RU2405824C1 - RECOMBINANT PLASMID pFastBAC-B17R DNA CONTAINING COWPOX VIRUS GENOME FRAGMENT CODING ALPHA/BETA-INTERFERON BINDING PROTEIN AND BvB17RG BACULOVIRUS STRAIN PRODUCING SOLUBLE ALPHA/BETA-INTERFERON BINDING PROTEIN OF COWPOX VIRUS - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: recombinant plasmid pFastBac-B17R DNA carries a cowpox virus genome fragment. BvB 17RG recombinant baculovirus strain is produced with the use of recombinant plasmid pFastBac-B 17R DNA and deposited in the Microorganism Cultures Collection of the Federal State Research Institution 'State Research Centre for Virology and Biotechnology 'Vector' of Federal Service for Supervision of Consumer Rights Protection and Human Welfare' (FGUN GNC VB 'Vector' of Rospotrebnadzor) under No. V-388, characterised as a producer of a soluble analogue protein of cowpox interferons type 1 cell receptor.

EFFECT: extended spectrum of preparations of new generation.

2 cl, 5 dwg, 8 ex

Description

The invention relates to a substance capable of modulating the exogenous synthesis of α / β-interferon in order to create drugs for immunocorrection or used as a component of a test system for determining the interferon status of a person in normal and pathological conditions, in biological samples (blood, tissues), and can be used in medicine and biotechnology, in particular in genetic engineering.

Type I interferons (α- and β-IFN) are produced by warm-blooded cells in response to a viral infection [1] and induce the expression of a number of genes whose products have antiviral activity [2, 3]. In some cases, the promising therapeutic use of interferon-alpha has been shown [4-6].

However, an increase in the level of IFNα is observed in a number of autoimmune diseases [7], in the initial stages of AIDS development [8]; in various diseases of the central nervous system and multiple sclerosis, IFNβ production is enhanced [9, 10].

Therefore, the search for substances capable of modulating the effects of IFNα and IFNβ is of interest for creating new drugs for immunocorrection. The candidate for the role of such drugs may be the α / βIFN-binding protein of orthopoxviruses. This protein can also be used as a component of test systems for determining the content of interferons in biological samples [11].

Analogs are known that are presented in [12-14], which describe proteins isolated from human biological fluids that are capable of binding type I interferons (IFN_I).

The closest analogue (prototype) of the claimed technical solution is the interferon-binding protein - the product of the expression of the B18R gene of the recombinant strain of vaccinia virus (BOB) Western Reserve [15].

However, the vaccinia virus (BAC) is non-pathogenic to humans, i.e. has a wide range of hosts. It is known that TNF- and complement-binding proteins of orthopoxviruses, despite the high degree of homology of orthologous genes, differ at the biochemical level, and high biological activity corresponds to a protein of a virus that is more pathogenic for humans [16, 17].

The technical result of the invention is to expand the range of drugs (recombinant α / β-interferon-binding proteins) of a new generation, capable of modulating the exogenous synthesis of α / β-interferon to create drugs for immunocorrection, or used as a component of test systems to determine the normal human interferon status and pathology.

The problem is solved by creating a recombinant baculovirus - producer of a soluble analogue of the cellular receptor for interferon I-type (IFN_I-BP) BOK. The first step in creating a producer strain is the construction of recombinant plasmid DNA pFastBac-B17R containing a fragment of the BOK genome that encodes the amino acid sequence of an analogue of the cell interferon receptor type I. The target plasmid pFastBac-B17R has a size of 5913 bp and a molecular weight of 3.85 Mda and consists of:

- a fragment of the BOK genome of strain GRI-90 with a length of 1161 bp encoding a protein analogue of the cell receptor for type I interferons;

- vector plasmid pFastBac [19], 4752 bp in length, providing site-specific transposition of the target DNA fragment into the baculovirus genome.

Recombinant baculovirus obtained by site-specific transposition of the target DNA fragment from the donor plasmid pFastBac1-B17R into the baculovirus vector (bacmid) located in E. coli [19] after infection of insect cells Spodoptera frugiperda of the Sf21 line produces a soluble wok protein of strain GRI -90 (INF_I-BP) is an analogue of the interferon receptor type I.

The inventive recombinant strain of EQA has a wider range of hosts among animals and, when in contact with a sick animal, can cause human disease, and the recombinant strain of the BOB prototype is non-pathogenic for humans. As mentioned above, it is known that TNF- and complement-binding proteins of orthopoxviruses differ at the biochemical level, and greater biological activity corresponds to a protein of a virus more pathogenic for humans [16, 17].

As a fragment of the EQA genome, a 1161 bp DNA fragment obtained by polymerase chain reaction was used. The amplification DNA is the wok DNA of strain GRI-90. Primers for amplification of the gene analog of the receptor INF-gamma wok have the following structure:

1.5 'CGGGATCCTAGTGCCGTATAATGACGATGA 3'

2.5 'CCCAAGCTTGTATATAAAAATGCATTGTGTA 3'

The structure of primer 1 and 2 contains recognition sites for restriction endonucleases BamHI and HindIIII, respectively. The plasmid pFastBac [18] containing the baculovirus specific pPolh promoter for expression of proteins in insect cells, mini-Tn7-transposon, gentamicin Gm resistance gene ^r , polylinker for cloning target genes and signal for polyadenylation of the SV-40 virus. Bakmid pMON14272 contains a low copy mini-F replicon, a kanamycin resistance gene, and a DNA fragment encoding the α-peptide of the E. coli β-galactosidase gene and provides α-complementation when propagated in E. coli DH10Bac ™ strain in the presence of the X-gal chromogenic substrate and IPTG inductor.

The selected baculovirus expression system provides a high level of synthesis of the target product and its correct post-translational modification in comparison with other expression systems.

The essence of the invention lies in the fact that the B17R gene is isolated by PCR from the GRI-90 strain VOA genome, then it is cloned in the pFastBac donor plasmid and a recombinant bacmid is constructed by site-specific transposition, which is used to transfect insect cells, as a result of which a recombinant virus is generated BvB17RG expressing the indicated gene. The nucleotide sequence of the inserted fragment and the amino acid sequence encoded by it are shown in figure 1.

The strain is characterized by the following features:

Morphological signs. The strain has the properties of a typical representative of baculoviruses, but unlike the vector virus, it has the Lac ^- phenotype.

Physiological and biochemical characteristics and cultural properties of the strain. Recombinant baculovirus DNA is about 140,000 bp in length. The presence of a target insertion of 1161 bp in its genome was confirmed using the PCR method. When a recombinant baculovirus is propagated on an insect cell culture Spodoptera frugiperda of the Sf21 line, its titer does not differ from that obtained by propagating a virus that does not contain foreign DNA fragments in its genome.

The main difference of the strain is its ability to synthesize IFN_I-BP / BOK protein that binds recombinant interferon α2B (IFNa2B) upon infection of Sf21 insect cell culture. The level of synthesis of the target protein is 2.5 mg / l of culture fluid of infected Sf21 cells.

The resulting strain of recombinant baculovirus BV-B17R was deposited in the collection of microorganisms of the Federal State Institution “State Scientific Center of Virology and Biotechnology" Vector "of the Federal Service for Supervision of Human Welfare under number V-388.

The invention is illustrated by the following figures of graphic images:

Figure 1. The nucleotide sequence of the B17R EQA gene (strain GRI-90) [20] and the amino acid sequence of the recombinant protein, an analogue of the cell interferon receptor type I [GenBank, CAD90743]. DNA sequences complementary to the specific primers used for PCR are highlighted in bold italics and underlined. Unique EcoRI restriction endonuclease sites are grayed out.

Figure 2. A physical map of the plasmid pFastBac-B17R is presented. The first nucleotide of the plasmid is the first nucleotide of the intercistronic region of phage fl; Tn7L, Tn7R sites for insertion of the transnase Tn7; SV40polyA- SV40 polyadenylation site; B17R - gene IFN_I-binding protein of the wok strain GRI-90; pPolh is a polyhedrin promoter; Ori site of replication initiation; Ap ^r , Gm ^r - markers of resistance to antibiotics.

Figure 3. The electrophoretic analysis in 1% agarose of PCR fragments containing the B17R gene amplified using specific primers with wok DNA (GRI-90) (lane 1) and from bacmid bMON14272-B17R (lane 2) and BamH / HindIII-recombinant DNA hydrolysates is presented. pFastBac and pFastBac-B17R (lanes 3 and 4, respectively). Lane M - DNA markers (100b.p. + 1.5 Kb + 3 Kb, NPO Sibenzim, Russia).

Figure 4. An electrophoretic analysis of recombinant IFNJ_BP / BOK protein, isolated by affinity chromatography from insect cells of the Sf-21 line (lane 1) by affinity chromatography is presented in 10% PAGE; lane 2 — M — molecular weight markers of proteins (103.7 kDa, 81.1 kDa, 47.7 kDa, 35.8 kDa, 27.1 kDa and 19.3 kDa, Prestained SDS-PAGE Standarts, BioRad, USA).

Figure 5. A graph of the α2B-interferon and deltaferon-binding activities of Sf-21 cell lysates infected with the recombinant baculovirus BvB17RG (-o- and -, respectively) and the α2B-interferon-binding activity of Sf-21 cell lysates is presented.

For a better understanding of the invention, the following are examples of its implementation.

Example 1. The method of amplification of a DNA fragment containing the B17R BOK gene.

The amplification reaction is carried out in Eppendorf tubes under a layer of mineral oil in a volume of 50 μl. The reaction mixture contains 10 mM Tris-HCl pH 8.8, 50 mM KCl, 2.5 mM MgCl ₂ , 0.1% Tween 20, 0.2 mM dATP, 0.2 mM dCTP, 0.2 mM dGTP, 0.2 mM dTTP, oligonucleotide primers in an amount of 40 pmol each, 2 food. Tth polymerase, 2-10 ng of the DNA template. Amplification is carried out for 20 cycles according to the scheme:

Cycle number Temperature (° C) Time (min) one 93 2 minutes 53 1 min 72 1 min 2-19 93 1 min 53 1 min 72 1 min twenty 93 1 min 53 1 min 72 10 min

Then chloroform is added to the reaction mixture, the aqueous phase is taken and transferred to a clean tube. The presence of the amplified product is checked by electrophoresis in 1% agarose gel (FIG. 3, lane 1).

Example 2. Construction of recombinant plasmid DNA pFastBac-B17R.

5-10 μg of the plasmid pFastBac [18] and 1-5 μg of the amplified product corresponding to the B17R BOK gene are hydrolyzed with BamHI and HindIII restriction endonucleases under standard conditions. The resulting fragments were isolated by electrophoresis on a 1% agarose gel, followed by elution. 0.2 μg of the vector and 0.6 μg of the fragment are ligated under standard conditions and competent E. coli cells of strain XL-blue are transformed with the obtained ligase mixture. Cellular Ap ^r clones are grown at 37 ° C in LB broth containing 100 μg / ml ampicillin to the stationary phase. Recombinant plasmid DNA was isolated by standard methods and analyzed using restriction endonucleases BamHI and HindIII. Plasmid DNA is isolated from the clones containing the inserted fragment, the structure of which in the insertion region is confirmed by determining the nullotide sequence by terminating the synthesized chain on an ABM PRISM ™ 310 sequencer (Perkin Elmer, Germany) (Fig. 1).

The thus obtained target plasmid, the physical map of which is shown in FIG. 2, is designated pFastBac-B17R.

Example 3. Obtaining Bakmid pMON14272-B17R.

To 100 μl of competent cells of E. coli strain DH10Bac ™ add 1 ng of plasmid pFastBac-B17R. The resulting mixture was incubated in ice for 30 minutes, then at 42 ° C for 45 seconds, followed by cooling in ice for 2 minutes. The reaction mixture was diluted 1:10 with LB broth and grown on a rocking chair with vigorous aeration at 37 ° for 4 hours. The cells are then plated on selective Petri dishes with LB agar containing 100 μg / ml X-gal, 40 μg / ml IPTG, 50 μg / ml kanamycin, 7 μg / ml gentamicin, 10 μg / ml tetracycline, in an incubator at 37 ° C and incubate for a day. Clones with the Lac phenotype ^are seeded in test tubes with 5 ml LB broth containing 50 μg / ml kanamycin, 7 μg / ml gentamicin, 10 μg / ml tetracycline and grown under intensive aeration at 37 ° to the stationary phase. The culture is transferred to 1.5 ml Eppendorf tubes, the cells are pelleted by centrifugation for 40 seconds at 14000g, and the medium is removed. The procedure for adding culture, sedimentation and removal of the medium is repeated two more times. The precipitate was resuspended in 0.3 ml of solution 1 (10 mM EDTA, 15 mM Tris-HCl pH 8.0, 100 μg / ml RNase), 0.3 ml of solution 2 (0.2 M NaOH, 1% SDS) was added and incubated at room temperature for 5 minutes. 0.3 ml of solution 3 (3 M KAc pH 5.2) was slowly added to the mixture. Incubate in ice for 10 minutes. Centrifuged at 14,000 rpm for 10 minutes. The supernatant was transferred to a clean tube, 0.8 ml of isopropanol was added, stirred and cooled at -20 ° C for 5 minutes, then precipitated at 14,000 rpm for 15 minutes. The precipitate was washed twice with ethanol, dried, dissolved in 40 μl of TE buffer. The presence of an integrated DNA fragment in the bacmid genome is confirmed by PCR (Figure 3, lane 2). The resulting bacmid DNA pMON14272-B17R is used to transfect insect cells of the Sf21 line.

Example 4. Transfection of insect cells Sf21 recombinant bacmid DNA pMON14272-B17R and obtaining recombinant virus BvB17RG.

Sf21 cells are seeded in the wells of a 6-well plate so that the next day there is a monolayer (2 × 10 ⁶ cells / well) in 2 ml of Grace medium containing 10% fetal bovine serum (ESC) (BioloT LLC, Russia ) The next day, two solutions are prepared: 10 μl of viral DNA + 100 μl of Grace medium and 6 μl of CellFECTIN reagent (LifeTechnologies, USA) + 100 μl of Grace medium. The solutions are mixed, incubated at room temperature for 25 minutes. At this time, the cell monolayer is washed twice with Grace medium. 0.8 ml / well of Grace medium and 200 μl of the prepared solution are added to the cells. Cells are incubated at 28 ° C for 5 hours. After this, the medium is selected and 2 ml of Grace medium with 10% ESC are added to the cells. Cells are incubated at 28 ° C for 2-5 days. Then the cells are resuspended (by intensive pipetting), centrifuged for 5 min at 5000 rpm and the clarified supernatant is packaged in sterile tubes. The titer of the virus is determined as follows. 200 μl of virus dilution is added to the monolayer of Sf21 cells and adsorption is carried out for 60 minutes at room temperature. Next, 2% low-melting agarose (Sigma, USA) is prepared and mixed in molten form with Grace's medium (10% ESC) in a 1: 1 ratio. The resulting medium is cooled in a thermostat to 37 ° C and 2 ml per well is added, and after solidification, 2 ml per well of Grace medium with 10% ESC is added. Incubated in a thermostat at 28 ° C for 5 days. Then, 2 ml per well of neutral red dye (0.6% aqueous solution) diluted in Grace medium with 10% ESC is added in a ratio of 1:20. Incubated at 28 ° C for a day. The titer is determined by counting stained plaques. The latter is 10 ⁷ PFU / ml. A suspension of the recombinant virus is titrated and stored at -20 ° C.

Example 5. Infection of insect cells with Sf21 recombinant virus.

200 μl of thawed viral material with a titer of 10 ⁷ is applied to a monolayer of Sf21 insect cells in a 250 ml culture mattress. Incubated for 30 minutes at room temperature. After incubation, add 25 ml of Grace medium with 10% ESC. Incubated at 28 ° C for 2-3 days. Then the cells are resuspended by intensive pipetting and centrifuged. The clarified supernatant is used to isolate the B17R BOK gene expression product in insect cells by affinity chromatography.

Example 6. Isolation by affinity chromatography of the protein IFN_I-BP / BOK, the expression product of the B17R EQA gene in insect cells.

To prepare an affinity carrier, 1 g of CNBr-activated sepharose 4B (Sigma, USA) was washed on a glass filter with 3 mM HCl and resuspended in 3.5 ml of 50 mM sodium bicarbonate buffer (pH 8.0) containing recombinant α2B interferon (FGUN) SSC VB “Vector”, Russia, [20]). Immobilization of interferon is carried out for 18 hours at a temperature of 5 ° C with gentle stirring. The resulting suspension fills a 0.5 x 4 cm column, washed with 10 ml of 0.2 M glycine-HCl (pH 2.5), and equilibrated with 10 mM Tris-HCl (pH 8.0). 200 ml of the clarified supernatant of Sf21 cells infected with recombinant baculovirus are applied to a prepared column with α2B-interferon-sepharose. The column is washed with 30 ml of buffer (10 mM Tris-HCl, pH 6.0). Recombinant protein IFN_I-BP / BOK was eluted from the column with a buffer containing 0.2 M glycine-HCl (pH 2.5). All operations are performed at a temperature of 8 ° C and an elution rate of 4 ml / hour. The volume of fractions during elution is 2.5 ml. The detection of the target product is carried out spectrophotometrically on a Perlin-Elmer 550 spectrophotometer (Germany), and then by electrophoretic analysis of the fractions according to the Lamley method [21] (Figure 4). The yield of the target product IFN_I-BP / BOK is 2.5 mg from 200 ml of clarified lysate. The resulting recombinant protein is used to produce polyclonal antibodies.

Example 7. Obtaining polyclonal antibodies to the recombinant protein IFN_I-BP / EQA.

To obtain polyclonal antibodies, 3-fold immunization of outbred rabbits weighing 2-3 kg is carried out by injecting subcutaneously in the back with the obtained recombinant protein. At the first administration, the antigen is emulsified in Freund's complete adjuvant (Sigma, USA); at subsequent immunizations, the antigen is injected in physiological saline at intervals of 7 days. One week after the last injection, the animals were bled from the marginal vein of the ear and the serum was separated. Immunoglobulins from rabbit serum are 3 times salted out with ammonium sulfate at a final saturation of 33%.

Example 8. Determination of interferon-binding activity of the product of gene expression of B17R by enzyme-linked immunosorbent assay.

For adsorption, 100 μl of a solution of α2B-interferon or a gamma-interferon analogue, deltaferon [22] (both cytokines manufactured by FSUE SSC VB "Vector", Russia) in 50 mM sodium bicarbonate (interferon concentration 2 μg / ml) and incubated for 18-20 hours at a temperature of 8 ° C. The wells of the plate are then washed with buffer B (10 mM potassium phosphate, pH 7.4, containing 0.8% NaCl and 0.05% tween-20). After removing the contents of the plate to suppress non-specific binding, 0.1% BSA (Sigma, USA) was added to wells in buffer B and incubated at room temperature for 2 hours, then removing the solution from the wells by aspiration. 100 μl of various dilutions of clarified supernatants of uninfected and recombinant baculovirus BV-B17R Sf21 cells are added to the wells of the plate. To prepare the dilution, 0.1% BSA is used in buffer B. The plate is incubated at 18 ° C for 18 hours. After washing three times with buffer B, 100 μl of polyclonal antiserum to the recombinant protein IFN_I-BP / BOK diluted with 0.1% BSA in buffer in a ratio of 1: 10000 is added to the wells of the plate. The plate is incubated at 18 h at 8 ° C. After washing three times with buffer B, 100 μl of a working solution of protein A conjugate with horseradish peroxidase (Sigma, USA) was added to each well, incubated for 2 hours at room temperature. After incubation, the wells of the plate are washed three times with buffer B, then 100 μl of freshly prepared 0.04% solution of o-phenylenediamine (Sigma, USA) in 25 mM citrate-phosphate buffer (pH 4.5) containing 0.012 are added to each well. % hydrogen peroxide. The plate is incubated for 30 minutes at room temperature in a dark place. The reaction is stopped by the addition of 100 μl / well of 1 M HCl. The results of an enzyme-linked immunosorbent assay are recorded by measuring the optical density at a wavelength of 495 nm on a Microplate Reader EL _X 808 device ("BIO-TEK INSTRUMENTS, INC", USA) (Figure 5).

Thus, a recombinant baculovirus BvB17RG was obtained that provides for the expression of the B17R gene of the smallpox virus of cows of strain GRI-90, an analogue of the gene for the cell receptor of interferon type I in insect cells of the Sf21 line. The resulting strain can be used to obtain the recombinant protein IFN_I-BP / BOK, which, in turn, can be used to develop drugs that can modulate exogenous synthesis of interferon, or a new domestic test system for determining human interferon status in normal and pathological conditions. .

Claims (2)

1. Recombinant plasmid DNA pFastBac-B17R, designed for transposition into baculovirus and carrying a fragment of the genome of the smallpox virus of cows, encoding a soluble protein-analogue of the cellular receptor for type 1 interferons, with a molecular weight of 3.85 MD and a size of 5745 bp, containing
A PSR fragment of the genome of smallpox virus of cows of strain GRI-90, containing the gene 17R obtained using primers
1) 5 'CGGGATCCTAGTGCCGTATAATGACGATGA 3',
2) 5 'CCCAAGCTTGTATATAAAAATGCATTGTGTA 3',
coding protein-analogue of the cellular receptor of interferons of the 1st type, flanked by recognition sites of restriction endonucleases BamHI and HindIII, size 1073 bp;
BamHI-HindII- fragment of the vector plasmid pFastBac, size 4672 bp, including the baculovirus promoter pPolh, mini-Tn7 transposon and a signal for polyadenylation of the SV-40 virus, providing site-specific transposition of B17R gene DNA into the baculovirus genome;
genetic markers:
the bla gene (β-lactamase), which determines resistance to ampicillin, and the Gm ^r gene, which determines resistance to gentomycin, upon transformation of E. coli;
unique restriction sites:
BamHI (4032);
HindIII (5105);
EcoRI (4133; 4550). 2. The strain of recombinant baculovirus BvB17RG, obtained using the recombinant plasmid DNA pFastBac-B17R according to claim 1, deposited in the collection of microorganism cultures of the Federal State Institution Scientific Center of the World Bank "Vector" Rospotrebnadzor under the number V-388, is a producer of a soluble protein-analogue of the cellular interferon receptor 1- th type of cowpox virus.

Images