RU2399388C2 - Agent for inactivation of viruses exhibiting simultaneous ribonuclease, membranolytic and antiviral activities - Google Patents

Abstract

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention concerns biochemistry and medicine. There is characterised an agent for inactivation of viruses representing derivatives of lysine, glutamic and 6-aminohexanoic acids.

EFFECT: presented agents exhibits ribonuclease, membranolytic and antiviral activities and can be used in medicine as active components for the development of dosage forms used for treating viral diseases.

6 dwg, 4 tbl, 7 ex

Description

The invention relates to the field of chemistry and medicine, namely to compounds having simultaneous ribonuclease, membranolytic and antiviral activities.

Viral diseases pose a common threat to public health worldwide. Among viruses, viruses containing the genome in the form of RNA cause a number of serious diseases of animals (domestic and wild) and are among the most dangerous for humans. Highly pathogenic RNA viruses such as avian influenza virus (Avian Influenza Virus), tick-borne encephalitis (Tick-borne enchefalitis), Dengue virus (Denge virus), coronavirus (SARS), etc., are a constant threat to public health. To date, viruses of birds and animals that can infect humans are of particular danger (Lipsitch, M. et al. Science, 2006, 312, 845; Krug, RM Science, 2006, 311, 1562-1563; Chen, H. et al. Nature, 2005, 436, 191-192). For example, for a long time it was believed that the avian influenza virus could not spread to humans, however, in recent years, a large number of transmission of the virus from birds to humans has been recorded, causing deaths in infected people (Subbarao, K. et al. Science, 1998, 279, 393-396; Fouchier, RA et al. Proc. Natl. Acad. Sci., USA, 2004, 101, 1356-1361). Outbreaks of the highly pathogenic H5N1 virus in some Asian and European countries have caused serious concern from the international community (Koopmans, M. et al. Lancet, 2004, 363, 587-593; Enserink, M., Science, 2006, 311, 932; Fabain NJ Environ. Health 2006, 68, 46-63).

The danger of epidemics and pandemics caused by RNA viruses makes the development of new antiviral drugs and new tools and methods for their inactivation one of the most urgent tasks of today.

Currently, physical methods are used as means of virus inactivation (irradiation with ultraviolet light, ionizing radiation, heating at elevated pressure) and a number of chemical compounds (formalin, β-propiolactone, ethyleneimine, a number of detergents), which differ in the mechanism of action and, therefore, scope, toxicity, virus inactivation efficacy, and cost (De Benedictis, P. et al. Zoonoses Public Health. 2007, 54 (2), 51-68).

The range of compounds that enable inactivation of the virus, including for the preparation of whole-virion vaccines, is limited to several compounds: formaldehyde, β-propiolactone (Goldstein M. and Tauraso N., Applied Microbiol., 1970, 19, 290-294), ethyleneimine and its derivatives (Budowsky EI, et al, Vaccine, 1991, 9, 473-476; Aarthi d., et al, Biologicals, 2004, 32, 153-156), UV irradiation (Budowsky EI, et al, Arch. Virol., 1981, 68-239-246) or UV light in the presence of compounds that increase the photosensitivity of the virus (Kasermann F and Kempf C., Antiviral Res., 1997, 34, 65-70), oxidation by atmospheric oxygen in the light (Kasermann F. and Kempf C., Rev. Med. Virol, 1998, 8, 143-151). It is known that treatment of the virus with such compounds leads to partial destruction of the viral antigenic determinants and thereby to a decrease in the immunogenic properties of vaccines, and selective destruction by the formalin of the antigenic determinants of the surface glycoprotein viruses can induce the development of an unbalanced immune response (Kasermann F., et al., Antiviral Res. , 2001, 52, 33-41).

An ideal target for the inactivation of influenza virus and other RNA viruses (hereinafter referred to as RNA viruses) is the genomic RNA of the virus. After its destruction, the virus loses its ability to replicate and, therefore, cannot multiply.

Closest to the claimed compounds, the prototype are lysine derivatives of the general formula nLm having ribonuclease activity (Zhdan N.S. et al. Bioorgan. Chemistry. 1999, 25, 723-732). Figure 1 shows the structural formula of nLm compounds, which are non-natural peptides based on lysine, where n is the number of lysine residues, m is the total positive charge of the compound at neutral pH. It was shown that although these compounds exhibit high ribonuclease activity, the efficiency of RNA cleavage by them depended on the spatial structure of this RNA, did not correlate with the total positive charge of the molecule (determines the efficiency of binding to RNA), and depended little on the number of lysine residues in the molecule.

The disadvantages of the known nLm compounds are the relatively low ribonuclease activity and low inactivation of RNA viruses.

An object of the invention is to obtain effective, low-toxic synthetic compounds (artificial ribonucleases) with simultaneous ribonuclease, membranolytic and antiviral activities.

The stated technical problem is solved by the proposed means for the inactivation of viruses with simultaneous ribonuclease, membrane and antiviral activities, which are derivatives of several amino acids (AA) linked by a hydrophobic linker (L) of the general formula

[nAK] ₂ L, where n is the number of different amino acids in the molecule of the compound, equal to one for compound (1) or three for compound (2); L is a dodecyl linker, AK is glutamic acid for (1) and lysine, 6-aminohexanoic and glutamic acid for (2). The figure 2 presents the structural formulas of the compounds (1) and (2).

To increase the ribonuclease activity of compounds (1) and (2), in comparison with the prototype, a new catalytically active group (carboxy group) was added to their structure, which is present in the active center of many natural ribonucleases. The presence in the molecule of both negatively and positively charged functional groups makes it possible to increase the efficiency of the RNA cleavage reaction. In addition, an extended hydrophobic linker connecting two amino acid fragments was introduced into the molecule, which allows enhancing the ribonuclease activity of the compounds.

Compounds (1) and (2) of the general formula [nAK] ₂ L were prepared according to the general scheme shown in FIG. 3.

The process for preparing compounds (1) and (2) involves the reaction of commercially available activated esters (N-hydroxysuccinimide and n-nitrophenyl) amino acids (compounds 6, 10, 11, 12). The synthesis scheme of compounds (1) and (2) is shown in Figs. 4, 5, where L is 1.12-dodecandiamine, AHA is 6-aminohexanoic acid, Glu is glutamic acid, Lys is lysine, Boc is a tert-butyloxycarbonyl protecting group. Z (2C1) is a 2-chlorobenzyloxycarbonyl protecting group, Bzl is a benzyl protecting group, TFA is trifluoroacetic acid.

The introduction of tert-butyloxycarbonyl protection on the amino group of 6-aminohexanoic acid and the synthesis of activated esters were carried out according to standard methods (A. A. Gershkovich, V. K. Kibirev. Peptide synthesis. Reagents and methods. Kiev. Naukova Dumka. 1987).

This scheme involves the reaction of a commercially available 1,12-dodecandiamine (3) with a protected amino acid (AK-D) to form a disubstituted derivative of the protected amino acids (D-AK) 2L, which is then freed from the protective groups. In the case of compound (2), the resulting terminal amino groups of the first amino acid were used to introduce the second and third amino acids according to the same scheme. As a result of the reaction in high yields, a product is formed containing one (three) amino acids dimerized using a dodecyl linker (L).

NMR spectra were recorded on spectrometers “Bruker AM-400” and “Bruker AV-300 (Germany)” in CD ₃ OD, (CD ₃ ) ₂ СО (“Aldrich”, USA). For ¹ H NMR spectra, tetramethylsilane or residual proton signals of solvents were used as internal standard. Chemical shifts are given in the scale δ, ppm

High resolution mass spectra were obtained using a MALDI-TOF (time-of-flight) mass spectrometer Bruker reflex III MALDI TOF (Bruker Analytical Systems, Inc., Germany).

Kieselgel 60 silica gel (63-100 μm, Merck, Germany) was used for column chromatography.

To study the ribonuclease activity of the compounds, we used a 96-unit RNA fragment of the human immunodeficiency virus HIV1 and synthetic oligoribonucleotide ON21, r (UCGAAUUUCCACAGAAUUCGU), which was synthesized by the phosphitamide method on a synthesizer ASM-102U (BIOSSET LLP, Novosibirsk) and purified ion preparative electrophoresis under denaturing conditions. The purity of the oligonucleotide was checked by electrophoresis in 15% PAG under denaturing conditions, visualization of the oligonucleotide in the gel was carried out using Stains-All stain. The RNA fragment was obtained using an in vitro transcription reaction according to the published protocol (Maniatis T., Fritsch E. F., Sambrook J. Molecular cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press, 1989).

The ribonuclease activity of compounds (1) and (2) was studied in the in vitro cleavage reaction of two RNA substrates, the oligoribonucleotide ON21 and RNA96, and the antiviral and membraneolytic activity of these compounds was studied in experiments on the inactivation of RNA-containing viruses (influenza virus and tick-borne encephalitis virus) and in experiments on the reproduction of these viruses in eukaryotic cell culture in vitro.

A comparative analysis of the claimed compounds with known and widely used compounds, such as formalin, UV light or monomeric or binary ethyleneimine (Budowsky. EI, et al., Vac. Res., 1996, 5, 29-39), showed that the proposed Compounds have the following advantages.

1) The claimed compounds possess both ribonuclease, membrane and antiviral activities, which allows us to consider them as promising drug agents.

2) The claimed compounds are low toxic to humans and do not require special precautions (gas mask, gloves, work under the hood) when working with them. In addition, these compounds are storage stable in the form of concentrated aqueous solutions or solutions in aprotic solvents such as dimethyl sulfoxide.

3) The inventive compounds do not have side effects on the protein components of virions, which does not reduce the immunogenic properties of inactivated viruses and improves the properties of vaccines derived from them.

A search by the sources of scientific, technical and patent literature showed that derivatives of lysine, glutamic and 6-aminohexanoic acids of the general formula [nAK] ₂ L, which simultaneously possess ribonuclease, membranolytic and antiviral activities, are not described in known sources.

The invention is illustrated by the following examples.

Example 1. Obtaining N, N'-bis (glutamyl) -1,12-dodecandiamine (1).

The synthesis scheme of the compound (1) is shown in Fig.4.

To a solution of 1,12-dodecanediamine (3) (2.1 mmol, 0.42 g) and ethyldiisopropylamine (4.4 mmol, 0.75 ml) in 10 ml of ethyl acetate was added with stirring a solution of n-nitrophenyl ether N ^α -t-butyloxycarbonyl-O-benzyl-L -glutamic acid (6) (4.4 mmol, 2.01 g) in 5 ml of ethyl acetate. The reaction mixture was stirred 24 hours at 22 ° C. Then, N, N-dimethylethylenediamine (1 mmol, 110 μl) was added to the reaction mixture and stirred for 30 minutes. The reaction mixture was washed sequentially with 2% citric acid solution (20 ml), water (20 ml), saturated NaHCO ₃ solution (20 ml) and water (20 ml). The organic layer was dried with anhydrous Na ₂ SO ₄ . The solvent was removed in vacuo. The residue was dried in vacuo. Purification was carried out using chromatography on silica gel, eluting the product with a gradient of ethanol in methylene chloride from 0 to 5%. Fractions containing the target compound were evaporated and dried in vacuo. Yield of N, N'-bis ((N ^α -t-butyloxycarbonyl-O-benzyl) glutamyl) -1,12-dodecandiamine (4) 0.86 g, 49.0%.

¹ H NMR data for N, N'-bis ((N ^α- tert-butyloxycar6onyl-O-benzyl) glutamyl) -1,12-dodecandiamine ((CD ₃ ) ₂ CO) δ, ppm (J / Hz): 1.27 (m, 16H, [-NH- (CH ₂ ) ₂ - (CH ₂ ) ₈ - (CH ₂ ) ₂ -NH-] ^L ); 1.41 (s, 18H, [CH ₃ ] ^Boc ); 1.49 (m, 4H, [-NH-CH ₂ CH ₂ -] ^L ); 1.86-2.17 (m, 4H, [CHCH ₂ CH ₂ ] ^{Glu, Glu '} ); 2.48 (t, 4H, [CHCH ₂ CH ₂ ] ^{Glu, Glu '} , J = 7.5); 3.22 (m, 4H, [-NH-CH ₂ CH ₂ -] ^L ); 4.13 (m, 2H, CHCH ₂ CH ₂ ] ^{Glu, Glu '} ); 5.13 (s, 4H, [CH ₂ ] ^Bzl ); 7.37 (m, 10H,

[CH] ^aroma ).

N, N'-bis ((N ^α -tert-butyloxycarbonyl-O-benzyl) glutamyl) -1,12-dodecanediamine (4) was dissolved in a mixture of TFA: CH ₂ Cl ₂ = 1: 1 (5 mL) and the reaction heated mixture for 1 h at room temperature. The solvent and TFA were removed in vacuo, the residue was evaporated with ethanol (3 × 10 ml), dissolved in CH ₂ Cl ₂ (5 ml) and precipitated with a 10-fold volume of sulfuric ether. They kept the night in the refrigerator. The ether was decanted, the solid residue was dried in vacuo. The yield of N, N'-bis ((γ-benzyl) -glutamyl) -1,12-dodecandiamine trifluoroacetate (5) 0.82 g, 92.0%. ¹ H NMR data for N, N'-bis ((γ-benzyl) -glutamyl) -1,12-dodecandiamine (5) (CDCl ₃ ) δ, ppm (J / Hz): 1.23 (m, 16H, [-NH- (CH ₂ ) ₂ - (CH ₂ ) ₈ - (CH ₂ ) ₂ -NH-] ^L ); 1.49 (m, 4H, [-NH-CH ₂ CH ₂ -] ^L ); 2.28-2.38 (m, 4H, [CHCH ₂ CH ₂ ] ^{Glu, Glu '} ); 2.48 (m, 4H, [CHCH ₂ CH ₂ ] ^{Glu, Glu '} ); 3.28 (m, 4H, [-NH-CH ₂ CH ₂ -] ^L ); 4.16 (m, 2H, CHCH ₂ CH ₂ ] ^{Glu, Glu '} ); 5.11 (s, 4H, [CH ₂ ] ^Bzl ); 7.34 (m, 10H, [(CH] ^arom ). MALDI-MS, m / z found, 639.42 [M + H] ⁺ , calculated 638.40.

Trifluoroacetate N, N'-bis ((γ-benzyl) -glutamyl) -1,12-dodecandiamine (5) (0.46 mmol, 400 mg) was dissolved in 5 ml of methanol and subjected to hydrogenolysis in the presence of 200 mg of 5% Pd / C. At the end of the reaction, the catalyst was filtered off, and the solvent was evaporated in vacuo. Yield of N, N'-bis (glutamyl) -1,12-dodecandiamine (1) after hydrogenation 292 mg, 92.2%.

The total yield of N, N'-bis (glutamyl) -1,12-dodecandiamine (1) based on 1.12-dodecandiamine (3) is 41.6%.

¹ H NMR data for N, N'-bis (glutamyl) -1,12-dodecanediamine trifluoroacetate (1) ((CD ₃ ) ₂ CO) δ, ppm (J / Hz): 1.33 (m, 16H, [-NH- (CH ₂ ) ₂ - (CH ₂ ) ₈ - (CH ₂ ) ₂ -NH-] ^L2 ); 1.55 (m, 4H, [-NH-CH ₂ CH ₂ -] ^L2 ); 2.15 (m, 4H, [CHCH ₂ CH ₂ ] ^{Glu, Glu '} ); 2.49 (m, 4H, [CHCH ₂ CH ₂ ^{Glu, Glu '} ); 3.20-3.36 (m, 4H, [-NH-CH ₂ CH ₂ -] ^L2 ); 3.90 (t, 2H, [CHCH ₂ CH ₂ ] ^{Glu, Glu '} , J = 3.6). MALDI-MS, m / z found, 459.28 [M + H] ⁺ , calculated 458.31.

Example 2. Obtaining N, N'-bis (glutamyl-6-aminohexanoyl-lysyl) -1,12-dodecandiamine (2).

The synthesis scheme of the compound (2) is shown in Fig.5.

To a solution of 1,12-dodecanediamine (3) (2.4 mmol, 0.48 g) and ethyldiisopropylamine (5 mmol, 0.85 ml) in 10 ml of ethyl acetate was added with stirring a solution of N ^α- tert-butyloxycarbonyl-N ^ε -2- chlorobenzyloxycarbonyllysine (10) (5 mmol, 2.6 g) in 5 ml of ethyl acetate. The reaction mixture was stirred 24 hours at 22 ° C. Then, N, N-dimethylethylenediamine (1 mmol, 110 μl) was added to the reaction mixture and stirred for 30 minutes. The reaction mixture was washed sequentially with 2% citric acid solution (20 ml), water (20 ml), saturated NaHCO ₃ solution (20 ml) and water (20 ml). The organic layer was dried with anhydrous Na ₂ SO ₄ . The solvent was removed in vacuo. The resulting foam was dried in vacuo. The yield N, N'-bis ((N ^α -t-butyloxycarbonyl-N ^ε -2-chlorobenzyloxycarbonyl) lysyl) -1,12-dodecanediamine (7) 1.38 g, 57.9%. ¹ H NMR data for N, N'-bis ((N ^α- tert-butyloxycarbonyl-N ^ε -2-chlorobenzyloxycarbonyl) lysyl) -1,12-dodecandiamine (7) ((CD ₃ ) ₂ CO) δ, ppm (J / Hz): 1.29 (m, 16H, [-NH- (CH ₂ ) ₂ - (CH ₂ ) ₈ - (CH ₂ ) ₂ -NH-] ^L ); 1.41 (s, 18H, [CH ₃ ] ^Boc ); 1.57 (m, 8H, [-NH-CH ₂ CH ₂ - (CH ₂ ) ₈ -] ^L , [-CHCH ₂ CH ₂ (CH ₂ ) ₂ ] ^{Lys, Lys'} ); 1.64 (m, 4H, [-CH (CH ₂ ) ₂ CH ₂ CH ₂ ] ^{Lys, Lys'} ); 1.79 (m, 4H, [-CHCH ₂ (CH ₂ ) ₂ CH ₂ ] ^{Lys, Lys'} ); 3.18 (m, 8H, [-CH (CH ₂ ) ₃ CH ₂ ] ^{Lys, Lys'} , 4H, [-NH-CH ₂ CH ₂ - (CH ₂ ) ₈ -] ^L ); 4.05 (m, 2H, [-CH (CH ₂ ) ₄ ] ^{Lys, Lys'} ); 5.17 (s, 4H, [CH ₂ ] ^{Z (2Cl)} ; 7.35 (m, 4H, [CH] ^arom ); 7.44 (m, 2H, [CH] ^arom. ); 7.50 (m, 2H, [CH] ^{arom .} ).

N, N'-bis ((N ^α -t-butyloxycarbonyl-N ^ε -2-chlorobenzyloxycarbonyl) lysyl) -1,12-dodecandiamine (7) was dissolved in a mixture of TFA: CH ₂ Cl ₂ = 1: 1 (5 ml) and kept the reaction mixture for 1 h at room temperature. The solvent and TFA were removed in vacuo, the residue was evaporated with ethanol (3 × 10 ml), dissolved in ethyl acetate (15 ml) and washed with saturated NaHCO ₃ solution (10 ml) and water (10 ml), dried over anhydrous Na ₂ SO ₄ . The solvent was removed in vacuo. The resulting oily residue was dried in vacuo and used without further purification.

Then, the procedure of condensation of the amino components in series with N-hydroxy succinimide ester of N ^α- tert-butyloxycarbonyl-6-aminohexanoic acid (11) and N ^α -tert-butyloxycarbonyl-O-benzyl-L-glutamic acid (12) in DMF was similarly repeated.

Yield N, N'-bis (N ^α -t-butyloxycarbonyl-6-aminohexanoyl-N ^ε -2-chlorobenzyloxycarbonyl) lysyl) -1,12-dodecandiamine (8) 0.54 g, 49.0%. ¹ H NMR data for ((8) (CD ₃ OD) δ, ppm (J / Hz): 1.30 (m, 16H, [-NH- (CH ₂ ) ₂ - (CN ₂ ) ₈ - (CH ₂ ) ₂ -NH-] ^L ); 1.44 (s, 18H, [CH ₃ ] ^Boc ); 1.50 (m, 12H, [-NH- CH ₂ CH ₂ - (CH ₂ ) ₈ -] ^L , [ -CHCH ₂ CH ₂ CH ₂ ) ₂ ] ^{Lys, Lys '} , [-C (O) - (CH ₂ ) ₂ -CH ₂ - (CH ₂ ) ₂ -NH] ^{AHA, AHA'} ); 1.63 (m, 8H, [-CH (CH ₂ ) ₂ CH ₂ CH ₂ ] ^{Lys, Lys '} , [-C (O) - (CH ₂ ) ₃ -CH ₂ -CH ₂ - NH] ^{AHA, AHA'} ) ; 1.73 (m, 4H, [—C (O) —CH ₂ —CH ₂ - (CH ₂ ) ₃ —NH] ^{AHA, AHA '} ); 1.87 (m, 4H, [-CHCH ₂ (CH ₂ ) ₃ ] ^{Lys, Lys'} ); 2.25 (t, 4H, [-C (O) -CH ₂ - (CH ₂ ) ₄ -NH] ^{AHA, AHA '} , J = 7.4); 3.03 (m, 4H, [—C (O) - (CH ₂ ) ₄ —CH ₂ —NH] ^{AHA, AHA '} ); 3.15 (m, 8H, [-CH (CH ₂ ) ₃ CH ₂ ^{Les, Lys'} , 4H, [-NH-CH ₂ CH ₂ - (CH ₂ ) ₈ -] ^L ); 4.27 (m, 2H, [-CH (CH ₂ ) ₄ ] ^{Lys, Lys'} ); 5.19 (s, 4H, [CH ₂ ] ^{Z (2Cl)} ); 7.33 (m, 4H, [CH] ^arom. ); 7.41 (m, 2H, [CH] ^arom. ); 7.45 (m, 2H, [CH] ^arom. ).

Yield N, N'-bis ((N ^α -t-6-butyloxycarbonyl-O-benzyl) glutamyl-aminohexanoyl-N ^ε -2-chlorobenzyloxycarbonyl) lysyl) -1,12-dodecanediamine (9) 0.07 g, 6.1%. ¹ H NMR data for ((9) (CD ₃ OD) δ, ppm (J / Hz): 1.33 (m, 16H, [-NH- (CH ₂ ) ₂ - (CH ₂ ) ₈ - (CH ₂ ) ₂ -NH-] ^L ); 1.44 (m, 22H, [CH ₃ ] ^Boc , [-NH-CH ₂ CH ₂ - (CH ₂ ) ₈ -] ^L ); 1.53 (m, 12H, [ -CH (CH ₂ ) ₂ CH ₂ CH ₂ ] ^{Lys, Les '} , [-C (O) - (CH ₂ ) ₂ -CH ₂ - (CH ₂ ) ₂ -NH] ^{AHA, AHA'} ), [-C (O) - (CH ₂ ) ₃ —CH ₂ —CH ₂ —NH] ^{AHA, AHA '} ); 1.64 (m, 12H, [-CHCH ₂ CH ₂ (CH ₂ ) ₂ ] ^{Lys, Les '} , [-C (O) -CH ₂ -CH ₂ - (CH ₂ ) ₃ -NH] ^{AHA, AHA'} , [ -CHCH ₂ CH ₂ ] ^{Glu, Glu '} ); 1.92 (m, 4H, [-CHCH ₂ (CH ₂ ) ₃ ] ^{Lys, Lus'} ); 2.13 (m, 4H, [-C (O) -CH ₂ - (CH ₂ ) _4- NH] ^{AHA, AHA '} ; 2.25 (m, 4H, [-CHCH ₂ CH ₂ ] ^{Glu, Glu'} ); 2.50 ( m, 4H, [-CH (CH ₂ ) ₃ CH ₂ ] ^{Lys, Lys '} ); 3.17 (m, 4H, [-C (O) - (CH ₂ ) ₄ -CH ₂ -NH] ^{AHA, AHA'} ) ; 3.40 (m, 4H, [-NH-CH ₂ CH ₂ - (CH ₂ ) ₈ -] ^L ); 4.05 (m, 2H, [-CHCH ₂ CH ₂ ] ^{Glu, Glu '} ); 4.16 (m, 2H , [-CH (CH ₂ ) ₄ ] ^{Lys, Lus'} ); 5.12 (s, 4H, [CH ₂ ] ^{Z (2Cl)} ; 7.35 (m, 18H, [CH] ^arom. ).

N, N'-bis ((O-benzyl) glutamylaminohexanoyl- (N ^ε -2-chlorobenzyloxycarbonyl) lysyl) -1,12-dodecandiamine (0.042 mmol, 70 mg) was dissolved in 5 ml of methanol and subjected to hydrogenolysis in the presence of 50 mg 5% Pd / C. At the end of the reaction, the catalyst was filtered off, and the solvent was evaporated in vacuo. Yield of N, N'-glutamyl-aminohexanoyl-lysyl-1,12-dodecanediamine trifluoroacetate (2) after hydrogenation 38.4 mg, 66.2%.

The total yield of N, N'-bis (glutamylaminohexanoyl-lysyl) -1,12-dodecandiamine trifluoroacetate (2), calculated as 1.12-dodecandiamine, was 1.7%.

¹ H NMR data for N, N'-bis (glutamylaminohexanoyl-lysyl) -1,12-dodecanediamine trifluoroacetate (2) (CD ₃ OD) δ, ppm (J / Hz): 1.33 (m, 24H, [-NH- (CH ₂ ) ₂ - (CH ₂ ) ₈ - (CH ₂ ) ₂ -NH-] ^L , [-CHCH ₂ CH ₂ (CH ₂ ) ₂ ] ^{Lys, Lys '} , [-C (O) - (CH ₂ ) ₂ -CH ₂ - (CH ₂ ) ₂ -NH] ^{AHA, AHA'} ); 1.44 (m, 4H, [-NH-CH ₂ CN ₂ - (CH ₂ ) ₈ -] ^L ; 1.58 (m, 8H, [-CH (CH ₂ ) ₂ CH ₂ CH ₂ ] ^{Lys, Lys'} [-C (O) - (CH ₂ ) ₃ -CH ₂ -CH ₂ -NH] ^{AHA, AHA '} ); 1.66 (m, 8H, [-C (O) -CH ₂ -CH ₂ - (CH ₂ ) ₃ -NH ] ^{AHA, AHA '} ), [-CHCH ₂ CH ₂ ] ^{Gly, Glu'} ); 1.84 (m, 4H, [-CHCH ₂ (CH ₂ ) ₃ ] ^{Lys, Lys'} ); 2.17 (m, 4H, [—C (O) —CH ₂ - (CH ₂ ) ₄ —NH] ^{AHA, AHA '} ); 2.37 (m, 4H, [-CHCH ₂ CH ₂ ] ^{Glu, Glu '} ); 2.47 (m, 4H, [-CH (CH ₂ ) ₃ CH ₂ ] ^{Lys, Lys'} ); 2.56 (m, 4H, [—C (O) - (CH ₂ ) ₄ —CH ₂ —NH] ^{AHA, AHA '} ); 2.94 (m, 4H, [-NH-CH ₂ CH ₂ - (CH ₂ ) ₈ -] ^L ; 3.88 (m, 2H, [-CHCH ₂ CH ₂ ] ^{Glu, Glu '} ); 4.10 (m, 2H, [ -CH (CH ₂ ) ₄ ] ^{Lys, Lys'} ). MALDI-MS, m / z found, 963.27 [M + Na] ⁺ , calculated 940.67.

Example 3. RNA cleavage with compounds (1) and (2).

RNA cleavage experiments with these compounds were carried out under the following conditions: a standard reaction mixture of 10 μl contained 10,000 cpm according to Cherenkov of a [5'- ³² P] -labeled ON21 (stabilized with unlabeled ON21 at a concentration of 5 × 10 ^-6 M) or [5 '- ³² P] -RNA96, one of the compounds (1) or (2) in concentrations from 10 ^-6 to 10 ^-3 M and 50 mM Tris-HCl pH 7.0, containing 0.2 M KCl, 0.5 mM EDTA.

Reactions were carried out at 37 ° С for 1–20 h and stopped by precipitation of reaction products with 10 volumes (100 μl) of a 2% solution of LiClO ₄ in acetone. The precipitate of RNA and its cleavage products was separated by centrifugation, dissolved in 5 μl of gel buffer. RNA cleavage products were analyzed by electrophoresis in 15% PAG containing 8 M urea. The gel after electrophoresis was dried and analyzed using a Molecular Imager FX phosphorimager instrument. The degree of RNA cleavage was determined as the ratio of the amount of radioactivity in the band corresponding to the cleavage product to the total radioactivity deposited on the track.

When establishing the dependence of the degree of RNA cleavage on the concentration of compounds (1) and (2), it was found that for both compounds the degree of cleavage increases with increasing concentration of the compounds. Both compounds showed the highest ribonuclease activity at a concentration of 1 mm. Table 1 presents data on the effect of the concentration of compounds (1) and (2) on the degree of RNA cleavage.

Table 1 The dependence of the degree of RNA cleavage on the concentration of compounds (1) and (2) for 3 hours. The highlighted values correspond to the highest degree of RNA cleavage with this compound. Concentration, mm The degree of cleavage of RNA,% (one) (2) 0.05 eleven 13 0.1 eleven 16 0.2 35 twenty 0.5 67 29th 0.7 77 41 one 82 54

When establishing the dependence of the degree of RNA cleavage by compounds (1) and (2) on time, it was found that the degree of cleavage increases linearly in the region from 1 to 5 hours, and after 7 hours of incubation, no more than 5-10% of the original RNA remains in the cleavable mixture (Table 2). On the linear portion of the kinetic curve according to the equation [P] _t = [P] _∝ × (1-e ^{-Kobs × t} ), where [P] _t and [P] _∝ are the degrees of substrate cleavage in time t and in infinite time (you can assuming that the substrate will be split into 100% in infinite time), the reaction rate constants k _obs were found to be 0.273 and 0.408 h ^-1 for compounds (1) and (2), respectively.

table 2 Dependence of the degree of RNA cleavage in the presence of compounds (1) and (2) in the optimal concentration on time. Time h The degree of cleavage of RNA,% (one) (2) 0 0 0 one 26 twenty 3 77 58 7 94 87 eighteen 96 95

The above examples confirm the high ribonuclease activity of compounds (1) and (2).

Example 4. The effect of compounds (1) and (2) on the viability of MDCK cells

MDCK cells (dog kidney cells) were cultured in IMDM medium containing 10% fetal calf serum, antibiotics (100 units / ml penicillin and 0.1 mg / ml streptomycin) and antimycotic amphotericin (0.25 μg / ml) in atmosphere 5 % CO ₂ at 37 ° C.

Cell viability after incubation with compounds (1) or (2) was determined using the MTT test, which is based on the ability of living cells to convert tetrazole-based compounds (MTT) into brightly colored formazan crystals, which allows spectrophotometric estimation of the number of living cells in the preparation. For this, cells were plated in 96-well plates (10 ⁴ cells per well). After 24 hours, the medium was changed in the wells and an aqueous solution of compound (1) or (2) in water was added to the cells to a final concentration in the medium from 10 ^-8 to 10 ^-4 M. Cells were incubated in the presence of compounds for another day in the same conditions. At the end of incubation without changing the medium, MTT solution (5 mg / ml) in phosphate-buffered saline was added to the cells to a concentration of 0.5 mg / ml and incubated for 3 h under the same conditions. The medium was removed, 100 μl of dimethyl sulfoxide, in which the formazan crystals formed in the cells were dissolved, were added to the cells, and the optical density was measured on a multichannel spectrophotometer at wavelengths of 570 and 630 nm, where A ₅₇₀ is the absorption of formazan and A ₆₃₀ is the background of the cells.

From the experimental data, the IC ₅₀ concentration of the compounds was calculated, at which 50% cell death was observed. IC ₅₀ values are shown in table 3.

Table 3 IC ₅₀ values of compounds (1) and (2) for MDCK cells Compound IC ₅₀ mm (one) > 5 (2) > 5

From the above data it is seen that the treatment of cells with compounds (1) or (2) causes their effective death only at concentrations of compounds higher than 5 mm, which indicates an extremely low toxicity of the compounds.

Example 5. Inactivation of influenza virus by the compounds (1) and (2)

The virucidal activity of artificial ribonucleases (1), (2) was studied on the model of influenza virus A / WSN / 33, (H1N1). In these experiments, the influenza virus A / WSN / 33, (H1N1) with an infectious titer of 10 ⁶ focus-forming units (PFU) of the virus-containing material was used. Infectious activity of the virus was determined by FOE on MDCK cells. The method is based on a modified enzyme-linked immunosorbent reaction: viral proteins expressed in virus-infected cells specifically bind to monoclonal antibodies labeled with the enzyme. Further, the enzyme interacts with the substrate, which leads to staining of the infected cell. Inactivation of influenza virus by compounds (1), (2) was carried out at 37 ° C in 50 mM Tris-HCl buffer, pH 7.0, containing 0.2 M KCl and 2 mM EDTA, for 18 h at 37 ° C at concentrations of compounds (1) , (2) from 200 μM to 4 mm.

Compounds (1), (2) effectively inactivate the influenza virus, and the degree of inactivation of the virus increases with increasing concentration of the compounds at which the virus is inactivated. Thus, incubation of the virus for 18 h at 37 ° С with compounds (1), (2) at a concentration of 200 μM reduces the titer of the virus by 0.8 log compared to the control. With an increase in the concentration of compounds (1), (2) to 2 mM, complete inactivation of the influenza virus is observed (table 4). It should be noted that the concentration of compounds (1) and (2), at which complete inactivation of the influenza virus is observed, is significantly lower than the IC ₅₀ value for these compounds.

Example 6. Inactivation of tick-borne encephalitis virus (TBE) compounds (1) and (2).

The virucidal activity of compounds (1), (2) was studied on the model of TBE virus (Sofjin strain) with an infectious titer of 10 ⁶ plaque-forming units (PFU). Infectious activity of TBE virus was determined on SPEV cells. CE virus inactivation by compounds (1), (2) was carried out at a concentration of 2 mM in 50 mM Tris-HCl buffer, pH 7.0, containing 0.2 M KCl and 2 mM EDTA, for 18 h at 37 ° С.

Compounds (1), (2) under these conditions (concentration of 2 mM, 18 h, 37 ° C) completely inactivate the TBE virus (table 4).

Incubation of cells infected with TBE virus with compound (2) at a concentration of 1 mM led to a decrease in the reproduction of the virus by an order of magnitude compared to the control.

The results obtained clearly indicate a high antiviral activity of compounds (1), (2).

Table 4 The virucidal effect of compounds (1), (2). Compound Flu virus TB virus Concentrations of compounds used to inactivate the virus Virus titer upon incubation for 18 hours at 37 ° C, log (IU / ml) Concentrations of compounds used to inactivate the virus Virus titer upon incubation for 18 hours at 37 ° C, log (PFU / ml) (one) 2 mm <1 2 mm <1 (2) 2 mm <1 2 mm <1 the control - 5.2 - 4.2

Example 7. The study of membranolytic activity of compounds (1) and (2)

The study of the morphology of viral particles after incubation with compounds (1) and (2) was carried out using electron microscopy by negative contrast. The studied samples were sorbed onto support electron microscopic grids coated with a molded film for 1.5 minutes, the remainder of the liquid was removed, the grid was dried and placed in a contrasting solution (2% solution of phosphoric-tungsten acid in distilled water) for 45 sec, the remainder of the solution cleaned, the mesh was dried. Samples (4-6 grids) were studied in a Hitachi-H800 transmission electron microscope at magnifications from 10,000 to 200,000.

An electron microscopic study of the morphology of viral particles inactivated by compounds (1) and (2) revealed virions with a damaged lipid membrane, a small part of the viral particles also observed a change in the thickness of the lipid layer, peplomeres on the surface of the viral membrane were preserved. The degree of damage to the structure of virions directly depended on the concentration of compounds (1) and (2). As the concentration of compounds increased to 10 ⁻³ M, damage to their structure developed.

Figure 6 presents electron micrographs of influenza virus particles, where in picture 1 there is an intact virus (peplomers are visible on the surface of a spherical particle, the shell is not damaged), in pictures 2-4 there is a flu virus treated with artificial ribonuclease under standard conditions (on the particle surface peplomeres, shell ruptures are visible, particles are deformed) Negative contrasting of FVC. The length of the scale line is 50 nm.

Based on the results of electron microscopic studies, it can be assumed that compounds (1) and (2) disintegrate the lipid shells of the virions, which contributes to the rapid inactivation of the virus.

Thus, the data obtained unambiguously indicate a high ribonuclease, membrane and antiviral activity of compounds (1) and (2), which allows them to be used as active components for the development of dosage forms of drugs intended for the treatment of viral diseases.

Claims (1)

Virus inactivation agent with simultaneous ribonuclease, membrane and antiviral activities, which are derivatives of lysine, glutamic and 6-aminohexanoic acids, linked by a hydrophobic linker with structural formulas (compounds 1 and 2):

Images