RU2318874C1 - RECOMBINANT PLASMID DNA pFastBac-B9RZ CONTAINING FRAGMENT OF MANKEYPOX VIRUS GENOME, ENCODING INTERFERON-GAMMA-BINDING PROTEIN AND STRAIN OF BACULOVIRUS BvB9RZ PRODUCING SOLUBLE INTERFERON-GAMMA-BINDING PROTEIN OF MANKEYPOX VIRUS - Google Patents

Abstract

FIELD: biotechnology, in particular gene engineering.

SUBSTANCE: Gene of B9R protein having high homology with extracellular segment of interferon-gamma receptor is isolated by PCR method from Mankeypox virus genome of strain Zaire-96-1-16. Then said protein is cloned in donor plasmid pFastbAC and via site-specific transposition recombinant bacmid is constructed. Said bacmid is used for pest cell transfection to generate target strain.

EFFECT: new drugs for treatment of human diseases associated with hyperproduction of interferon-gamma.

2 cl, 3 dwg, 6 ex

Description

The invention relates to biotechnology, in particular to genetic engineering, and may find application as a new generation of medicine to combat severe human diseases associated with the overproduction of interferon gamma (IFNg).

Interferons are secreted species-specific glycoproteins, divided into two types (a / b and g). Interacting with the corresponding cellular receptors, they induce the occurrence of an antiviral state [1]. Interferons are multifunctional cytokines, one of the most important regulators of the development of inflammatory and immune responses in response to a viral infection. However, violations of the controlled production of IFNg play a critical role in the etiology of the development of a number of human diseases, such as Crohn’s disease [2], type 1 diabetes [3], rheumatoid arthritis [4], systemic lupus erythematosus [5], psoriasis [6]. Success in treating these diseases will depend on how quickly and efficiently it is possible to reduce the level of IFNg in the patient's body. Currently, there is positive experience with the use of polyclonal [7, 8, 9, 10] and monoclonal antibodies [11] for the treatment of autoimmune diseases. The preparation of humanized monoclonal antibodies is currently at the second stage of clinical trials [11]. There are also preparations “Anaferon” and “Anaferon for children” (per. Beats. P N 000372 / 01-2001), prepared on the basis of affinity-purified antibodies, containing the activated form of ultra-low doses of monoclonal, polyclonal or natural antibodies to IFNg, obtained mainly by homeopathic technology used to treat influenza and SARS [12].

Another method of treating diseases associated with high levels of IFNg in the body of sick people is the use of soluble IFNg-binding proteins - receptors of this cytokine. These proteins were isolated from urine [13, 14] or from human cells (WISH, HeLa, FS11 ...) [15]. However, the process of obtaining IFNg receptors from these sources is rather laborious and does not allow to obtain the drug in sufficient quantities.

Closest to the claimed approach is the use of recombinant IFNg receptors as a means of anti-IFNg therapy. Recombinant soluble forms of the human IFNg receptor and several antibodies to these receptors are described in several US patents [16, 17]. The cDNA encoding the IFNg-binding protein obtained by genetic engineering is cloned and expressed in E. coli cells, and the resulting product must be glycosylated. These receptors and antibodies, after further study, are expected to be used as IFNg antagonists, in particular for the treatment of autoimmune diseases.

Analysis of the nucleotide sequence of the monkeypox virus (SBI) genome revealed an open B9R translation frame encoding a protein that has a high degree of homology with the extracellular segment of the gamma interferon receptor [18]. This protein is one of the components of the system that allows the monkeypox virus to efficiently overcome the immune responses of the human body.

An object of the invention is to expand the range of new generation drugs intended for the treatment of human diseases associated with the overproduction of interferon gamma.

The problem is solved by creating a recombinant baculovirus - a producer of soluble IFNg-binding protein. The first step in creating a producer strain is the construction of pFastBac-B9RZ recombinant plasmid DNA containing a fragment of the monkeypox virus genome that encodes the amino acid sequence of the IFNg binding protein.

The target plasmid pFastBac-B9RZ (FIG. 1) has a size of 5628 bp. and a molecular weight of 3.85 mDa and consists of

- a fragment of the genome of the smallpox virus of monkeys of the strain Zaire-96-I-16 with a length of 868 bp encoding an IFNg-binding protein;

- vector plasmid pFastBac [19] with a length of 4760 bp, which provides site-specific transposition of the target DNA fragment into the baculovirus genome.

Recombinant baculovirus obtained by site-specific transposition of the target DNA fragment from the donor plasmid pFastBac-B9RZ into the baculovirus vector (bacmid) located in E. coli [18], after infection of insect cells with Sf21, it produces a soluble monkeypox virus protein of strain Zaire- 96-I-16 is an analogue of the human IFNg receptor.

As a fragment of the monkeypox virus genome, a DNA fragment of 868 bp obtained by polymerase chain reaction is used. The amplification template is monkeypox virus DNA of strain Zaire-96-I-16. The oligonucleotide primers for amplification of the IFNg-binding protein of monkeypox virus have the following structure:

1.5′CGGGATCCATGAGATATATTATAATTCTCGCAGTTTTG 3 ′

2.5′GGAATTCACCAGTGTATAATATGCAGTTTTATTTCAT 3 ′

The structure of primers 1 and 2 contains recognition sites for restriction endonucleases BamHI and EcoRI, respectively (highlighted in bold italics in the sequence of primers). The plasmid pFastBac [18] containing the baculovirus specific pPolh promoter for expression of proteins in insect cells, mini-Tn7-transposon, ampicillin and genes for resistance is used as a plasmid vector that provides site-specific transposition of the target DNA fragment into pMON14272 [18]. gentamicin, a polylinker for cloning target genes and a signal for polyadenylation of the SV-40 virus. PMON14272 contains the low copy bacmid mini-F replicon, kanamycin resistance gene and a DNA fragment encoding α-donor peptide of β-galactosidase E.coli, and provides α-complementation when propagated in strain E.coli DH10Bac ^TM in the presence of chromogenic substrate X-gal and IPTG inductor.

The selected baculovirus expression system provides a high level of synthesis of the target product and its correct post-translational modification in comparison with other expression systems.

The essence of the invention lies in the fact that the DNA fragment containing the gene for interferon gamma-binding protein B9R of smallpox virus monkeys strain Zaire-96-I-16, obtained by PCR from the viral genome, then the resulting gene is cloned in the donor plasmid pFastBac and by specific transposition in bacterial cells, a recombinant bacmid is formed, which is used to transfect insect cells, resulting in the generation of a recombinant BvB9RZ virus expressing the specified gene. The nucleotide sequence of the inserted fragment is shown in figure 2.

The strain is characterized by the following features.

Morphological signs. The strain has the properties of a typical representative of baculoviruses, but unlike the vector virus, it has the Lac ^- phenotype.

Physiological and biochemical characteristics and cultural properties of the strain. Recombinant baculovirus DNA is about 140,000 bp in length. The presence of a target insert of 868 bp in its genome confirmed by PCR method. When a recombinant baculovirus is propagated on an insect cell culture Spodoptera frugiperda (Sf21), its titer does not differ from that obtained by propagating a virus that does not contain foreign DNA fragments in its genome.

The main difference between the strain is its ability to synthesize the IFNg-binding protein BOO when infected with insect cell culture Sf21.

The resulting strain of recombinant baculovirus BvB9RZ deposited in the collection of microorganisms of the State scientific center of virology and biotechnology "Vector" under the number V-356 from 08/15/05

The invention is illustrated by the following figures of graphic images:

Figure 1 Physical map of the plasmid pFastBac-B9RZ. The nucleotide A of the intercistronic region of phage f1 is taken as the first nucleotide of the plasmid; Tn7L, Tn7R — fragments of the transposon Tn7; SV40polyA — SV40 polyadenylation site; B9R - gene interferon gamma-binding protein BOO strain Zaire-96-I-16; pPolh is the polyhedrin promoter; Ori - replication initiation site; Ap ^r , Gm ^r are markers of resistance to ampicillin and gentamicin, respectively.

Figure 2. The nucleotide sequence of the B9R BOO gene (strain Zaire-96-I-16) and the location of specific primers (shown in bold) on the matrix. The restriction endonucleases BamHI and EcoRI used in the construction of the integration plasmid pFastBac-B9RZ are shown with single underlining. The initiating and terminating codons of the IFNg-binding BOO protein are indicated by double underlining.

Figure 3. Electrophoretic analysis in 1% agarose of PCR fragments containing interferon gamma-binding protein BOO, amplified using specific primers with BOO DNA (lane 3), plasmids pFastBac-B9RZ (lane 4) and from bacmid bMON14272-B9RZ (lane 5). Lane 1 - markers of lengths “bp 100” (SibEnzyme, Russia), lane 2 - negative control.

For a better understanding of the invention, the following are examples of its implementation.

Example 1. The method of amplification of a DNA fragment containing the gene of IFNg-binding protein BOO.

The amplification reaction is carried out in Eppendorf tubes in a volume of 50 μl in amplifiers with a hot cap. The reaction mixture contains 10 mM Tris-HCl pH 8.8, 50 mM KCl, 2.5 mM MgCl ₂ , 0.1% Tween 20, 0.2 mM dATP, 0.2 mM dCTP, 0.2 mM dGTP, 0.2 mM dTTP, oligonucleotide primers in an amount of 10 pmol each, 2 food. Tth polymerase, 2-10 ng of the DNA template.

Amplification was carried out for 30 cycles according to the following scheme:

The presence of the amplified product is checked by electrophoresis in 1% agarose gel (figure 3).

Example 2. Construction of recombinant plasmid DNA pFastBac-B9RZ.

5-10 μg of the plasmid pFastBac [18] and 1-5 μg of the amplified product corresponding to the B9R BOO gene are hydrolyzed with restriction endonucleases BamHI and EcoRI under standard conditions. The resulting fragments were isolated by electrophoresis on a 1% agarose gel, followed by elution. 0.2 μg of the vector and 0.6 μg of the fragment are ligated under standard conditions and competent E. coli strain XL-blue are transformed with the obtained ligase mixture. Cell Ap ^r -klony grown at ³⁷ ° C in LB medium containing 100 .mu.g / ml ampicillin to stationary phase. Recombinant plasmid DNA was isolated by standard methods and analyzed using restriction endonucleases BamHI and EcoRI. Plasmid DNA is isolated from the clones containing the inserted fragment, the structure of which in the insertion region is confirmed by determining the nullotide sequence by the method of terminating the synthesized chain on an ABM PRISM ^TM 310 automatic sequencer (Perkin Elmer, USA). The target plasmid thus obtained is designated pFastBac-B9RZ.

Example 3. Obtaining bacmids pMON14272-B9RZ.

To 100 μl of competent cells of E. coli strain DH10Bac ^™ add 1 ng of plasmid pFastBac-B9RZ. The resulting mixture was incubated on ice for 30 min, then at 42 ^{° C} for 45 seconds, followed by cooling on ice for 2 min. The reaction mixture was diluted 1:10 LB-broth and were maintained on a shaker with intensive aeration at ³⁷ ° C for four hours. Then the cells are seeded on a selective medium - LB-agar containing 100 μg / ml X-gal, 40 μg / ml IPTG, 50 μg / ml kanamycin, 7 μg / ml gentamicin, 10 μg / ml tetracycline, and incubated in an incubator at 37 ^about C during the day. The clones with a phenotype Lac ^- inoculated into tubes with 5 ml LB-broth containing 50 ug / ml kanamycin, 7 ug / ml gentamicin, 10 ug / ml tetracycline and grown with intensive aeration at ³⁷ ° C to stationary phase. The culture is transferred to 1.5 ml Eppendorf tubes, the cells are pelleted by centrifugation for 40 seconds at 14000g, and the medium is removed. The procedure for adding culture, sedimentation and removal of the medium is repeated two more times. The precipitate was resuspended in 0.3 ml of solution 1 (10 mM EDTA, 15 mM Tris-HCl pH 8.0, 100 μg / ml RNase), 0.3 ml of solution 2 (0.2 M NaOH, 1% SDS) was added and incubated at room temperature for 5 min. 0.3 ml of solution 3 (3 M KAc pH 5.2) was slowly added to the mixture. Incubated in ice for 10 minutes. Centrifuge at 14,000 g for 10 minutes. The supernatant was transferred to a clean test tube is added 0.8 ml of isopropanol, stirred and cooled at ^-20 ° C for 5 minutes, then pelleted at 14000 g for 15 min. The precipitate was washed twice with ethanol, dried, dissolved in 40 μl of TE buffer. The presence of an integrated DNA fragment in the bacmid genome is confirmed by PCR. The obtained bacmid DNA pMON14272-B9RZ is used to transfect insect cells of the Sf21 line.

Example 4. Transfection of insect cells Sf21 with recombinant bacmid DNA pMON14272-B9RZ and obtaining a recombinant virus.

Sf21 cells are seeded in the wells of a 6-well plate so that the next day there is a monolayer (2 × 10 ⁶ cells / well). The next day, two solutions are prepared: 10 μl of viral DNA + 100 μl of Grace medium and 6 μl of CellFECTIN reagent from LifeTechnologies (USA) +100 μl of Grace medium. The solutions are mixed, incubated at room temperature for 25 minutes. At this time, the cell monolayer is washed twice with Grace medium. To the cells add 0.8 ml / well of Grace medium and 200 μl of the prepared solution. Incubate cells at ²⁸ ° C for 5 hours. Thereafter, the medium is taken and added to the cells in 2 ml Grace's medium with 10% fetal bovine serum (ES) (OOO "Biolot", Russia). Cells are incubated at 28 ^about C for 2-5 days. Then the cells are resuspended (by intensive pipetting), centrifuged for 5 min at 5000 g and the clarified supernatant is packaged in sterile tubes. The titer of the virus is determined as follows. 200 μl of virus dilution was added to the monolayer of Sf21 cells and adsorption was carried out for 60 minutes at room temperature. Next, 2% low-melting agarose (Sigma, USA) is prepared and mixed in molten form with Grace medium with 10% ESC in a 1: 1 ratio. The resulting medium is cooled in a thermostat to 37 ^° C and 2 ml per well are added, and after solidification, 2 ml per well of Grace medium with 10% ESC is added. Incubated in a thermostat at 28 ^about 5 days. Then, 2 ml per well of neutral red dye diluted in Grace medium with 10% ESC is added in a ratio of 1:20. Incubated at 28 ^about C for a day. The titer is determined by counting stained plaques. The latter is 10 ⁷ PFU / ml. Recombinant virus suspension was stored at -20 ° ^C.

Example 5. Infection of insect cells with Sf21 recombinant virus.

200 μl of thawed viral material with a titer of 10 ⁷ is applied to a monolayer of Sf21 insect cells in a 25 ml culture mattress. Incubated for 30 minutes at room temperature. After incubation, add 2 ml of Grace medium with 10% ESC. Incubated at 28 ^about C for 2-3 days. Then the cells are resuspended by intensive pipetting and centrifuged for 5 min at 5000 g. The clarified supernatant is analyzed in a test for the ability to inhibit the protective effect of hIFNg from mouse encephalomyocarditis virus (VEMCM) on a lung cell culture from a human L68 embryo.

Example 6. Determination of the biological activity of the product of expression of the B9R gene.

The biological activity of the B9R gene expression product is determined by its ability to inhibit the protective effect of hIFNg from VEMCM on a lung cell culture from human L68 embryo. L68 cells were cultured in 200 μl of DMEM medium with 10% fetal bovine serum until a cell monolayer was formed on 75-85% of the surface of the 96-well plate well. Upon reaching the required cell density, the growth medium is replaced with 200 μl of DMEM medium with 2% fetal serum of cows containing lysates of Sf21 cells infected with recombinant baculovirus (100 μl per well and serial two-fold dilutions) and hIFNg preparation (4 ng / ml, which, according to a preliminary determination of the protective effect of hIFNg corresponds to a three-fold dose, which provides a 50% protective effect from the action of VEMKM). Plates were incubated at ³⁷ ° C in a CO ₂ incubator _(CO2 concentration was 5%). As controls, plate wells containing L68 cells are used; L68 + VARV-IFNgBP cells; L68 + MPXV-IFNgBP cells; L68 + VEMKM cells giving a background value (0%) of optical density; L68 + hIFNg cells, giving 100% optical density; L68 cells + VEMKM + hIFNg. The number of viable cells is determined two days after infection with VEMCM by staining with neutral red dye [20]. The optical density was measured using a Microplate Reader EL _X 808 instrument (BIO-TEK INSTRUMENTS, INC, USA). Results are expressed as a percentage of surviving cells relative to the number of cells in control samples. Each sample was taken in three repetitions, and the average value of the percentage of survival is calculated by the formula:

(OD _{VEMKM + IFNg + IFNgBP} -OP _VEMKM ) / (OD _IFNg- OP _VEMKM ) × 100%

According to the inhibition of the protective effect of hIFNg from VEMCM on L68 cell culture at a concentration in the hIFNg culture medium of 4 ng / ml, 50% cell death is achieved by adding 100 μl of culture medium to Sf21 cells infected with recombinant BvB9RZ virus with a multiplicity of infection of 0.01 PFU per cell on the seventh day of infection.

Thus, a recombinant baculovirus BvB9RZ was obtained that provides expression of the gene for interferon gamma-binding protein B9R of smallpox virus of monkey strain Zaire-96-I-16 in insect cells of the Sf21 line. The resulting strain can be used to develop a new generation therapeutic drug to combat human diseases associated with the overproduction of interferon gamma.

Claims (2)

1. Recombinant plasmid DNA pFastBac-B9RZ, carrying a fragment of the genome of smallpox virus monkey strain Zaire-96-I-16, encoding a soluble interferon gamma-binding protein, providing site-specific transposition of the target DNA fragment in the baculovirus genome, size 5628 bp and a molecular weight of 3.85 mDa containing PCR fragment of the genome of the virus of smallpox monkey strain Zaire-96-I-16, containing the B9R gene obtained using primers 5′- CGGGATCCATGAGATATATTATAATTCTCGCAGTTTTG - 3 ′ and 5′- GGAATTCACCAGTGTATAATATGCAGTTTTATTTCAT - 3 ′, interferon-encoding gamma-binding protein flanked by recognition sites for restriction endonucleases BamHI and EcoRI, size 868 bp; BamHI-EcoRI fragment of the vector plasmid pFastBac, size 4760 bp, including the baculovirus promoter pPolh, mini-Tn7 transposon and a signal for polyadenylation of the SV-40 virus, providing site-specific transposition of B9R gene DNA into the baculovirus genome; genetic markers: b-lactamase gene defining ampicillin resistance; aminoglycoside transferase gene, which determines resistance to gentamicin; unique restriction sites: BamHI (4033), EcoRI (4907). 2. The strain of recombinant baculovirus BvB9RZ obtained using the recombinant plasmid DNA pFastBac-B9RZ according to claim 1, deposited at the KKM Research Institute under the number V-356, is a producer of soluble interferon gamma-binding protein encoded by the monkeypox virus B9R gene.

Images