RU2396355C2 - Method of identifying hepatitis c virus genotype and subtype - Google Patents

Abstract

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to molecular biology, virology and medicine. The method is based on analyis of 5'-untranslated region of the hepatitis C virus genome using a differentiating oligonucleotide microchip. The method involves a two-step polymerase chain reaction to obtain a fluorescent labelled single-strand fragment of the 5'-untranslated region of the hepatitis C virus genome and subsequent hybridisation of this fragment on a biological microchip which contains a set of specific discriminating oligonucleotides. The hepatitis C virus genotype or subtype is identified by determining specific sequences of sections of the 5'-untranslated region fragment. Invention can be used in medicine.

EFFECT: invention enables analysis directly from a clinical specimen, determine 6 genotypes and 22 subtypes of the hepatitis C virus, including the most virulent and drug-resistant forms, and lower cost of analysis.

5 cl, 15 dwg, 2 tbl, 14 ex

Description

FIELD OF THE INVENTION

The invention relates to the field of molecular biology, virology and medicine, and relates to a method for identifying the genotype and subtype of hepatitis C virus (HCV) based on sequence analysis of the 5 'untranslated region of the HCV genome using an oligonucleotide microchip.

State of the art

HCV belongs to the family of RNA viruses Flaviviridae and causes an infectious process in humans, the most common complication of which is hepatitis, which develops into cirrhosis and hepatocarcinoma (Surveillance. Hepatitis. CDC Report No. 61; Younossi Z, Kallman J, Kincaid J. The effects of HCV infection and management on health-related quality of life. Hepatology. 2007 Mar; 45 (3): 806-16). This disease affects more than 170 million people on Earth, and the number of infected continues to increase. Worldwide, there are about 1.5 million cases of hepatocarcinoma caused by HCV infection. The losses associated with this disease in the United States alone are estimated at $ 200 million annually.

A common current trend in the treatment of HCV is the use of complex therapy, including co-administration of megadoses of interferon with a cocktail containing both common antiviral drugs and one or two inhibitors of the multiplication of HCV (specific protease inhibitors - helicase and / or RNA polymerase) (Toniutto P , Fabris C, Bitetto D, Fornasiere E, Rapetti R, Pirisi M. Valopicitabine dihydrochloride: a specific polymerase inhibitor of hepatitis C virus. Curr Opin Investig Drugs. 2007 Feb; 8 (2): 150-8; Johnson CL, Owen DM , Gale M Jr. Functional and therapeutic analysis of hepatitis C virus NS3.4A protease control of antiviral immune defense. J Biol Chem. 2007 Apr; 282 (14): 10792-803). Such cocktails increase the percentage of cure, however, will inevitably lead to the selection of adaptive HCV mutants resistant to these inhibitors.

The identification of the genotype of the HCV test sample is important for assessing the duration and effectiveness of antiviral therapy, as well as determining the pathway of the virus. Accurate determination of the HCV subtype may be useful in assessing the effectiveness of the latest viral RNA polymerase inhibitors that can be used as antiviral drugs. (Pauwels F, Mostmans W, Quirynen LM, van der Helm L, Boutton CW, Rueff AS, Cleiren E, Raboisson P, Surleraux D, Nyanguile O, Simmen KA Binding-site identification and genotypic profiling of hepatitis C virus polymerase inhibitors. J Virol. 2007 Jul; 81 (13): 6909-19).

The following methods are currently used to determine the genotypes and subtypes of hepatitis C virus:

I. Direct determination of the nucleotide sequence (Sequencing) of the 5'-non-coding region of the hepatitis C virus genome, followed by analysis of the obtained sequence by comparison with the existing database, on the basis of which it is concluded that this sample belongs to a specific genotype and subtype ('TRUGENE HCV5' set NTR '(Bayer HealthCare LLC, USA)):

Jeffrey J. Germer, David W. Majewski, Michael Rosser, Amber Thompson, P. Shawn Mitchell, Thomas F. Smith, Slava Elagin, and Joseph D.C. Yao. 2003. Evaluation of the TRUGENE HCV 5'HTP Genotyping Kit with the New Gene Librarian Module 3.1.2 for Genotyping of Hepatitis C Virus from Clinical Specimens. J Clin Microbiol., Vol. 41, No. 10, p. 4855-4857;

II. Probe Method (Line Probe assay (LiPA)):

Verbeeck J, Stanley MJ, Shieh J, Celis L, Huyck E, Wollants E, Morimoto J, Farrior A, Sablon E, Jankowski-Hennig M, Schaper C, Johnson P, Van Ranst M, Van Brussel M. Evaluation of the VERSANT HCV Genotype Assay (LiPA) 2.0. J Clin Microbiol. 2008 Apr 9;

Nadarajah R, Khan GY, Miller SA, Brooks GF. Evaluation of a new-generation line-probe assay that detects 5 'untranslated and core regions to genotype and subtype hepatitis C virus. Am J Clin Pathol. 2007 Aug; 128 (2): 3 00-4;

III. The method of extension of genotype-specific primer (Primer-specific extension analysis):

Antonishyn NA, Ast VM, McDonald RR, Chaudhary RK, Lin L, Andonov AP, Horsman GB. 2005. Rapid genotyping of hepatitis C virus by primer-specific extension analysis. J Clin Microbiol. Oct; 43 (10): 5158-63.

IV. Mass spectrometric methods (Matrix-assisted laser desorption ionization-time of flight (mass spectrometry)):

Ilina EN, Malakhova MV, Generozov EV, Nikolaev EN, Govorun VM. 2005. Matrix-assisted laser desorption ionization-time of flight (mass spectrometry) for hepatitis C virus genotyping. J Clin Microbiol. Jun; 43 (6): 2810-5.

V. Enzyme immunoassay methods (Serotyping of hepatitis C virus):

Elsawy EM, Sobh MA, El-Chenawi FA, Hassan IM, Shehab El-Din AB, Ghoneim MA 2005. Serotyping of hepatitis C virus in hemodialysis patients: comparison with a standardized genotyping assay Diagn Microbiol Infect Dis. Feb 51 (2): 91-4.

VI. Heteroduplex analysis using capillary electrophoresis (heteroduplex mobility analysis using temperature gradient capillary electrophoresis):

Margraf RL, Erali M, Liew M, Wittwer CT. 2004. Genotyping hepatitis C virus by heteroduplex mobility analysis using temperature gradient capillary electrophoresisro J Clin Microbiol. 2004 Oct; 42 (10): 4545-51.

VII. Invasive probe method (Invader Assay):

Germer JJ, Majewski DW, Yung B, Mitchell PS, Yao JD. 2006. Evaluation of the invader assay for genotyping hepatitis C virus. J Clin Microbiol. Feb 44 (2): 318-23.

Viii. Nested restriction site-specific PCR method for nested PCR followed by structurally specific cleavage:

Krekulova L, Rehak V, Wakil AE, Harris E, Riley LW. 2001. Nested restriction site-specific PCR to detect and type hepatitis C virus (HCV): a rapid method to distinguish HCV subtype 1b from other genotypes. J Clin Microbiol. May; 39 (5): 1774-80.

IX. High-performance liquid chromatography (denaturing high-performance liquid chromatography):

Liew M, Erali M, Page S, Hillyard D, Wittwer C. 2004 Hepatitis C genotyping by denaturing high-performance liquid chromatography. J Clin Microbiol. Jan; 42 (1): 158-63.

X. Transcription-mediated amplification in conjunction with the line probe assay:

Comanor L, Elkin C, Leung K, Krajden M, Kronquist K, Nicolas K, Horansky E, deMedina M, Kittichai P, Sablon E, Ziermann R, Sherlock C. 2003 Successful HCV genotyping of previously failed and low viral load specimens using an HCV RNA qualitative assay based on transcription-mediated amplification in conjunction with the line probe assay. J Clin Virol. Sep; 28 (1): 14-26.

Xi. Real-time PCR method with subsequent analysis of melting curves (Melting curve analysis):

Doris M. Haverstick, Grant C. Bullock, and David E. Bruns. 2004. Genotyping of Hepatitis C Virus by Melting Curve Analysis: Analytical Characteristics and Performance. Clinical Chemistry 50, No. 12, p / 2405-2407.

XII. Direct determination of the nucleotide sequence (Sequencing) of the hepatitis C virus NS5B region, followed by analysis of the obtained sequence by constructing a phylogenetic tree and determining the genotype and subtype of the test sample based on the location of the analyzed sequence in one of the clusters of this tree (NS5B sequencing followed by phylogenetic analysis):

C. Sandres-Saune, P. Deny, C. Pasquier, V. Thibaut, G. Duverlie, J. Isopet. 2003. Determining hepatitis C genotype by analyzing the sequence of the NS5b region. Journal of Virological Methods Vol. 109, p. 187-193;

Laperche S, Lunel F, Izopet J, Alain S, Deny P, Duverlie G, Gaudy C, Pawlotsky JM, Plantier JC, Pozzetto B, Thibault V, Tosetti F, Lefrere JJ. 2005. Comparison of hepatitis C virus NS5b and 5 'noncoding gene sequencing methods in a multicenter study. J Clin Microbiol. Feb 43 (2): 733-9;

Hnatyszyn, J., Beld M., Gualbertus Hubertus M., Guettouche T., Gouw R., Van Der Meer, C., Beatrijs Maria. (Bayer Healthcare LLC). Methods and reagents for genotyping HCV. WO / 2007/076493. International application no. PCT / US2006 / 062582. Publication Date: 07/05/2007.

Methods (I-IV, VI-XI) are based on the analysis of genotype- and subtype-specific sequences of the 5'-untranslated region of the HCV genome (5'NTR). Sequence analysis of the 5'NTR region makes it possible to uniquely identify all 6 HCV genotypes and most clinically significant subtypes. However, methods II-IV, VI-XI only detect a limited number of HCV subtypes. So, the most common VERSANT HCV Genotype Assay (LiPA) 2.0 commercial test determines 15 subtypes (1a, 1b, 1a / 1b, 2a / 2c, 2b, 3a, 3b, 3c, 4a, 4c / 4d, 4e, 4f, 4h, 5a, 6a).

Currently, analysis of the NS5B region allows the identification of subtype 1b with a specificity close to 100%. Moreover, the study of sequences in this area makes it possible to identify a significantly larger number of subtypes than in the analysis of 5'HTP sequences (Thomas F, Nicot F, Sandres-Saune K, Dubois M, Legrand-Abravanel F, Alric L, Peron JM, Pasquier C , Izopet J. 2007. Genetic diversity of HCV genotype 2 strains in south western France. J Med Viral. Jan; 79 (1): 26-34; Nicot F, Legrand-Abravanel F, Sandres-Saune K, Boulestin A, Dubois M, Alric L, Vinel JP, Pasquier C, Izopet J. 2005. Heterogeneity of hepatitis C virus genotype 4 strains circulating in southwestern France. J Gen Virol Jan; 86 (Pt 1): 107-14). At the same time, due to the extremely high variability of the NS5B region, effective amplification of a fragment of the NS5B region of all genotypes and subtypes is difficult, which leads to a loss of sensitivity of the analysis as a whole, and, as a result, the impossibility of creating a reliable and effective diagnostic test system used in a qualitatively routine tool for HCV genotyping. (Martró E, González V, Buckton AJ, Saludes V, Femández G, Matas L, Planas R, Ausina V. Evaluation of a new assay in comparison with reverse hybridization and sequencing methods for hepatitis C virus genotyping targeting both 5 'noncoding and nonstructural 5b genomic regions. J Clin Microbiol. 2008 Jan; 46 (1): 192-7.)

The method of sequencing the sequence of the HCV NS5B region with subsequent phylogenetic analysis (XII) requires staging amplification and sequencing reactions, additional purification of the reaction products after each of the above steps, and subsequent analysis on an automatic sequencer. Moreover, the subsequent analysis of chromatograms, the construction of multiple alignment and the construction of phylogenetic trees impose increased requirements on the qualifications of staff, which prevents the widespread use of this approach for analyzing the flow of clinical samples in an ordinary diagnostic laboratory.

The method of detecting serotypes using enzyme-linked immunosorbent assay (V) options allows you to identify only a limited set of genotypes and subtypes (1a, 1b, 2a, 2b, 3a, and 4a) and requires highly purified monoclonal antibodies for each serotype.

Also, for the above methods of identifying genotypes and subtypes, the following disadvantages were noted:

- The commercial INNO-LiPA (II) kit and its use in combination with transcription-mediated amplification (X) are characterized by high cost and identifies a limited number of subtypes. Moreover, the method does not allow unambiguous identification of the 4d subtype, which is the most virulent and drug resistant among the subtypes of genotype 4;

- The method using genotype-specific primers in vitro (III) requires the formulation of independent reactions according to the number of genotypes (i.e. at least 6) in order to identify only one genotype;

- PCR heteroduplex analysis using capillary electrophoresis (VI) and nested PCR followed by structural-specific cleavage (VIII) are laborious, take a lot of time and require standard standards for each genotype and / or subtype determined;

- The method of invasive probes (VII) identifies only the genotype and does not allow to draw a conclusion about the subtype, which is a serious limitation for its use in clinical practice, where it is necessary to identify drug-resistant varieties of HCV (at least 1b and 4d) to assess the effectiveness and duration of therapy;

- Methods of mass spectrometry (IV) and HPLC (IX) require expensive equipment, additional stages of sample preparation for analysis and identify a limited number of subtypes;

- PCR with real-time detection (XI) reveals the presence of only the most common genotypes and subtypes and is very expensive for routine analysis.

Thus, in this area there is an urgent need to develop a method for identifying the hepatitis C virus genotype and subtype that compares favorably with the solutions known from the prior art by the ease of analysis, high specificity and information content in relation to the number of identifiable genotypes and subtypes, as well as low cost .

Disclosure of invention

As a result of extensive scientific research, analysis of databases of nucleotide sequences of the HCV genome, the authors of the present invention found that the task of developing a method for identifying the genotype and subtype of hepatitis C virus can be successfully solved by using oligonucleotide microarrays containing genotype and subtype-specific probes, sequences which are complementary to the sequences of the 5'-non-coding region of the HCV genome.

The method for identifying the genotype and subtype of hepatitis C virus (HCV) on oligonucleotide microchips compares favorably with the methods known from the prior art by the ability to identify all six genotypes (1-6) and 22 subtypes of HCV (1a, 1b, 1d, 1e, 2a, 2b, 2c , 2i, 2k, 3a, 3b, 4a, 4c, 4d, 4f, 4h, 4k, 4r, 5a, 6a, 6b, 6d) in clinical samples, as well as low cost, short time needed to get the result. The method does not require expensive equipment and highly qualified personnel. Data obtained using the proposed method can be used to assess and predict the severity of the course of the disease (acute / chronic cirrhosis, the likelihood of developing liver cancer), determine the therapeutic dose of drugs and the duration of the course of therapy, as well as for epidemiological genotyping.

In a first aspect, the invention provides a method for identifying a HCV genotype and subtype using an oligonucleotide microchip containing genotype and subtype specific probes. The procedure of the present invention is based on two-stage PCR to obtain a fluorescently labeled, predominantly single-stranded fragment of the 5'HTP region, followed by hybridization of this fragment on a microchip containing a set of specific discriminating oligonucleotides, complementary to sequences of sequences of 5'HTP regions specific for genotypes subtypes.

The method comprises the following steps:

(a) reverse transcription combined with PCR (RT-PCR) using viral RNA as a template and the first pair of primers specific for a fragment of the 5'HTP region, the sequences of which are represented by SEQ ID NOs: 53 and 54;

(b) asymmetric amplification of a fragment of the 5'HTP region using the RT-PCR product obtained in stage (a) as a template, a second pair of specific primers, sequences of which are represented by SEQ ID NOs: 55 and 56, and a mixture of four deoxynucleoside triphosphates, wherein one of the four deoxynucleoside triphosphates is fluorescently labeled as a substrate to produce a predominantly single-stranded fluorescently labeled fragment;

(c) an oligonucleotide microchip for identification of the HCV genotype and subtype, which is a substrate containing many discrete elements, each of which has a unique oligonucleotide probe immobilized having a sequence complementary to the sequence of the single-chain fragment obtained in stage (b) and selected from the group including: a) genotype-specific sequences of a fragment of a 5'-untranslated region for each HCV genotype; and b) the subtype-specific for each of the subtypes of the HCV sequence of the fragment of the 5'-untranslated region, the sequences of immobilized oligonucleotide probes are represented by SEQ ID NO: 1-52;

(d) - hybridization of the amplified labeled product obtained in stage (b) on an oligonucleotide microchip with the formation of duplexes with immobilized probes under conditions providing a resolution of one nucleotide between perfect and imperfect duplexes formed as a result of hybridization;

(e) - recording the results of hybridization on an oligonucleotide microchip carried out in stage (d), carried out using a portable fluorescence analyzer and software, which allows the use of software processing of signal intensities with subsequent interpretation of the results;

(f) - interpretation of the hybridization results obtained in stage (e), carried out in two stages: at the first stage, signals are analyzed in microchip elements containing oligonucleotide probes specific for HCV genotypes, thereby identifying the genotype of the test sample; in case of identification of the genotype in the second stage, only microarray elements containing oligonucleotide probes specific to the subtypes of the identified genotype are analyzed, regardless of the presence of signals in elements containing probes specific to subtypes of other genotypes

In one of its embodiments, the method is characterized in that in step (b) one of the primers of the second pair is used in at least a ten-fold molar excess with respect to the second primer.

In its next embodiment, the method is characterized in that in step (b), fluorescently labeled deoxyuridine triphosphate is used as a fluorescently labeled deoxynucleoside triphosphate.

In yet another embodiment, the method is characterized in that the oligonucleotide microchip is a microgel based on hydrogel cells obtained by a method of chemically or photo-induced copolymerization.

Finally, in yet another embodiment, the method further includes assessing and predicting the severity of the disease (acute / chronic cirrhosis, the likelihood of developing liver cancer), determining the therapeutic dose of the drug and the duration of the course of therapy, and / or epidemiological genotyping based on the interpretation of hybridization results.

The claimed aspect of the present invention will be clear from the accompanying figures, a detailed description and claims.

Short list of figures

For a clearer understanding of the essence of the claimed invention, as well as to demonstrate its characteristic features and advantages, the following is a detailed description of the invention with reference to the figures of the drawings, in which:

Figure 1 is a schematic diagram of an analysis of HCV RNA to identify the genotype and subtype of HCV on an oligonucleotide microchip. Designations:

I - stage reverse transcription, combined with PCR using viral RNA as a template for double-stranded cDNA;

II - asymmetric amplification of a fragment of the 5'-untranslated region with the inclusion of deoxynucleoside triphosphates containing a fluorescent label, in order to obtain a single-stranded fluorescently-labeled product for its subsequent hybridization on an oligonucleotide microchip;

III - hybridization of a fluorescently labeled single chain fragment of the 5'-untranslated region obtained in stage II, with oligonucleotides immobilized on a microchip;

IV - registration and interpretation of hybridization results on an oligonucleotide microchip.

Figure 2 is a selection scheme for oligonucleotides for identifying HCV genotypes and subtypes.

Figure 3 represents the layout of discriminating oligonucleotides on a microchip.

Figure 4 presents the results of the RT-PCR step with primers, the sequences of which are represented by SEQ ID NO: 53 and 54, for HCV RNA samples having different genotypes and subtypes. Designations (gel tracks):

1 - subtype 1a; 2 - subtype 1b; 3 - subtype 1e; 4 - subtype 2a; 5 - subtype 2k; 6 - subtype 2i; 7 - subtype 3a; 8 - subtype 4a; 9 - subtype 4d; 10 - subtype 5a; 11 - subtype 6b; 12 - DNA of hepatitis B virus (neg. Counter); 13 - HIV RNA (Neg. Cont.); 14 - Neg. monitoring the stage of RT-PCR; M - molecular marker 'FastRuler ™ DNA Ladder, Middle Range' (Fermentas, Lithuania).

Figure 5 presents the results of the PCR stage with primers, the sequences of which are represented by SEQ ID NO: 55 and 56, using the RT-PCR stage as the template product for HCV samples having different genotypes and subtypes. Designations (gel tracks):

1 - subtype 1a; 2 - subtype 1b; 3 - subtype 1e; 4 - subtype 2a; 5 - subtype 2k; 6 - subtype 2i; 7 - subtype 3a; 8 - subtype 4a; 9 - subtype 4d; 10 - subtype 5a; 11 - subtype 6b; 12 - DNA of hepatitis B virus (neg. Counter); 13 - HIV RNA (Neg. Cont.); 14 - Neg. monitoring the stage of RT-PCR; M - molecular marker 'FastRuler ™ DNA Ladder, Middle Range' (Fermentas, Lithuania).

Fig.6 represents a fluorescence picture of hybridization and the distribution of normalized cell signals obtained on a microchip as a result of analysis of a HCV sample having genotype 1, subtype 1a.

Fig. 7 presents a fluorescence picture of hybridization and the distribution of normalized cell signals obtained on a microchip as a result of analysis of a HCV sample having genotype 1, subtype 1b.

Fig. 8 shows a fluorescence picture of hybridization and the distribution of normalized cell signals obtained on a microchip as a result of analysis of a HCV sample having genotype 1, subtype 1e.

Fig.9 presents a fluorescence picture of hybridization and the distribution of normalized cell signals obtained on the microchip, as a result of analysis of the sample In the HS, having genotype 2, subtype 2A.

Figure 10 presents a fluorescence picture of hybridization and the distribution of normalized cell signals obtained on a microchip as a result of analysis of a HCV sample having genotype 2, subtype 2i.

11 presents a fluorescence picture of hybridization and the distribution of normalized cell signals obtained on a microchip as a result of analysis of a HCV sample having genotype 3, subtype 3a.

12 presents a fluorescence picture of hybridization and the distribution of normalized cell signals obtained on a microchip as a result of analysis of a HCV sample having genotype 4, subtype 4a.

Fig.13 presents a fluorescence picture of hybridization and the distribution of normalized cell signals obtained on a microchip as a result of analysis of a HCV sample having genotype 4, subtype 4d.

Fig. 14 shows a fluorescence picture of hybridization and the distribution of normalized cell signals obtained on a microchip as a result of analysis of a HCV sample having genotype 5, subtype 5a.

Fig. 15 shows a fluorescence picture of hybridization and the distribution of normalized cell signals obtained on a microchip as a result of analysis of a HCV sample having genotype 6.

The implementation of the invention

The objective of the present invention is to provide a method for identifying the genotype and subtype of hepatitis C virus based on the analysis of the 5 'untranslated region of the HCV genome using an oligonucleotide microchip.

The claimed method proposes the use of: reverse transcription procedures, combined with a polymerase chain reaction (RT-PCR), for amplification of the sequence of the 5'HTP fragment of the HCV genome region; obtaining a single-stranded fluorescently labeled fragment from the product obtained, while viral RNA isolated from clinical material, such as, for example, blood, plasma or liver biopsy, can be used as the initial sample. The claimed method also involves the use of an original oligonucleotide microchip with immobilized specific probes, hybridization procedures, registration and interpretation of the results.

Schematic diagram of the identification of the genotype and subtype of the studied HCV sample on a microchip.

The sequence analysis scheme of the 5'HTR fragment of the HCV genome for identifying the genotype and subtype using a microchip is shown in Fig. 1.

Isolation of HCV RNA from a clinical sample is carried out using methods known in the art (e.g., Hourfar MK, Michelsen U, Schmidt M, Berger A, Seifried E, Roth WK. High-throughput purification of viral RNA based on novel chemical chemistry for nucleic acid isolation. Clin Chem. 2005 Jul; 51 (7): 1217-22), or any specialized commercially available reagent kit for isolating RNA from blood, plasma, or liver biopsy specimen, for example, QIAamp DSP Virus Kit (Cat No. 60704, Qiagen, Germany) , MagMAX ™ AI / ND Viral RNA Isolation Kits (Cat. No. AM1939, Ambion, USA) or “Reagent Kit for RNA Isolation” (Cat. No. 05-013, ZAO NPF DNA Technology, Russia).

Amplification of the 5'NTR fragment of the HCV genome in the first stage is performed using the reverse transcription reaction combined with PCR (RT-PCR).

The primers for the first stage of amplification are selected so that they flank the most polymorphic segment of the 5'-untranslated region of the HCV genome, which allows differentiating existing HCV genotypes and subtypes. Preferably, the segment of the region to be amplified includes positions 40 to 460 of the HCV genome according to Choo, QL, K. N. Richman, J. N. Han, K. Berger, C. Lee, C. Dong, C. Gallegos, D. Coit, R. Medina-Selby, PJ Barr, et al. 1991. Genetic organization and diversity of the hepatitis C virus. Proc. Natl. Acad. Sci. USA 88: 2451-2455.

The primer sequences are selected in such a way as to efficiently amplify the RNA of the studied segment of the 5'-untranslated region of any genotype and, accordingly, the HCV subtype. For this, for example, multiple alignment of all available nucleotide sequences in the 5'HTP region located at http://www.ncbi.nlm.nih.gov/Genbank/index.html and http: // hcv can be designed . lanl. gov / content / hcv-db. Then find the most conservative for all HCV genotypes sections of the study area and select primers specific to these areas. Using specialized software, for example, Oligo v.6.3 (Molecular Biology Insights Inc., USA) or Fast PCR (http://www.biocenter.helsinki.fi/bi/Programs/fastpcr.htm) or other commercially available programs, or programs freely available on the Internet calculate the melting points of the primers and, varying their length, ensure that the spread in temperature of the annealing of the primers inside the pair does not exceed 3-4 ° C. When selecting primers, sequences that are capable of forming secondary structures such as hairpins with high melting points are avoided. Each selected primer must have unique specificity for the analyzed area. The specificity of the primers is checked using software that uses the BLAST algorithm to search the nucleotide sequence databases (for example, www.ncbi.nlm.nih. Gov / BLAST). In particular, sequences that are capable of productively hybridizing (annealing) with the sequences of the human genome must be avoided.

At the second stage, a predominantly single-stranded fluorescently labeled product is obtained by asymmetric PCR using a mixture of deoxynucleoside triphosphates, in which one of the deoxynucleoside triphosphates is fluorescently labeled, as a substrate for constructing a de novo chain. As is known to those skilled in the art, a mixture of deoxynucleoside triphosphates for PCR contains dATP, dGTP, dCTP and dTTP, and dUTP or a mixture of dTTP / dUTP in any molar proportion can be used instead of dTTP. Any of these deoxynucleoside triphosphates may carry a fluorescent label. Most preferably, the use of fluorescently labeled deoxyuridine triphosphate and / or deoxycytidine triphosphate, which, on the one hand, determines the effective incorporation of this substrate into the newly synthesized DNA chain during PCR, and on the other hand, makes it possible to prevent false results due to cross-contamination with amplicons by using the first stage of the enzyme uracil-DNA glycosylase. This is critical when conducting mass analyzes in a specialized laboratory.

As the fluorescent dye, any fluorescent dye can be used that can be chemically incorporated into the deoxynucleoside triphosphate molecule in such a way as not to impede the passage of the polymerase chain reaction and subsequent hybridization of the polynucleotide molecule containing such fluorescently labeled nucleotide residues with oligonomobases. In the case of a fluorescently labeled deoxyuridine triphosphate, for example, a fluorescent dye may be attached to the 5'-end of the amino allyl derivative of dUTP. Examples of such dyes are well known to the person skilled in the art and include dyes of fluorescein (TAMRA ^® , ROX ^® , JOE ^® ), rhodamine (Texas Red ^® ), polymethine (Cy3 ^® , Cy5 ^® , Cy5.5 ^® , Cy7 ^® ) series ( Ranasinghe R. and Brown T). Fluorescence based strategies for genetic analysis. Chem. Commun., 2005, 5487-5502). Fluorescent dyes are commercially available, in particular from Molecular Probes, USA. The most preferred are dyes, the excitation spectrum of which lies in the long-wave (red) region of the spectrum, which makes it possible to use inexpensive sources of exciting radiation such as semiconductor lasers to excite fluorescence.

Fluorescently labeled deoxynucleoside triphosphates can be obtained in vitro using such known methods as, for example (Kuwahara M, Nagashima J, Hasegawa M, Tamura T, Kitagata R, Hanawa K, Hososhima S, Kasamatsu T, Ozaki H, Sawai H. Systematic characterization of 2'-deoxynucleoside-5'-triphosphate analogs as substrates for DNA polymerases by polymerase chain reaction and kinetic studies on enzymatic production of modified DNA. Nucleic Acids Res. 2006 34 (19): 5383-94) commercially available, for example, CyDye Fluorescent Nucleotides (Cat. No. PA55021, PA55032, PA55026, GE Healthcare, USA).

The primers for the second stage of amplification are selected taking into account the requirements set forth above, with the difference that at least one of the primers is selected inside the PCR fragment obtained in the first stage, which increases the specificity of the reaction. Thus, the resulting product will ultimately be the product of a semi-nested or nested amplification reaction. The size of the fragment amplified in the second stage is not specifically limited as long as this ensures efficient hybridization of the fragment with probes immobilized on the microchip. In the case where the microchip is a microchip based on hydrogel elements, the primers for the second stage of amplification are chosen so that the size of the amplified fragment was 100-800 bp The large length of the PCR product obtained in the second stage makes it difficult to efficiently diffuse the analyzed genome fragment in the gel elements of the microchip during hybridization, which ultimately can lead to a decrease in the number of hybridization duplexes formed and, as a result, to a decrease in the fluorescent signal in the cells. When selecting primers, one should take into account the fact that the output of the reaction produces predominantly single-stranded fluorescently labeled products, which should be complementary to oligonucleotides immobilized on a microchip. Therefore, in each pair, the primer added in excess (“lead primer”) is selected from the chain whose sequence is complementary to the sequences of oligonucleotides immobilized on a microchip. Those. if the oligonucleotides for immobilization are selected from the sense strand, for the formation of hybridization duplexes in the cells of the microchip, the predominant amplification of the antisense strand is necessary, the very “leading primer” is selected from the strand complementary to the gene sequence (antisense strand), and vice versa.

To obtain a predominantly single-stranded fluorescently labeled product, the lead primer is added in molar excess with respect to the second primer. Preferably, the molar excess is at least ten times.

When choosing discriminating oligonucleotides for immobilization on a microchip taking into account the size and complexity of the analyzed sequence and, in particular, the presence of repeats and extended homopolymer sequences, the length of the discriminating oligonucleotides is determined, which ensures their specificity with respect to the analyzed sequence.

The selection of discriminating oligonucleotides for genotypes and subtypes is as follows. In the constructed multiple alignment of sequences of the 5'THP region for each genotype, a consensus sequence of this region is created, based on which unique probes are selected that allow each genotype to be uniquely identified. Moreover, due to the high variability of the HCV genome, to increase the reliability of the procedure, if possible, choose two discriminating probes for each of the genotypes complementary to different parts of the studied fragment of the 5'HTP region. A consensus sequence is also created for each of the subtypes, and then sections of the fragment of the studied 5'HTP region are selected, which allow differentiating the maximum number of subtypes within the same genotype. The number of such sites should be sufficient to ensure reliable identification of each of the subtypes. Based on the sequences of the selected sections, probes are designed to identify subtypes, while the sequence of one probe can correspond to two or more subtypes in a separate differentiating section of the studied fragment of the 5'HTP region. The strategy for selecting probes for immobilization on a microchip is schematically presented in FIG. 2.

Using software such as Oligo v. 6.3 (Molecular Biology Insights Inc., USA), calculate the melting temperature of oligonucleotides and, varying their length, ensure that the dispersion of the melting temperature of oligonucleotides is not more than 2-3 ° C. Avoid such oligonucleotides that are capable of forming secondary structures such as hairpins with high melting points.

Discriminating oligonucleotides are immobilized on a microchip substrate. As activated substrates for the manufacture of a microchip, an activated, e.g., aminated, surface of a glass slide can be used (Adessi C., Matton G., Ayala G., Turcatti G., Mermod J., Mayer P., Kawashima E. Solid phase DNA amplification: characterization of primer attachment and amplification mechanisms Nucleic Acids Research. 2000. V. 51. 28 (20) .: E87), plastic carriers (Nikiforov T., Rendle R., Goelet P., Rogers Y., Kotewicz M., Anderson S ., Trainor G., Knapp Michael R. Genetic Bit Analysis: a solid phase method for typing single nucleotide polymorphisms. Nucleic Acids Research. 1994. 22 (20): 4167-75), substrates with polymer macroporous carriers such as acrylamide ( Timofeev E., Kochetkova S., Mirzabekov A., Florentiev V. Regioselective immobi lization of short oligonucleotides to acrylic copolymer gels. Nucleic Acids Res. 1996 24 (16): 3142-8), Sepharose (Margulies M, Egholm M, Altman WE et al., Genome sequencing in microfabricated high density picolitre reactors. Nature. 2005 437 (7057): 376-80) and others. Methods of immobilizing oligonucleotides on substrates are well known in the art and include:

- chemisorption of oligonucleotides and DNA containing a thiol group on metals (Mirkin CA, Letsinger RL, Mucic RC and Storhoff JJ A DNA-based method for rationally assembling nanoparticles into macroscopic materials. Nature. 1996 Aug 15; 382 (6592): 607- 9);

- covalent binding of modified oligonucleotides to surface functional groups based on amide formation reactions (Healey BG, Matson RS, Walt DR. Fiberoptic DNA sensor array capable of detecting point mutations. Anal Biochem. 1997 251 (2): 270-9), ester (Ghosh SS, Musso GF. Covalent attachment of oligonucleotides to solid supports. Nucleic Acids Res. 1987 15 (13): 5353-72), carbimidoyl (Matson RS, Rampal J, Pentoney SL. Anderson PD, Coassin P. Biopolymer synthesis on polypropylene supports: oligonucleotide arrays. Anal Biochem. 1995 Jan 1; 224 (1): 110-6) bonds, etc.

- photochemically, chemically and electrochemically induced copolymerization of oligonucleotides bearing a unsaturated group with monomers that form the basis of the formed solid phase (Vasiliskov AV, Timofeev EN, Surzhikov SA, Drobyshev AL, Shick VV and Mirzabekov AD, Fabrication of microarray of gel-immobilized metal a chip by copolymerization. Biotechniques, 1999, 27, 592-606)

In a preferred embodiment of the present invention, a microchip based on hydrogel elements is used. Methods for producing such microarrays include the polymerization of amine-modified oligonucleotides to form a covalent bond with hydrogel monomers under appropriate conditions (pH, temperature, composition of the polymerization mixture, etc.) (Rubina AY, Pan'kov SV, Dementieva El et al. Hydrogel drop microchips with immobilized DNA :

properties and methods for large-scale production. Anal Biochem 2004; 325: 92-106). Most preferred is the use of microchips containing gel elements that are applied to the matrix in the form of droplets with a diameter of 80 to 300 microns with a period of 150-500 microns, without the use of special devices, for example, quartz masks. As the matrix can be used as a glass substrate (slide or cover glass), as well as more affordable materials, such as plastic. To immobilize the oligonucleotides in the gel elements of the microchip, their joint polymerization with the main components of the gel is used. As a result of this one-step reaction, the immobilized molecules are irreversibly, covalently attached to certain monomers of the growing polymer chain and are evenly distributed throughout the gel volume with a high yield (about 50% for oligonucleotides) (Rubina AY, Pan'kov SV, Dementieva EI et al. Hydrogel drop microchips with immobilized DNA: properties and methods for large-scale production. Anal Biochem 2004; 325: 92-106). The concentration of immobilized oligonucleotide probes can be estimated by staining the gel elements of the microchip with a dye with low specificity for the DNA nucleotide sequence (A.L. Mikheikin, A.V. Chudinov, A.I. Yaroshchuk, A.Yu. Rubina, S.V. Pankov, A.S. Krylov, A.S. Zasedatelev, A.D. Mirzabekov Dye with low specificity for the nucleotide sequence of DNA: application for estimating the number of oligonucleotides immobilized in cells of biological microarrays Molecular Biology 2003; 37 (6): 1061- 70).

PCR products obtained in the second stage of amplification are hybridized on a microchip with immobilized differentiating oligonucleotides complementary to the consensus sequences of genotypes and subtypes of the 5'HTP region fragment. Hybridization is carried out in a solution containing a buffer component to maintain pH, a salt to create ionic strength and a chaotropic (destabilizing hydrogen bond) agent in a sealed hybridization chamber at a temperature depending on the melting temperature of discriminating oligonucleotides immobilized on a microchip. As a hydrogen destabilizing agent, for example, guanidine thiocyanate, urea or formamide can be used. The choice of the optimum hybridization temperature is carried out taking into account the convenience of the practical application of the system. The discriminating oligonucleotides of the present invention have a melting point in the range of 42 to 44 ° C, which allows hybridization at 37 ° C using a chaotropic agent. The temperature of 37 ° C is convenient because most clinical laboratories are equipped with thermostats that maintain this temperature.

The DNA fragment under study forms perfect hybridization duplexes only with the corresponding (fully complementary) oligonucleotides. With all other oligonucleotides, the studied DNA fragment gives an imperfect duplex. Discrimination of perfect and imperfect duplexes is performed by comparing the fluorescence intensities of the cells in which the duplexes formed. The signal intensity in the cell in which the perfect hybridization duplex was formed (I _ow ) is higher than in that where the imperfect duplex was formed (I _ow ). Carrying out under optimal hybridization conditions (temperature, concentration of the chaotropic agent chosen and the ionic strength of the hybridization buffer) allows to achieve the ratio _cos I / I _Nessov ≥1,5 between two cells containing probes belonging to one group and differ in one nucleotide.

The hybridization results can be recorded on microarrays using commercial scanning devices — biological microarray fluorescence analyzers, for example, GenePix 4000B (Ahn Instruments, USA) equipped with appropriate software for calculating the intensity of fluorescent signals of discrete microarray elements and then normalizing them to a background value, for example 'GenePix Pro', 'Acuity' (Axon Instruments, USA).

Interpretation of the results of hybridization can be done visually by correlating a fixed fluorescence picture of the microchip and / or the obtained distribution of signal intensities of the elements of the microchip to the location of specific discriminating probes in the elements of the microchip (see Figure 3). Possessing the distribution of signal intensity in the cells of the microchip, the maximum signal is distinguished among elements containing genotype-specific oligonucleotides. Genotype identification can be carried out by identifying the microarray element with the highest fluorescence intensity among cells containing probes for determining the HCV genotype. The subtype of the HCV sample under study can be identified by determining the largest signals in cells containing subtype-specific oligonucleotides corresponding to the identified genotype, if the maximum signals are detected in at least two different cells containing unique oligonucleotides specific for a particular subtype.

Preferably, the interpretation of hybridization results on microarrays is as follows. At the first stage, reliable signals are extracted, i.e. signals in cells where the formation of perfect duplexes is possible. To do this, the normalized fluorescence intensity signals of all microarray cells are sorted in ascending order and compared with the average signal (I _ref ) in cells that do not contain oligonucleotides. Reliable signals are considered to be those that are superior to I _ref by at least 1.5 times. The second stage begins with the analysis of the filtered reliable G _i signals in groups of cells containing oligonucleotides specific for different genotypes (genotype i-number). The maximum signal within each group of cells G _{imax is isolated} and compared with each other. If the G _imax signal in one group exceeds the maximum signals in the remaining groups by more than 1.5 times (threshold value), then a conclusion is drawn about the belonging of the test sample to this genotype. If the signal ratio among G _imax does not exceed the threshold value, then a conclusion is drawn about the impossibility of unambiguous identification of the genotype and the possible presence in the analyzed sample of a mixture of two or more HCV variants with different genotypes. If the signals in groups containing genotype-specific oligonucleotides do not undergo primary filtering with respect to I _ref , then a conclusion is made about the low signal intensity and the possible absence of HCV RNA in the test sample. However, subtype identification is not performed.

Thus, if the genotype is determined based on the value of the G _imax signal, then only groups of cells containing oligonucleotides specific to the subtypes belonging to the identified genotype are considered below. In accordance with the proposed strategies for selecting probes for identifying a subtype, the oligonucleotides are combined into groups corresponding to selected sections of the studied fragment, which allows differentiating the maximum number of subtypes. Moreover, for each of the subtypes, 2 oligonucleotides were constructed, combined into 2 different groups of sequences of a fragment of the 5'-untranslated region, and is dictated by the need for reliable differentiation of the subtypes within the genotype. When identifying a subtype, first, signals within each group of cells are selected that exceed the other signals in this group by at least 1.5 times, such a signal is denoted as S _ixj (where i is the genotype number, 'x' is the symbolic designation of the subtype in accordance with the accepted classification of HCV subtypes, j is the group number). If two or more cells in a group have signals that differ by less than 1.5 times, then select all such signals S _ixj , S _ivj , etc. The result is a set of cells from different groups ixl, iy1, ix2, iz2, ix3, etc., the signals in which exceed other signals in their groups by at least 1.5 times. Moreover, if the obtained set contains at least 2 cells from different groups corresponding to one subtype, for example, ix1 and ix3 or ix1 and ixy2, then a conclusion is drawn on the belonging of the test sample to the subtype 'x' of the genotype 'i'. If in the resulting set the cells from different groups correspond to different genotypes, for example, ix1, iy2, iz3 or ix1, iyz3, then the signal intensities of these cells are compared with each other. If the signal of the cell corresponding to the subtype 'x' of one group exceeds the signals of cells of other groups by 3 or more times, then a conclusion is drawn on whether the sample under study belongs to the subtype 'x'. If the signal ratio S _ix1 / S _iy2 does not exceed three, a conclusion is drawn that the subtype is not set and that it can be a subtype of 'x' or a subtype of 'y'. The same conclusion is issued if the maximum signal in the group has a cell containing an oligonucleotide specific for two subtypes, for example, ixy1, in the absence of reliable signals in other groups of cells. If the signals in groups containing subtype-specific oligonucleotides do not undergo primary filtering with respect to I _ref , then it is considered that the subtype of the test sample is not defined.

Estimation of the duration of antiviral therapy and prognosis of the course of the disease can be made based on the identification of the genotype and subtype. So, in the case of establishing genotype 1, leading to cirrhosis, chronic hepatitis and hepatocellular carcinoma, the duration of therapy with pegylated interferon and ribavirin should be at least 24 weeks for subtypes 1a, 1c, 1d, 1e, and in case of detection of subtype 1b resistant to interferon , - at least 48 weeks (Week K. Molecular methods of hepatitis C genotyping. Expert Rev Mol Diagn. 2005 Jul; 5 (4): 507-20).

HCV infection with genotype 4 gives a clinical picture similar to infection with a virus having genotype 1 (Legrand-Abravanel F, Nicot F, Boulestin A, Sandres-Sauné K, Vinel JP, Alric L, Izopet J. Pegylated interferon and ribavirin therapy for chronic hepatitis C virus genotype 4 infection. J Med Virol. 2005 Sep; 77 (1): 66-9). Moreover, unlike genotype 1, genotype 4 is characterized by splitting into a significantly larger number of subtypes (Nicot F, Legrand-Abravanel F, Sandres-Saune K, Boulestin A, Dubois M, Alric L, Vinel JP, Pasquier C, Izopet J 2005. Heterogeneity of hepatitis C virus genotype 4 strains circulating in south-western France. J Gen Virol Jan; 86 (Pt 1): 107-14). The clinical significance of a number of them, for example, 4a and 4d, has already been established - 4d is resistant to interferon and requires a prolonged course of treatment (at least 48 weeks) (Roulot D, Bourcier V, Grando V et al. Epidemiological characteristics and response to peginterferon plus ribavirin treatment of hepatitis C virus genotype 4 infection. J Viral Hepat. 2007 Jul; 14 (7): 460-7).

Subtypes of HCV genotypes 2 and 3 are drug-sensitive therapy and are much less likely to lead to a chronic process. The duration of treatment with ribavirin and interferon for patients infected with HCV with these genotypes is from 6 to 12 weeks.

If a patient develops hepatitis C virus having genotype 5 or 6, the same course of therapy is recommended as for HCV having genotype 1 (Pawlotsky JM. Therapy of hepatitis C: from empiricism to eradication. Hepatology. 2006 Feb; 43 ( 2 Suppl 1): S207-20).

In addition to prognostic goals and assessing the duration of therapy, determining the genotype and subtype provides information in terms of the etiology of the infection. Subtypes 1a, 3a, 4a, 4d are more often associated with “syringe” hepatitis in people who use parenteral drugs, while genotype 2 and subtype 1b are associated with blood transfusion transmission (Simmonds P, Bukh J, Combet C et al. Consensus recommendation for a unified system of nomenclature of hepatitis C virus genotypes. Hepatology. 2005 Oct; 42 (4): 962-73).

Finally, the results obtained using the method of the present invention can be used for epidemiological genotyping. The distribution of HCV genotypes and subtypes varies in different geographical regions (Zein NN. Clinical significance of hepatitis C virus genotypes. Clin Microbiol Rev. 2000 13 (2): 223-35). Some of the subtypes are universal, others circulate only within limited geographical areas. Subtype 1b prevails in southern Europe, in China, Japan, and Russia (50-80%). In the USA and countries of South America, in the north of Western Europe, genotypes 1a and 1b are more common, followed by genotypes 2 and 3. Genotype 4 prevails in North and Central Africa, while genotype 5 is the main one in the south of the continent. Genotype 3 is found almost everywhere and is major in Australia and Southeast Asia. Genotype 6 is also common in Southeast Asia and is the main type in Vietnam, one of the main in Thailand, Indonesia.

The invention will now be illustrated by examples, which are intended to provide a better understanding of the essence of the claimed invention, but should not be construed as limiting the invention.

Examples

Example 1. A microchip for identifying the genotype and subtype of HCV based on the analysis of the 5'-untranslated region of the HCV genome.

1. Oligonucleotides for immobilization on a microchip and amplification primers were synthesized on a 394 DNA / RNA synthesizer (Applied Biosystems, USA) and contained a 3'-Ammo-Modifier C7 CPG 500 free amino group spacer (Glen Research, USA) immobilization in gel. The manufacture of microchips was carried out according to the procedure described previously (Rubina AY, Pan'kov SV, Dementieva EI et al. Hydrogel drop microchips with immobilized DNA: properties and methods for large-scale production. Anal Biochem 2004; 325: 92-106). The microchips contained hemispherical cells with a diameter of 100 μm and spaced 300 μm apart. The uniformity of the deposition of cells and their diameter was evaluated using the software 'Test chip' (Microchip-IMB, Russia). The quality control of microarrays was performed by measuring the concentrations of immobilized oligonucleotides. The microchips were stained with ImD-310 fluorescent dye (Microchip-IMB), the concentration of immobilized probes was evaluated as described previously (A.L. Mikheikin, A.V. Chudinov, A.I. Yaroshchuk, A.Yu. Rubina, S.V. .Pankov, A.S. Krylov, A.S. Zasedatelev, A.D. Mirzabekov. Dye with low specificity for the nucleotide sequence of DNA: application for estimating the number of oligonucleotides immobilized in cells of biological microarrays. Molecular Biology 2003; 37 (6) : 1061-70).

Microchip structure

The microchip contains 52 immobilized oligonucleotides, the list of which is presented in Table 1, four marker points (M) for the correct positioning (image capture) performed by a computer program, and 3 empty gel cells (0), which are necessary for calculating the reference (background) value of fluorescence intensity Iref. The location of the oligonucleotides immobilized on the microchip is shown in FIG. 3.

In the upper two rows, oligonucleotides with an index of 'G' are immobilized to identify the HCV genotype. The microchip identifies all six HCV genotypes. For reliable identification of each genotype, 2 unique genotype-specific oligonucleotides were constructed.

The following oligonucleotides are immobilized to identify subtypes:

- within the genotype 1: 1a, 1b, 1d, 1e. For reliable identification of each of the subtypes of genotype 1, 2 groups of oligonucleotides were constructed. Each group corresponds to a separate area within the studied fragment of the 5'HTP region;

- within the genotype 2: 2a, 2b, 2c, 2i, 2k. For reliable identification of each of the subtypes of genotype 2, 2 groups of oligonucleotides were constructed. Each group corresponds to a separate area within the studied fragment of the 5'HTP region;

- within the genotype 3: 3a, 3b. For reliable identification of each of the subtypes of genotype 3, 2 groups of oligonucleotides were constructed. Each group corresponds to a separate area within the studied fragment of the 5'HTP region;

- within the genotype 4: 4a, 4s, 4d, 4f, 4h, 4k, 4r. For reliable identification of each of the subtypes of genotype 4, 2 groups of oligonucleotides were constructed. Each group corresponds to a separate area within the studied fragment of the 5'HTP region;

- within the genotype 5: 5a. Genotype 5 is the only subtype 5a, thereby probes identifying the genotype also detect subtype 5a;

- within genotype 6: 6a, 6b, 6d. For reliable identification of each of the subtypes of genotype 6, 2 groups of oligonucleotides were constructed. Each group corresponds to a separate site within the studied fragment of the 5'HTP region.

Table 1.
List of oligonucleotide sequences immobilized on a microchip. SEQ ID NO: Oligonucleotide * Genotype Subtype Group Sequence 5 '→ 3' ** The position of the oligonucleotide in the sequence of the HCV genome (Acc. No AF290978) one G1-1 one - G1 CCGCTCAATGCCTGGA 211-227 2 G1-2 one - G1 CCGGAATTGCCAGGAC 167-183 3 G2-1 2 - G2 ACCGTGCATCATGAGCAC 335-354 four G2-2 2 - G2 AAAACCAAAAGAAACACYA 372-391 5 G3-1 3 - G3 CAACATGAGCACACTTCCT 344-362 6 G3-2 3 - G3 CGCTCAATACCCAGAAAAT 213-230 7 G4-1 four - G4 GGAATCGCCGGGATGA 171-186 8 G4-2 four - G4 ACCAAACGTAACACCAACCC 376-394 9 G5-1 5 - G5 CTCAATGCCCGGAGATTT 220-237 10 G5-2 5 - G5 GAATTGCCGGGATGACC 173-190 eleven G6-1 6 - G6 TCAATGCCTGGRGATTTG 217-232 12 G6-2 6 - G6 CACTTCYAAAACCCCAWA 354-372 13 1a1 one 1a one TGGATAAACCCGCTCAA 202-218 fourteen 1b1 one 1b one TGGATCAACCCGCTGA 202-217 fifteen 1d1 one 1d one TGGATTAACTCGCTGAA 202-218

16 1e1 one 1e one TGGATCTACTACGCTGA 202-218 17 1a2 one 1a 2 CGAATCCTAAACCCCAAA 354-370 eighteen 1b2 one 1b 2 CGATTCCCAAACCTCAAA 354-370 19 1d2 one 1d 2 CGATTCGCAATCCTCAAA 354-370 twenty 1e2 one 1e 2 GATTCGCGACCCTCA 355-368 21 2a1 2 2a one ACTCTATGCCCGGCC 214-230 22 2b1 2 2b one CACTCTATGTCCGGTCA 213-231 23 2c1 2 2c one CACTCGATGTCCGGCC 213-230 24 2i1 2 21 one GACTYGTTGTCCRGCC 213-230 25 2k1 2 2k one ACTCGAGGTCCGGC 214-229 26 2a2 2 2a 2 CACAAAACCTAAACCTCA 352-369 27 2b2 2 2b 2 ACAATCCCTAAACCTC 352-368 28 2c2 2 2c 2 CAAGCCTAAGCTCA 350-347 29th 2i2 2 2i 2 CACAACCCGAACCTCA 351-368 thirty 2k2 2 2k 2 ACAAAGCTAAACCTC 352-367 31 3a1 3 3a one CTCAATACCCAGAAATTTG 215-234 32 3b1 3 3b one CTCAATGCCCGGAAATTTG 215-234 33 3a2 3 3a 2 CACACTTCCTAAACCACAA 352-367 34 3b2 3 3b 2 ACAAAGCTAAACCTC 353-365 35 4ac1 four 4a / 4c one CGCCGGGATGACC 210-226

36 4df1 four 4d / 4f one CGCCGTGATGACC 210-226 37 4hk1 four 4h / 4k one GCCGGGCTGACC 209-226 38 4r1 four 4r one CGCCGGTATGACC 210-226 39 4a2 four 4a 2 AATCCTAAACCTCAAAGA 355-372 40 4d2 four 4d 2 AATCCTAAAGCTCAAA 355-370 41 4s2 four 4c 2 CCTAAGCCTCACAGA 358-372 42 4h2 four 4h 2 CCTAAACCTCGAAGG 358-372 43 4f2 four 4f 2 AATCCTCAAGCTCGAA 355-371 44 4k2 four 4k 2 GTCCTACACCTCAAAG 356-371 45 4r2 four 4r 2 ATCCTATTCCTCAAAG 356-371 46 5a1 5 5a one CAATGCCCGGAGATTT 213-229 47 6a1 6 6a one CTTTCCATTGGATCAAAC 204-221 48 6b1 6 6b one CTTTCCAGTGGATCAAA 204-220 49 6d1 6 6d one CTTTCCGCTGGATCA 204-218 fifty 6a2 6 6a 2 AGCACACTTCCAAAAACC 350-365 51 6b2 6 6b 2 CACACTTCCAGAACC 352-365 52 6d2 6 6d 2 AGCACGCTTCCAATT 350-363 - * The names of the oligonucleotides are given in accordance with their position in Figure 3. - ** Decoding of the single-letter designations of nucleotides in the sequences of degenerate oligonucleotides:

R - A, G Y - C, T M - A, C K - G, T S - C, G W - A, T H - A, C, T B - C, G, T V - A, C, G D - A, G, T N - A, C, G, T

Example 2. Reverse transcription combined with amplification (RT-PCR) of a fragment of the 5'HTR region; obtaining single-stranded fluorescently labeled fragments by asymmetric PCR.

At the first stage, reverse transcription was performed, combined with amplification (RT-PCR) of a fragment of the 5'HTR region of 418 bp in length.

In 40 μl of the mixture for RT-PCR, 10 μl of the isolated RNA preparation was added (final volume 50 μl).

The composition of the PCR mixture:

- 1X RT-PCR buffer: 70 mM Tris-HCl, pH 8.3, 16.6 mM (NH ₄ ) ₂ SO ₄ , 7.5 mM MgCl ₂ ;

- 200 μM of each dATP, dCTP, dGTP, dUTP (Sileks, Russia);

- A mixture of primers (sequences are shown in Table 2) Pr3_f / Pr2_r at a concentration of 200 nm each;

- 10 units thermostable ST polymerase (Sileks, Russia);

- 1 unit uracil DNA glycosylase (Silex, Russia);

- 10 units RNase inhibitor (Fermentas, Lithuania).

Amplification was carried out on a RTS-200 Dyad thermal cycler (MJ Research, USA) with the following mode: reverse transcription at 50 ° C for 30 minutes, then 50 PCR cycles: 95 ° C for 30 s, 63 ° C for 30 s, 72 ° C - 30 s; final elongation at 72 ° C - 10 minutes.

The result of the RT-PCR step using HCV RNA isolated from clinical samples containing HCV of various genotypes and subtypes is shown in FIG. 4.

1 μl of the reaction mixture obtained after the first PCR step was used as a matrix in the second step.

The second stage of PCR was performed in a semi-nested version, with primers P3_f / Pr5_r flanking the 5'NTR region of the region with a length of 382 bp The primer sequences are shown in table 2.

The composition of the PCR mixture (25 μl):

- 1X PCR buffer: 10 mM KCl, 10 mM Tris-Hcl (pH 8.3) (Sileks, Russia);

- 1.5 mm MgCl ₂ ;

- 200 μm of each dNTP (Sileks, Russia);

- 10 μM fluorescently labeled dUTP (Microchip-IMB, Russia);

- A mixture of primers P3_f / Pr5_r at a concentration of 20 nm / 100 nm, respectively;

- 10 units thermostable Taq DNA polymerase (Sileks, Russia).

Amplification was carried out on a RTS-200 Dyad thermal cycler (MJ Research, USA) with the following regime: 95 ° С - 2 min, then 36 cycles: 95 ° С - 20 s, 60 ° С - 20 s, 72 ° С - 30 s, final elongation 72 ° C - 5 minutes.

The results of the PCR stage when using the RT-PCR stage as the product matrix for HCV samples having different genotypes and subtypes are presented in FIG. 5.

12 μl of the resulting product was used in hybridization on a microchip.

Example 3. Hybridization of amplified labeled product on a microchip.

To 12 μl of the reaction mixture obtained after the second PCR stage and containing mainly single-stranded fluorescently labeled DNA fragments corresponding to the studied fragment of the 5'HTP region, a concentrated solution of hybridization buffer was added so that the final concentration of guanidine thiocyanate was 1 M, HEPES - 50 mM, pH 7.5, EDTA - 5 mm. The resulting mixture (32 μl) was placed in a hybridization chamber of the microchip. Hybridization was carried out at 37 ° C for 12-18 hours. After hybridization was completed, the microchip was washed three times with distilled water at 37 ° C for 30 seconds and dried.

Example 4. Registration and interpretation of hybridization results

The fluorescence image of the microchip was recorded on a universal hardware-software complex (UAPK) (IMB RAS, Russia) for the analysis of biological microchips using the specialized ImageWare ^® software (Microchip-IMB, Russia).

The interpretation of the results was carried out according to the above algorithm, implemented in the software module for the analysis of fluorescence images of microchips 'Imageware ^® '.

Example 5. Analysis of the 5'HTR region of the genome of the hepatitis C virus, having a subtype 1a, using the proposed method.

A blood sample obtained from a patient was treated with a Qiamp viral RNA viral RNA isolation kit (Qiagen, Germany) according to the manufacturer's protocol. The isolated RNA preparation was used in RT-PCR as described in Example 2. At the end of RT-PCR, the presence of an amplified fragment of a given length (418 bp) was tested by agarose gel electrophoresis, after which the RT-PCR product was divided into 2 parts, one of which was processed and analyzed in accordance with the procedure described in Examples 2-4 (PCR step followed by hybridization on a microchip, washing, recording and interpretation of the fluorescence pattern of the microchip). The second part of the first stage product after additional purification was used in the sequencing reaction, followed by separation on an automatic sequencer, obtaining and correcting the chromatogram, analyzing the processed sequence of the 5'HTP fragment, constructing multiple alignment and phylogenetic tree, on the basis of which the genotype and subtype were determined.

Figure 6 presents the hybridization pattern of the microchip and the distribution of normalized hybridization signals of the cells of the microchip.

In accordance with the proposed algorithm for interpreting the results, the analysis begins with the calculation of the averaged signal (I _ref ) in cells that do not contain oligonucleotides. In this case, the value of I _ref was 0.22. In accordance with this value and a threshold value of 1.5, the signals are filtered into the genotype and subtype-specific cells. As a result, it was found that the signals in the cells of the G1 group containing probes specific for genotype 1 exceed I _{ref by} 1.5 and more times. Signals in other groups of cells containing genotype-specific probes were close to the background. Next, the maximum signal is selected from the group Gl, G1-1 (5.7). Therefore, the RNA sequence of the analyzed sample refers to genotype 1.

An analysis in groups of cells containing probes specific for subtypes of genotype 1 reveals the following: In group 1, the maximum (i.e., exceeding the threshold value of 1.5 with respect to other cells) signals have 1a1 (16.7). In group 2 - 1a2 (16.4). Thus, in all groups, cells containing probes specific for subtype 1a have the maximum signal. Therefore, the analyzed sample belongs to subtype 1a.

By sequencing followed by phylogenetic analysis, it was shown that the test sequence falls into the sequence cluster of subtype 1a.

Thus, it was found that the analyzed HCV RNA sample has genotype 1 and subtype 1a, which completely coincides with the sequencing results.

Example 6. Analysis of the 5'NTR region of the genome of the hepatitis C virus, having a subtype 1b, using the proposed method.

A blood sample obtained from a patient was treated with a Qiamp viral RNA viral RNA isolation kit (Qiagen, Germany) according to the manufacturer's protocol. The isolated RNA preparation was used in RT-PCR as described in Example 2. At the end of RT-PCR, the presence of an amplified fragment of a given length (418 bp) was tested by agarose gel electrophoresis, after which the RT-PCR product was divided into 2 parts, one of which was processed and analyzed in accordance with the procedure described in Examples 2-4 (PCR step followed by hybridization on a microchip, washing, recording and interpretation of the fluorescence pattern of the microchip). The second part of the first stage product after additional purification was used in the sequencing reaction, followed by separation on an automatic sequencer, obtaining and correcting the chromatogram, analyzing the processed sequence of the 5'HTP fragment, constructing multiple alignment and phylogenetic tree, on the basis of which the genotype and subtype were determined.

Figure 7 presents the hybridization pattern of the microchip and the distribution of normalized hybridization signals of the cells of the microchip.

In accordance with the proposed algorithm for interpreting the results, the analysis begins with the calculation of the averaged signal (I _ref ) in cells that do not contain oligonucleotides. In this case, the value of I _ref was 0.31. In accordance with this value and a threshold value of 1.5, the signals are filtered in genotype and subtype specific cells. As a result, it was found that the signals in the cells of the G1 group containing probes specific for genotype 1 exceed I _{ref by} 1.5 or more times (cell G1-2 (0.802) has a maximum signal). Signals in other groups of cells containing genotype-specific probes were close to the background. Therefore, the RNA sequence of the analyzed sample refers to genotype 1.

An analysis in groups of cells containing probes specific for subtypes of genotype 1 reveals the following: In group 1, the maximum signal (i.e., exceeding the threshold value of 1.5 relative to other cells) has 1b1 (8.79). In group 2 - 1b2 (2.58). Thus, in both groups, perfect hybridization duplexes were formed in cells containing oligonucleotides specific for subtype 1b. Therefore, the analyzed sample belongs to subtype 1b.

By sequencing followed by phylogenetic analysis, it was shown that the test sequence falls into the sequence cluster of subtype Ib.

Thus, it was found that the analyzed HCV RNA sample has genotype 1 and subtype 1b, which completely coincides with the sequencing results.

Example 7. Analysis of the 5'NTR region of the genome of the hepatitis C virus, having a subtype 1e, using the proposed method.

A blood sample obtained from a patient was treated with a Qiamp viral RNA viral RNA isolation kit (Qiagen, Germany) according to the manufacturer's protocol. The isolated RNA preparation was used in RT-PCR as described in Example 2. At the end of RT-PCR, the presence of an amplified fragment of a given length (418 bp) was tested by agarose gel electrophoresis, after which the RT-PCR product was divided into 2 parts, one of which was processed and analyzed in accordance with the procedure described in Examples 2-4 (PCR step followed by hybridization on a microchip, washing, recording and interpretation of the fluorescence pattern of the microchip). The second part of the first stage product after additional purification was used in the sequencing reaction, followed by separation on an automatic sequencer, obtaining and correcting the chromatogram, analyzing the processed sequence of the 5'HTR fragment, constructing multiple alignment and phylogenetic tree, on the basis of which the genotype and subtype were determined.

On Fig presents the hybridization pattern of the microchip and the distribution of normalized hybridization signals of the cells of the microchip.

In accordance with the proposed algorithm for interpreting the results, the analysis begins with the calculation of the averaged signal (I _ref ) in cells that do not contain oligonucleotides. In this case, the value of I _ref was 0.04. In accordance with this value and a threshold value of 1.5, the signals are filtered in genotype and subtype specific cells. As a result, it was found that the signal in cell G1-2 (0.632), containing a probe specific for genotype 1, exceeds I _{ref by} 1.5 or more times. Also, the signal in cell G2-1 (0,121) passes the threshold relative to I _ref . Signals in other groups of cells containing genotype-specific probes are close to the background. The signal in cell G1-2 is more than 3 times the signal in cell G2-1. Therefore, the RNA sequence of the analyzed sample refers to genotype 1.

Analysis in groups of cells containing probes specific for subtypes of genotype 1 reveals the following: In group 1, the maximum signal (i.e., exceeding the threshold value of 1.5 relative to other cells) has 1е1 (4.18). In group 2, the signals in none of the cells passed the threshold relative to I _ref . Thus, in group 1, a perfect duplex with the studied DNA forms an oligonucleotide, the sequence of which is unique for subtype 1e. Therefore, the analyzed sample belongs to subtype 1e.

By sequencing followed by phylogenetic analysis, it was shown that the test sequence falls into the sequence cluster of subtype 1e.

Thus, it was found that the analyzed HCV RNA sample has genotype 1 and subtype 1e, which completely coincides with the sequencing results.

Example 8. Analysis of the 5'HTR region of the genome of the hepatitis C virus, having a subtype 2a, using the proposed method.

A blood sample obtained from a patient was treated with a Qiamp viral RNA viral RNA isolation kit (Qiagen, Germany) according to the manufacturer's protocol. The isolated RNA preparation was used in RT-PCR as described in Example 2. At the end of RT-PCR, the presence of an amplified fragment of a given length (418 bp) was tested by agarose gel electrophoresis, after which the RT-PCR product was divided into 2 parts, one of which was processed and analyzed in accordance with the procedure described in Examples 2-4 (PCR step followed by hybridization on a microchip, washing, recording and interpretation of the fluorescence pattern of the microchip). The second part of the first stage product after additional purification was used in the sequencing reaction, followed by separation on an automatic sequencer, obtaining and correcting the chromatogram, analyzing the processed sequence of the 5'HTP fragment, constructing multiple alignment and phylogenetic tree, on the basis of which the genotype and subtype were determined.

Figure 9 presents the hybridization pattern of the microchip and the distribution of normalized hybridization signals of the cells of the microchip.

In accordance with the proposed algorithm for interpreting the results, the analysis begins with the calculation of the averaged signal (I _ref ) in cells that do not contain oligonucleotides. In this case, the value of I _ref was 0.11. In accordance with this value and a threshold value of 1.5, the signals are filtered into the genotype and subtype-specific cells. As a result, it was found that the signals in the cells of the G2 group containing probes specific for genotype 2 exceed I _{ref by} 1.5 and more times. The maximum signal in group G2 is cell G2-2 (2.71). Signals in other groups of cells containing genotype-specific probes are close to the background. Therefore, the RNA sequence of the analyzed sample belongs to genotype 2.

An analysis in groups of cells containing probes specific for subtypes of genotype 2 reveals the following: In group 1, the maximum signal (i.e., exceeding the threshold value of 1.5 relative to other cells) has 2a1 (3.02). In group 2 - 2a2 (2.01). In both groups, cells containing probes specific for subtype 2a have the maximum signal. Therefore, the analyzed sample belongs to subtype 2a.

By sequencing followed by phylogenetic analysis, it was shown that the test sequence falls into the sequence cluster of subtype 2a.

Thus, it was found that the analyzed HCV RNA sample has genotype 2 and subtype 2a, which completely coincides with the sequencing results.

Example 9. Analysis of the 5'HTR region of the genome of the hepatitis C virus, having a subtype 2i, using the proposed method.

A blood sample obtained from a patient was treated with a Qiamp viral RNA viral RNA isolation kit (Qiagen, Germany) according to the manufacturer's protocol. The isolated RNA preparation was used in RT-PCR as described in Example 2. At the end of RT-PCR, the presence of an amplified fragment of a given length (418 bp) was tested by agarose gel electrophoresis, after which the RT-PCR product was divided into 2 parts, one of which was processed and analyzed in accordance with the procedure described in Examples 2-4 (PCR step followed by hybridization on a microchip, washing, recording and interpretation of the fluorescence pattern of the microchip). The second part of the first stage product after additional purification was used in the sequencing reaction, followed by separation on an automatic sequencer, obtaining and correcting the chromatogram, analyzing the processed sequence of the 5'HTP fragment, constructing multiple alignment and phylogenetic tree, on the basis of which the genotype and subtype were determined.

Figure 10 presents the hybridization pattern of the microchip and the distribution of normalized hybridization signals of the cells of the microchip.

In accordance with the proposed algorithm for interpreting the results, the analysis begins with the calculation of the averaged signal (I _ref ) in cells that do not contain oligonucleotides. In this case, the value of I _ref was 0.06. In accordance with this value and a threshold value of 1.5, the signals are filtered in genotype and subtype specific cells. As a result, it was found that only signals in cells of the G2 group containing probes specific for genotype 2 exceed I _{ref by} 1.5 and more times.

The maximum signal in group G2 is cell G2-2 (1,559). Therefore, the RNA sequence of the analyzed sample belongs to genotype 2.

An analysis in groups of cells containing probes specific for subtypes of genotype 2 reveals the following: In group 1, the maximum (i.e., exceeding the threshold value of 1.5 relative to other cells) signal has 2il (0.187). In group 2 - 2i2 (0.627). Thus, in two groups, the maximum signal belongs to cells containing unique oligonucleotides specific for subtype 2i. In accordance with the claimed interpretation algorithm, the analyzed sample belongs to subtype 2i.

By sequencing followed by phylogenetic analysis, it was shown that the test sequence falls into the sequence cluster of subtype 2i.

Thus, it was found that the analyzed HCV RNA sample has genotype 2 and subtype 2i, which completely coincides with the sequencing results.

Example 10. Analysis of the 5'HTR region of the genome of the hepatitis C virus, having a subtype 3a, using the proposed method.

A blood sample obtained from a patient was treated with a Qiamp viral RNA viral RNA isolation kit (Qiagen, Germany) according to the manufacturer's protocol. The isolated RNA preparation was used in RT-PCR as described in Example 2. At the end of RT-PCR, the presence of an amplified fragment of a given length (418 bp) was tested by agarose gel electrophoresis, after which the RT-PCR product was divided into 2 parts, one of which was processed and analyzed in accordance with the procedure described in Examples 2-4 (PCR step followed by hybridization on a microchip, washing, recording and interpretation of the fluorescence pattern of the microchip). The second part of the first stage product after additional purification was used in the sequencing reaction, followed by separation on an automatic sequencer, obtaining and correcting the chromatogram, analyzing the processed sequence of the 5'HTP fragment, constructing multiple alignment and phylogenetic tree, on the basis of which the genotype and subtype were determined.

Figure 11 presents the hybridization pattern of the microchip and the distribution of normalized hybridization signals of the cells of the microchip.

In accordance with the proposed algorithm for interpreting the results, the analysis begins with the calculation of the averaged signal (I _ref ) in cells that do not contain oligonucleotides. In this case, the value of I _ref was 0.03. In accordance with this value and a threshold value of 1.5, the signals are filtered in genotype and subtype specific cells. As a result, it was found that only the signal in cell G3-1 (0.37), containing a probe specific for genotype 3, exceeds I _{ref by} 1.5 or more times. Signals in other groups of cells containing genotype-specific probes are close to the background. Therefore, the RNA sequence of the analyzed sample belongs to genotype 3.

An analysis in groups of cells containing probes specific for subtypes of genotype 3 reveals the following: In group 1, the maximum signal (i.e., exceeding the threshold value of 1.5 relative to other cells) is in cell 3a1 (3.51). In group 2 - 3a2 (0.141). Thus, in all groups, cells containing probes specific for subtype 3a have the maximum signal. Therefore, the analyzed sample belongs to subtype 3a.

By sequencing followed by phylogenetic analysis, it was shown that the test sequence falls into the sequence cluster of subtype 3a.

Thus, it was found that the analyzed HCV RNA sample has genotype 3 and subtype 3a, which completely coincides with the sequencing results.

Example 11. Analysis of the 5'HTR region of the genome of the hepatitis C virus, having a subtype 4a, using the proposed method.

A blood sample obtained from a patient was treated with a Qiamp viral RNA viral RNA isolation kit (Qiagen, Germany) according to the manufacturer's protocol. The isolated RNA preparation was used in RT-PCR as described in Example 2. At the end of RT-PCR, the presence of an amplified fragment of a given length (418 bp) was tested by agarose gel electrophoresis, after which the RT-PCR product was divided into 2 parts, one of which was processed and analyzed in accordance with the procedure described in Examples 2-4 (PCR step followed by hybridization on a microchip, washing, recording and interpretation of the fluorescence pattern of the microchip). The second part of the first stage product after additional purification was used in the sequencing reaction, followed by separation on an automatic sequencer, obtaining and correcting the chromatogram, analyzing the processed sequence of the 5'HTR fragment, constructing multiple alignment and phylogenetic tree, on the basis of which the genotype and subtype were determined.

On Fig presents the hybridization pattern of the microchip and the distribution of normalized hybridization signals of the cells of the microchip.

In accordance with the proposed algorithm for interpreting the results, the analysis begins with the calculation of the averaged signal (I _ref ) in cells that do not contain oligonucleotides. In this case, the value of I _ref was 0.08. In accordance with this value and a threshold value of 1.5, the signals are filtered in genotype and subtype specific cells. As a result, it was found that only signals in cells of the G4 group containing probes specific for genotype 4 exceed I _{ref by} 1.5 and more times. The signals in the remaining cells containing genotype-specific oligonucleotides were close to the background. The maximum signal in group G4 is registered in cell G4-1 (1.25). Therefore, the RNA sequence of the analyzed sample belongs to genotype 4.

An analysis in groups of cells containing probes specific for genotype 4 subtypes reveals the following: in both groups of probes specific for genotype 4, cells containing probes for detecting subtype 4a: 4ac1 (1.71), 4a2 (0, 2). Therefore, in accordance with the described algorithm, the analyzed sample belongs to subtype 4a.

By sequencing followed by phylogenetic analysis, it was shown that the test sequence falls into the sequence cluster of subtype 4a.

Thus, it was found that the analyzed HCV RNA sample has genotype 4 and subtype 4a, which completely coincides with the sequencing results.

Example 12. Analysis of the 5'HTR region of the genome of the hepatitis C virus, having a subtype 4d, using the proposed method.

A blood sample obtained from a patient was treated with a Qiamp viral RNA viral RNA isolation kit (Qiagen, Germany) according to the manufacturer's protocol. The isolated RNA preparation was used in RT-PCR as described in Example 2. At the end of RT-PCR, the presence of an amplified fragment of a given length (418 bp) was tested by agarose gel electrophoresis, after which the RT-PCR product was divided into 2 parts, one of which was processed and analyzed in accordance with the procedure described in Examples 2-4 (PCR step followed by hybridization on a microchip, washing, recording and interpretation of the fluorescence pattern of the microchip). The second part of the first stage product after additional purification was used in the sequencing reaction, followed by separation on an automatic sequencer, obtaining and correcting the chromatogram, analyzing the processed sequence of the 5'HTR fragment, constructing multiple alignment and phylogenetic tree, on the basis of which the genotype and subtype were determined.

On Fig presents the hybridization pattern of the microchip and the distribution of normalized hybridization signals of the cells of the microchip.

In accordance with the proposed algorithm for interpreting the results, the analysis begins with the calculation of the averaged signal (I _ref ) in cells that do not contain oligonucleotides. In this case, the value of I _ref was 0.16. In accordance with this value and a threshold value of 1.5, the signals are filtered in genotype and subtype specific cells. As a result, it was found that the signals in the cells of the G4 group containing probes specific for genotype 4 exceed I _{ref by} 1.5 and more times. The signals in the remaining cells containing genotype-specific oligonucleotides were close to the background. The maximum signal in group G4 is cell G4-2 (1.69). Therefore, the RNA sequence of the analyzed sample belongs to genotype 4.

An analysis in groups of cells containing probes specific for subtypes of genotype 4 reveals the following: in group 1, the cell containing the oligonucleotide specific for subtypes 4d and 4f-4df1 (1.69) has the maximum signal, and in group 2, cell 4d2 (0 , 54). In all groups, cells containing probes specific for subtype 4d have the maximum signal. Therefore, the analyzed sample belongs to subtype 4d.

By sequencing followed by phylogenetic analysis, it was shown that the test sequence falls into the sequence cluster of subtype 4d.

Thus, it was found that the analyzed HCV RNA sample has genotype 4 and subtype 4d, which completely coincides with the sequencing results.

Example 13. Analysis of the 5'NTR region of the genome of the hepatitis C virus, having a subtype 5a, using the proposed method.

A blood sample obtained from a patient was treated with a Qiamp viral RNA viral RNA isolation kit (Qiagen, Germany) according to the manufacturer's protocol. The isolated RNA preparation was used in RT-PCR as described in Example 2. At the end of RT-PCR, the presence of an amplified fragment of a given length (418 bp) was tested by agarose gel electrophoresis, after which the RT-PCR product was divided into 2 parts, one of which was processed and analyzed in accordance with the procedure described in Examples 2-4 (PCR step followed by hybridization on a microchip, washing, recording and interpretation of the fluorescence pattern of the microchip). The second part of the first stage product after additional purification was used in the sequencing reaction, followed by separation on an automatic sequencer, obtaining and correcting the chromatogram, analyzing the processed sequence of the 5'HTP fragment, constructing multiple alignment and phylogenetic tree, on the basis of which the genotype and subtype were determined.

On Fig presents the hybridization pattern of the microchip and the distribution of normalized hybridization signals of the cells of the microchip.

In accordance with the proposed algorithm for interpreting the results, the analysis begins with the calculation of the averaged signal (I _ref ) in cells that do not contain oligonucleotides. In this case, the value of I _ref was 0.03. In accordance with this value and a threshold value of 1.5, the signals are filtered in genotype and subtype specific cells. As a result, we obtain that only signals in cells of the G5 group containing probes specific for genotype 5 exceed I _{ref by} 1.5 or more times - G5-1 / G5-2 (0.35). Therefore, the RNA sequence of the analyzed sample refers to genotype 5. Since genotype 5 has only one subtype, 5a, it is concluded that the test sample has a subtype 5a.

By sequencing followed by phylogenetic analysis, it was shown that the test sequence falls into the sequence cluster of subtype 5a.

Thus, it was found that the analyzed HCV RNA sample has genotype 5 and subtype 5a, which completely coincides with the sequencing results.

Example 14. Analysis of the 5'NTR region of the genome of the hepatitis C virus, having a subtype of 6b, using the proposed method.

A blood sample obtained from a patient was treated with a Qiamp viral RNA viral RNA isolation kit (Qiagen, Germany) according to the manufacturer's protocol. The isolated RNA preparation was used in RT-PCR as described in Example 2. At the end of RT-PCR, the presence of an amplified fragment of a given length (418 bp) was tested by agarose gel electrophoresis, after which the RT-PCR product was divided into 2 parts, one of which was processed and analyzed in accordance with the procedure described in Examples 2-4 (PCR step followed by hybridization on a microchip, washing, recording and interpretation of the fluorescence pattern of the microchip). The second part of the first stage product after additional purification was used in the sequencing reaction, followed by separation on an automatic sequencer, obtaining and correcting the chromatogram, analyzing the processed sequence of the 5'HTR fragment, constructing multiple alignment and phylogenetic tree, on the basis of which the genotype and subtype were determined.

On Fig presents a hybridization pattern of the microchip and the distribution of normalized hybridization signals of the cells of the microchip.

In accordance with the proposed algorithm for interpreting the results, the analysis begins with the calculation of the averaged signal (I _ref ) in cells that do not contain oligonucleotides. In this case, the value of I _ref was 0.13. In accordance with this value and a threshold value of 1.5, the signals are filtered into the genotype and subtype-specific cells. As a result, we find that the signal in the cell of group G6-1 (10.54) containing a probe specific for genotype 6 exceeds I _{ref by} 1.5 and more times. The signal in cell G3-1 (1.923) should also be considered reliable. Cell G6 exceeds the signal in cell G3-1 by more than 1.5 times, which means that the RNA of the analyzed sample belongs to genotype 6.

Of the two groups containing probes specific for subtypes of genotype 6, in cell 6b1, the signal (1,147) is reliable with respect to I _ref , exceeded the threshold value. Therefore, the subtype of this HCV sample is classified as 6b.

By sequencing followed by phylogenetic analysis, it was shown that the test sequence falls into the sequence cluster of subtype 6b.

Thus, it was found that the analyzed HCV RNA sample has genotype 6 and subtype 6b, which completely coincides with the sequencing results.

Thus, the presented invention allows to identify the genotype and subtype of hepatitis C virus based on the analysis of the 5'-untranslated region of the HCV genome using an oligonucleotide microchip. The method allows to identify all 6 genotypes and 22 subtypes of hepatitis C virus, including the most virulent and drug-resistant forms. The method compares favorably with existing analogues with high specificity with respect to the identification of subtypes of genotype 1 and 4, in particular subtypes 1b and 4d, as well as ease of implementation and low cost. Data obtained using the microarray hybridization procedure of the present invention can be used to predict and evaluate the severity of the course of the disease (acute / chronic cirrhosis, the likelihood of developing liver cancer), determine the therapeutic dose of drugs and the duration of the course of therapy, as well as for epidemiological genotyping.

All patents, publications, scientific articles, and other documents and materials cited or referenced herein are hereby incorporated by reference to the extent that each of these documents was individually incorporated by reference or is presented in its entirety.

Although the preferred embodiments of the present invention and their advantages have been described in detail above, a person skilled in the art will be able to make various changes, additions, without going beyond the scope of this invention, which are defined by the appended claims.

Claims (5)

1. A method for identifying the genotype and subtype of hepatitis C virus (HCV) based on sequence analysis of the 5'-untranslated region of the HCV genome, including:
(a) reverse transcription combined with PCR (RT-PCR) using viral RNA as a template and the first pair of primers specific for a fragment of the 5'-untranslated region of the HCV genome, the sequences of which are represented by SEQ ID NOs: 53 and 54;
(b) asymmetric amplification of a fragment of the 5'-untranslated region of the HCV genome using the RT-PCR product obtained in stage (a) as a template, a second pair of specific primers, the sequences of which are represented by SEQ ID NOs: 55 and 56, and a mixture of four deoxynucleoside triphosphates, in which one of the four deoxynucleoside triphosphates is fluorescently labeled, as a substrate, to obtain a predominantly single-stranded fluorescently labeled fragment;
(c) an oligonucleotide microchip for identification of the HCV genotype and subtype, which is a substrate containing many discrete elements, in each of which a unique oligonucleotide probe is immobilized, having a sequence complementary to the sequence of the single chain fragment obtained in stage (b) and selected from the group including: a) genotype-specific sequences of a fragment of a 5'-untranslated region for each HCV genotype; and b) the subtype-specific for each of the subtypes of the HCV sequence of the fragment of the 5'-untranslated region, the sequences of immobilized oligonucleotide probes are represented by SEQ ID NO: 1-52;
(d) hybridization of the amplified labeled product obtained in stage (b) on an oligonucleotide microchip with the formation of duplexes with immobilized probes under conditions providing a resolution of one nucleotide between perfect and imperfect duplexes formed as a result of hybridization;
(e) recording the results of hybridization on an oligonucleotide microchip carried out in step (d) using a portable fluorescence analyzer and software, which allows the use of software processing of signal intensities with subsequent interpretation of the results;
(f) interpretation of the hybridization results obtained in stage (e), carried out in two stages: at the first stage, signals are analyzed in microchip elements containing oligonucleotide probes specific for HCV genotypes, thereby identifying the genotype of the test sample; in case of identification of the genotype in the second stage, only microarray elements containing oligonucleotide probes specific for subtypes of the identified genotype are analyzed, regardless of the presence of signals in elements containing probes specific for subtypes of other genotypes. 2. The method according to claim 1, characterized in that in stage (b) one of the primers of the second pair is used in at least a ten-fold molar excess with respect to the second primer. 3. The method according to claim 1, characterized in that in step (b), fluorescently labeled deoxyuridine triphosphate is used as a fluorescently labeled deoxynucleoside triphosphate. 4. The method according to claim 1, characterized in that the oligonucleotide microchip is a microchip based on hydrogel cells, obtained by the method of chemically or photo-induced copolymerization. 5. The method according to claim 1, characterized in that it is additionally designed to assess and predict the severity of the course of the disease (acute / chronic cirrhosis, the likelihood of developing liver cancer), determine the therapeutic dose of drugs and the duration of the course of therapy, and / or epidemiological genotyping on based on the interpretation of hybridization results.

Images