser Lys Pro Val 325 330 335 His Gly Ser Cys Arg Asn Ile Thr Cys Asp Asn Trp Phe Thr Ser Ile 340 345 350 Pro Leu Ala Lys Asn Leu Leu Gln Glu Pro Tyr Lys Leu Thr Ile Val 355 360 365 Gly Thr Val Arg Ser Asn Lys Arg Glu Ile Pro Glu Val Leu Lys Asn 370 375 380 Ser Arg Ser Arg Pro Val Gly Thr Ser Met Phe Cys Phe Asp Gly Pro 385 390 395 400 Leu Thr Leu Val Ser Tyr Lys Pro Lys Pro Ala Lys Met Val Tyr Leu 405 410 415 Leu Ser Ser Cys Asp Glu Asp Ala Ser Ile Asn Glu Ser Thr Gly Lys 420 425 430 Pro Gln Met Val Met Tyr Tyr Asn Gln Thr Lys Gly Gly Val Asp Thr 435 440 445 Leu Asp Gln Met Cys Ser Val Met Thr Cys Ser Arg Lys Thr Asn Arg 450 455 460 Trp Pro Met Ala Leu Leu Tyr Gly Met Ile Asn Ile Ala Cys Ile Asn 465 470 475 480 Ser Phe Ile Ile Tyr Ser His Asn Val Ser Ser Lys Gly Glu Lys Val 485 490 495 Gln Ser Arg Lys Lys Phe Met Arg Asn Leu Tyr Met Ser Leu Thr Ser 500 505 510 Ser Phe Met Arg Lys Arg Leu Glu Ala Pro Thr Leu Lys Arg Tyr Leu 515 520 525 Arg Asp Asn Ile Ser Asn Ile Leu Pro Asn Glu Val Pro Gly Thr Ser 530 535 540 Asp Asp Ser Thr Glu Glu Pro Val Met Lys Lys Arg Thr Tyr Cys Thr 545 550 555 560 Tyr Cys Pro Ser Lys Ile Arg Arg Lys Ala Asn Ala Ser Cys Lys Lys 565 570 575 Cys Lys Lys Val Ile Cys Arg Glu His Asn Ile Asp Met Cys Gln Ser 580 585 590 Cys Phe <210> 5 <211> 594 <212> PRT <213> Artificial Sequence <220> <223> Super Piggybac Transposase <400> 5 Met Gly Ser Ser Leu Asp Asp Glu His Ile Leu Ser Ala Leu Leu Gln 1 5 10 15 Ser Asp Asp Glu Leu Val Gly Glu Asp Ser Asp Ser Glu Val Ser Asp 20 25 30 His Val Ser Glu Asp Asp Val Gln Ser Asp Thr Glu Glu Ala Phe Ile 35 40 45 Asp Glu Val His Glu Val Gln Pro Thr Ser Ser Gly Ser Glu Ile Leu 50 55 60 Asp Glu Gln Asn Val Ile Glu Gln Pro Gly Ser Ser Leu Ala Ser Asn 65 70 75 80 Arg Ile Leu Thr Leu Pro Gln Arg Thr Ile Arg Gly Lys Asn Lys His 85 90 95 Cys Trp Ser Thr Ser Lys Ser Thr Arg Arg Ser Arg Val Ser Ala Leu 100 105 110 Asn Ile Val Arg Ser Gln Arg Gly Pro Thr Arg Met Cys Arg Asn Ile 115 120 125 Tyr Asp Pro Leu Leu Cys Phe Lys Leu Phe Phe Thr Asp Glu Ile Ile 130 135 140 Ser Glu Ile Val Lys Trp Thr Asn Ala Glu Ile Ser Leu Lys Arg Arg 145 150 155 160 Glu Ser Met Thr Ser Ala Thr Phe Arg Asp Thr Asn Glu Asp Glu Ile 165 170 175 Tyr Ala Phe Phe Gly Ile Leu Val Met Thr Ala Val Arg Lys Asp Asn 180 185 190 His Met Ser Thr Asp Asp Leu Phe Asp Arg Ser Leu Ser Met Val Tyr 195 200 205 Val Ser Val Met Ser Arg Asp Arg Phe Asp Phe Leu Ile Arg Cys Leu 210 215 220 Arg Met Asp Asp Lys Ser Ile Arg Pro Thr Leu Arg Glu Asn Asp Val 225 230 235 240 Phe Thr Pro Val Arg Lys Ile Trp Asp Leu Phe Ile His Gln Cys Ile 245 250 255 Gln Asn Tyr Thr Pro Gly Ala His Leu Thr Ile Asp Glu Gln Leu Leu 260 265 270 Gly Phe Arg Gly Arg Cys Pro Phe Arg Val Tyr Ile Pro Asn Lys Pro 275 280 285 Ser Lys Tyr Gly Ile Lys Ile Leu Met Met Cys Asp Ser Gly Thr Lys 290 295 300 Tyr Met Ile Asn Gly Met Pro Tyr Leu Gly Arg Gly Thr Gln Thr Asn 305 310 315 320 Gly Val Pro Leu Gly Glu Tyr Tyr Val Lys Glu Leu Ser Lys Pro Val 325 330 335 His Gly Ser Cys Arg Asn Ile Thr Cys Asp Asn Trp Phe Thr Ser Ile 340 345 350 Pro Leu Ala Lys Asn Leu Leu Gln Glu Pro Tyr Lys Leu Thr Ile Val 355 360 365 Gly Thr Val Arg Ser Asn Lys Arg Glu Ile Pro Glu Val Leu Lys Asn 370 375 380 Ser Arg Ser Arg Pro Val Gly Thr Ser Met Phe Cys Phe Asp Gly Pro 385 390 395 400 Leu Thr Leu Val Ser Tyr Lys Pro Lys Pro Ala Lys Met Val Tyr Leu 405 410 415 Leu Ser Ser Cys Asp Glu Asp Ala Ser Ile Asn Glu Ser Thr Gly Lys 420 425 430 Pro Gln Met Val Met Tyr Tyr Asn Gln Thr Lys Gly Gly Val Asp Thr 435 440 445 Leu Asp Gln Met Cys Ser Val Met Thr Cys Ser Arg Lys Thr Asn Arg 450 455 460 Trp Pro Met Ala Leu Leu Tyr Gly Met Ile Asn Ile Ala Cys Ile Asn 465 470 475 480 Ser Phe Ile Ile Tyr Ser His Asn Val Ser Ser Lys Gly Glu Lys Val 485 490 495 Gln Ser Arg Lys Lys Phe Met Arg Asn Leu Tyr Met Ser Leu Thr Ser 500 505 510 Ser Phe Met Arg Lys Arg Leu Glu Ala Pro Thr Leu Lys Arg Tyr Leu 515 520 525 Arg Asp Asn Ile Ser Asn Ile Leu Pro Lys Glu Val Pro Gly Thr Ser 530 535 540 Asp Asp Ser Thr Glu Glu Pro Val Met Lys Lys Arg Thr Tyr Cys Thr 545 550 555 560 Tyr Cys Pro Ser Lys Ile Arg Arg Lys Ala Asn Ala Ser Cys Lys Lys 565 570 575 Cys Lys Lys Val Ile Cys Arg Glu His Asn Ile Asp Met Cys Gln Ser 580 585 590 Cys Phe <210> 6 <211> 340 <212> PRT <213> Artificial Sequence <220> <223> Sleeping Beauty Transposase <400> 6 Met Gly Lys Ser Lys Glu Ile Ser Gln Asp Leu Arg Lys Lys Ile Val 1 5 10 15 Asp Leu His Lys Ser Gly Ser Ser Leu Gly Ala Ile Ser Lys Arg Leu 20 25 30 Lys Val Pro Arg Ser Ser Val Gln Thr Ile Val Arg Lys Tyr Lys His 35 40 45 His Gly Thr Thr Gln Pro Ser Tyr Arg Ser Gly Arg Arg Arg Tyr Leu 50 55 60 Ser Pro Arg Asp Glu Arg Thr Leu Val Arg Lys Val Gln Ile Asn Pro 65 70 75 80 Arg Thr Thr Ala Lys Asp Leu Val Lys Met Leu Glu Glu Thr Gly Thr 85 90 95 Lys Val Ser Ile Ser Thr Val Lys Arg Val Leu Tyr Arg His Asn Leu 100 105 110 Lys Gly Arg Ser Ala Arg Lys Lys Pro Leu Leu Gln Asn Arg His Lys 115 120 125 Lys Ala Arg Leu Arg Phe Ala Thr Ala His Gly Asp Lys Asp Arg Thr 130 135 140 Phe Trp Arg Asn Val Leu Trp Ser Asp Glu Thr Lys Ile Glu Leu Phe 145 150 155 160 Gly His Asn Asp His Arg Tyr Val Trp Arg Lys Lys Gly Glu Ala Cys 165 170 175 Lys Pro Lys Asn Thr Ile Pro Thr Val Lys His Gly Gly Gly Ser Ile 180 185 190 Met Leu Trp Gly Cys Phe Ala Ala Gly Gly Thr Gly Ala Leu His Lys 195 200 205 Ile Asp Gly Ile Met Arg Lys Glu Asn Tyr Val Asp Ile Leu Lys Gln 210 215 220 His Leu Lys Thr Ser Val Arg Lys Leu Lys Leu Gly Arg Lys Trp Val 225 230 235 240 Phe Gln Met Asp Asn Asp Pro Lys His Thr Ser Lys Val Val Ala Lys 245 250 255 Trp Leu Lys Asp Asn Lys Val Lys Val Leu Glu Trp Pro Ser Gln Ser 260 265 270 Pro Asp Leu Asn Pro Ile Glu Asn Leu Trp Ala Glu Leu Lys Lys Arg 275 280 285 Val Arg Ala Arg Arg Pro Thr Asn Leu Thr Gln Leu His Gln Leu Cys 290 295 300 Gln Glu Glu Trp Ala Lys Ile His Pro Thr Tyr Cys Gly Lys Leu Val 305 310 315 320 Glu Gly Tyr Pro Lys Arg Leu Thr Gln Val Lys Gln Phe Lys Gly Asn 325 330 335 Ala Thr Lys Tyr 340 <210> 7 <211> 340 <212> PRT <213> Artificial Sequence <220> <223> hyperactive sleeping beauty transposase <400> 7 Met Gly Lys Ser Lys Glu Ile Ser Gln Asp Leu Arg Lys Arg Ile Val 1 5 10 15 Asp Leu His Lys Ser Gly Ser Ser Leu Gly Ala Ile Ser Lys Arg Leu 20 25 30 Ala Val Pro Arg Ser Ser Val Gln Thr Ile Val Arg Lys Tyr Lys His 35 40 45 His Gly Thr Thr Gln Pro Ser Tyr Arg Ser Gly Arg Arg Arg Tyr Leu 50 55 60 Ser Pro Arg Asp Glu Arg Thr Leu Val Arg Lys Val Gln Ile Asn Pro 65 70 75 80 Arg Thr Thr Ala Lys Asp Leu Val Lys Met Leu Glu Glu Thr Gly Thr 85 90 95 Lys Val Ser Ile Ser Thr Val Lys Arg Val Leu Tyr Arg His Asn Leu 100 105 110 Lys Gly His Ser Ala Arg Lys Lys Pro Leu Leu Gln Asn Arg His Lys 115 120 125 Lys Ala Arg Leu Arg Phe Ala Thr Ala His Gly Asp Lys Asp Arg Thr 130 135 140 Phe Trp Arg Asn Val Leu Trp Ser Asp Glu Thr Lys Ile Glu Leu Phe 145 150 155 160 Gly His Asn Asp His Arg Tyr Val Trp Arg Lys Lys Gly Glu Ala Cys 165 170 175 Lys Pro Lys Asn Thr Ile Pro Thr Val Lys His Gly Gly Gly Ser Ile 180 185 190 Met Leu Trp Gly Cys Phe Ala Ala Gly Gly Thr Gly Ala Leu His Lys 195 200 205 Ile Asp Gly Ile Met Asp Ala Val Gln Tyr Val Asp Ile Leu Lys Gln 210 215 220 His Leu Lys Thr Ser Val Arg Lys Leu Lys Leu Gly Arg Lys Trp Val 225 230 235 240 Phe Gln His Asp Asn Asp Pro Lys His Thr Ser Lys Val Val Ala Lys 245 250 255 Trp Leu Lys Asp Asn Lys Val Lys Val Leu Glu Trp Pro Ser Gln Ser 260 265 270 Pro Asp Leu Asn Pro Ile Glu Asn Leu Trp Ala Glu Leu Lys Lys Arg 275 280 285 Val Arg Ala Arg Arg Pro Thr Asn Leu Thr Gln Leu His Gln Leu Cys 290 295 300 Gln Glu Glu Trp Ala Lys Ile His Pro Asn Tyr Cys Gly Lys Leu Val 305 310 315 320 Glu Gly Tyr Pro Lys Arg Leu Thr Gln Val Lys Gln Phe Lys Gly Asn 325 330 335 Ala Thr Lys Tyr 340 <210> 8 <211> 21 <212> PRT <213> Homo sapiens <400> 8 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro 20 <210> 9 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence for human CD8alpha signal peptide <400> 9 atggcactgc cagtcaccgc cctgctgctg cctctggctc tgctgctgca cgcagctaga 60 cca 63 <210> 10 <211> 24 <212> PRT <213> Homo sapiens <400> 10 Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu 1 5 10 15 Ser Leu Val Ile Thr Leu Tyr Cys 20 <210> 11 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence coding for human CD8alpha transmembrane domain <400> 11 atctacattt gggcaccact ggccgggacc tgtggagtgc tgctgctgag cctggtcatc 60 acactgtact gc 72 <210> 12 <211> 112 <212> PRT <213> Homo sapiens <400> 12 Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Lys Gln Gly 1 5 10 15 Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr 20 25 30 Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys 35 40 45 Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys 50 55 60 Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg 65 70 75 80 Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala 85 90 95 Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg 100 105 110 <210> 13 <211> 336 <212> DNA <213> Artificial Sequenec <220> <223> nucleotide sequence encoding the CD28 costimulatory domain <400> 13 cgcgtgaagt ttagtcgatc agcagatgcc ccagcttaca aacaggggaca gaaccagctg 60 tataacgagc tgaatctggg ccgccgagag gaatatgacg tgctggataa gcggagagga 120 cgcgaccccg aaatgggagg caagcccagg cgcaaaaacc ctcaggaagg cctgtataac 180 gagctgcaga aggacaaaat ggcagaagcc tattctgaga tcggcatgaa gggggagcga 240 cggagaggca aagggcacga tgggctgtac cagggactga gcaccgccac aaaggacacc 300 tatgatgctc tgcatatgca ggcactgcct ccaagg 336 <210> 14 <211> 42 <212> PRT <213> Homo sapiens <400> 14 Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met 1 5 10 15 Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe 20 25 30 Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu 35 40 <210> 15 <211> 126 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence encoding the 4-1BB costimulatory domain <400> 15 aagagaggca ggaagaaact gctgtatatt ttcaaacagc ccttcatgcg ccccgtgcag 60 actaccccagg aggaagacgg gtgctcctgt cgattccctg aggaagagga aggcgggtgt 120 gagctg 126 <210> 16 <211> 45 <212> PRT <213> Homo sapiens <400> 16 Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala 1 5 10 15 Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly 20 25 30 Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp 35 40 45 <210> 17 <211> 135 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence encoding human CD8alpha hinge <400> 17 actaccacac cagcacctag accaccaact ccagctccaa ccatcgcgag tcagcccctg 60 agtctgagac ctgaggcctg caggccagct gcaggaggag ctgtgcacac caggggcctg 120 gacttcgcct gcgac 135 <210> 18 <211> 18 <212> PRT <213> Thata signa <400> 18 Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro 1 5 10 15 Gly Pro <210> 19 <211> 21 <212> PRT <213> Artificial Sequence <220> <223> GSG-T2A <400> 19 Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu 1 5 10 15 Glu Asn Pro Gly Pro 20 <210> 20 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> GSG-T2A <400> 20 ggatctggag agggaagggg aagcctgctg acctgtggag acgtggagga aaacccagga 60 cca 63 <210> 21 <211> 20 <212> PRT <213> Equine rhinitis A <400> 21 Gln Cys Thr Asn Tyr Ala Leu Leu Lys Leu Ala Gly Asp Val Glu Ser 1 5 10 15 Asn Pro Gly Pro 20 <210> 22 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> GSG-E2A peptide <400> 22 Gly Ser Gly Gln Cys Thr Asn Tyr Ala Leu Leu Lys Leu Ala Gly Asp 1 5 10 15 Val Glu Ser Asn Pro Gly Pro 20 <210> 23 <211> 22 <212> PRT <213> Foot and nout disease virus type O <400> 23 Val Lys Gln Thr Leu Asn Phe Asp Leu Leu Lys Leu Ala Gly Asp Val 1 5 10 15 Glu Ser Asn Pro Gly Pro 20 <210> 24 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> GSG-F2A peptide <400> 24 Gly Ser Gly Val Lys Gln Thr Leu Asn Phe Asp Leu Leu Lys Leu Ala 1 5 10 15 Gly Asp Val Glu Ser Asn Pro Gly Pro 20 25 <210> 25 <211> 19 <212> PRT <213> Porcine teschovirus-1 <400> 25 Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn 1 5 10 15 Pro Gly Pro <210> 26 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> GSG-P2A peptide <400> 26 Gly Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val 1 5 10 15 Glu Glu Asn Pro Gly Pro 20 <210> 27 <211> 5296 <212> DNA <213> Artificial Sequence <220> <223> Hellraiser transposon <400> 27 tcctatataa taaaagagaa acatgcaaat tgaccatccc tccgctacgc tcaagccacg 60 cccaccagcc aatcagaagt gactatgcaa attaacccaa caaagatggc agttaaattt 120 gcatacgcag gtgtcaagcg ccccaggagg caacggcggc cgcgggctcc caggaccttc 180 gctggccccg ggaggcgagg ccggccgcgc ctagccacac ccgcgggctc ccgggacctt 240 cgccagcaga gagcagagcg ggagagcggg cggagagcgg gaggtttgga ggacttggca 300 gagcaggagg ccgctggaca tagagcagag cgagagagag ggtggcttgg agggcgtggc 360 tccctctgtc accccagctt cctcatcaca gctgtggaaa ctgacagcag ggaggaggaa 420 gtcccacccc cacagaatca gccagaatca gccgttggtc agacagctct cagcggcctg 480 acagccagga ctctcattca cctgcatctc agaccgtgac agtagagagg tgggactatg 540 tctaaagaac aactgttgat acaacgtagc tctgcagccg aaagatgccg gcgttatcga 600 cagaaaatgt ctgcagagca acgtgcgtct gatcttgaaa gaaggcggcg cctgcaacag 660 aatgtatctg aagagcagct actggaaaaaa cgtcgctctg aagccgaaaa acagcggcgt 720 catcgacaga aaatgtctaa agaccaacgt gcctttgaag ttgaaagaag gcggtggcga 780 cgacagaata tgtctagaga acagtcatca acaagtacta ccaataccgg taggaactgc 840 cttctcagca aaaatggagt acatgaggat gcaattctcg aacatagttg tggtggaatg 900 actgttcgat gtgaattttg cctatcacta aatttctctg atgaaaaacc atccgatggg 960 aaatttactc gatgttgtag caaagggaaa gtctgtccaa atgatataca ttttccagat 1020 tacccggcat atttaaaaag attaatgaca aacgaagatt ctgacagtaa aaatttcatg 1080 gaaaatattc gttccataaa tagttctttt gcttttgctt ccatgggtgc aaatattgca 1140 tcgccatcag gatatgggcc atactgtttt agaatacacg gacaagttta tcaccgtact 1200 ggaactttac atccttcgga tggtgtttct cggaagtttg ctcaactcta tattttggat 1260 acagccgaag ctacaagtaa aagattagca atgccagaaa accagggctg ctcagaaaga 1320 ctcatgatca acatcaacaa cctcatgcat gaaataaatg aattaacaaa atcgtacaag 1380 atgctacatg aggtagaaaa ggaagcccaa tctgaagcag cagcaaaagg tattgctccc 1440 acagaagtaa caatggcgat taaatacgat cgtaacagtg acccaggtag atataattct 1500 ccccgtgtaa ccgaggttgc tgtcatattc agaaacgaag atggagaacc tccttttgaa 1560 agggacttgc tcattcattg taaaccagat cccaataatc caaatgccac taaaatgaaa 1620 caaatcagta tcctgtttcc tacattagat gcaatgacat atcctattct ttttccacat 1680 ggtgaaaaag gctggggaac agatattgca ttaagactca gagacaacag tgtaatcgac 1740 aataatacta gacaaaatgt aaggacacga gtcacacaaa tgcagtatta tggatttcat 1800 ctctctgtgc gggacacgtt caatcctatt ttaaatgcag gaaaattaac tcaacagttt 1860 attgtggatt catattcaaa aatggaggcc aatcggataa atttcatcaa agcaaaccaa 1920 tctaagttga gagttgaaaa atatagtggt ttgatggatt atctcaaatc tagatctgaa 1980 aatgacaatg tgccgattgg taaaatgata atacttccat catcttttga gggtagtccc 2040 agaaatatgc agcagcgata tcaggatgct atggcaattg taacgaagta tggcaagccc 2100 gatttattca taaccatgac atgcaacccc aaaatgggcag atattacaaa caattttacaa 2160 cgctggcaaa aagttgaaaa cagacctgac ttggtagcca gagtttttaa tattaagctg 2220 aatgctcttt taaatgatat atgtaaattc catttatttg gcaaagtaat agctaaaatt 2280 catgtcattg aatttcagaa acgcggactg cctcacgctc acatattatt gatattagat 2340 agtgagtcca aattacgttc agaagatgac attgaccgta tagttaaggc agaaattcca 2400 gatgaagacc agtgtcctcg actttttcaa attgtaaaat caaatatggt acatggacca 2460 tgtggaatac aaaatccaaa tagtccatgt atggaaaatg gaaaatgttc aaagggatat 2520 ccaaaagaat ttcaaaatgc gaccatgga aatattgatg gatatcccaa atacaaacga 2580 agatctggta gcaccatgtc tattggaaat aaagttgtcg ataacacttg gattgtccct 2640 tataacccgt atttgtgcct taaatataac tgtcatataa atgttgaagt ctgtgcatca 2700 attaaaagtg tcaaatattt atttaaatac atctataaag ggcacgattg tgcaaatatt 2760 caaatttctg aaaaaaaatat tatcaatcat gacgaagtac aggacttcat tgactccagg 2820 tatgtgagcg ctcctgaggc tgtttggaga ctttttgcaa tgcgaatgca tgaccaatct 2880 catgcaatca caagattagc tattcatttg ccaaatgatc agaatttgta ttttcatacc 2940 gatgattttg ctgaagtttt agatagggct aaaaggcata actcgacttt gatggcttgg 3000 ttcttattga atagagaaga ttctgatgca cgtaattatt attattggga gattccacag 3060 cattatgtgt ttaataattc tttgtggaca aaacgccgaa agggtgggaa taaagtatta 3120 ggtagactgt tcactgtgag ctttagagaa ccagaacgat attaccttag acttttgctt 3180 ctgcatgtaa aaggtgcgat aagttttgag gatctgcgaa ctgtaggagg tgtaacttat 3240 gatacatttc atgaagctgc taaacaccga ggattattac ttgatgacac tatctggaaa 3300 gatacgattg acgatgcaat catccttaat atgcccaaac aactacggca actttttgca 3360 tatatatgtg tgtttggatg tccttctgct gcagacaaat tatgggatga gaataaatct 3420 cattttatg aagatttctg ttggaaatta caccgaagag aaggtgcctg tgtgaactgt 3480 gaaatgcatg cccttaacga aattcaggag gtattcacat tgcatggaat gaaatgttca 3540 catttcaaac ttccggacta tcctttatta atgaatgcaa atacatgtga tcaattgtac 3600 gagcaacaac aggcagaggt tttgataaat tctctgaatg atgaacagtt ggcagccttt 3660 cagactataa cttcagccat cgaagatcaa actgtacacc ccaaatgctt tttcttggat 3720 ggtccaggtg gtagtggaaa aacatatctg tataaagttt taacacatta tattagaggt 3780 cgtggtggta ctgttttacc cacagcatct acaggaattg ctgcaaattt acttcttggt 3840 ggaagaacct ttcattccca atataaatta ccaattccat taaatgaaac ttcaatttct 3900 agactcgata taaagagtga agttgctaaa accattaaaa aggcccaact tctcattatt 3960 gatgaatgca ccatggcatc cagtcatgct ataaacgcca tagatagatt actaagagaa 4020 attatgaatt tgaatgttgc atttggtggg aaagttctcc ttctcgggagg ggattttcga 4080 caatgtctca gtattgtacc acatgctatg cgatcggcca tagtacaaac gagtttaaag 4140 tactgtaatg tttggggatg tttcagaaag ttgtctctta aaaaaatat gagatcagag 4200 gattctgctt atagtgaatg gttagtaaaa cttggagatg gcaaacttga tagcagtttt 4260 catttaggaa tggatattat tgaaatcccc catgaaatga tttgtaacgg atctattatt 4320 gaagctacct ttggaaatag tatatctata gataatatta aaaatatatc taaacgtgca 4380 attctttgtc caaaaaatga gcatgttcaa aaattaaatg aagaaatttt ggatatactt 4440 gatggagatt ttcacacata tttgagtgat gattccattg attcaacaga tgatgctgaa 4500 aaggaaaatt ttcccatcga atttcttaat agtattactc cttcgggaat gccgtgtcat 4560 aaattaaaat tgaaagtggg tgcaatcatc atgctattga gaaatcttaa tagtaaatgg 4620 ggtctttgta atggtactag atttattatc aaaagattac gacctaacat tatcgaagct 4680 gaagtattaa caggatctgc agagggagag gttgttctga ttccaagaat tgatttgtcc 4740 ccatctgaca ctggcctccc atttaaatta attcgaagac agtttcccgt gatgccagca 4800 tttgcgatga ctattaataa atcacaagga caaactctag acagagtagg aatattccta 4860 cctgaacccg ttttcgcaca tggtcagtta tatgttgctt tctctcgagt tcgaagagca 4920 tgtgacgtta aagttaaagt tgtaaatact tcatcacaag ggaaattagt caagcactct 4980 gaaagtgttt ttactcttaa tgtggtatac agggagatat tagaataagt ttaatcactt 5040 tatcagtcat tgtttgcatc aatgttgttt ttatatcatg tttttgttgt ttttatatca 5100 tgtctttgtt gttgttatat catgttgtta ttgtttatatt attaataaat ttatgtatta 5160 ttttcatata cattttactc atttcctttc atctctcaca cttctattat agagaaaggg 5220 caaatagcaa tattaaaata tttcctctaa ttaattccct ttcaatgtgc acgaatttcg 5280 tgcaccgggc cactag 5296 <210> 28 <211> 1496 <212> PRT <213> Artificial Sequence <220> <223> Helitron transposase <400> 28 Met Ser Lys Glu Gln Leu Leu Ile Gln Arg Ser Ser Ala Ala Glu Arg 1 5 10 15 Cys Arg Arg Tyr Arg Gln Lys Met Ser Ala Glu Gln Arg Ala Ser Asp 20 25 30 Leu Glu Arg Arg Arg Arg Leu Gln Gln Asn Val Ser Glu Glu Gln Leu 35 40 45 Leu Glu Lys Arg Arg Ser Glu Ala Glu Lys Gln Arg Arg His Arg Gln 50 55 60 Lys Met Ser Lys Asp Gln Arg Ala Phe Glu Val Glu Arg Arg Arg Trp 65 70 75 80 Arg Arg Gln Asn Met Ser Arg Glu Gln Ser Ser Thr Ser Thr Thr Asn 85 90 95 Thr Gly Arg Asn Cys Leu Leu Ser Lys Asn Gly Val His Glu Asp Ala 100 105 110 Ile Leu Glu His Ser Cys Gly Gly Met Thr Val Arg Cys Glu Phe Cys 115 120 125 Leu Ser Leu Asn Phe Ser Asp Glu Lys Pro Ser Asp Gly Lys Phe Thr 130 135 140 Arg Cys Cys Ser Lys Gly Lys Val Cys Pro Asn Asp Ile His Phe Pro 145 150 155 160 Asp Tyr Pro Ala Tyr Leu Lys Arg Leu Met Thr Asn Glu Asp Ser Asp 165 170 175 Ser Lys Asn Phe Met Glu Asn Ile Arg Ser Ile Asn Ser Ser Phe Ala 180 185 190 Phe Ala Ser Met Gly Ala Asn Ile Ala Ser Pro Ser Gly Tyr Gly Pro 195 200 205 Tyr Cys Phe Arg Ile His Gly Gln Val Tyr His Arg Thr Gly Thr Leu 210 215 220 His Pro Ser Asp Gly Val Ser Arg Lys Phe Ala Gln Leu Tyr Ile Leu 225 230 235 240 Asp Thr Ala Glu Ala Thr Ser Lys Arg Leu Ala Met Pro Glu Asn Gln 245 250 255 Gly Cys Ser Glu Arg Leu Met Ile Asn Ile Asn Asn Leu Met His Glu 260 265 270 Ile Asn Glu Leu Thr Lys Ser Tyr Lys Met Leu His Glu Val Glu Lys 275 280 285 Glu Ala Gln Ser Glu Ala Ala Ala Lys Gly Ile Ala Pro Thr Glu Val 290 295 300 Thr Met Ala Ile Lys Tyr Asp Arg Asn Ser Asp Pro Gly Arg Tyr Asn 305 310 315 320 Ser Pro Arg Val Thr Glu Val Ala Val Ile Phe Arg Asn Glu Asp Gly 325 330 335 Glu Pro Pro Phe Glu Arg Asp Leu Leu Ile His Cys Lys Pro Asp Pro 340 345 350 Asn Asn Pro Asn Ala Thr Lys Met Lys Gln Ile Ser Ile Leu Phe Pro 355 360 365 Thr Leu Asp Ala Met Thr Tyr Pro Ile Leu Phe Pro His Gly Glu Lys 370 375 380 Gly Trp Gly Thr Asp Ile Ala Leu Arg Leu Arg Asp Asn Ser Val Ile 385 390 395 400 Asp Asn Asn Thr Arg Gln Asn Val Arg Thr Arg Val Thr Gln Met Gln 405 410 415 Tyr Tyr Gly Phe His Leu Ser Val Arg Asp Thr Phe Asn Pro Ile Leu 420 425 430 Asn Ala Gly Lys Leu Thr Gln Gln Phe Ile Val Asp Ser Tyr Ser Lys 435 440 445 Met Glu Ala Asn Arg Ile Asn Phe Ile Lys Ala Asn Gln Ser Lys Leu 450 455 460 Arg Val Glu Lys Tyr Ser Gly Leu Met Asp Tyr Leu Lys Ser Arg Ser 465 470 475 480 Glu Asn Asp Asn Val Pro Ile Gly Lys Met Ile Ile Leu Pro Ser Ser 485 490 495 Phe Glu Gly Ser Pro Arg Asn Met Gln Gln Arg Tyr Gln Asp Ala Met 500 505 510 Ala Ile Val Thr Lys Tyr Gly Lys Pro Asp Leu Phe Ile Thr Met Thr 515 520 525 Cys Asn Pro Lys Trp Ala Asp Ile Thr Asn Asn Leu Gln Arg Trp Gln 530 535 540 Lys Val Glu Asn Arg Pro Asp Leu Val Ala Arg Val Phe Asn Ile Lys 545 550 555 560 Leu Asn Ala Leu Leu Asn Asp Ile Cys Lys Phe His Leu Phe Gly Lys 565 570 575 Val Ile Ala Lys Ile His Val Ile Glu Phe Gln Lys Arg Gly Leu Pro 580 585 590 His Ala His Ile Leu Leu Ile Leu Asp Ser Glu Ser Lys Leu Arg Ser 595 600 605 Glu Asp Asp Ile Asp Arg Ile Val Lys Ala Glu Ile Pro Asp Glu Asp 610 615 620 Gln Cys Pro Arg Leu Phe Gln Ile Val Lys Ser Asn Met Val His Gly 625 630 635 640 Pro Cys Gly Ile Gln Asn Pro Asn Ser Pro Cys Met Glu Asn Gly Lys 645 650 655 Cys Ser Lys Gly Tyr Pro Lys Glu Phe Gln Asn Ala Thr Ile Gly Asn 660 665 670 Ile Asp Gly Tyr Pro Lys Tyr Lys Arg Arg Ser Gly Ser Thr Met Ser 675 680 685 Ile Gly Asn Lys Val Val Asp Asn Thr Trp Ile Val Pro Tyr Asn Pro 690 695 700 Tyr Leu Cys Leu Lys Tyr Asn Cys His Ile Asn Val Glu Val Cys Ala 705 710 715 720 Ser Ile Lys Ser Val Lys Tyr Leu Phe Lys Tyr Ile Tyr Lys Gly His 725 730 735 Asp Cys Ala Asn Ile Gln Ile Ser Glu Lys Asn Ile Ile Asn His Asp 740 745 750 Glu Val Gln Asp Phe Ile Asp Ser Arg Tyr Val Ser Ala Pro Glu Ala 755 760 765 Val Trp Arg Leu Phe Ala Met Arg Met His Asp Gln Ser His Ala Ile 770 775 780 Thr Arg Leu Ala Ile His Leu Pro Asn Asp Gln Asn Leu Tyr Phe His 785 790 795 800 Thr Asp Asp Phe Ala Glu Val Leu Asp Arg Ala Lys Arg His Asn Ser 805 810 815 Thr Leu Met Ala Trp Phe Leu Leu Asn Arg Glu Asp Ser Asp Ala Arg 820 825 830 Asn Tyr Tyr Tyr Trp Glu Ile Pro Gln His Tyr Val Phe Asn Asn Ser 835 840 845 Leu Trp Thr Lys Arg Arg Lys Gly Gly Asn Lys Val Leu Gly Arg Leu 850 855 860 Phe Thr Val Ser Phe Arg Glu Pro Glu Arg Tyr Tyr Leu Arg Leu Leu 865 870 875 880 Leu Leu His Val Lys Gly Ala Ile Ser Phe Glu Asp Leu Arg Thr Val 885 890 895 Gly Gly Val Thr Tyr Asp Thr Phe His Glu Ala Ala Lys His Arg Gly 900 905 910 Leu Leu Leu Asp Asp Thr Ile Trp Lys Asp Thr Ile Asp Asp Ala Ile 915 920 925 Ile Leu Asn Met Pro Lys Gln Leu Arg Gln Leu Phe Ala Tyr Ile Cys 930 935 940 Val Phe Gly Cys Pro Ser Ala Ala Asp Lys Leu Trp Asp Glu Asn Lys 945 950 955 960 Ser His Phe Ile Glu Asp Phe Cys Trp Lys Leu His Arg Arg Glu Gly 965 970 975 Ala Cys Val Asn Cys Glu Met His Ala Leu Asn Glu Ile Gln Glu Val 980 985 990 Phe Thr Leu His Gly Met Lys Cys Ser His Phe Lys Leu Pro Asp Tyr 995 1000 1005 Pro Leu Leu Met Asn Ala Asn Thr Cys Asp Gln Leu Tyr Glu Gln 1010 1015 1020 Gln Gln Ala Glu Val Leu Ile Asn Ser Leu Asn Asp Glu Gln Leu 1025 1030 1035 Ala Ala Phe Gln Thr Ile Thr Ser Ala Ile Glu Asp Gln Thr Val 1040 1045 1050 His Pro Lys Cys Phe Phe Leu Asp Gly Pro Gly Gly Ser Gly Lys 1055 1060 1065 Thr Tyr Leu Tyr Lys Val Leu Thr His Tyr Ile Arg Gly Arg Gly 1070 1075 1080 Gly Thr Val Leu Pro Thr Ala Ser Thr Gly Ile Ala Ala Asn Leu 1085 1090 1095 Leu Leu Gly Gly Arg Thr Phe His Ser Gln Tyr Lys Leu Pro Ile 1100 1105 1110 Pro Leu Asn Glu Thr Ser Ile Ser Arg Leu Asp Ile Lys Ser Glu 1115 1120 1125 Val Ala Lys Thr Ile Lys Lys Ala Gln Leu Leu Ile Ile Asp Glu 1130 1135 1140 Cys Thr Met Ala Ser Ser His Ala Ile Asn Ala Ile Asp Arg Leu 1145 1150 1155 Leu Arg Glu Ile Met Asn Leu Asn Val Ala Phe Gly Gly Lys Val 1160 1165 1170 Leu Leu Leu Gly Gly Asp Phe Arg Gln Cys Leu Ser Ile Val Pro 1175 1180 1185 His Ala Met Arg Ser Ala Ile Val Gln Thr Ser Leu Lys Tyr Cys 1190 1195 1200 Asn Val Trp Gly Cys Phe Arg Lys Leu Ser Leu Lys Thr Asn Met 1205 1210 1215 Arg Ser Glu Asp Ser Ala Tyr Ser Glu Trp Leu Val Lys Leu Gly 1220 1225 1230 Asp Gly Lys Leu Asp Ser Ser Phe His Leu Gly Met Asp Ile Ile 1235 1240 1245 Glu Ile Pro His Glu Met Ile Cys Asn Gly Ser Ile Ile Glu Ala 1250 1255 1260 Thr Phe Gly Asn Ser Ile Ser Ile Asp Asn Ile Lys Asn Ile Ser 1265 1270 1275 Lys Arg Ala Ile Leu Cys Pro Lys Asn Glu His Val Gln Lys Leu 1280 1285 1290 Asn Glu Glu Ile Leu Asp Ile Leu Asp Gly Asp Phe His Thr Tyr 1295 1300 1305 Leu Ser Asp Asp Ser Ile Asp Ser Thr Asp Asp Ala Glu Lys Glu 1310 1315 1320 Asn Phe Pro Ile Glu Phe Leu Asn Ser Ile Thr Pro Ser Gly Met 1325 1330 1335 Pro Cys His Lys Leu Lys Leu Lys Val Gly Ala Ile Ile Met Leu 1340 1345 1350 Leu Arg Asn Leu Asn Ser Lys Trp Gly Leu Cys Asn Gly Thr Arg 1355 1360 1365 Phe Ile Ile Lys Arg Leu Arg Pro Asn Ile Ile Glu Ala Glu Val 1370 1375 1380 Leu Thr Gly Ser Ala Glu Gly Glu Val Val Leu Ile Pro Arg Ile 1385 1390 1395 Asp Leu Ser Pro Ser Asp Thr Gly Leu Pro Phe Lys Leu Ile Arg 1400 1405 1410 Arg Gln Phe Pro Val Met Pro Ala Phe Ala Met Thr Ile Asn Lys 1415 1420 1425 Ser Gln Gly Gln Thr Leu Asp Arg Val Gly Ile Phe Leu Pro Glu 1430 1435 1440 Pro Val Phe Ala His Gly Gln Leu Tyr Val Ala Phe Ser Arg Val 1445 1450 1455 Arg Arg Ala Cys Asp Val Lys Val Lys Val Val Asn Thr Ser Ser 1460 1465 1470 Gln Gly Lys Leu Val Lys His Ser Glu Ser Val Phe Thr Leu Asn 1475 1480 1485 Val Val Tyr Arg Glu Ile Leu Glu 1490 1495 <210> 29 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Hellraiser palindromic sequence <400> 29 gtgcacgaat ttcgtgcacc gggccactag 30 <210> 30 <211> 649 <212> PRT <213> Oryzias latipes <400> 30 Met Glu Glu Val Cys Asp Ser Ser Ala Ala Ala Ser Ser Thr Val Gln 1 5 10 15 Asn Gln Pro Gln Asp Gln Glu His Pro Trp Pro Tyr Leu Arg Glu Phe 20 25 30 Phe Ser Leu Ser Gly Val Asn Lys Asp Ser Phe Lys Met Lys Cys Val 35 40 45 Leu Cys Leu Pro Leu Asn Lys Glu Ile Ser Ala Phe Lys Ser Ser Pro 50 55 60 Ser Asn Leu Arg Lys His Ile Glu Arg Met His Pro Asn Tyr Leu Lys 65 70 75 80 Asn Tyr Ser Lys Leu Thr Ala Gln Lys Arg Lys Ile Gly Thr Ser Thr 85 90 95 His Ala Ser Ser Ser Lys Gln Leu Lys Val Asp Ser Val Phe Pro Val 100 105 110 Lys His Val Ser Pro Val Thr Val Asn Lys Ala Ile Leu Arg Tyr Ile 115 120 125 Ile Gln Gly Leu His Pro Phe Ser Thr Val Asp Leu Pro Ser Phe Lys 130 135 140 Glu Leu Ile Ser Thr Leu Gln Pro Gly Ile Ser Val Ile Thr Arg Pro 145 150 155 160 Thr Leu Arg Ser Lys Ile Ala Glu Ala Ala Leu Ile Met Lys Gln Lys 165 170 175 Val Thr Ala Ala Met Ser Glu Val Glu Trp Ile Ala Thr Thr Thr Asp 180 185 190 Cys Trp Thr Ala Arg Arg Lys Ser Phe Ile Gly Val Thr Ala His Trp 195 200 205 Ile Asn Pro Gly Ser Leu Glu Arg His Ser Ala Ala Leu Ala Cys Lys 210 215 220 Arg Leu Met Gly Ser His Thr Phe Glu Val Leu Ala Ser Ala Met Asn 225 230 235 240 Asp Ile His Ser Glu Tyr Glu Ile Arg Asp Lys Val Val Cys Thr Thr 245 250 255 Thr Asp Ser Gly Ser Asn Phe Met Lys Ala Phe Arg Val Phe Gly Val 260 265 270 Glu Asn Asn Asp Ile Glu Thr Glu Ala Arg Arg Cys Glu Ser Asp Asp 275 280 285 Thr Asp Ser Glu Gly Cys Gly Glu Gly Ser Asp Gly Val Glu Phe Gln 290 295 300 Asp Ala Ser Arg Val Leu Asp Gln Asp Asp Gly Phe Glu Phe Gln Leu 305 310 315 320 Pro Lys His Gln Lys Cys Ala Cys His Leu Leu Asn Leu Val Ser Ser 325 330 335 Val Asp Ala Gln Lys Ala Leu Ser Asn Glu His Tyr Lys Lys Leu Tyr 340 345 350 Arg Ser Val Phe Gly Lys Cys Gln Ala Leu Trp Asn Lys Ser Ser Arg 355 360 365 Ser Ala Leu Ala Ala Glu Ala Val Glu Ser Glu Ser Arg Leu Gln Leu 370 375 380 Leu Arg Pro Asn Gln Thr Arg Trp Asn Ser Thr Phe Met Ala Val Asp 385 390 395 400 Arg Ile Leu Gln Ile Cys Lys Glu Ala Gly Glu Gly Ala Leu Arg Asn 405 410 415 Ile Cys Thr Ser Leu Glu Val Pro Met Phe Asn Pro Ala Glu Met Leu 420 425 430 Phe Leu Thr Glu Trp Ala Asn Thr Met Arg Pro Val Ala Lys Val Leu 435 440 445 Asp Ile Leu Gln Ala Glu Thr Asn Thr Gln Leu Gly Trp Leu Leu Pro 450 455 460 Ser Val His Gln Leu Ser Leu Lys Leu Gln Arg Leu His His Ser Leu 465 470 475 480 Arg Tyr Cys Asp Pro Leu Val Asp Ala Leu Gln Gln Gly Ile Gln Thr 485 490 495 Arg Phe Lys His Met Phe Glu Asp Pro Glu Ile Ile Ala Ala Ala Ile 500 505 510 Leu Leu Pro Lys Phe Arg Thr Ser Trp Thr Asn Asp Glu Thr Ile Ile 515 520 525 Lys Arg Gly Met Asp Tyr Ile Arg Val His Leu Glu Pro Leu Asp His 530 535 540 Lys Lys Glu Leu Ala Asn Ser Ser Ser Asp Asp Glu Asp Phe Phe Ala 545 550 555 560 Ser Leu Lys Pro Thr Thr His Glu Ala Ser Lys Glu Leu Asp Gly Tyr 565 570 575 Leu Ala Cys Val Ser Asp Thr Arg Glu Ser Leu Leu Thr Phe Pro Ala 580 585 590 Ile Cys Ser Leu Ser Ile Lys Thr Asn Thr Pro Leu Pro Ala Ser Ala 595 600 605 Ala Cys Glu Arg Leu Phe Ser Thr Ala Gly Leu Leu Phe Ser Pro Lys 610 615 620 Arg Ala Arg Leu Asp Thr Asn Asn Phe Glu Asn Gln Leu Leu Leu Lys 625 630 635 640 Leu Asn Leu Arg Phe Tyr Asn Phe Glu 645 <210> 31 <211> 4682 <212> DNA <213> Oryzias latipes <400> 31 cagaggtgta aagtacttga gtaattttac ttgattactg tacttaagta ttatttttgg 60 ggatttttac tttacttgag tacaattaaa aatcaatact tttactttta cttaattaca 120 tttttttaga aaaaaaagta ctttttactc cttacaattt tatttacagt caaaaagtac 180 ttattttttg gagatcactt cattctattt tcccttgcta ttaccaaacc aattgaattg 240 cgctgatgcc cagtttaatt taaatgttat ttattctgcc tatgaaaatc gttttcacat 300 tatatgaaat tggtcagaca tgttcattgg tcctttggaa gtgacgtcat gtcacatcta 360 ttaccacaat gcacagcacc ttgacctgga aattagggaa attataacag tcaatcagtg 420 gaagaaaatg gaggaagtat gtgattcatc agcagctgcg agcagcacag tccaaaatca 480 gccacaggat caagagcacc cgtggccgta tcttcgcgaa ttcttttctt taagtggtgt 540 aaataaagat tcattcaaga tgaaatgtgt cctctgtctc ccgcttaata aagaaatatc 600 ggccttcaaa agttcgccat caaacctaag gaagcatatt gaggtaagta cattaagtat 660 tttgttttac tgatagtttt ttttttttt ttttttttt tttttgggtg tgcatgtttt 720 gacgttgatg gcgcgccttt tatatgtgta gtaggcctat tttcactaat gcatgcgatt 780 gacaatataa ggctcacgta ataaaatgct aaaatgcatt tgtaattggt aacgttaggt 840 ccacgggaaa tttggcgcct attgcagctt tgaataatca ttatcattcc gtgctctcat 900 tgtgtttgaa ttcatgcaaa acacaagaaa accaagcgag aaattttttt ccaaacatgt 960 tgtattgtca aaacggtaac actttacaat gaggttgatt agttcatgta ttaactaaca 1020 ttaaataacc atgagcaata catttgttac tgtatctgtt aatctttgtt aacgttagtt 1080 aatagaaata cagatgttca ttgtttgttc atgttagttc acagtgcatt aactaatgtt 1140 aacaagatat aaagtattag taaatgttga aattaacatg tatacgtgca gttcattatt 1200 agttcatgtt aactaatgta gttaactaac gaaccttatt gtaaaagtgt taccatcaaa 1260 actaatgtaa tgaaatcaat tcaccctgtc atgtcagcct tacagtcctg tgtttttgtc 1320 aatataatca gaaataaaat taatgtttga ttgtcactaa atgctactgt atttctaaaa 1380 tcaacaagta tttaacatta taaagtgtgc aattggctgc aaatgtcagt tttattaaag 1440 ggttagttca cccaaaaatg aaaataatgt cattaatgac tcgccctcat gtcgttccaa 1500 gcccgtaaga cctccgttca tcttcagaac acagtttaag atattttaga tttagtccga 1560 gagctttctg tgcctccatt gagaatgtat gtacggtata ctgtccatgt ccagaaaggt 1620 aataaaaaca tcaaagtagt ccatgtgaca tcagtgggtt agttagaatt ttttgaagca 1680 tcgaatacat tttggtccaa aaataacaaa acctacgact ttattcggca ttgtattctc 1740 ttccgggtct gttgtcaatc cgcgttcacg acttcgcagt gacgctacaa tgctgaataa 1800 agtcgtaggt tttgttattt ttggaccaaa atgtattttc gatgcttcaa ataattctac 1860 ctaacccact gatgtcacat ggactacttt gatgttttta ttacctttct ggacatggac 1920 agtataccgt acatacattt tcagtggagg gacagaaagc tctcggacta aatctaaaat 1980 atcttaaact gtgttccgaa gatgaacgga ggtgttacgg gcttggaacg acatgagggt 2040 gagtcattaa tgacatcttt tcatttttgg gtgaactaac cctttaatgc tgtaatcaga 2100 gagtgtatgt gtaattgtta catttattgc atacaatata aatatttatt tgttgttttt 2160 acagagaatg cacccaaatt acctcaaaaa ctactctaaa ttgacagcac agaagagaaa 2220 gatcgggacc tccacccatg cttccagcag taagcaactg aaagttgact cagttttccc 2280 agtcaaacat gtgtctccag tcactgtgaa caaagctata ttaaggtaca tcattcaagg 2340 acttcatcct ttcagcactg ttgatctgcc atcatttaaa gagctgatta gtacactgca 2400 gcctggcatt tctgtcatta caaggcctac tttacgctcc aagatagctg aagctgctct 2460 gatcatgaaa cagaaagtga ctgctgccat gagtgaagtt gaatggattg caaccacaac 2520 ggattgttgg actgcacgta gaaagtcatt cattggtgta actgctcact ggatcaaccc 2580 tggaagtctt gaaagacatt ccgctgcact tgcctgcaaa agattaatgg gctctcatac 2640 ttttgaggta ctggccagtg ccatgaatga tatccactca gagtatgaaa tacgtgacaa 2700 ggttgtttgc acaaccacag acagtggttc caactttatg aaggctttca gagtttttgg 2760 tgtggaaaac aatgatatcg agactgaggc aagaaggtgt gaaagtgatg acactgattc 2820 tgaaggctgt ggtgagggaa gtgatggtgt ggaattccaa gatgcctcac gagtcctgga 2880 ccaagacgat ggcttcgaat tccagctacc aaaacatcaa aagtgtgcct gtcacttact 2940 taacctagtc tcaagcgttg atgcccaaaa agctctctca aatgaacact acaagaaact 3000 ctacagatct gtctttggca aatgccaagc tttatggaat aaaagcagcc gatcggctct 3060 agcagctgaa gctgttgaat cagaaagccg gcttcagctt ttaaggccaa accaaacgcg 3120 gtggaattca acttttatgg ctgttgacag aattcttcaa atttgcaaag aagcaggaga 3180 aggcgcactt cggaatatat gcacctctct tgaggttcca atgtaagtgt ttttcccctc 3240 tatcgatgta aacaaatgtg ggttgttttt gtttaatact ctttgattat gctgatttct 3300 cctgtaggtt taatccagca gaaatgctgt tcttgacaga gtgggccaac acaatgcgtc 3360 cagttgcaaa agtactcgac atcttgcaag cggaaacgaa tacacagctg gggtggctgc 3420 tgcctagtgt ccatcagtta agcttgaaac ttcagcgact ccaccattct ctcaggtact 3480 gtgacccact tgtggatgcc ctacaacaag gaatccaaac acgattcaag catatgtttg 3540 aagatcctga gatcatagca gctgccatcc ttctccctaa atttcggacc tcttggacaa 3600 atgatgaaac catcataaaa cgaggtaaat gaatgcaagc aacatacact tgacgaattc 3660 taatctgggc aacctttgag ccataccaaa attattcttt tatttattta tttttgcact 3720 ttttaggaat gttatatccc atctttggct gtgatctcaa tatgaatatt gatgtaaagt 3780 attcttgcag caggttgtag ttatccctca gtgtttcttg aaaccaaact catatgtatc 3840 atatgtggtt tggaaatgca gttagatttt atgctaaaat aagggatttg catgatttta 3900 gatgtagatg actgcacgta aatgtagtta atgacaaaat ccataaaatt tgttcccagt 3960 cagaagcccc tcaaccaaac ttttctttgt gtctgctcac tgtgcttgta ggcatggact 4020 acatcagagt gcatctggag cctttggacc acaagaagga attggccaac agttcatctg 4080 atgatgaaga ttttttcgct tctttgaaac cgacaacaca tgaagccagc aaagagttgg 4140 atggatatct ggcctgtgtt tcagacacca gggagtctct gctcacgttt cctgctattt 4200 gcagcctctc tatcaagact aatacacctc ttcccgcatc ggctgcctgt gagaggcttt 4260 tcagcactgc aggattgctt ttcagcccca aaagagctag gcttgacact aacaattttg 4320 agaatcagct tctactgaag ttaaatctga ggttttacaa ctttgagtag cgtgtactgg 4380 cattagattg tctgtcttat agtttgataa ttaaatacaa acagttctaa agcaggataa 4440 aaccttgtat gcatttcatt taatgttttt tgagattaaa agcttaaaca agaatctcta 4500 gttttctttc ttgcttttac ttttacttcc ttaatactca agtacaattt taatggagta 4560 cttttttact tttactcaag taagattcta gccagatact tttactttta attgagtaaa 4620 attttcccta agtacttgta ctttcacttg agtaaaattt ttgagtactt tttacacctc 4680 tg 4682 <210> 32 <211> 1053 <212> PRT <213> Artificial Sequence <220> <223> dSaCas9 <400> 32 Met Lys Arg Asn Tyr Ile Leu Gly Leu Ala Ile Gly Ile Thr Ser Val 1 5 10 15 Gly Tyr Gly Ile Ile Asp Tyr Glu Thr Arg Asp Val Ile Asp Ala Gly 20 25 30 Val Arg Leu Phe Lys Glu Ala Asn Val Glu Asn Asn Glu Gly Arg Arg 35 40 45 Ser Lys Arg Gly Ala Arg Arg Leu Lys Arg Arg Arg Arg His Arg Ile 50 55 60 Gln Arg Val Lys Lys Leu Leu Phe Asp Tyr Asn Leu Leu Thr Asp His 65 70 75 80 Ser Glu Leu Ser Gly Ile Asn Pro Tyr Glu Ala Arg Val Lys Gly Leu 85 90 95 Ser Gln Lys Leu Ser Glu Glu Glu Phe Ser Ala Ala Leu Leu His Leu 100 105 110 Ala Lys Arg Arg Gly Val His Asn Val Asn Glu Val Glu Glu Asp Thr 115 120 125 Gly Asn Glu Leu Ser Thr Lys Glu Gln Ile Ser Arg Asn Ser Lys Ala 130 135 140 Leu Glu Glu Lys Tyr Val Ala Glu Leu Gln Leu Glu Arg Leu Lys Lys 145 150 155 160 Asp Gly Glu Val Arg Gly Ser Ile Asn Arg Phe Lys Thr Ser Asp Tyr 165 170 175 Val Lys Glu Ala Lys Gln Leu Leu Lys Val Gln Lys Ala Tyr His Gln 180 185 190 Leu Asp Gln Ser Phe Ile Asp Thr Tyr Ile Asp Leu Leu Glu Thr Arg 195 200 205 Arg Thr Tyr Tyr Glu Gly Pro Gly Glu Gly Ser Pro Phe Gly Trp Lys 210 215 220 Asp Ile Lys Glu Trp Tyr Glu Met Leu Met Gly His Cys Thr Tyr Phe 225 230 235 240 Pro Glu Glu Leu Arg Ser Val Lys Tyr Ala Tyr Asn Ala Asp Leu Tyr 245 250 255 Asn Ala Leu Asn Asp Leu Asn Asn Leu Val Ile Thr Arg Asp Glu Asn 260 265 270 Glu Lys Leu Glu Tyr Tyr Glu Lys Phe Gln Ile Ile Glu Asn Val Phe 275 280 285 Lys Gln Lys Lys Lys Pro Thr Leu Lys Gln Ile Ala Lys Glu Ile Leu 290 295 300 Val Asn Glu Glu Asp Ile Lys Gly Tyr Arg Val Thr Ser Thr Gly Lys 305 310 315 320 Pro Glu Phe Thr Asn Leu Lys Val Tyr His Asp Ile Lys Asp Ile Thr 325 330 335 Ala Arg Lys Glu Ile Ile Glu Asn Ala Glu Leu Leu Asp Gln Ile Ala 340 345 350 Lys Ile Leu Thr Ile Tyr Gln Ser Ser Glu Asp Ile Gln Glu Glu Leu 355 360 365 Thr Asn Leu Asn Ser Glu Leu Thr Gln Glu Glu Ile Glu Gln Ile Ser 370 375 380 Asn Leu Lys Gly Tyr Thr Gly Thr His Asn Leu Ser Leu Lys Ala Ile 385 390 395 400 Asn Leu Ile Leu Asp Glu Leu Trp His Thr Asn Asp Asn Gln Ile Ala 405 410 415 Ile Phe Asn Arg Leu Lys Leu Val Pro Lys Lys Val Asp Leu Ser Gln 420 425 430 Gln Lys Glu Ile Pro Thr Thr Leu Val Asp Asp Phe Ile Leu Ser Pro 435 440 445 Val Val Lys Arg Ser Phe Ile Gln Ser Ile Lys Val Ile Asn Ala Ile 450 455 460 Ile Lys Lys Tyr Gly Leu Pro Asn Asp Ile Ile Ile Glu Leu Ala Arg 465 470 475 480 Glu Lys Asn Ser Lys Asp Ala Gln Lys Met Ile Asn Glu Met Gln Lys 485 490 495 Arg Asn Arg Gln Thr Asn Glu Arg Ile Glu Glu Ile Ile Arg Thr Thr 500 505 510 Gly Lys Glu Asn Ala Lys Tyr Leu Ile Glu Lys Ile Lys Leu His Asp 515 520 525 Met Gln Glu Gly Lys Cys Leu Tyr Ser Leu Glu Ala Ile Pro Leu Glu 530 535 540 Asp Leu Leu Asn Asn Pro Phe Asn Tyr Glu Val Asp His Ile Ile Pro 545 550 555 560 Arg Ser Val Ser Phe Asp Asn Ser Phe Asn Asn Lys Val Leu Val Lys 565 570 575 Gln Glu Glu Ala Ser Lys Lys Gly Asn Arg Thr Pro Phe Gln Tyr Leu 580 585 590 Ser Ser Ser Asp Ser Lys Ile Ser Tyr Glu Thr Phe Lys Lys His Ile 595 600 605 Leu Asn Leu Ala Lys Gly Lys Gly Arg Ile Ser Lys Thr Lys Lys Glu 610 615 620 Tyr Leu Leu Glu Glu Arg Asp Ile Asn Arg Phe Ser Val Gln Lys Asp 625 630 635 640 Phe Ile Asn Arg Asn Leu Val Asp Thr Arg Tyr Ala Thr Arg Gly Leu 645 650 655 Met Asn Leu Leu Arg Ser Tyr Phe Arg Val Asn Asn Leu Asp Val Lys 660 665 670 Val Lys Ser Ile Asn Gly Gly Phe Thr Ser Phe Leu Arg Arg Lys Trp 675 680 685 Lys Phe Lys Lys Glu Arg Asn Lys Gly Tyr Lys His His Ala Glu Asp 690 695 700 Ala Leu Ile Ile Ala Asn Ala Asp Phe Ile Phe Lys Glu Trp Lys Lys 705 710 715 720 Leu Asp Lys Ala Lys Lys Val Met Glu Asn Gln Met Phe Glu Glu Lys 725 730 735 Gln Ala Glu Ser Met Pro Glu Ile Glu Thr Glu Gln Glu Tyr Lys Glu 740 745 750 Ile Phe Ile Thr Pro His Gln Ile Lys His Ile Lys Asp Phe Lys Asp 755 760 765 Tyr Lys Tyr Ser His Arg Val Asp Lys Lys Pro Asn Arg Glu Leu Ile 770 775 780 Asn Asp Thr Leu Tyr Ser Thr Arg Lys Asp Asp Lys Gly Asn Thr Leu 785 790 795 800 Ile Val Asn Asn Leu Asn Gly Leu Tyr Asp Lys Asp Asn Asp Lys Leu 805 810 815 Lys Lys Leu Ile Asn Lys Ser Pro Glu Lys Leu Leu Met Tyr His His 820 825 830 Asp Pro Gln Thr Tyr Gln Lys Leu Lys Leu Ile Met Glu Gln Tyr Gly 835 840 845 Asp Glu Lys Asn Pro Leu Tyr Lys Tyr Tyr Glu Glu Thr Gly Asn Tyr 850 855 860 Leu Thr Lys Tyr Ser Lys Lys Asp Asn Gly Pro Val Ile Lys Lys Ile 865 870 875 880 Lys Tyr Tyr Gly Asn Lys Leu Asn Ala His Leu Asp Ile Thr Asp Asp 885 890 895 Tyr Pro Asn Ser Arg Asn Lys Val Val Lys Leu Ser Leu Lys Pro Tyr 900 905 910 Arg Phe Asp Val Tyr Leu Asp Asn Gly Val Tyr Lys Phe Val Thr Val 915 920 925 Lys Asn Leu Asp Val Ile Lys Lys Glu Asn Tyr Tyr Glu Val Asn Ser 930 935 940 Lys Cys Tyr Glu Glu Ala Lys Lys Leu Lys Lys Ile Ser Asn Gln Ala 945 950 955 960 Glu Phe Ile Ala Ser Phe Tyr Asn Asn Asp Leu Ile Lys Ile Asn Gly 965 970 975 Glu Leu Tyr Arg Val Ile Gly Val Asn Asn Asp Leu Leu Asn Arg Ile 980 985 990 Glu Val Asn Met Ile Asp Ile Thr Tyr Arg Glu Tyr Leu Glu Asn Met 995 1000 1005 Asn Asp Lys Arg Pro Pro Arg Ile Ile Lys Thr Ile Ala Ser Lys 1010 1015 1020 Thr Gln Ser Ile Lys Lys Tyr Ser Thr Asp Ile Leu Gly Asn Leu 1025 1030 1035 Tyr Glu Val Lys Ser Lys Lys His Pro Gln Ile Ile Lys Lys Gly 1040 1045 1050 <210> 33 <211> 1368 <212> PRT <213> Artificial Sequence <220> <223> dCas9 with <220> <221> misc_feature <222> (1)..(1) <223> Xaa can be any naturally occurring amino acid <400> 33 Xaa Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn Ser Val 1 5 10 15 Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe 20 25 30 Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile 35 40 45 Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu 50 55 60 Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys 65 70 75 80 Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser 85 90 95 Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys 100 105 110 His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr 115 120 125 His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp 130 135 140 Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His 145 150 155 160 Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro 165 170 175 Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr 180 185 190 Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala 195 200 205 Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn 210 215 220 Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn 225 230 235 240 Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe 245 250 255 Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp 260 265 270 Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp 275 280 285 Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp 290 295 300 Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser 305 310 315 320 Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys 325 330 335 Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe 340 345 350 Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser 355 360 365 Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp 370 375 380 Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg 385 390 395 400 Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu 405 410 415 Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe 420 425 430 Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile 435 440 445 Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp 450 455 460 Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu 465 470 475 480 Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr 485 490 495 Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser 500 505 510 Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys 515 520 525 Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln 530 535 540 Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr 545 550 555 560 Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp 565 570 575 Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly 580 585 590 Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 595 600 605 Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr 610 615 620 Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala 625 630 635 640 His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr 645 650 655 Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp 660 665 670 Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe 675 680 685 Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe 690 695 700 Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu 705 710 715 720 His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly 725 730 735 Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly 740 745 750 Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln 755 760 765 Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile 770 775 780 Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro 785 790 795 800 Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu 805 810 815 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg 820 825 830 Leu Ser Asp Tyr Asp Val Asp Ala Ile Val Pro Gln Ser Phe Leu Lys 835 840 845 Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg 850 855 860 Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys 865 870 875 880 Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys 885 890 895 Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp 900 905 910 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr 915 920 925 Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp 930 935 940 Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser 945 950 955 960 Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg 965 970 975 Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val 980 985 990 Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe 995 1000 1005 Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala 1010 1015 1020 Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe 1025 1030 1035 Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala 1040 1045 1050 Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu 1055 1060 1065 Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val 1070 1075 1080 Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr 1085 1090 1095 Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys 1100 1105 1110 Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro 1115 1120 1125 Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser Val 1130 1135 1140 Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys 1145 1150 1155 Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser 1160 1165 1170 Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys 1175 1180 1185 Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu 1190 1195 1200 Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala Gly 1205 1210 1215 Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val 1220 1225 1230 Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser 1235 1240 1245 Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys 1250 1255 1260 His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys 1265 1270 1275 Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala 1280 1285 1290 Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn 1295 1300 1305 Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala 1310 1315 1320 Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser 1325 1330 1335 Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr 1340 1345 1350 Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp 1355 1360 1365 <210> 34 <211> 199 <212> PRT <213> Clostridium sp. 7_2_43FAA <400> 34 Glu Gly Ile Lys Ser Asn Ile Ser Leu Leu Lys Asp Glu Leu Arg Gly 1 5 10 15 Gln Ile Ser His Ile Ser His Glu Tyr Leu Ser Leu Ile Asp Leu Ala 20 25 30 Phe Asp Ser Lys Gln Asn Arg Leu Phe Glu Met Lys Val Leu Glu Leu 35 40 45 Leu Val Asn Glu Tyr Gly Phe Lys Gly Arg His Leu Gly Gly Ser Arg 50 55 60 Lys Pro Asp Gly Ile Val Tyr Ser Thr Thr Leu Glu Asp Asn Phe Gly 65 70 75 80 Ile Ile Val Asp Thr Lys Ala Tyr Ser Glu Gly Tyr Ser Leu Pro Ile 85 90 95 Ser Gln Ala Asp Glu Met Glu Arg Tyr Val Arg Glu Asn Ser Asn Arg 100 105 110 Asp Glu Glu Val Asn Pro Asn Lys Trp Trp Glu Asn Phe Ser Glu Glu 115 120 125 Val Lys Lys Tyr Tyr Phe Val Phe Ile Ser Gly Ser Phe Lys Gly Lys 130 135 140 Phe Glu Glu Gln Leu Arg Arg Leu Ser Met Thr Thr Gly Val Asn Gly 145 150 155 160 Ser Ala Val Asn Val Val Asn Leu Leu Leu Gly Ala Glu Lys Ile Arg 165 170 175 Ser Gly Glu Met Thr Ile Glu Glu Leu Glu Arg Ala Met Phe Asn Asn 180 185 190 Ser Glu Phe Ile Leu Lys Tyr 195 <210> 35 <211> 4897 <212> DNA <213> Artificial Sequence <220> <223> PB-EF1a vector <400> 35 tgtacataga ttaaccctag aaagataatc atattgtgac gtacgttaaa gataatcatg 60 cgtaaaattg acgcatgtgt tttatcggtc tgtatatcga ggtttattta ttaatttgaa 120 tagatattaa gttttattat atttacactt acatactaat aataaattca acaaacaatt 180 tatttatgtt tatttattta ttaaaaaaaaa acaaaaactc aaaatttctt ctataaagta 240 acaaaacttt tatcgaatac ctgcagcccg ggggatgcag agggacagcc cccccccaaa 300 gcccccaggg atgtaattac gtccctcccc cgctaggggg cagcagcgag ccgcccgggg 360 ctccgctccg gtccggcgct ccccccgcat ccccgagccg gcagcgtgcg gggacagccc 420 gggcacgggg aaggtggcac gggatcgctt tcctctgaac gcttctcgct gctctttgag 480 cctgcagaca cctgggggga tacggggaaa agttgactgt gcctttcgat cgaaccatgg 540 acagttagct ttgcaaagat ggataaagtt ttaaacagag aggaatcttt gcagctaatg 600 gaccttctag gtcttgaaag gagtgggaat tggctccggt gcccgtcagt gggcagagcg 660 cacatcgccc acagtccccg agaagttggg gggaggggtc ggcaattgaa ccggtgccta 720 gagaaggtgg cgcggggtaa actgggaaag tgatgtcgtg tactggctcc gcctttttcc 780 cgagggtggg ggagaaccgt atataagtgc agtagtcgcc gtgaacgttc tttttcgcaa 840 cgggtttgcc gccagaacac aggtaagtgc cgtgtgtggt tcccgcgggc ctggcctctt 900 tacgggttat ggcccttgcg tgccttgaat tacttccacc tggctgcagt acgtgattct 960 tgatcccgag cttcgggttg gaagtgggtg ggagagttcg aggccttgcg cttaagggagc 1020 cccttcgcct cgtgcttgag ttgaggcctg gcctgggcgc tggggccgcc gcgtgcgaat 1080 ctggtggcac cttcgcgcct gtctcgctgc tttcgataag tctctagcca tttaaaattt 1140 ttgatgacct gctgcgacgc tttttttctg gcaagatagt cttgtaaatg cgggccaaga 1200 tctgcacact ggtatttcgg tttttggggc cgcgggcggc gacggggccc gtgcgtccca 1260 gcgcacatgt tcggcgaggc ggggcctgcg agcgcggcca ccgagaatcg gacgggggta 1320 gtctcaagct ggccggcctg ctctggtgcc tggcctcgcg ccgccgtgta tcgccccgcc 1380 ctgggcggca aggctggccc ggtcggcacc agttgcgtga gcggaaagat ggccgcttcc 1440 cggccctgct gcagggagct caaaatggag gacgcggcgc tcgggagagc gggcgggtga 1500 gtcacccaca caaaggaaaa gggcctttcc gtcctcagcc gtcgcttcat gtgactccac 1560 ggagtaccgg gcgccgtcca ggcacctcga ttagttctcg agcttttgga gtacgtcgtc 1620 tttaggttgg ggggaggggt tttatgcgat ggagtttccc cacactgagt gggtggagac 1680 tgaagttagg ccagcttggc acttgatgta attctccttg gaatttgccc tttttgagtt 1740 tggatcttgg ttcattctca agcctcagac agtggttcaa agtttttttc ttccatttca 1800 ggtgtcgtga gaattctaat acgactcact atagggtgtg ctgtctcatc attttggcaa 1860 agattggcca ccaagcttgt cctgcaggag ggtcgacgcc tctagacggg cggccgctcc 1920 ggatccacgg gtaccgatca catatgcctt taattaaaca ctagttctat agtgtcacct 1980 aaattccctt tagtgagggt taatggccgt aggccgccag aattgggtcc agacatgata 2040 agatacattg atgagtttgg acaaaccaca actagaatgc agtgaaaaaa atgctttatt 2100 tgtgaaattt gtgatgctat tgctttattt gtaaccatta taagctgcaa taaacaagtt 2160 aacaacaa attgcattca ttttatgttt caggttcagg gggaggtgtg ggaggttttt 2220 tcggactcta ggacctgcgc atgcgcttgg cgtaatcatg gtcatagctg tttcctgttt 2280 tccccgtatc cccccaggtg tctgcaggct caaagagcag cgagaagcgt tcagaggaaa 2340 gcgatcccgt gccaccttcc ccgtgcccgg gctgtccccg cacgctgccg gctcggggat 2400 gcggggggag cgccggaccg gagcggagcc ccgggcggct cgctgctgcc ccctagcggg 2460 ggagggacgt aattacatcc ctgggggctt tggggggggg ctgtccctct caccgcggtg 2520 gagctccagc ttttgttcga attggggccc cccctcgagg gtatcgatga tatctataac 2580 aagaaaatat atatataata agttatcacg taagtagaac atgaaataac aatataatta 2640 tcgtatgagt taaatcttaa aagtcacgta aaagataatc atgcgtcatt ttgactcacg 2700 cggtcgttat agttcaaaat cagtgacact taccgcattg acaagcacgc ctcacgggag 2760 ctccaagcgg cgactgagat gtcctaaatg cacagcgacg gattcgcgct atttagaaag 2820 agagagcaat atttcaagaa tgcatgcgtc aattttacgc agactatctt tctagggtta 2880 atctagctag ccttaagggc gcctattgcg ttgcgctcac tgcccgcttt ccagtcggga 2940 aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt 3000 attgggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg 3060 cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac 3120 gcaggaaaga acatgaccaa aatcccttaa cgtgagtttt cgttccactg agcgtcagac 3180 cccgtagaaa agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc 3240 ttgcaaaacaa aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca 3300 actctttttc cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgttcttcta 3360 gtgtagccgt agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct 3420 ctgctaatcc tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg 3480 gactcaagac gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc 3540 acacagccca gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcta 3600 tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg 3660 gtcggaacag gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt 3720 cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg 3780 cggagcctat ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc cttttgctgg 3840 ccttttgctc acatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa 3900 tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag tcagaagaac 3960 tcgtcaagaa ggcgatagaa ggcgatgcgc tgcgaatcgg gagcggcgat accgtaaagc 4020 acgaggaagc ggtcagccca ttcgccgcca agctcttcag caatatcacg ggtagccaac 4080 gctatgtcct gatagcggtc cgccacaccc agccggccac agtcgatgaa tccagaaaag 4140 cggccatttt ccaccatgat attcggcaag caggcatcgc catgggtcac gacgagatcc 4200 tcgccgtcgg gcatgctcgc cttgagcctg gcgaacagtt cggctggcgc gagcccctga 4260 tgctcttcgt ccagatcatc ctgatcgaca agaccggctt ccatccgagt acgtgctcgc 4320 tcgatgcgat gtttcgcttg gtggtcgaat gggcaggtag ccggatcaag cgtatgcagc 4380 cgccgcattg catcagccat gatggatact ttctcggcag gagcaaggtg agatgacagg 4440 agatcctgcc ccggcacttc gcccaatagc agccagtccc ttcccgcttc agtgacaacg 4500 tcgagcacag ctgcgcaagg aacgcccgtc gtggccagcc acgatagccg cgctgcctcg 4560 tcttgcagtt cattcagggc accggacagg tcggtcttga caaaaagaac cgggcgcccc 4620 tgcgctgaca gccggaacac ggcggcatca gagcagccga ttgtctgttg tgcccagtca 4680 tagccgaata gcctctccac ccaagcggcc ggagaacctg cgtgcaatcc atcttgttca 4740 atcataatat tattgaagca tttatcaggg ttcgtctcgt cccggtctcc tcccaatgca 4800 tgtcaatatt ggccattagc catattattc attggttata tagcataaat caatattggc 4860 tattggccat tgcatacgtt gtatctatat cataata 4897 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EF1a-2r primer <400> 36 caccggagcc aattcccact 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AAVS-3r primer <400> 37 ctgcaccacg tgatgtcctc 20 <210> 38 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SV40pA-1r primer <400> 38 gtaaccatta taagctgcaa taaacaag 28 <210> 39 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AAVS-2f primer <400> 39 ctggggactc tttaaggaaa gaag 24 <210> 40 <211> 1591 <212> PRT <213> Artificial Sequence <220> <223>dCas9-Clo051 <400> 40 Met Ala Pro Lys Lys Lys Arg Lys Val Glu Gly Ile Lys Ser Asn Ile 1 5 10 15 Ser Leu Leu Lys Asp Glu Leu Arg Gly Gln Ile Ser His Ile Ser His 20 25 30 Glu Tyr Leu Ser Leu Ile Asp Leu Ala Phe Asp Ser Lys Gln Asn Arg 35 40 45 Leu Phe Glu Met Lys Val Leu Glu Leu Leu Val Asn Glu Tyr Gly Phe 50 55 60 Lys Gly Arg His Leu Gly Gly Ser Arg Lys Pro Asp Gly Ile Val Tyr 65 70 75 80 Ser Thr Thr Leu Glu Asp Asn Phe Gly Ile Ile Val Asp Thr Lys Ala 85 90 95 Tyr Ser Glu Gly Tyr Ser Leu Pro Ile Ser Gln Ala Asp Glu Met Glu 100 105 110 Arg Tyr Val Arg Glu Asn Ser Asn Arg Asp Glu Glu Val Asn Pro Asn 115 120 125 Lys Trp Trp Glu Asn Phe Ser Glu Glu Val Lys Lys Tyr Tyr Phe Val 130 135 140 Phe Ile Ser Gly Ser Phe Lys Gly Lys Phe Glu Glu Gln Leu Arg Arg 145 150 155 160 Leu Ser Met Thr Thr Gly Val Asn Gly Ser Ala Val Asn Val Val Asn 165 170 175 Leu Leu Leu Gly Ala Glu Lys Ile Arg Ser Gly Glu Met Thr Ile Glu 180 185 190 Glu Leu Glu Arg Ala Met Phe Asn Asn Ser Glu Phe Ile Leu Lys Tyr 195 200 205 Gly Gly Gly Gly Ser Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly 210 215 220 Thr Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro 225 230 235 240 Ser Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys 245 250 255 Lys Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu 260 265 270 Ala Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys 275 280 285 Asn Arg Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys 290 295 300 Val Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu 305 310 315 320 Glu Asp Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp 325 330 335 Glu Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys 340 345 350 Lys Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu 355 360 365 Ala Leu Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly 370 375 380 Asp Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu 385 390 395 400 Val Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser 405 410 415 Gly Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg 420 425 430 Arg Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly 435 440 445 Leu Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe 450 455 460 Lys Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys 465 470 475 480 Asp Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp 485 490 495 Gln Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile 500 505 510 Leu Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro 515 520 525 Leu Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu 530 535 540 Thr Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys 545 550 555 560 Glu Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp 565 570 575 Gly Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu 580 585 590 Glu Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu 595 600 605 Asp Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His 610 615 620 Gln Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp 625 630 635 640 Phe Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu 645 650 655 Thr Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser 660 665 670 Arg Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp 675 680 685 Asn Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile 690 695 700 Glu Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu 705 710 715 720 Pro Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu 725 730 735 Thr Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu 740 745 750 Ser Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn 755 760 765 Arg Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile 770 775 780 Glu Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn 785 790 795 800 Ala Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys 805 810 815 Asp Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val 820 825 830 Leu Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu 835 840 845 Lys Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys 850 855 860 Arg Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn 865 870 875 880 Gly Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys 885 890 895 Ser Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp 900 905 910 Ser Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln 915 920 925 Gly Asp Ser Leu His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala 930 935 940 Ile Lys Lys Gly Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val 945 950 955 960 Lys Val Met Gly Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala 965 970 975 Arg Glu Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg 980 985 990 Met Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu 995 1000 1005 Lys Glu His Pro Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu 1010 1015 1020 Tyr Leu Tyr Tyr Leu Gln Asn Gly Arg Asp Met Tyr Val Asp Gln 1025 1030 1035 Glu Leu Asp Ile Asn Arg Leu Ser Asp Tyr Asp Val Asp Ala Ile 1040 1045 1050 Val Pro Gln Ser Phe Leu Lys Asp Asp Ser Ile Asp Asn Lys Val 1055 1060 1065 Leu Thr Arg Ser Asp Lys Asn Arg Gly Lys Ser Asp Asn Val Pro 1070 1075 1080 Ser Glu Glu Val Val Lys Lys Met Lys Asn Tyr Trp Arg Gln Leu 1085 1090 1095 Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe Asp Asn Leu Thr 1100 1105 1110 Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp Lys Ala Gly Phe 1115 1120 1125 Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr Lys His Val 1130 1135 1140 Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp Glu Asn 1145 1150 1155 Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser Lys 1160 1165 1170 Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg 1175 1180 1185 Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala 1190 1195 1200 Val Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser 1205 1210 1215 Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met 1220 1225 1230 Ile Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr 1235 1240 1245 Phe Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr 1250 1255 1260 Leu Ala Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn 1265 1270 1275 Gly Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala 1280 1285 1290 Thr Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys 1295 1300 1305 Lys Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu 1310 1315 1320 Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp 1325 1330 1335 Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr 1340 1345 1350 Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys 1355 1360 1365 Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg 1370 1375 1380 Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly 1385 1390 1395 Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr 1400 1405 1410 Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser 1415 1420 1425 Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys 1430 1435 1440 Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys 1445 1450 1455 Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln 1460 1465 1470 His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe 1475 1480 1485 Ser Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu 1490 1495 1500 Ser Ala Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala 1505 1510 1515 Glu Asn Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro 1520 1525 1530 Ala Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr 1535 1540 1545 Thr Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser 1550 1555 1560 Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly 1565 1570 1575 Gly Asp Gly Ser Pro Lys Lys Lys Arg Lys Val Ser Ser 1580 1585 1590 <210> 41 <211> 4073 <212> DNA <213> Artificial Sequence <220> <223> pHR-GFP- selection gene plasmid <400> 41 ggggccacta gggacaggat cggcgtcttc actcgctggg ttcccttttc cttctccttc 60 tggggcctgt gccatctctc gtttcttagg atggccttct ccgacggatg tctcccttgc 120 gtccccgcctc cccttcttgt aggcctgcat catcaccgtt tttctggaca accccaaagt 180 accccgtctc cctggcttta gccacctctc catcctcttg ctttctttgc ctggacaccc 240 cgttctcctg tggattcggg tcacctctca ctcctttcat ttgggcagct cccctacccc 300 ccttacctct ctagtctgtg ctagctcttc cagccccctg tcatggcatc ttccaggggt 360 ccgagagctc agctagtctt cttcctccaa cccgggcccc tatgtccact tcaggacagc 420 atgtttgctg cctccaggga tcctgtgtcc ccgagctggg accaccttat attcccaggg 480 ccggttaatg tggctctggt tctgggtact tttatctgtc ccgacgtccg atcgaaccat 540 ggacagttag ctttgcaaag atggataaag ttttaaacag agaggaatct ttgcagctaa 600 tggaccttct aggtcttgaa aggagtggga attggctccg gtgcccgtca gtgggcagag 660 cgcacatcgc ccacagtccc cgagaagttg gggggagggg tcggcaattg aaccggtgcc 720 tagagaaggt ggcgcggggt aaactgggaa agtgatgtcg tgtactggct ccgccttttt 780 cccgagggtg ggggagaacc gtatataagt gcagtagtcg ccgtgaacgt tctttttcgc 840 aacgggtttg ccgccagaac acaggtaagt gccgtgtgtg gttcccgcgg gcctggcctc 900 tttacgggtt atggcccttg cgtgccttga attacttcca cctggctgca gtacgtgatt 960 cttgatcccg agcttcgggt tggaagtggg tgggagagtt cgaggccttg cgcttaagga 1020 gccccttcgc ctcgtgcttg agttgaggcc tggcctgggc gctggggccg ccgcgtgcga 1080 atctggtggc accttcgcgc ctgtctcgct gctttcgata agtctctagc catttaaaat 1140 ttttgatgac ctgctgcgac gctttttttc tggcaagata gtcttgtaaa tgcgggccaa 1200 gatctgcaca ctggtatttc ggtttttggg gccgcgggcg gcgacggggc ccgtgcgtcc 1260 cagcgcacat gttcggcgag gcggggcctg cgagcgcggc caccgagaat cggacggggg 1320 tagtctcaag ctggccggcc tgctctggtg cctggcctcg cgccgccgtg tatcgccccg 1380 ccctgggcgg caaggctggc ccggtcggca ccagttgcgt gagcggaaag atggccgctt 1440 cccggccctg ctgcagggag ctcaaaatgg aggacgcggc gctcggggaga gcgggcgggt 1500 gagtcaccca cacaaaggaa aagggccttt ccgtcctcag ccgtcgcttc atgtgactcc 1560 acggagtacc gggcgccgtc caggcacctc gattagttct cgagcttttg gagtacgtcg 1620 tctttaggtt ggggggaggg gttttatgcg atggagtttc cccacactga gtgggtggag 1680 actgaagtta ggccagcttg gcacttgatg taattctcct tggaatttgc cctttttgag 1740 tttggatctt ggttcattct caagcctcag acagtggttc aaagtttttt tcttccattt 1800 caggtgtcgt gagaattcta atacgactca ctatagggtg tgctgtctca tcattttggc 1860 aaagattggc caccaagctt accgccatgg tgagcaaggg cgaggagctg ttcaccgggg 1920 tggtgcccat cctggtcgag ctggacggcg acgtaaacgg ccacaagttc agcgtgtccg 1980 gcgagggcga gggcgatgcc acctacggca agctgaccct gaagttcatc tgcaccaccg 2040 gcaagctgcc cgtgccctgg cccaccctcg tgaccaccct gacctacggc gtgcagtgct 2100 tcagccgcta ccccgaccac atgaagcagc acgacttctt caagtccgcc atgcccgaag 2160 gctacgtcca ggagcgcacc atcttcttca aggacgacgg caactacaag acccgcgccg 2220 aggtgaagtt cgagggcgac accctggtga accgcatcga gctgaagggc atcgacttca 2280 aggaggacgg caacatcctg gggcacaagc tggagtacaa ctacaacagc cacaacgtct 2340 atatcatggc cgacaagcag aagaacggca tcaaggtgaa cttcaagatc cgccacaaca 2400 tcgaggacgg cagcgtgcag ctcgccgacc actaccagca gaacaccccc atcggcgacg 2460 gccccgtgct gctgcccgac aaccactacc tgagcaccca gtccgccctg agcaaagacc 2520 ccaacgagaa gcgtgatcac atggtcctgc tggagttcgt gaccgccgcc gggatcactc 2580 tcggcatgga cgagctgtac aaggaaggaa gaggcagcct gctgacatgt ggcgacgtgg 2640 aggagaaccc tggcccaatg gtgggcagcc tgaattgtat cgtggccgtg tcccagaaca 2700 tgggcatcgg caagaatggc gattttcctt ggccccctct gagaaatgag tccagatact 2760 ttcagaggat gaccacaacc agctccgtgg agggcaagca gaacctggtc atcatgggca 2820 agaagacatg gttctctatc ccagagaaga accgccccct gaagggccgg atcaatctgg 2880 tgctgagcag ggagctgaag gagccacccc agggagcaca ctttctgtcc aggtctctgg 2940 acgatgccct gaagctgacc gagcagcctg agctggccaa caaggtggac atggtgtgga 3000 tcgtgggcgg ctctagcgtg tataaggagg ccatgaatca ccctggccac ctgaagctgt 3060 tcgtgacacg gatcatgcag gactttgagt ccgatacctt ctttccagag atcgacctgg 3120 agaagtacaa gctgctgccc gagtatcctg gcgtgctgtc tgatgtgcag gaggagaagg 3180 gcatcaagta caagttcgag gtgtatgaga agaacgattg ataacatatg cctttaatta 3240 aacactagtt ctatagtgtc acctaaattc cctttagtga gggttaatgg ccgtaggccg 3300 ccagaattgg gtccagacat gataagatac attgatgagt ttggacaaac cacaactaga 3360 atgcagtgaa aaaaatgctt tatttgtgaa atttgtgatg ctattgcttt atttgtaacc 3420 attataagct gcaataaaca agttaacaac aacaattgca ttcattttat gtttcaggtt 3480 cagggggagg tgtgggaggt tttttcggac tctaggacct gcgcatgcgc ttggggtacc 3540 taggatatcg acagaaaagc cccatcctta ggcctcctcc ttcctagtct cctgatattg 3600 ggtctaaccc ccacctcctg ttaggcagat tccttatctg gtgacacacc cccattcct 3660 ggagccatct ctctccttgc cagaacctct aaggtttgct tacgatggag ccagagagga 3720 tcctgggagg gagagcttgg cagggggtgg gagggaaggg ggggatgcgt gacctgcccg 3780 gttctcagtg gccaccctgc gctaccctct cccagaacct gagctgctct gacgcggccg 3840 tctggtgcgt ttcactgatc ctggtgctgc agcttcctta cacttcccaa gaggagaagc 3900 agtttggaaa aacaaaatca gaataagttg gtcctgagtt ctaactttgg ctcttcacct 3960 ttctagtccc caatttatat tgttcctccg tgcgtcagtt ttacctgtga gataaggcca 4020 gtagccagcc ccgtcctggc agggctgtgc ctctagggac aggattggtg acg 4073 <210> 42 <211> 3089 <212> DNA <213> Artificial Sequence <220> <223> pMMEJ-GFP-selection gene plasmid <400> 42 ccaatcctgt ccctagtggc cccactgtgg ggacgtccga tcgaaccatg gacagttagc 60 tttgcaaaga tggataaagt tttaaacaga gaggaatctt tgcagctaat ggaccttcta 120 ggtcttgaaa ggagtgggaa ttggctccgg tgcccgtcag tgggcagagc gcacatcgcc 180 cacagtcccc gagaagttgg ggggaggggt cggcaattga accggtgcct agagaaggtg 240 gcgcggggta aactgggaaa gtgatgtcgt gtactggctc cgcctttttc ccgagggtgg 300 gggagaaccg tatataagtg cagtagtcgc cgtgaacgtt ctttttcgca acgggtttgc 360 cgccagaaca caggtaagtg ccgtgtgtgg ttcccgcggg cctggcctct ttacgggtta 420 tggcccttgc gtgccttgaa ttacttccac ctggctgcag tacgtgattc ttgatcccga 480 gcttcgggtt ggaagtgggt gggagagttc gaggccttgc gcttaagggag ccccttcgcc 540 tcgtgcttga gttgaggcct ggcctgggcg ctggggccgc cgcgtgcgaa tctggtggca 600 ccttcgcgcc tgtctcgctg ctttcgataa gtctctagcc atttaaaatt tttgatgacc 660 tgctgcgacg ctttttttct ggcaagatag tcttgtaaat gcgggccaag atctgcacac 720 tggtatttcg gtttttgggg ccgcgggcgg cgacggggcc cgtgcgtccc agcgcacatg 780 ttcggcgagg cggggcctgc gagcgcggcc accgagaatc ggacgggggt agtctcaagc 840 tggccggcct gctctggtgc ctggcctcgc gccgccgtgt atcgccccgc cctgggcggc 900 aaggctggcc cggtcggcac cagttgcgtg agcggaaaga tggccgcttc ccggccctgc 960 tgcagggagc tcaaaatgga ggacgcggcg ctcgggagag cgggcgggtg agtcacccac 1020 acaaaggaaa agggcctttc cgtcctcagc cgtcgcttca tgtgactcca cggagtaccg 1080 ggcgccgtcc aggcacctcg attagttctc gagcttttgg agtacgtcgt ctttaggttg 1140 gggggagggg ttttatgcga tggagtttcc ccacactgag tgggtggaga ctgaagttag 1200 gccagcttgg cacttgatgt aattctcctt ggaatttgcc ctttttgagt ttggatcttg 1260 gttcattctc aagcctcaga cagtggttca aagttttttt cttccatttc aggtgtcgtg 1320 agaattctaa tacgactcac tatagggtgt gctgtctcat cattttggca aagattggcc 1380 accaagctta ccgccatggt gagcaagggc gaggagctgt tcaccggggt ggtgcccatc 1440 ctggtcgagc tggacggcga cgtaaacggc cacaagttca gcgtgtccgg cgagggcgag 1500 ggcgatgcca cctacggcaa gctgaccctg aagttcatct gcaccaccgg caagctgccc 1560 gtgccctggc ccaccctcgt gaccaccctg acctacggcg tgcagtgctt cagccgctac 1620 cccgaccaca tgaagcagca cgacttcttc aagtccgcca tgcccgaagg ctacgtccag 1680 gagcgcacca tcttcttcaa ggacgacggc aactacaaga cccgcgccga ggtgaagttc 1740 gagggcgaca ccctggtgaa ccgcatcgag ctgaagggca tcgacttcaa ggaggacggc 1800 aacatcctgg ggcacaagct ggagtacaac tacaacagcc acaacgtcta tatcatggcc 1860 gacaagcaga agaacggcat caaggtgaac ttcaagatcc gccacaacat cgaggacggc 1920 agcgtgcagc tcgccgacca ctaccagcag aacacccca tcggcgacgg ccccgtgctg 1980 ctgcccgaca accactacct gagcacccag tccgccctga gcaaagaccc caacgagaag 2040 cgtgatcaca tggtcctgct ggagttcgtg accgccgccg ggatcactct cggcatggac 2100 gagctgtaca aggaaggaag aggcagcctg ctgacatgtg gcgacgtgga ggagaaccct 2160 ggcccaatgg tgggcagcct gaattgtatc gtggccgtgt cccagaacat gggcatcggc 2220 aagaatggcg attttccttg gccccctctg agaaatgagt ccagatactt tcagaggatg 2280 accacaacca gctccgtgga gggcaagcag aacctggtca tcatgggcaa gaagacatgg 2340 ttctctatcc cagagaagaa ccgccccctg aagggccgga tcaatctggt gctgagcagg 2400 gagctgaagg agccacccca gggagcacac tttctgtcca ggtctctgga cgatgccctg 2460 aagctgaccg agcagcctga gctggccaac aaggtggaca tggtgtggat cgtgggcggc 2520 tctagcgtgt ataagggaggc catgaatcac cctggccacc tgaagctgtt cgtgacacgg 2580 atcatgcagg actttgagtc cgataccttc tttccagaga tcgacctgga gaagtacaag 2640 ctgctgcccg agtatcctgg cgtgctgtct gatgtgcagg aggagaaggg catcaagtac 2700 aagttcgagg tgtatgagaa gaacgattga taacatatgc ctttaattaa acactagttc 2760 tatagtgtca cctaaattcc ctttagtgag ggttaatggc cgtaggccgc cagaattggg 2820 tccagacatg ataagataca ttgatgagtt tggacaaacc acaactagaa tgcagtgaaa 2880 aaaatgcttt atttgtgaaa tttgtgatgc tattgcttta tttgtaacca ttataagctg 2940 caataaaacaa gttaacaaca acaattgcat tcattttatg tttcaggttc agggggaggt 3000 gtgggaggtt ttttcggact ctaggacctg cgcatgcgct tggggtacct aggatatcgg 3060 atggggcttt tctgtcacca atcctgagg 3089

Claims (39)

A method of generating a plurality of modified T cells, comprising:
(a) a transposon composition comprising (i) a transposon comprising a nucleic acid sequence encoding an antigen receptor, and (ii) a transposase or a nucleic acid sequence encoding a transposase, to a plurality of primary human T cells. Introducing a transposase composition; and
(b) culturing the modified T cells under conditions that preserve the desired stem-like properties of the modified T cells, such that at least 25% of the plurality of modified T cells are stem memory T cells (T _SCM ) or T _SCM -like. causing the cell to express one or more cell surface marker(s),
A method of producing one or more cell surface marker(s) comprising CD45RA and CD62L. 2. The method of claim 1, wherein said introducing step comprises homologous recombination. 3. The method of claim 2, wherein the homologous recombination is performed by contacting the transposon composition and genome editing construct comprising a nucleic acid sequence encoding an antigen receptor with the genomic sequence of at least one primary human T cell among the plurality of primary human T cells. A method that includes the step of asking. The method of claim 3, wherein the genome editing structure comprises a guide RNA and a clustered regularly interspaced short palindromic repeats (CRISPR)-related protein 9 (Cas9) DNA endonuclease. . The method of claim 4, wherein the genome editing construct comprises a DNA binding domain and a type IIS endonuclease. The method of claim 3, wherein the genome editing structure is an amino acid sequence derived from Cas9 endonuclease, an amino acid sequence derived from a transcription activator-like effector nuclease (TALEN), or a zinc finger nuclease. A method comprising an amino acid sequence derived from zinc-finger nuclease (ZFN). The method of claim 6, wherein the amino acid sequence derived from the Cas9 endonuclease is a DNA binding domain or encodes an inactive Cas9. 4. The method of claim 3, wherein the genome editing construct comprises a safe harbor region on a human chromosome, a nucleic acid sequence encoding a component of the endogenous major histocompatibility complex (MHC) on a human chromosome, or a nucleic acid sequence encoding a component of the endogenous T cell receptor. How to target. The method of claim 1, wherein the transposon is a piggyBac transposon, Sleeping Beauty transposon, Hellraiser transposon, or Tol2 transposon. The method of claim 1, wherein the transposase is piggyback transposase, super piggyback transposase, sleeping beauty transposase, hyperactive sleeping beauty transposase (SB100X), Helitron transposase, or Tol2 transposase method. The method of claim 1, wherein the sequence encoding the transposase is an mRNA sequence. The method of claim 1, wherein the antigen receptor is a T cell receptor (TCR). 13. The method of claim 12, wherein the TCR is not naturally occurring. The method of claim 1, wherein the antigen receptor is a chimeric antigen receptor (CAR). The method of claim 14, wherein the CAR comprises at least one of a single chain variable fragment (scFv), a single domain antibody, a VHH, an antibody mimetic, a protein scaffold, or Centyrin. 2. The method of claim 1, wherein the antigen receptor is a therapeutic protein that is a secreted or secretible protein. 2. The method of claim 1, wherein the T cell activator composition comprises one or more of an anti-human CD3 monospecific tetrameric antibody complex, an anti-human CD28 monospecific tetrameric antibody complex, and an activation supplement and said plurality of modified The method further comprising contacting the T cells to generate a plurality of activated modified T cells. 18. The method of claim 17, wherein the T cell activator composition further comprises an anti-human CD2 monospecific tetrameric antibody complex. The method of claim 1, wherein the modified T cells contain sterols; alkanes; A method comprising culturing in a medium containing phosphorus and one or more of octanoic acid, palmitic acid, linoleic acid, and oleic acid. 20. The method of claim 19, wherein the medium contains octanoic acid at a concentration of 0.9 mg/kg to 90 mg/kg inclusive or 6.4 μmol/kg to 640 μmol/kg inclusive; palmitic acid at a concentration of 0.2 mg/kg to 20 mg/kg including the end point or from 0.7 μmol/kg to 70 μmol/kg including the end point; linoleic acid at a concentration of 0.2 mg/kg to 20 mg/kg inclusive of the end point or from 0.75 μmol/kg to 75 μmol/kg inclusive of the end point; oleic acid at a concentration between 0.2 mg/kg and 20 mg/kg inclusive of the end point or between 0.75 μmol/kg and 75 μmol/kg inclusive of the end point; and a sterol at a concentration of 0.1 mg/kg to 10 mg/kg including the end point or a concentration of 0.25 μmol/kg to 25 μmol/kg including the end point. The method of claim 1, wherein at least 30%, at least 40%, at least 50%, or at least 60% of the plurality of modified T cells display one or more cell surface markers of stem memory T cells (T _SCM ) or T _SCM -like cells. A method of expressing (s). The method of claim 1 , wherein at least 25% or at least 30% of the plurality of modified T cells further express one or more of CD28, CCR7, CD127, CD45RO, CD95, and IL-2Rβ. delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete